University of Rome “La Sapienza”

Dept. of Molecular Medicines

PhD in Immunology XXV cycle

IRF1 and NF-kB in neuroblastoma: from immune escape to immune recognition

Coordinator: Prof. Angela Santoni

Tutor: Dr. Doriana Fruci

Candidate: Silvia Lorenzi

1

CONTENTS

LIST OF PUBLICATIONS 3

INTRODUCTION 4

1 The MHC Class I Antigen Processing And Presentation Pathway 4

1.1 The proteasome and the immunoproteasome 6

1.2 Transporters associated with antigen processing TAP1 and TAP2 7

1.3 Endoplasmic reticulum aminopeptidases 8

1.4 MHC class I 11

1.5 The peptide loading-complex 11

2 Trascriptional regulation of MHC class I and APM components 13

2.1 Transcriptional regulation of MHC class I molecules 13

2.1.1 Enhancer A and NF-kB 14

2.1.2 ISRE and IRF family members 16

3 Cancer Immune Evasion 19

3.1 MHC class I defects 20

3.2 Antigen-processing machinery (APM) defects 21

4 Neuroblastoma 24

4.1 Genetic factors 25

4.1.1 MYCN amplification 25

4.1.2 Gain and loss of genetic material 26

4.2 NB therapy 28

5 Immune Evasion of Neuroblastoma 30

5.1 MHC class I and APM expression in NB and CTL recognition 31

5.2 Susceptibility of NB to NK cell-mediated cytotoxicity 32

5.3 IRFs and NF-kB as regulators of immunogenicity of NB 33

AIM OF THE WORK 35

MATERIAL AND METHODS 36

RESULTS 41

DISCUSSION 55

REFERENCES 59

2

LIST OF PUBLICATIONS

Lorenzi, Silvia; Forloni, Matteo; Cifaldi, Loredana; Antonucci, Chiara; Citti, Arianna; Boldrini, Renata; Pezzullo, Marco; Castellano, Aurora; Russo, Vincenzo; van der Bruggen, Pierre; Giacomini, Patrizio; Locatelli, Franco; Fruci, Doriana (2012). IRF1 and NF-kB restore MHC class I-restricted tumor antigen processing and presentation to cytotoxic T cells in aggressive neuroblastoma. PLoS ONE 7, e46928.

Fruci, D; Benevolo, M; Cifaldi, L; Lorenzi, S; Lo Monaco, E; Tremante, E; Giacomini, P (2012). Major histocompatibility complex class i and tumour immuno-evasion: how to fool T cells and natural killer cells at one time. Curr Oncol 19, 39-41.

Cifaldi, Loredana; Romania, Paolo; Lorenzi, Silvia; Locatelli, Franco; Fruci, Doriana (2012). Role of endoplasmic reticulum aminopeptidases in health and disease: from infection to cancer. Int J Mol Sci 13, 8338-8352.

Cifaldi, Loredana; Lo Monaco, Elisa; Forloni, Matteo; Giorda, Ezio; Lorenzi, Silvia; Petrini, Stefania; Tremante, Elisa; Pende, Daniela; Locatelli, Franco; Giacomini, Patrizio; Fruci, Doriana (2011). Natural killer cells efficiently reject lymphoma silenced for the endoplasmic reticulum aminopeptidase associated with antigen processing. Cancer Res. 71, 1597-1606.

3

INTRODUCTION

1. The MHC Class I Antigen Processing And Presentation

Pathway

The major histocompatibility complex (MHC) class I antigen processing and

presentation pathway play an important role in alerting the immune system for the

presence of viral infection and tumor transformation. MHC class I molecules are expressed

on the cell surface of all nucleated cells and present peptide fragments derived from

intracellular proteins. These peptides are normally derived from self-proteins, but in virally

infected and tumor cells, peptides derived from aberrant or viral proteins may also be

presented. In this way, tumor- and virus-specific cytotoxic T lymphocytes (CTL) monitor

cell surface for MHC class I molecules loaded with peptides derived from aberrant or viral

proteins and eliminate altered cells.

The formation and presentation of peptide-MHC class I complexes takes place in

four major steps (Fig. 1). First, endogenous proteins are degraded to peptides in the cytosol

by the multicatalytic complex of the proteasome and other cytosolic peptidases. This step

is followed by translocation of peptides of 8-16 amino acids length across the endoplasmic

reticulum (ER) membrane through proteins known as transporters associated with antigen

processing (TAP1 and TAP2). All peptides longer than 8-10 amino acids are further

trimmed by aminopeptidases into the lumen of ER to produce mature N-terminal

(Brouwenstijn 2001; Fruci 2001, Lauvau 1999). In human, this step is catalyzed by at least

two ER aminopeptidases, ERAP1 and ERAP2 (Saric 2002; York 2002; Saveanu2005).

Finally, peptides are assembled with MHC class I and the peptide-MHC class I complexes

formed reach the cell surface through the secretory pathway for the recognition by specific

CTLs (Hammer 2007; Lehner 1996).

Given the role that the MHC class I antigen presentation pathway plays in the

detection of altered cells by CTLs, it is not surprising that tumors and viruses have evolved

proteins that interfere with this pathway.

4

Figure 1 – Antigen processing and presentation. Self-proteins in the target cells that have to be

removed are polyubiquitinated in the cytoplasm (1) and degraded by the proteasomes and additional

cytosolic proteases (2). The produced peptides are either tailored in the ideal length for binding to

MHC class I molecules or generated as amino-terminally extended precursors. TAP transports peptides

into the endoplasmic reticulum (ER) (3) where they are further trimmed at the N-terminus by ER

aminopeptidases (ERAPs) (4) before to be loaded on the MHC class I molecules (5). Peptide-MHC

class I complexes (pMHC class I) reach the plasma membrane (6) to be recognized by T cell antigen

5

receptors (TCR) of CD8+ T cells.

1.1. The proteasome and the immunoproteasome

Proteasomes are multicatalytic complexes that contribute to the quality control of

proteins, degrading those misfolded, damaged or unnecessary (Fehling 1994; Rock1994).

The degradation process produces peptide fragments of about 2 to 20 amino acids long,

which can then be further broken down into amino acids and used for the synthesis of new

proteins. Proteins are recognized for degradation because tagged with a small protein

called ubiquitin. This process is catalyzed by ubiquitin ligases. The binding of the first

molecule of ubiquitin is followed by the binding of other ubiquitins to form a polyubiquitin

chain that is bound by the proteasome, allowing it to degrade the tagged protein. The

ubiquitinated proteins are recognized by the 19S regulatory particle in an ATP-dependent

binding step and enter into the core of the proteasome to come in contact with the

proteolytic active sites (Glickman 2002).

In structure, the proteasome is a cylindrical complex containing a catalytic 20S

chamber of four stacked heptameric rings around a central pore, inside which the

proteolytic activity remains confined. Each ring is composed of seven proteins. The two

outer α-rings define a gated channel, while the two inner β-rings centralize the catalytic

activity of the complex. Three β subunits, namely β1, β2 and β5, are catalytically active.

The 20S core proteasome can associate with two regulatory complexes, the 19S cap

produces to form the 26S proteasome particle, which is responsible for the ubiquitin-

conjugated proteins degradation, or the P28 complex that is though to increase its catalytic

activity (Tanaka 1998).

In the presence of IFN-γ three additional catalytic subunits, named β1i (LMP2), β2i

(MECL1) and β5i (LMP7), are expressed to replace their homologous counterparts β1, β2

and β5. This results in a new type of complex called immunoproteasome with higher

trypisn-like and chymotrypsin-like activities and lower caspase-like activity (Rock 1999;

Loukissa 2000; Bochtler 1999). The immunoproteasome complex is more likely to

generate peptides with hydrophobic C-terminal residues generate that more preferentially

6

bind MHC class I molecules (Cascio 2001). For this reason the immunoproteasome

complex is thought to be more suitable for the antigen presentation.

The immunoproteasome complex is constitutively expressed in immune tissues and

at much lower level in other cell types where it can be induced by exposing cells to IFNγ

or TNFα cytokines released during the early stage of viral infections (Khan 2001).

Since peptides presented by MHC class I molecules range in size from 9 to 10

amino acids, the proteasomal products (of 2 to 20 amino acids) often require little

trimming to fit MHC class I molecules. The C-terminus of these peptides is usually

generated by proteasomes, whereas the correct N-terminus requires trimming by cytosolic

aminopeptidases, such as the tripeptidyl peptidase II (TPII), the blemycin hydrolase

(BLH), the puromycin-sensitive aminopeptidase and the IFNγ-inducible leucine

aminopeptidase (LAP) (Hammer 2007; van Endert 2011). Many of peptides that enter the

ER may be further N-terminal trimmed by ER aminopeptidases, ERAP1 and ERAP2

(Chang 2005; Saveanu2005).

1.2. Transporters associated with antigen processing TAP1 and TAP2

Less than 2% of peptides generated by the proteasome complex enter in the lumen

of ER by the TAP complex (Yewdell 2003). TAP belongs to the large family of ATP-

binding cassette (ABC) transporters and is a heterodimeric multimembrane-spanning

polypeptide consisting of TAP1 and TAP2 (Higgins 1992). The two subunits form a

peptide-binding site and two ATP-binding sites that face the lumen of the cytosol.

Common to all ABC transporters is a four-domain structure with two hydrophobic

transmembrane domains (TMDs) and two hydrophilic nucleotide-binding domains

(NBDs). Both subunits are essential for antigen processing and are composed of an NH2-

terminal TMD followed by a COOH-terminal NBD (Spies 2001). The peptide-binding

region is localized to the last cytosolic loop and a 15-amino acid extension of the last

transmembrane helix of TAP1 and TAP2 (Koch 2004). The NBDs of TAP convert the

energy of ATP hydrolysis to peptide transport. A prerequisite for peptide transport is

7

peptide binding to TAP (van Endert 1994). This step is ATP independent. In contrast,

peptide transport strictly requires ATP hydrolysis (Neefjes 1993). TAP most efficiently

binds peptides with a length of 8–16 amino acids, whereas the most efficient transport is

restricted to peptides with 8–12 amino acids (van Endert 1994).

MHC class I molecules interact with the TAP complex via an ER-resident type I

glycoprotein, TAP-associated glycoprotein also known as tapasin (tpn). Tpn mediates

complex formation and the cross-talk of structural information of MHC class I and TAP

and is therefore important for class I assembly and editing (Ortmann 1997). This molecule

has two independent functions: 1) to increase the level of TAP, thereby increasing the

efficiency of peptide transport, and 2) to associate with MHC class I molecules, thereby

facilitating directly loading and assembly of class I molecules. Approximately four MHC

class I molecules seem to be linked via four tpn to one TAP complex (Abele 2004).

Peptide binding to MHC class I molecules is a prerequisite for dissociation of TAP-MHC

complexes. This peptide-mediated detachment depends on conformational signals from the

TAP complex induced by ATP binding. Recent data suggest that release of peptide-loaded

MHC class I molecules is predominantly dependent on the conformation of TAP1 (Alberts

2001). Therefore, the dynamic activity of the TAP-MHC class I complex is synchronized

with the peptide binding and translocation cycle of TAP.

Different mechanisms for TAP-dependent inhibition of antigen presentation have

evolved, which are reflected in genetic diseases, tumor development, and viral infections.

1.3. Endoplasmic reticulum aminopeptidases

It has been estimated that over 30% of the peptides that enter the ER need to be

shortened to the right length to fit the peptide binding groove of MHC class I molecules.

The enzyme responsible for this trimming has been identified as ERAAP in mice (Serwold

2002) and ERAP1 and ERAP2 in human (Saric 2002; York 2002; Saveanu 2005).

These ER aminopeptidases are zinc-metallopeptidases of the oxytocinase M1

subfamily, which share consensus zinc-binding motif essential for their enzymatic activity

(Hattori 1999). The human ERAP1 and ERAP2 genes are located on chromosome 5q15 in

8

the opposite orientation, likely to share regulatory elements. Human ERAP2 has no

analogues in rodents (e.g., mouse, rat, rabbit and guinea pig) and evolution studies suggest

that it originates from a relatively recent duplication of ERAP1 (Andrés 2010). These

enzymes are normally present in many tissues and are strongly induced after stimulation

with type I and type II interferons (IFNs) (Saric 2002, Tanioka 2003) and tumor necrosis

factor-alpha (TNF-α) (Forloni 2010).

Among these enzymes only ERAP1 has been studied in detail with respect to its

specificity. However, it is likely that ERAAP, its murine analog, displays similar

specificity. Chang et al. reported that peptides of 9-16 amino acids (the length of peptides

efficiently transported into the ER by TAP) were optimal substrate for ERAP1 (Chang

2005; Hammer2006). Of note, ERAP1 activity is substantially reduced for peptides with

proline at position 2 (X-P-Xn) (Serwold 2002), or for peptides with a size of 8 or 9 amino

acids, the optimal length for binding MHC class I molecules. ERAP1 activity appears to be

also affected by the nature of the internal residues of peptides. In particular, position 2, 5

and 7 (with position 1 defined as the N-terminal residue of the peptide) were most

important and showed inhibitory effects for negatively charged residues increasing peptide

sensitivity to ERAP1 degradation, while hydrophobic and positively charged residues

promoted trimming (Evnouchidou 2008). Based on the analogies with TAP and MHC class

I preferences, Chang et al. proposed the “molecular ruler” model for ERAP. According to

this model, ERAP1 facilitates antigen processing and presentation by trimming precursors

transported by TAP to MHC class I binding peptides (Chang 2005).

ERAP2 has been shown to cooperate with ERAP1 to trim a large variety of

precursor peptides to generate mature epitopes for binding to MHC class I molecules

(Saveanu 2005). ERAP2 was found to have distinct specificities for the N-terminal residue

of the peptide substrates and to physically associate with ERAP1. This complex is

expected to be more efficient than single enzymes in dealing the large number of precursor

peptides (Saveanu 2005). To date, there are few studies regarding ERAP2 function.

The substantial contribution of ER peptide trimming to MHC class I antigen

processing and presentation has been confirmed in mice lacking ERAP1 generated

independently in four independent groups (York 2006, Yan 2006, Firat 2007, Hammer

2007). Although loss of ERAP1 had a relatively modest effect on the cell surface

9

expression of most MHC class I molecules (a reduction of 20–40% for Kb and Db class I

molecules) (Hammer 2006), immunization of ERAP1−/− mice with wild-type (wt) cells or

vice versa, resulted in potent CD8+ T cell responses, suggesting that loss of ERAP1 alters

the peptide-MHC class I repertoire not only quantitatively but also qualitatively (Hammer

2007). Analysis of the individual peptides displayed on the cell surface with a panel of

peptide-specific CD8+ T cell hybridomas showed that ERAP1 deficiency left some peptides

unaffected, whereas others were either absent or dramatically up-regulated (Serwold 2002,

Hammer 2006, Hammer 2007). Consistent with these findings, mass spectrometry analysis

of natural and viral peptides processed in mice lacking ERAP1, revealed that ERAP1

deficiency causes a marked increase in the length of peptides normally presented by MHC

class I molecules (Blanchard 2010). Thus, ERAP1 proteolysis determines the characteristic

length, as well as the composition of MHC class I binding peptide in the ER.

In addition to classical MHC class I molecules, ERAP1−/− mice also exhibited

defects in the surface expression of nonclassical MHC class I molecules Qa-2 and Qa-1b,

which serve as ligands in both the innate and adaptive immune responses (Yan 2006). Yan

and collaborators found a significant reduction of the nonclassical class I molecules Qa-2

in ERAP1-deficient splenocytes and dendritic cells as compared with wt cells. Although

ERAP1 did not significantly affect the surface expression of Qa-1 molecules, presentation

of Qdm, an epitope derived from the signal sequence of classical MHC class I molecules,

to Qa-1-restricted CTLs was impaired, suggesting that ERAP1 activity is required for the

generation of this epitope. Thus, it is conceivable that reduced ERAP1 function may

represent a rate-limiting step in presenting Qdm peptide to Qa-1b-restricted CD8+ T cells or

NK cells expressing CD94/NKG2 receptors. More recently, a new naturally processed Qa-

1b epitope (FL9) derived from the Fam49b protein, has been identified in cells lacking

ERAP1 activity by Shastri and colleagues (Nagarajan 2012). Unlike the Qa-1b-Qdm

complex, Qa-1b-FL9 is an immunodominant ligand recognized by CD8+ T cells derived

from wt mice immunized with ERAP1 deficient cells. The authors found an abundant

fraction of CD8+ T cells specific for the Qa-1b-FL9 complex in naive wt mice able to

proliferate and efficiently eliminate ERAP1-deficient cells.

10

1.4. MHC class I

The product of the MHC class I genes encode cell-surface glycoproteins that

display antigenic peptides to CD8+ T cells. These molecules play critical roles in immune

response to viruses, malignant transformation and tissue rejection. MHC class I proteins

are encoded by three highly polymorphic genes HLA-A, HLA-B and HLA-C, that are

expressed in all eukaryotic cells (Little 1999), and three less polymorphic genes HLA-E,

HLA-F and HLA-G that are expressed in a tissue-restricted fashion (Wake1986). The first

group (HLA-A, HLA-B and HLA-C) plays an essential role in the detection and

elimination of virus-infected cells, tumor cells and transplanted allogeneic cells and in the

control of natural killer-cell responses. The second group (HLA-E and HLA-G) has

specialized immune regulatory functions (Braud 1999). HLA-E functions predominantly as

an inhibitor of NK-cell, whereas HLA-G inhibits both T- and NK-cell functions, including

the trans-endothelial migration of human NK cells (van_den_Elsen2004). Although HLA-

F was identified at the same time as HLA-E and HLA-G, little is known of its function.

Recently HLA-F has been proposed as surface marker of activating lymphocytes, but no

more is known about its function (Ni Lee 2010).

MHC class I consists of two polypeptide chains, an heavy or α chain encoded in the

MHC locus and a smaller nonpolymorphic light chain, β2-microglobulin (β2m) which is

encoded elsewhere (Cunningham 1977).

The MHC class I heavy chain folds into three separate domains called α1, α2 and

α3. The α3-domain is non-covalently associated with the β2m (Ohnishi 1983) to form a

folded structure that closely resembles that of an immunoglobulin domain. The α1 and α2

domains fold to make up a region bounded by a β-pleated sheet on the bottom and two α

helices on the sides. This groove binds in a non-covalent manner a small peptide of about

8-10 amino acids. This structure, termed peptide-binding site, is highly polymorphic.

1.5. The peptide loading-complex

In the ER, the MHC class I heavy chain and β2m assembly is coordinated by

chaperones such as calnexin, tpn, calreticulin, protein disulfide isomerase (PDI) as well as

11

the thiol oxidoreductase ERp57, that collectively form the multimeric peptide-loading

complex (PLC) (Cresswell 2005; Elliott2005). Tpn, ERp57 and PDI are required both for

the stabilization of TAP and involved in peptide loading onto MHC class I molecules by

regulating the redox state of a disulfide bound in the peptide-binding groove of the MHC

class I heavy chain (Cabrera 2007; Chambers2008). Upon peptide loading, the PLC

dissociates and the trimer complex consisting of the MHC class I heavy chain, β2m and

peptide is released and transported via trans-Golgi to the cell surface to be exposed to

CD8+ T cells.

12

2. Trascriptional regulation of MHC class I and APM

components

2.1. Transcriptional regulation of MHC class I molecules

The expression level of the different classical MHC class I genes varies amongst

the different tissue types. In particular, certain reproductive and developmental tissues lack

the expression of MHC class I molecules, similar to cells of the nervous system and the

eyes. The highest levels of MHC class I gene expression occur in tissues and cells of the

immune system (Garrido 1993; Singer1990).

Activation of MHC class I (with the exception of HLA-G) and β2m gene promoter

is mediated by three major regulatory elements: enhancer A, IFN-stimulated response

element (ISRE), and the SXY module (Fig. 2) (van-den-Elsen 1998). These regulatory

promoter elements mediate different routes of tissue-specific and cytokine-induced

transcription of MHC class I and β2m genes, and are localized in a region extending

approximately from nucleotides -220 to -95 upstream of the transcription initiation site.

The enhancer A and the ISRE of MHC class I and β2m gene promoters contain binding

sites for nuclear transcription factor kB (NF-kB) and interferon-regulatory factor (IRF)

family members, respectively (Gobin 1998; Gobin1999). Nucleotide sequence variation in

the enhancer A and the ISRE in the different MHC class I promoters affects the binding of

the specific factors to these elements. As a result, the level of promoter activation induced

by these pathways differs between the various MHC class I loci and different cell types,

revealing cell-type-specific basal and inducible expression levels (Gobin 1998;

Johnson2003).

In addition to the enhancer A and ISRE, MHC class I and β2m promoters share the

SXY upstream sequence motifs, consisting of four regulatory elements: the S box, the X1

box, the X2 box and the Y box. This SXY module is cooperatively bound by a multiprotein

complex containing regulatory factor X (RFX), cAMP response element binding protein

(CREB)/activating transcription factor (ATF), and nuclear factor Y (NFY), which acts as

an enhanceosome driving transactivation of these genes (Gobin 2001). In addition to the

13

above factors, the class II transactivator (CIITA) is also required. CIITA contributes to the

activation of MHC class I and β2m promoters, but it is essential for MHC class II

expression (Gobin 1997). Lack of either CIITA or one of the RFX subunit affects the

function and assembly of the MHC enhanceosome, respectively leading to a lack of MHC

class II and reduced levels of MHC class I transcription (Reith 2001).

Figure 2 – cis-acting elements on the MHC class I promoter. Upstream regulatory modules of the

HLA-A, HLA-B and HLA-C promoters, comprising the enhancer A, ISRE and their interacting factors.

The SXY (S-X1-X2-Y) is cooperatively bound by a multiprotein complex which acts as an enhanceosome

driving transactivation of the MHC class I genes.

2.1.1 Enhancer A and NF-kB

The family of NF-kB transcription factors bind to the enhancer A binding site and

regulate the expression of constitutive and cytokine-induced genes that play important

roles in immunity, inflammation, cell growth, and cell survival. The kB motif

(GGGGATTCCCC) of enhancer A is highly conserved in MHC class I gene promoters,

particularly in HLA-A and HLA-B loci (Le_Bouteiller 1994). It is a symmetrical variant of

the more divergent kB motif of the promoter of Ig k-light chain gene (GGGACTTCC)

(Sen1986). Although the kB motif is the principal target sequence for proteins of NF-

kB/Rel family, it is also bound by several other DNA-binding proteins, such as the high

14

mobility group protein (HMG)I(Y) and proteins belong to the leucine zipper family of

transcription factors (Miyamoto 1995).

The NF-kB family is composed of five related transcription factors: p50, p52, p65

(RelA), c-Rel, and RelB. These transcription factors share an N-terminal DNA-

binding/dimerization domain, known as the Rel homology domain, through which they can

form homo- and heterodimers (Baeuerle 1994; Miyamoto1995). RelB, c-Rel, and p65

contain C-terminal transcription activation domains (TADs) that enable co-activator

recruitment and target gene expression. On the contrary p50 and p52, lacking of TADs, can

activate transcription by forming heterodimers with p65, c-Rel, or RelB, or by recruiting

other TAD-containing proteins. However, as homodimers lacking the ability to drive

transcription, they can repress transcription on binding to DNA (Hayden 2011). The p50-

p65 heterodimer is present in virtually all differentiated cells and it is the most abundant of

the NF-kB/rel dimers. NF-kB resides predominantly in the cytoplasm complexed with

inhibitory IkB protein (Finco 1995; Thanos1995). When signaling pathways are activated

by stimuli such as cytokines (TNFα, IL-1β), oxidative stress, ultraviolet irradiation and

bacterial molecules (e.g. LPS), the IkB protein is phosphorilated by IkB kinase (IKK). IKK

is composed of an heterodimer of the catalytic IKK alpha and IKK beta subunits and a

"master" regulatory protein termed NEMO (NF-κB essential modulator), also known as

IKK gamma. The phosphorilated IkB is degraded allowing nuclear traslocation of NF-kB

dimers. Into the nucleus NF-kB interacts with kB site resulting in transactivation of MHC

class I genes and a variety of the other molecules including cytokines (Fig. 3). The level of

gene transcription of the various MHC class I loci is determined by a) the specific

expression level of the NF-kB/Rel family proteins at the specific tissue, b) the binding

affinity of the NF-kB/Rel family proteins for a particular kB site, and c) the transactivation

capacities of different NF-kB/Rel dimers (Baeuerle 1994; Miyamoto1995).

15

Figure 3 – NF-kB signaling pathway. The binding of ligand to a receptor leads to the recruitment and

activation of an IKK complex comprising IKK alpha and/or IKK beta catalytic subunits and two

molecules of NEMO. The IKK complex then phosphorylates IkB leading to degradation by the

proteasome. NF-kB then translocates to the nucleus to activate target genes regulated by kB sites.

2.1.2 ISRE and IRF family members

The mammalian interferon regulatory factor (IRF) family of transcription factors

comprises nine members: IRF1, IRF2, IRF3, IRF4, IRF5, IRF6, IRF7, IRF8/ICSBP and

IRF9/ISGF3γ (Savitsky 2010). IRFs were first characterized as transcriptional regulators of

type I interferon (IFN) and IFN-inducible genes, but recent studies have revealed that this

family plays a pivotal role in the regulation of host defence beyond its function in the IFN

16

system. IRFs exert several functions in regulating important biological processes, such as

innate immune and non-immune cells, cell growth, apoptosis and oncogenesis (Paun

2007).

All IRF proteins contain an amino (N)-terminal DNA binding domain (DBD) that is

characterized by a series of five well-conserved tryptophan-rich repeats (Mamane 1999;

Taniguchi 2001). The DBD forms a helix-loop-helix domain and recognizes DNA similar

in sequence to the IFN-stimulated response element (ISRE, A/GNGAAANNGAAACT)

(Darnell 1994). The C-terminal regions of IRFs are less well conserved and mediate

interactions with other IRF members, other transcriptional factors, or cofactors, thereby

conferring specific activities upon each IRF (Savitsky 2010).

IFNγ exerts its biological effects through the signal transduction pathway, which

involves binding to its receptor, activation of Janus kinase (JAK) 1 and 2, and

phosphorilation of STAT1 (Bach 1997; Schindler1995). A homodimer of activated STAT1

can bind the IFNγ activation site (GAS), or the ISRE in combination with p48 (also called

ISGF3), thereby transactivating genes containing these sequences in their promoters (Fig.

4)(Darnell 1994). IRF1, IRF2 and the IFN consensus sequence binding protein (ICSBP)

are induced by this route. These molecules form a group of secondary transcription factors

that regulate gene transcription in a positive or negative manner, or act as helper of

protein/DNA complex formation. This cascade of events results in the transactivation of a

number of genes important in the immune system, including MHC class I heavy chain, β2-

microglobulin, TAP1, TAP2, Tpn, ERAP1 and ERAP2, all product genes of the MHC

class I antigen processing and presentation pathway (Boehm 1997).

17

Figure 4 - Interferon receptors and activation of classical JAK–STAT pathways by type I and type II

interferons. All type I interferons (IFNs) bind a common receptor at the surface of human cells, which

is known as the type I IFN receptor. Both type I IFN and type II IFN receptors are composed of two

subunits each associated with the Janus activated kinases (JAKs) tyrosine kinase 2 (TYK2) and JAK1,

respectively. Activation of the JAKs that are associated with the type I IFN receptor results in tyrosine

phosphorylation of STAT2 (signal transducer and activator of transcription 2) and STAT1; this leads to

the formation of STAT1–STAT2–IRF9 (IFN-regulatory factor 9) complexes, which are known as ISGF3

(IFN-stimulated gene (ISG) factor 3) complexes. These complexes translocate to the nucleus and bind

IFN-stimulated response elements (ISREs) in DNA to initiate gene transcription. Both type I and type II

IFNs also induce the formation of STAT1–STAT1 homodimers that translocate to the nucleus and bind

GAS (IFN-γ-activated site) elements that are present in the promoter of certain ISGs, thereby initiating

the transcription of these genes. The consensus GAS element and ISRE sequences are shown. N, any

nucleotide.

18

3. Cancer Immune Evasion

The concept that the immune system can recognize and destroy nascent

transformed cells was originally embodied in the cancer immunosurveillance hypothesis of

Burnet and Thomas (Burnet 1970). This hypothesis was abandoned shortly afterwards

because of the absence of strong experimental evidence supporting the concept. New data,

however, clearly show the existence of cancer immunosurveillance and also indicate that it

may function as a component of a more general process of cancer immunoediting

(Shankaran 2001; Dunn 2002). Cancer immunoediting is a dynamic process composed of

three phases: elimination, equilibrium, and escape (Fig. 5). Elimination represents the

classical concept of cancer immunosurveillance, which consists of the recognition of

transformed cells by the innate and the adaptative immune system, leading to the killing of

these cells. In the second phase of cancer immunoediting (equilibrium), residual cancer

cells persist, but they are prevented from expanding by immune pressure. Cancer cells that

develop the capacity to evade the immunological control, grow progressively and enter in

the escape phase (Dunn 2006; Schreiber 2011).

Several mechanisms are developed by tumor cells to escape from the immune

system: 1) elimination of the immune cells, 2) suppression of their functions by releasing

immunosuppressive cytokines that directly or indirectly suppress immune function, such as

TGF-b, IL-10 or prostaglandins (Ahmad 2004; Bin2002); 3) down-regulation of cell-

surface peptide-MHC class I complexes that are essential for the presentation of tumor-

associated antigens (TAAs) to T cells (Garrido 1993); 4) modulating the balance of

expression of activating and inhibitory ligands for the Natural Killer (NK) cells receptor,

that are important for the elimination of tumor cells by NK cells (Gray 2009).

Appropriate TAA processing and presentation is a prerequisite for the successful

outcome of T-cell-based immunotherapy of malignant diseases. Optimization of the design

of the T-cell epitope greatly benefits from detailed knowledge of the pathophysiology of

the MHC class I and II antigen-processing machinery and of molecular defects used by

tumor cells to escape from T-cell recognition.

19

Figure 5 – Immunoediting theory. Following cellular transformation and the failure of intrinsic tumor

suppressor mechanisms, a developing tumor is detected by the immune system and its ultimate fate is

determined by whether or not it is eliminated by the host protective actions of immunity (Elimination

phase), maintained in a dormant or equilibrium state (Equilibrium phase) or escapes the extrinsic

tumor suppressor actions of immunity by either becoming non-immunogenic or through the elaboration

of immunosuppressive molecules and cells (Escape phase).

3.1. MHC class I defects

It has been demonstrated that 40% of human tumors of distinct histology express

low or down-regulated MHC class I surface antigens (Garrido1993). This phenomenon

can be due to modulation and/or inhibition of the expression of various MHC class I APM

components (Seliger2001)(Restifo1993). A direct correlation between the degree of tumor

differentiation and expression of MHC class I, in which poor differentiated tumor cells

have reduced expression of MHC class I, has been reported for a variety of tumor types,

including breast, lung, basal cell carcinomas (Garrido 1993; Esteban 1989; López-Nevot

1989). Furthermore, an association between metastasis, tumor progression and poorer

prognosis has been described for tumors having reduced expression of MHC class I

20

(Aptsiauri 2007; Ogino 2006;Ruiz-Cabello 1989). These data provide compelling evidence

for loss of MHC class I determinants representing a major factor in tumor progression.

Interestingly, hepatocellular carcinoma and leukemia are exceptions to these general

finding (Shen 2009; Wetzler2001).

Loss of MHC class I expression can results from mutations in any of the proteins

involved in MHC class I antigen processing and presentation pathway or in MHC class I

molecules themselves. In particular, downregulation of MHC class I molecules can be

caused by point mutations or by large deletions correlating with loss of heterozygosity

(LOH) on chromosome 6p21 (Maleno 2004; Maleno2006). Another reason for defective

MHC class I surface expression as detected in colorectal tumors and melanoma is due to

mutated β2m, which severely impairs the formation of stable MHC class I complexes

(Bicknell 1994; Hicklin1998). Moreover, altered transcriptional regulation, such as

decreased levels or loss of locus-specific transcription factors as well as epigenetic

alterations like DNA hypermethylation can contribute to the decrease of MHC class I

expression (Fonsatti 2003; Soong1992). Therefore, mutations of antigen processing

protein-codifying genes, or alterations in transcription of MHC class I as well as in other

antigen processing molecules are more likely candidates for affecting this mechanism of

immune evasion.

3.2. Antigen-processing machinery (APM) defects

Besides abnormalities of MHC class I antigens, downregulation of APM

components such as LMPs, TAP and tpn could result in deficient MHC class I surface

expression. Downregulation of expression of LMP2, LMP7, TAP1 and TAP2 has been

demonstrated in a variety of tumor types, including small-cell lung carcinoma (Lou 2005),

esophageal squamous cell carcinomas (Liu 2009), melanoma (Tao 2008), and renal cell

carcinoma (Seliger 1996). In a recent work, Fruci et al. gave evidence that also the

expression of ERAP1 and ERAP2 is imbalanced in several tumor cell lines, including

leukaemia/lymphoma, melanoma and carcinoma cell lines, compare to EBV-B cells from

healthy donors (Fruci 2006). Moreover, the authors found that ERAP1 expression, but not

ERAP2, significantly correlated with MHC class I level suggesting that ERAP1 has a

21

dominant role in the generation of MHC class I epitope. In a subsequent study, the

expression of ERAP1 and ERAP2 was investigated in a large panel of surgically removed

normal and neoplastic tissues. In approximately 150 neoplastic lesions, the expression of

either or both enzymes was lost, acquired or retained as compared to the normal

counterparts, depending on the tumor histotype. Down-regulation of ERAP1 and/or

ERAP2 expression was mainly detected in ovary, breast and lung carcinomas, whereas an

up-regulation of these enzymes was observed in colon and thyroid carcinomas. Of note,

ERAP1 and MHC class I were co-ordinately expressed in normal and, to a lesser extent,

neoplastic lesions (Fruci 2008). As expected, the altered expression of ERAPs results in

abnormal cell surface expression of MHC class I molecules in tumor cell lines (Fruci

2006). In the most aggressive type of neuroblastoma cells, ERAP1, ERAP2 as well as

MHC class I molecules were expressed at very low levels as consequence of a poor

constitutive NF-kB nuclear activity (Forloni 2010).

All these findings suggest that aberrant expression of ERAP1 may contribute to

escape from immune surveillance. To evaluate the relevance of the ER peptide trimming

inhibition on tumorigenicity, we stably reduced ERAP1 expression in a murine T-cell

lymphoma by ERAP1-targeted small interfering RNA. We demonstrated that interfering

with ERAP1 expression ultimately leads to tumor rejection in syngeneic animals by

boosting NK cell-, and subsequently T cell-mediated cytolysis (Cifaldi 2012). This

rejection was mainly due to NK cell response and depends on the MHC class I peptides

presented by ERAP1-silenced tumor cells, because replacement of the endogenous

peptides with high-affinity peptides was sufficient to restore an NK protective effect of

MHC class I through the inhibitory receptor LY49C/I. In spite of the relatively modest

impact on overall MHC class I expression, we demonstrated that ERAP1 inhibition was

able to shift the balance between activating and inhibitory signals towards NK cell

activation resulting in target cell killing.

The molecular mechanisms underlying the APM components downregulation could

occur at different levels such as structural alterations and dysregulation due to epigenetic

control, transcriptional and post-transcriptional modulation. Structural alteration, mutation

and deletion in the promoter or coding region of these genes appear to be a rare event

(Seliger 2008; Khan 2008). These deficiencies may cause defects in peptide generation,

22

translocation and/or loading onto β2-microglobulin-MHC class I heavy chain complexes.

As a consequence, these complexes are retained in the ER and are rapidly degraded.

Normally IFNγ treatment restores antigen processing and presentation pathway up-

regulating APM component expression and reverts MHC class I antigen downregulation.

However in some cases can exist a loss of MHC class I APM inducibility by IFN, which

could be caused by different defects in the IFN signal transduction cascade (Seliger 2012).

23

4. Neuroblastoma

Neuroblastoma (NB) is an embryonal tumor that origins from precursors of the

sympathetic nervous system and represents the third leading cause of cancer-related death

in childhood accounting for approximately 1-5% of all pediatric cancer deaths.

The heterogeneous clinical behavior, ranging from spontaneous regression to rapid

progression, is attributable to biological and genetic characteristics of the tumor.

An International Neuroblastoma Risk Group (INRG) classification system proposes

four categories (very low risk, low risk, intermediate risk, and high risk) based on age at

diagnosis, stage, tumor histopathology, DNA index (ploidy) and MYCN amplification

status (Maris 2010).

NB diagnosed in patients before 1 year of age and/or with localized disease are

curable with surgery and little or no adjuvant therapy. These tumors undergo spontaneous

regression in most cases, particularly in infants, or differentiate into benign

ganglioneuromas (GNB). In contrast, older children often have extensive metastasis and

die from disease progression despite intensive multimodal therapy. Therefore this tumor

requires cellular and molecular markers to distinguish the different biological

characteristics (Maris 1999). The prognosis of stage I-III NB, with a tumor confined to the

originating organ or surrounding tissue, is quite favorable, whereas that of stage IV NB,

where the tumor is metastatic, is dismal. Stage IV-S NB is a metastatic disease seen

exclusively in infants, which is associated with high survival rate due to the spontaneous

maturation and regression of tumor cells. Nevertheless, since disease and risk staging are

not comprehensive and fully precise, they should be considered as surrogate markers of the

underlying tumor biology (Chon 2009).

The degree of differentiation of NB is another important factor for establishing pro-

gnosis. Based on this, NB tumors are classified in different histologically categories ac-

cording to the degree of cellular differentiation into ganglionic cells, the maturation stage

and the development of a Schwann cell stroma: 1) mature and benign ganglioneuromas

(GN, Schwannian stroma-dominant); 2) intermediate and potentially malignant GNB gan-

glioneuroblastomas (GNB, Schwannian stroma-rich); 3) undifferentiated NB (Schwannian

24

stroma-poor), always malignant with worst prognosis (Shimada 1999).

Compared to the NB sporadic form, only 1-2% of children with NB show a familial

genetic predisposition. The familial forms of NB occur at a younger median age than

sporadic cases forms, and have an autosomal dominant pattern of inheritance with

incomplete penetrance (Longo 2007). Many genes have been demonstrated to be involved

in the familial predisposition to NB, but little is known about their precise roles (Maris

1999).

4.1. Genetic factors

Many genetic features of NB, such as the ploidy status, oncogene amplification or

allelic loss, have been identified to correlate with clinical outcome. Based on their nuclear

DNA content, NB can be divided into near-diploid (45%) or triploid tumors (55%). Near-

triploid NB tumors are characterized by whole chromosome gains and losses without

genetic aberrations and are more often localized and show favorable outcome. Conversely,

near-diploid NB are characterized by genetic aberrations, such as MYCN amplification,

17q gain, and chromosomal losses and are associated with a more aggressive phenotype

(Brodeur 2003; Park2010).

4.1.1 MYCN amplification

Some NBs contain double-minute chromatin bodies (DMs) or homogeneously

staining regions (HSRs), which represent cytogenetically manifestations of gene

amplifications.

Schwab and colleagues identified MYCN amplification in a panel of NB cell lines

(Schwab 1984). MYCN is a proto-oncogene of the Myc family, normally expressed in the

developing nervous system and other tissues. The MYCN gene product is a nuclear

phosphoprotein with short half-life that belongs to the basic/helix-loop-helix/zipper

(b/HLH/Z) transcription factors. MYCN forms an heterodimer with MAX, and this protein

complex functions as a transcriptional activator. In the absence of MYCN, MAX forms a

homodimer that is transcriptional repressive. MYCN functions as a classic dominant

oncogene (Maris 1999). The activation of the known MYCN target genes leads to

25

progression through the G1 phase of the cell cycle.

Brodeur et al. were the first to show that MYCN amplification occurs in a

substantial subset of primary untreated NB and is highly correlated with advanced stage

and poor outcome (Brodeur 1984; Seeger1985). Interestingly, MYCN over-expression in

murine peripheral neural crest cells causes neuroblastic tumors with high penetrance and

phenotype similar to humans. MYCN copy number is directly correlated with the levels of

mRNA and protein expression. MYCN oncogene is overexpressed in 25% to 35% of NB.

MYCN amplification is found in 30% to 40% of stage III and IV neuroblastomas and in

only 5% of localized or stage IV-S neuroblastomas (Park 2010; Brodeur 1995).

Although MYCN amplification identifies a subset of NB with highly malignant

behavior, the precise role of MYCN expression in non-amplified tumors remains

controversial. In fact, some NB cell lines express high levels of MYCN protein without

gene amplification (Seeger 1988;Slavc1990), and this may be cause by alterations in

normal protein degradative pathways rather than loss in transcriptional regulation (Otto

2009; Cohn1990). In a subset of tumors without MYCN amplification, MYCN expression

has been shown to inversely correlate with survival probability (Chan 1997). This

phenomenon was found to be correlate with the role of MYCN regulation on cMYC: high

expression of MYCN in not amplified tumors is paradoxically associated to a good

prognosis because the level of cMYC is kept low. On the contrary, tumors with low

expression levels of MYCN are more aggressive because they express cMYC

(Westermann 2008). Further studies using standardized methods in a larger cohort of

consistently treated patients will be necessary to determine if quantitative assessment of

MYCN expression in tumors lacking MYCN amplification may provide further prognostic

information.

4.1.2 Gain and loss of genetic material

Sporadic NB is the most common genetic occurrence and is associated with a wide

range of acquired genetic changes from gain to loss of genetic material.

Recurrent abnormalities of the long arm of chromosome 17 have been identified in

NB primary tumors and NB cell lines (Gilbert 1984). Although unbalanced gain of 17q can

occur independently, it is frequently detected as part of an unbalanced translocation

26

between chromosome 1 and 17, resulting in loss of distal 1p with concomitant gain of

distal 17q material (Van_Roy 1997). However, the 17q translocation breakpoints are

heterogeneous and often involve other partner chromosome, but preferential gain of a

region from 17q22-qter indicates a dosage effect that provides a selective advantage rather

than interruption of a gene (Łastowska 2002). Gain of 17q is associated with more

aggressive NB, although its prognostic significance relative to other genetic and biological

markers awaits a detailed analysis (Brodeur 2003).

Other significant genetic abnormalities, in the pathogenesis of NB, include

chromosomal deletions. Brodeur et al, first recognized that deletions of the short arm of

chromosome 1 (1p) were a common feature of NB cell lines and advanced tumors

(Brodeur 1977; Brodeur1981). This kind of deletions is detected in approximately 35% of

primary tumors with advanced stages of disease, and 1p allelic loss (LOH) is highly

associated with MYCN amplification (Fong 1989). Caron et al. found that tumors with

MYCN amplification generally had 1p deletions extending proximal to 1p36, but single-

copy tumors more often had small terminal deletions of 1p36 only (Caron 1993).

There is a strong correlation between 1p LOH and high-risk features such as age

greater than 1 year at diagnosis, metastatic disease, and MYCN amplification. Thus, 1p

LOH occurs frequently in the more malignant subset of NB. However, there have been

contrasting opinions concerning the independent prognostic significance of 1p LOH (Maris

1995; Caron 1996; Rubie1 997). Current evidence indicates that allelic loss at 1p36

predicts for disease progression but not overall survival in NB patients (Maris 2000).

Other important alterations found in NB tumors include hemizygous deletions of

the long arm of chromosome 11, occurring in approximately 40% of human NB (Srivatsan

1993). In addition, constitutional rearrangements of chromosome 11q, including interstitial

deletions, have been observed in NB patients. The common region of LOH mapped to

11q23, suggesting the presence of suppressor gene. In contrast to 1p deletions, there was a

striking inverse correlation of 11q LOH and MYCN amplification. Nevertheless, this

abnormality is correlated with unfavorable phenotype of disease (Guo 1999).

Likewise, deletion of the long arm of chromosome 14 is also a common anomaly

occurring in approximately 20-25% of cases of NB. Allelic loss of 14q was highly

correlated with 11q LOH, inversely related to 1p deletion and MYCN amplification and

27

present in all clinical risk groups, indicating that this abnormality may occur early in tumor

development (Maris 1999).

There are other regions of the genome that are frequently deleted in NB tissues,

suggesting the existence of additional tumor suppressor genes. There have been reports of

LOH and/or allelic imbalance at chromosome arms 3p (Ejeskär 1998), 4p (Caron 1996), 9p

(Marshall 1997), and 18q (Reale 1996), but there seem to occur at lower frequency than

loss at the other loci noted above.

4.2. NB therapy

The most enigmatic clinical behavior of NB is its spontaneous regression. This is

particularly common in stage IV-S patients without MYCN amplification. Patients > 18

months of age with stage IV and those <18 months of age with MYCN-amplified stage IV

disease constitute the most challenging groups of study and treatment for pediatric

oncologists.

Current standard therapy for high-risk patients, given in sequence, consists of: 1) intensive

induction chemotherapy and surgery to achieve remission; 2) myeloablative consolidation

chemotherapy, autologous hematopoietic progenitor cell transplantation and local

radiation; 3) consolidation of remission with 13-cis-retinoic acid combined with IL-2, GM-

CSF, and anti-disialoganglioside (GD2) monoclonal antibody (mAb) (Modak 2010;

Matthay 2012).

The goal of induction chemotherapy is the rapid reduction of the entire tumor

burden: both metastatic and primary sites, the latter to facilitate complete resection of soft

tissue disease. Although most tumors respond to chemotherapy, surgery is critical to

achieving complete remission in primary site for most patients. Gross total resection was

correlated with reduced risk of local recurrence, especially when combined with dose-

intensive induction chemotherapy and local radiotherapy (La_Quaglia 2001).

Non-cytotoxic therapy with retinoids (vitamin A derivatives) are currently used for the

treatment of minimal residual disease. It has been demonstrated that retinoids induce

differentiation and growth arrest of malignant NB cells (Thiele 1985). Although retinoic

acid is the standard of care for post-remission induction maintenance therapy, generally it

28

is used in combination with mAb anti-GD2, IL-2 and GM-CSF to enhance the killing of

residual NB cells (Gilman 2009). However, despite advances in treatment and

improvement in survival in patients with high-risk NB, 50 to 60% of patients have a

relapse, which is fatal in most of them. Therefore development of new and more effective

immunotherapy strategies for treating minimal residual disease will be based upon

improved understanding of interactions between tumor cells and immune system,

maximizing anti-tumor cell immune responses and minimizing pro-tumor and

immunosuppressive immune response.

One of the most promising therapy for treatment of high-risk NB involves the use

of autologous human T lymphocytes genetically modified to express chimeric antigen

receptors (CARs) that recognize tumor antigens and provide activating signal to the T

cells. These receptors use a single chain fraction variable (scFv) antibody-derived motif for

recognizing a cell surface antigen and most important, such recognition is independent of

antigen processing or MHC class I-restricted presentation. T cells engineered to express an

anti-GD2 CAR recognize and lyse GD2-expressing NB cells. However, functionally

declined over time in vitro, and antigenic stimulation did not induce proliferation (Rossig

2001). Subsequently has been shown that EBV- specific T cells, which were transducted

with the anti-GD2 CAR gene, could be expanded and maintained long-term in the presence

of EBV-infected B cells. These T cells efficiently lyse both EBV infected cells and GD2-

expressing NB cells. Currently, these CAR-T cells have been used to mediate tumor

regression in patients with NB, and offer another testable strategy for GD2-directed

immunotherapy as well as for any specific NB antigen (Pule 2008).

29

5. Immune Evasion of Neuroblastoma

NB use different mechanisms to evade recognition by effector cells of the immune

system (Fig. 6), including i) to express immunosuppressive cytokines like TGF-b and/or

IL-10 which may prevent activation and expansion of tumor-infiltrating lymphocytes

(Corrias 2001; Rivoltini1992); ii) to downregulate costimulatory molecules such as CD40,

CD80 or CD86 (Airoldi 2003); iii) to express low levels of MHC class I antigens. The lack

of MHC class I expression should make NB cells an ideal target for NK cells as one of the

main mechanisms by which NK cells recognize abnormal cells is by the detection of

“absent self” or lack of MHC class I on their cell surface. However, aberrant expression of

ligands for NK cell-activating receptors on NB cell lines prevent their recognition by NK

cells (Gray 2009).

Figure 6 - Mechanisms of immune escape in neuroblastoma. Levels of tumour antigen and MHC

molecules expressed on neuroblastoma cells may be low and cross-presentation of antigens by dendritic

30

cells is often inefficient. In addition, in the non-inflammatory tumour environment, dendritic cells may

not express the co-stimulatory molecules necessary for effective T cell activation. Finally, any immune

response generated may be counteracted by immunosuppressive cytokines and regulatory T cells

(Treg).

5.1. MHC class I and APM expression in NB and CTL recognition

NB cell lines and primary tumors have been characterized for expression of several

tumor-associated antigens including the family members of the embryonic genes MAGE,

BAGE and GAGE, NY-ESO, PRAME, ALK, MYCN, the disialoganglioside GD2, and

the CD56 (Corrias 1996).

Over the past decades it has been demonstrated that NB cell lines and tumors

display low to absent expression of MHC class I molecules, thus escaping from CTL

recognition (Lampson 1986; Wölfl 2005). Metastatic NBs in bone marrow have been

shown to express HLA-A, -B, -C molecules at very low level (Lampson 1983). Moreover,

Corrias and colleagues showed that TAP subunits, and particularly TAP1, expression is

highly defective in human NB cell lines lacking MHC class I antigen expression. In several

such cell lines the TAP defect was associated with a reduced β2-microglobulin expression

(Corrias 2001). Differently from TAPs, the tpn gene appeared to be constitutively

expressed in all cell lines, although it was also susceptible to IFNγ upregulation (Corrias

2001; Lampson 1986). Subsequently, the same group studied the expression of MHC class

I molecules and the APM components in primary NB tumors. They showed that primary

NB tissue expressed low levels of tpn, TAP1, or TAP2, MHC class I heavy chain, β2-

microglobulin, LMP2 and LMP7, demonstrating the existence of a link between

downregulation of the APM components and the deficiency of MHC class I molecules on

NB tumors (Raffaghello 2005). Interestingly, the expression of MHC class I and APM

components was significantly up-regulated upon IFNγ treatment in a panel of NB cell lines

(Corrias 2001). Accordingly, the expression of MHC class I molecules on NB cells

stimulated with IFNγ appears adequate for CTL recognition and lysis (Sarkar 2000). These

findings suggest that both primary NB tumors and NB cell lines show defects in the

31

expression of MHC class I and APM components.

The molecular mechanisms underlying defects in the expression of the antigen

processing and presenting molecules remain to be investigated. The elucidation of these

mechanisms may allow a more accurate selection of patients as candidates to receive

cellular immunotherapy and eventually improve their outcome.

5.2. Susceptibility of NB to NK cell-mediated cytotoxicity

Defects in MHC class I and APM component expression may render NB cells an

excellent target for NK-mediated cytotoxicity, whether they express NK cell activating

ligands on their cell surface.

The activating receptors involved in NK cell–mediated cytotoxicity are NKG2D

and the natural cytotoxicity receptors (NCRs) NKp46, NKp44, and NKp30, which belong

to the immunoglobulin superfamily. NCR ligands have been detected on the surface of NB

cell lines and found to be involved in their NK-mediated killing (Moretta 2001). Most of

the cytolytic activity was confined to the NKp46 and NKp30/NKp44 bright subsets (Sivori

2000), suggesting that down-regulation of NCR ligands on the NB cells can affect their

killing by NK cells.

NKG2D is a C type lectin-like molecule expressed by all NK cells, γ/δ T cells, and

CD8+ T cells in humans (Bauer 1999). NKG2D ligands are not expressed in normal cells,

but can be upregulated upon viral and bacterial infections, transformation, and oxidative

stress. In humans, NKG2D ligands are the MHC class I – related chain (MIC)A and MICB

molecules and the more recently identified family of cytomegalovirus UL-16 binding

proteins (ULBPs) (Groh 1996; Cosman2001). Pende and colleagues analyzed a large panel

of tumor cell lines of different histotypes for the surface expression of MICA and ULBPs.

The two NB cell lines studied (SK-N-BE and LAN-5) were found to express a MICA -

/ULBP- phenotype (Pende 2002). Afterwards, Raffaghello et al. demonstrated that most

primary NB tumors express MICA and MICB both at the mRNA and protein levels, and

similar patterns were observed in a panel of NB cell lines. The MICA protein was not

detected in tumor cells, but was present in soluble form in most NB sera; in contrast, the

MICB protein was found consistently in the cytosol, but not on the surface of tumor cells.

32

The only NKG2D ligand expressed on the surface of primary NB tumors is ULBP-2,

which was detected in half of the cases, whereas ULBP-1 and ULBP-3 staining was

consistently negative. ULBP-3 was detected in half of the tested NB cell lines, ULBP-2 in

only a small number of them, while ULBP-1 in none cells (Raffaghello 2004).

Therefore, these data demonstrated down-regulation of the ligands for the NKG2D

activating receptor on the surface of primary NB tumors and cell lines, suggesting that NB

tumor cells can often escape from the control of NKG2D+ cytotoxic effectors. Moreover,

the soluble MICA detected in the sera of NB patients can impair NKG2D expression on

cytotoxic cells and their effector function against NKG2D ligand expressing target cells.

5.3 IRFs and NF-kB as regulators of immunogenicity of NB

In the past, few works focused on the identification of the molecular mechanisms

underlying the MHC class I paucity on NB tumors, even if most of the transcription factors

involved in the transcriptional regulation of these molecules are well known.

A recent study conducted in our lab has identified NF-kB as the major, direct

transacting factor responsible for coordinated regulation of MHC class I and ER

aminopeptidases in NB, and that reconstitution of this missing transacting function

enhances MHC class I in at least some aggressive NB cell lines (Forloni 2010).

Furthermore sequences ISRE-like, capable of binding the transcription factor IRF1,

have been found in the promoter region of MHC class I heavy chain, β2-microglobulin and

many of the APM genes. In this regard, many studies have been performed to investigate

the effects of IFNγ on MHC class I and APM components expression in NB cell lines.

Drew et al. also observed that treatment of NB cells with IFNγ and TNFα induce factor

binding to the cis-elements and led to increased MHC class I and β2-microglobulin gene

transcription (Drew 1993). Moreover, treatment with both cytokines resulted in a

synergistic enhancement of the MHC class I and β2-microglobulin expression. TNFα

induced binding of the p65 and p50 NF-kB subunits to the NF-kB elements of the MHC

class I promoter, while IFNγ induced binding of IRF1 to the adjacent interferon consensus

sequence (ICS) (Drew 1993; Drew1995). It has been demonstrated a physical interaction

between NF-kB and IRF1 which cooperate to induce MHC class I transactivation when co-

33

transfected into NB cell lines (Drew 1995).

All these findings support a model by which TNFα and IFNγ synergistically can

restore the expression of a variety of genes involved in immune response, including MHC

class I, and suggest the hypothesis that lack of transcription factors, like NF-kB and IRF1,

in NB cell lines could account for the impaired immunogenycity of NB.

34

AIM OF THE WORK

My PhD project focus on the identification of the molecular mechanisms underlying the

down-regulation of MHC I and APM components in NB cells. Specifically, we identified

IRF1 as a transcription factor that sinergizes with NF-kB in reconstituting of MHC I and

all APM components in NB cell lines. In this way, NB cells can be recognized and lysed

by tumor antigen-specific CTL.

I hope that these results will be useful to understand the molecular basis of immune escape

utilized by NB cells, and may suggest a strategy to correct these factors leading to the

development of an effective immunotherapeutic strategy.

35

MATERIALS AND METHODS

Tumor Cell Lines and Reagents

All human NB and melanoma cell lines were obtained from the American Type

Culture Collection and characterized by morphology and HLA class I typing by PCR-SSP

sets (Genovision). The human NB cell lines SH-EP, SK-N-AS, LAN-5, IMR-32, SK-N-

BE(2) and SK-N-BE(2)c were cultured in RPMI 1640 medium, SH-SY5Y and SK-N-SH

cells in DMEM and MEM, respectively. The melanoma cell lines ET1 and MSR3-mel

were maintained in IMDM. All media were supplemented with 10% FCS (HyClone),

glutamine, 100 mg/ml penicillin and 50 mg/ml streptomycin.

For IFNγ-treatment, NB cell lines were cultured for 48 hours in the presence of 500

U/ml recombinant human IFNγ (R & D Systems).

DNA Constructs and Transfections

The expression vector carring NF-kB p65 subunit, IRF1 and IRF2 (kindly provided

respectively by M. Levrero, Rome Oncogenomic Center, Regina Elena Institute, Rome,

Italy and A. Battistini, Department of Infectious, Parasitic and Immune-Mediated Diseases,

Istituto Superiore di Sanita`, Rome, Italy), and the corresponding empty vectors were

transfected using LipofectAMINE 2000 (Invitrogen Life Tecnologies) according to the

manufacturer’s instructions. Cells were seeded in tissue culture plates and transfected 24

hours later at an 80% confluence with DNA-lipofectamine complexes in Opti-MEM.

Fifteen hours following transfection the culture medium was replaced with fresh medium,

and the cells were treated as indicated for Western blot, Cytofluorimetric analysis and

mRNA analysis.

Semi quantitative and quantitative (RT)-PCR

Total RNA was extracted with Trizol Reagent (Invitrogen), according to the

manufacturer’s instructions. Aliquots of 1 μg of total RNA were treated with DNase I

(Ambion), and the single stranded cDNAs were obtained by retro-transcription with

36

Superscript II (Invitrogen) according to the manufacturer’s instructions (Invitrogen). Real-

time qRT-PCR was performed with Taqman probes (Applied Biosystems) in the Applied

Byostsystems 7900 HT Sequence Detection system. The expression of each mRNA was

defined from the threshold cycle (Ct), and relative expression levels were calculated using

the 2-DDCt method (Livak and Schmittgen, 2001) after normalization with reference to

expression of 18S RNA.

For semiquantitative RT-PCR 100 ng of cDNA were amplified using REDTaq ReadyMix

PCR Reaction Mix (SIGMA). The oligonucleotide sequences and gene-specific PCR

amplification programs used for each genes are reported in the Table 1. Relative

expression levels were determined by visualizing DNA bands on GelRed-stained 1.5%

agarose gels.

Gene Sequence Amplicon length

(bp)Thermal cycle

MAGE-A1Sense

Antisense

CGGCCGAAGGAACCTGACCCAG

GCTGGAACCCTCACTGGGTTGCC

421

30 cycles of94°C 1 min, 72°C 3 min

MAGE-A3Sense

Antisense

TGGAGGACCAGAGGCCCCC

GGACGATTATCAGGAGGCCTGC

725

30 cycles of94°C 1 min, 72°C 4 min

MART-1Sense

Antisense

CTGACCCTACAAGATGCCAAGAG

ATCATGCATTGCAACATTTATTGATGGAG

602

24 cycles of 94°C 1 min, 6°C 1 min, 72°C 1 min

NY-ESO-1Sense

Antisense

CACACAGGATCCATGGATGCTGCAGATGCGG

CACACAAAGCTTGGCTTAGCGCCTCTGCCCTG

379

35 cycles of 94°C 1 min, 59°C 1 min, 72°C 1 min

GAPDHSense

Antisense

ACCACAGTCCATGCCATCAC

TCCACCACCCTGTTGCTGTA

451

35 cycles of95°C 1 min60°C 1 min72°C 1 min

Table 1 - Primers and thermal protocols utilized for the RT-PCR evaluation of cancer testis

antigens in human NB cells.

37

Antibodies and Immunoblotting

Murine mAbs W6/32, HC10, 6H9, 3F5, NAMB-1 and 435.3 recognize human fully

assembled MHC-I heavy chains, β2m-free MHC-I heavy chains, ERAP1, ERAP2, β2m

and TAP2, respectively [Giorda2003][Saveanu2005][Martayan1999][van_Endert1994].

The rabbit polyclonal Abs R5996-4, 352 and GCY were raised against human β2m-free

MHC-I heavy chains, tapasin and TAP1, respectively [Forloni2010][Sigalotti2008]. The

following Abs were all from Santa Cruz Biotechnology: NF-kB p65 (sc-109), IRF1 (sc-

497), IRF2 (sc-498) and PCNA (sc-56). The polyclonal Ab IRF1 (Ab-26109) from Abcam

was used for immunohistochemical staining.

For total extracts cells were lysed in 50 mM Tris pH 7.5 and 250 mM NaCl

containing 1% Nonidet P-40 (NP-40) in the presence of a mixture of protease inhibitors

(10 mM Leupeptin, 10 mM Pepstatin A, 1 mM PMSF, and 10 mM Aprotinin). Nuclear

extracts were obtained by suspending cells in hypotonic buffer (300 mM Sucrose, 10 mM

HEPES-KOH pH 7.9, 0.1 mM EDTA, 1.5 mM MgCl2 and proteinase inhibitors) for 10’ on

ice. Following addition of 0.2% NP-40, the solution was subjected to shearing with a 22-

gauge needle. After mild centrifugation, nuclear pellets were lysed in extraction buffer (10

mM HEPES-KOH pH 7.9, 400 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2, 25% glycerol

and protease inhibitors) for 30’ on ice. The extracts were quantified by the bicinchoninic

acid assay (Pierce). Equal amount of protein extracts were resolved on 8-10% SDS-PAGE

and electroblotted on a nitrocellulose membrane (Whatman). Filters were blocked with 5%

nonfat milk, and probed with primary Ab, followed by incubation with peroxidase-

coupled secondary Ab. Immunoreactivity was detected using the ECL detection system

(Amersham Biosciences). ERp57 and PCNA were used as loading control of whole-cell

and nuclear extracts, respectively.

Flow cytometry and immunohistochemistry

MHC-I surface expression was determined by flow cytometry with mAb W6/32. 5

X 105 cells, for experimental point, were incubated for 1h at 4°C with the W6/32 antibody.

38

Cells were washed with PBS containing 0.5% FCS. The cells were then incubated for 1h at

4°C with FITC-labelled goat anti mouse Ig Fc (1:100). The cells were washed with PBS

containing 0.5% FCS and analyzed with a FACScalibur flow cytometer (Becton

Dickinson).

All primary NB lesions were obtained from patients diagnosed at the ‘‘Bambino

Gesu`’’ Children Hospital, Rome, (Italy), after obtaining written informed parental consent

and approval by the Ethical Committee of the Institution. The histologic features of NB

were classified into ganglioneuroblastoma (stroma rich, 10 cases) and undifferentiated NB

(stroma poor, 10 cases) according to the percentage and degree of differentiation of the NB

cells using the criteria of the International NB Pathology Classification (Shimada 1999) .

For immunohistochemical staining, consecutive sections of paraffin-embedded tissue

blocks were cut at 3 mm. Deparaffinization and antigen retrieval were performed with PT-

link (Dako) in Tris/EDTA (pH 9.0) (Dako) for 15 min at 98°C for HC10 and citrate buffer

(pH 6.1) (Dako) for the other Abs. Sections were incubated with the primary mAb for 45

min at room temperature, followed by incubation with the peroxidase-conjugated

secondary Ab (Dako) for 20 min at room temperature.

Diaminobenzidinetetrahydrochloride (DAB) was used as chromogen. All samples were

counterstained with hematoxylin.

Antigen-specific T Cells Generation and Propagation

Peripheral blood mononuclear cells (PBMC) from an HLA-A1 melanoma patient

were incubated with the MAGE-A3.A1 peptide EVDPIGHLY (20 mM) [Gaugler1994] for

60 min at room temperature. Then, cells were washed and cultured in complete medium

containing 10% human serum, rhIL-2 (20 U/ml) and rhIL-7 (10 U/ml) [Fontana2009].

After 10 days, the cells were stimulated weekly with autologous MAGE-A3.A1 peptide-

pulsed dendritic cells (DCs) in the presence of irradiated (100 Gy) autologous EBV

transformed B-cells, in complete medium containing 10% human serum and rhIL-2 (50

U/mL) [Fontana2009][Russo2000]. Generation of CTLs specific to the MAGE-A3.A1

peptide was verified by a standard 5-hour 51Cr release assay and an IFNγ ELISA assay

against the MAGE-A3+ HLA-A1+ melanoma cell line ET-1, MAGE-A3+ HLA-A1

39

melanoma cell line 624mel and the HLA class I negative melanoma cell line MSR-3-mel

as controls. The presence of NK cells activity was tested by cold inhibition assay using the

NK targets K562 cells. Lytic activity of the CTLs against NB cells was evaluated by 51Cr

release assay after four hours of co-culture of CTL-target cells.

Statistical Analysis

Digital images of Western blots were analysed by Image J

(http://rsbweb.nih.gov/ij/index.html) and statistical significance of densitometric values

was assessed by the two-tailed unpaired Student’s t-test. A P value of 0.05 was considered

to be statistically significant.

40

RESULTS

IRF1 and IRF2 expression correlates with MHC I expression in

NB cell lines and primary NB samples

Flow cytometry and Western blotting of NB cell lines revealed that the 3 cell lines

expressing higher levels of cell surface MHC I (SH-EP, SK-N-AS and SK-N-SH) also

expressed higher levels of IRF1 and IRF2, whereas the 5 cell lines expressing lower levels

of cell surface MHC I displayed lower levels of IRF1 and IRF2 (Figs. 7, 8A, 8B). Similar

results were obtained in nuclear extracts (Figs. 8A, 8B) and at mRNA level (Fig. 8C).

IRF1, IRF2, and the NF-kB p65 subunit were clearly detected by

immunohistochemistry in the nuclei of MHC I-positive, mature ganglion cells, in 10/10

primary stroma-rich NB lesions. Conversely, the three transcription factors were hardly

seen in the nuclei of MHC I-negative neuroblastic cells from 10/10 stroma-poor

(undifferentiated) NB samples. Representative staining (Fig. 9) reveals expression levels

and subcellular localization. Thus, a significant correlation was detected, both in vitro and

in vivo, between MHC I, NF-kB, IRF1 and IRF2.

41

Figure 7 - Expression of MHC I in NB cell lines. Flow cytometry analysis of surface MHC I

expression in NB cell lines using W6/32 mAb (grey lines). Shaded histograms, negative controls stained

with isotype-matched primary antibody

42

Figure 8 - Expression of IRF1 and IRF2 in NB cell lines.. A , immunoblot analysis of IRF1 and IRF2

in NB cell lines. Equal amounts of whole-cell extracts and nuclear extracts, as indicated, were resolved

by SDS-PAGE, immunoblotted and probed with specific antibodies. ERp57 and PCNA were used for

43

normalization. B, Densitometric and statistical analysis of WB bands in panel A. C, qRT-PCR analysis

of mRNA from different NB cell lines. 18S RNA was used for normalization.

Figure 9 - Expression of MHC I, IRF1, IRF2 and the NF-kB p65 subunit in primary NB lesions.

Immunohistochemistry of human NB tissue sections with Abs to MHC I (A, E), IRF1 (B, F), IRF2 (C, G)

or NF-kB p65 subunit (D, H). Visualized with diaminobenzidine (DAB; brown), nuclei counter-stained

with haematoxilin (blue). IRF1, IRF2 and NF-kB p65 are strongly expressed in the nuclei of mature

44

ganglion cells (arrows), endothelial cells, lymphocytes and stroma cells in the well-differentiated MHC

I-positive ganglioneuroblastoma (A-D), and weakly expressed in the MHC I-negative neuroblastic cells

(arrowhead), i.e. undifferentiated stroma-poor NB (E-H). In E-H, positive staining of benign cells,

including lymphocytes and macrophages. NF-kB p65- positive staining of the fibrillary network in H is

evident. Original magnification, x40. Scale bars 30 mm. Data shown are representative of 10 stroma-

rich and 10 stroma-poor NB tissue sections.

IFNγ enhances the expression of IRFs, MHC I and APM

components in NB cell lines

NB cell lines were treated with IFNγ, a major enhancer of MHC I, APM

components, IRF1 and IRF2. After IFNγ treatment, cell surface MHC I expression was

strongly increased in all NB cell lines (Fig. 10A). Western blot analysis revealed

coordinated expression and significant enhancement of IRF1, MHC I and almost all the

APM gene products tested in all the cells, although the magnitude of the enhancement

tended to be greater in the 5 cell lines expressing lower baseline levels, grouped at the

right-hand side of the panel (Fig. 10B, 10C). These cells also displayed preferential up-

regulation of IRF2, a known mediator of IFNγ signaling extinction that competitively

inhibits the binding of IRF1 to the ISRE (Fig. 10B, 10C).

Thus, constitutive and IFNγ-mediated IRF1/IRF2 expression correlates with

constitutive and IFNγ-mediated MHC I and APM expression, suggesting that IRFs are

involved in regulating MHC I in NB.

45

46

Figure 10 - IFNγ restores IRF1, MHC I and APM components in NB cell lines. A, flow cytometry

47

analysis with mAb W6/32 of surface MHC I expression of NB cells grown for 48 hours in the presence

and absence of IFNγ. Untreated cells (grey lines), treated cells (black lines) and isotype-matched

negative controls (shaded histograms) are shown. B, whole-cell lysates of NB cell lines cultured for 48

hours in the presence and absence of IFNγ were resolved by SDS-PAGE and Western blotted with

specific antibodies. ERp57 was used as loading control. C, Densitometric and statistical analysis of WB

bands in panel B. Data shown in panels A and B are representative of 3 and 5 independent experiments,

respectively.

Synergistic enhancement of MHC I and APM component

expression by IRF1 and NF-kB in NB cell lines

Combined with our previous study (Forloni 2010), the above observations strongly

indicate that not only a lack of NF-kB, but also a lack of IRF1 and/or IRF2, is responsible

for the MHC I-low NB phenotype. To obtain direct evidence for this, the three NB cell

lines SH-SY5Y, SK-N-BE(2) and SK-N-BE(2)c, which are particularly depressed in MHC

I expression, were single-transfected and double-transfected with expression vectors

encoding IRF1, IRF2, and the NF-kB p65 cDNAs (Fig. 11A). IMR-32 and LAN-5 could

not be included in this analysis because they were refractory to transfection.

Transfection-mediated overexpression of either IRF1 or IRF2 did not affect NF-kB

p65, MHC I or APM components in any of the three tested cell lines, the only exceptions

being IRF1-mediated up-regulation of ERAP2 and MHC I in SH-SY5Y and SK-N-BE(2)c,

respectively (Fig. 11A). No additional up-regulation could be obtained by co-transfection

of IRF1 and IRF2, demonstrating that the IRFs, by themselves, are very poor MHC I/APM

transactivators in NB cell lines. In line with the known antigen-presentation impairment

operating in NB, even the master MHC I regulator NF-kB p65 was partially effective,

since it up-regulated both MHC I and APM components in SH-SY5Y, but only MHC I in

SK-N-BE(2) and SK-N-BE(2)c (Figs. 11A, 11B). Remarkably, these two cell lines are

MYCN amplified and representative of very aggressive NB tumors (Forloni 2010). Also

noteworthy is the observation that only in fully responsive SH-SY5Y cells was p65

capable of promoting substantial IRF1 enhancement, suggesting that efficient correction of

48

APM-low phenotypes requires not only a direct effect of p65 on target genes, but also an

indirect effect through IRF1 (Figs. 11A and 11B). In agreement with this interpretation,

nearly complete MHC I/APM reconstitution could be obtained in refractory SK-N-BE(2)

and SK-N-BE(2)c cells through double IRF1/p65 transfection, ERAP2 remaining the only

unresponsive gene (Figs. 11A and 11B). This is reminiscent of experiments in figure 3, in

which IFNγ also failed to up-regulate ERAP2 in SK-N-BE(2) and SK-N-BE(2)c, and

suggests a gene-specific up-regulation defect in these cell lines.

In agreement with the above experiments, optimal recovery of cell surface MHC I

expression could only be observed in double p65/IRF1 transfectants (Fig. 12), conclusively

showing critical dependence of MHC I/APM reactivation on NF-kB/IRF1 synergy,

particularly in certain NB cells with hard-to-rescue APM defects.

49

Figure 11 - IRF1 and p65 synergistically enhance MHC I and APM components in NB cell lines. A,

50

immunoblotting of cell extracts from three NB cell lines left untransfected (none) or single- and double-

transfected, as indicated, with the control empty vector (pcDNA3) or vectors expressing IRF1, IRF2,

and NF-kB p65. ERp57 was used as loading control. B, Densitometric and statistical analysis of WB

bands related to the cells transfected with pcDNA3, or p65, or IRF1 and p65. Data shown in panels A

are representative of 5 independent experiments.

Figure 12 - IRF1 and p65 synergistically enhance surface MHC I expression in NB cell lines. Flow

cytometry analysis of surface MHC I expression in the same NB cell lines (indicated by different colors)

with mAb W6/32. Isotype-matched negative controls are displayed as shaded histograms. Data shown

are representative of 8 independent experiments.

Up-regulation of cell surface MHC I expression with IRF1 and

NF-kB p65 renders NB cells susceptible to antigen specific CTLs

NB cells are not susceptible to tumor antigen-specific CTLs because of their very

low MHC I expression (Raffaghello 2005). Hence, we sought to determine whether an

increase in cell surface MHC I expression by IRF1 and p65 would render NB cells

susceptible to antigen-specific T-cell cytotoxicity.

To this end, the three NB cell lines tested above, i.e. SH-SY5Y, SK-N-BE(2) and

SK-N-BE(2)c, were evaluated by RT-PCR for the expression of the well-known tumor-

antigen coding genes MAGE-A1, MAGE-A3, MART-1 and NY-ESO-1 (Fig. 13A). Three

51

antigens (MAGE-A1, MART-1 and NY-ESO-1) were not detectable. Absence of MART-1

in NB is not surprising in light of a previous study (Corrias 1996). Only MAGE-A3 was

highly expressed in the HLA-A1+ SH-SY5Y cell line (Fig. 13A, 13B). Therefore, SH-

SY5Y cells treated with IFNγ, or transfected with IRF1 and/or p65 were tested in a

standard 51Cr release assay as targets of HLA-A1-restricted CTL specific for MAGE-A3-

encoded peptide EVDPIGHLY (Fontana 2009). CTLs did not lyse the HLA class I-

negative melanoma cell line MSR3-mel and SH-SY5Y cells transfected with an empty

vector, but lysed efficiently, and approximately to the same extent, the MAGE-A3+ HLA-

A1+ melanoma cell line ET-1, SH-SY5Y cells treated with IFNγ, and SH-SY5Y cells co-

transfected with IRF1 and p65 (Figs. 13B, 14A, 14B). Conversely, SH-SY5Y single-

transfected with IRF1 or p65 were lysed at lower efficiency as compared to SH-SY5Y

double-transfected cells (Figs. 14A and 14B). These lytic effects are entirely due to MHC-I

rescue, since IRF1 and/or p65 transfections did not alter the expression of MAGE-A3 (Fig.

13B)

Altogether, these data provide the proof of principle that the efficacy of T cell-

based immunotherapy of NB may be improved by enhancing cell surface MHC I

expression with IRF1 and NFkB p65.

52

Figure 13 – Expression of tumor antigens in NB cell lines. A, RT-PCR analysis of tumor antigens in

NB cell lines. The melanoma cell line HO-1 was included as positive control. GAPDH gene expression

was used for normalization. B, RT-PCR analysis of MAGE-A3 in the SH-SY5Y either untransfected

(none) and transfected with IRF1 and/or the NF-kB p65 subunit and the control empty vector

(pcDNA3). Total mRNA was extracted from the transfected cells, reverse transcribed and cDNAs

amplified with specific primers for MAGE-A3. GAPDH gene was used for normalization. Data shown

in A and B are representative of 3 experiments.

53

Figure 14 - Double IRF1/p65 transfection renders NB cells susceptible to killing by specific cytotoxic

T cells. A, the SH-SY5Y cell line (5Y) grown in the presence of IFNγ (5Y-IFNγ) for 48 hours or co-

transfected with IRF1 (5Y-IRF1) and the NF-kB p65 subunit (5Y-IRF1-p65, and 5Y-p65 respectively) or

empty vector (5Y-pcDNA3) was assayed as targets to HLA-A1-restricted/MAGE-A3-specific CTLs at

the indicated effector:target (E:T) ratios in a standard 51Cr-release assay. B, MHC I expression was

assayed by flow cytometry to verify the efficiency of transfection. Statistically significant differences are

indicated (*, P,0.002, **, P,0.0000002). Mean +/- SD of three experiments is shown. Data shown in A

and B are representative of 3 experiments.

54

DISCUSSION

Restoration of Antigen processing and presentation in NB

Antigen processing and presentation have a fundamental role in the activation of an

immune response against tumor cells. Most tumor, including NB, display defective

expression of the MHC I antigen processing and presentation components, thereby evading

the immune surveillance. Genetic defects and aberrant expression of specific transcription

factors have been identified as principal determinants of the low immunogenic activity of

tumor cells. NB is the human tumor in which MHC I-low phenotypes have the highest

prevalence and most closely correlate with molecular determinants of aggressiveness

(Feltner1989). However, in NB tumors the transcriptional mechanism leading to inefficient

expression of the MHC I antigen processing and presentation pathway needs to be

elucidated.

In this study, we used NB cell lines representative of distinct NB molecular classes

to identify impaired steps of MHC I antigen presentation, and to correct them.

We confirm that NF-kB is the master regulator of constitutive MHC I expression in

NB, but, in addition, we show that it is a poor inducer of some APM components in NB

cells with aggressive features and low MHC I expression. However, these cells are

particular susceptible to IFNγ up-regulation as demonstrated by the elective IFNγ-mediated

MHC I up-regulation and by the induction of both IRF1 and its inhibitor IRF2. These

results suggest a full-fledged activation-extinction signaling loop. Accordingly, IRF1 is

absolutely necessary to obtain a full rescue of antigen-presenting molecules in these MHC

I-low cells.

MHC I reconstitution requires synergy between IRF1 and NF-kB, since IRF1

(either alone or in combination with IRF2) is substantially inactive. This finding places

IRF1 on a hierarchically lower position than NF-kB. Nevertheless, IRF1 also appears to be

crucial. Without it, large sections of the antigen processing and presentation cascade are

impaired.

55

IRF1 has long been known to be a major IFNγ-induced mediator of MHC I up-

regulation in tumors, including NB (Corrias 2001). However, a direct effect on MHC I and

APM has never been demonstrated, to our knowledge, by direct reconstitution with IRF1.

Herein, we identify IRF1 as a crucial coordinator of APM up-regulation. In our hands,

IRF1 and NF-kB synergize in enhancing MHC I, β2m, TAP1, TAP2, ERAP1, ERAP2, and

tapasin, which are structural MHC I subunits, dedicated peptide translocators, trimmers,

editors, and chaperones.

Along the same line, IRF1, NF-kB p65, and MHC I are coordinately expressed in

vivo in tumor lesions, their nuclear absence and presence neatly segregating between high-

grade and low-grade NB, respectively. Altogether, these findings suggest that linked

suppression of genes collaborating in antigen processing and presentation in aggressive NB

depends, in vivo as well as in vitro, on epistatic repression mainly acting on IRF-1 and NF-

kB. Downstream correction of the stoichiometric insufficiency of IRF1 and NF-kB restores

the presentation of tumor antigens in a model NB cell line, providing the proof of principle

that complex immune escape phenotypes can be rescued by a limited number of master

genes, and that NB can be made sensitive to CTLs that otherwise would be unable to

recognize expressed, endogenous NB tumor antigens. To our knowledge, this is the first

complete reconstitution of the MHC I antigen-processing pathway in a tumor model by

reintegration of a limited number of transcription factors, and not through treatment with

pleiotropic cytokines or a mixture of undefined constituents. It is remarkable that at least in

some NB cell lines MHC I/APM defects are fully reversible, and that, in the limited cell

panel studied by us, NF-kB and IRF1 are as good as IFNγ in rescuing low expression.

Our inability to correct ERAP2-low phenotypes in certain cells also suggests that

extending the panel of NB cell lines and tissues is likely to reveal additional requirements.

Further studies are necessary to test the percentage of NB tumors that can be rescued by

double NF-kB/IRF1 reconstitution. It will be of interest to identify the master regulators

that are still missing to achieve step-by-step, full reconstitution of the antigen presentation

pathway in as many NB tumors as possible.

ERAP1 and ERAP2 trim peptide antigens to a size that fits the MHC I antigen-

binding groove. Whereas interference with the mouse homologue of ERAP1 has been

56

shown to drastically alter tumor recognition by both T and NK cells (Cifaldi 2011),

ERAP2 has no known mouse homologue, is less tightly coordinated with MHC I (Fruci

2006; Fruci2008) in vitro and in vivo, and is believe in vitro to have a more specialized role

than ERAP1, i.e. ERAP2 only trims a limited subset of peptide antigens. Therefore,

whereas of interest in light of the specialized role and regulation of ERAP2, the selective

nonrescuability of this aminopeptidase in some NB cell lines is not expected to affect the

processing of most antigens, including tumor antigens.

The present results support the original suggestion that MHC I and APM

components act as a coordinome with core and peripheral (gene-specific) control features,

and a hierarchy of control steps (Giorda 2003). Rescue of tumor antigen presentation on

the whole by a limited number of transactivators will hopefully provide impetus to search

for NB antigens to be used as immunotherapeutic targets, and to design small molecules to

selectively manipulate the expression of NF-kB and IRF1 transcription factors, and target

their activity to tumor cells. Indeed, antineoplastic effects of small molecule inhibitors

targeting a single transcription factor (the late SV40 factor) have been preliminary reported

(Santhekadur 2012). It is hoped that antigen-specific immunotherapy (altogether one of the

safest therapeutic approaches in oncology) may be more successful in early childhood, in

the unexplored context of the very plastic immune system of the infant.

Innate immunity recognition of NB

Of interest, the role of IRF1 and NF-kB as regulators of activating ligands for NK

cells receptors is well known. In particular it has been demonstrated that, in a mouse model

of pulmonary metastasis, IRF1 mediates elimination of tumor cells through the induction

of activating ligands DR5 and CD155 (Ksienzyk A 2011). Shetty et al. also demonstrated

that NF-kB is the activator, in cooperation with p53, of the activating ligand DR5 (Shetty

2005). Based on this findings, we are currently studying the effects of IRF1 and NF-kB in

the regulation of expression of a number of activating ligands in NB cell lines. Preliminary

data identify NF-kB as the predominant regulator of some activating ligands, improving

the recognition and lysis of NB cells by NK cells; anyway further studies are needed to

confirm these results.

57

All together, these results prove that the most aggressive form of NB, restored for

the expression of IRF1 and NF-kB, can be recognized and lysed by cells of both innate and

adaptative immunity. Further studies to find drugs capable of modulating these two

transcription factors will result in a successful immunotherapy for NB.

58

REFERENCES

Abele, R. and Tampé, R. (2004). The ABCs of immunology: structure and function of TAP, the transporter associated with antigen processing. Physiology (Bethesda) 19, 216-224.

Ahmad, M., Rees, RC. and Ali, SA. (2004). Escape from immunotherapy: possible mechanisms that influence tumor regression/progression. Cancer Immunol. Immunother. 53, 844-854.

Airoldi, I., Lualdi, S., Bruno, S. et al. (2003). Expression of costimulatory molecules in human neuroblastoma. Evidence that CD40+ neuroblastoma cells undergo apoptosis following interaction with CD40L. Br. J. Cancer 88, 1527-1536.

Alberts, P., Daumke, O., Deverson, EV. et al. (2001). Distinct functional properties of the TAP subunits coordinate the nucleotide-dependent transport cycle. Curr. Biol. 11, 242-251.

Andrés, AM., Dennis, MY., Kretzschmar, WW. et al. (2010). Balancing selection maintains a form of ERAP2 that undergoes nonsense-mediated decay and affects antigen presentation. PLoS Genet. 6, e1001157.

Aptsiauri, N., Cabrera, T., Mendez, R. et al. (2007). Role of altered expression of HLA class I molecules in cancer progression. Adv. Exp. Med. Biol. 601, 123-131.

Bach, EA., Aguet, M. and Schreiber, RD. (1997). The IFN gamma receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15, 563-591.

Baeuerle, PA. and Henkel, T. (1994). Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 12, 141-179.

Bauer, S., Groh, V., Wu, J. et al. (1999). Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285, 727-729.

Bicknell, DC., Rowan, A. and Bodmer, WF. (1994). Beta 2-microglobulin gene mutations: a study of established colorectal cell lines and fresh tumors. Proc. Natl. Acad. Sci. U.S.A. 91, 4751-4755.

Bin, Q., Johnson, BD., Schauer, DW. et al. (2002). Production of macrophage migration inhibitory factor by human and murine neuroblastoma. Tumour Biol. 23, 123-129.

Blanchard, N., Kanaseki, T., Escobar, H. et al. (2010). Endoplasmic reticulum aminopeptidase associated with antigen processing defines the composition and structure of MHC class I peptide repertoire in normal and virus-infected cells. J. Immunol. 184, 3033-3042.

59

Bochtler, M., Ditzel, L., Groll, M. et al. (1999). The proteasome. Annu Rev Biophys Biomol Struct 28, 295-317.

Boehm, U., Klamp, T., Groot, M. et al. (1997). Cellular responses to interferon-gamma . Annu. Rev. Immunol. 15, 749-795.

Braud, VM., Allan, DS. and McMichael, AJ. (1999). Functions of nonclassical MHC and non-MHC-encoded class I molecules. Curr. Opin. Immunol. 11, 100-108.

Brodeur, GM. (1995). Molecular basis for heterogeneity in human neuroblastomas. Eur J Cancer 31A, 505-510.

Brodeur, GM. (2003). Neuroblastoma: biological insights into a clinical enigma. Nat. Rev. Cancer 3, 203-216.

Brodeur, GM., Green, AA., Hayes, FA. et al. (1981). Cytogenetic features of human neuroblastomas and cell lines. Cancer Res. 41, 4678-4686.

Brodeur, GM., Seeger, RC., Schwab, M. et al. (1984). Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 224, 1121-1124.

Brodeur, GM., Sekhon, G. and Goldstein, MN. (1977). Chromosomal aberrations in human neuroblastomas. Cancer 40, 2256-2263.

Brouwenstijn, N., Serwold, T. and Shastri, N. (2001). MHC class I molecules can direct proteolytic cleavage of antigenic precursors in the endoplasmic reticulum. Immunity 15, 95-104.

Burnet, FM. (1970). The concept of immunological surveillance. Prog Exp Tumor Res 13, 1-27.

Cabrera, CM. (2007). The double role of the endoplasmic reticulum chaperone tapasin in peptide optimization of HLA class I molecules. Scand. J. Immunol. 65, 487-493.

Caron, H., van Sluis, P., de Kraker, J. et al. (1996). Allelic loss of chromosome 1p as a predictor of unfavorable outcome in patients with neuroblastoma. N. Engl. J. Med. 334, 225-230.

Caron, H., van Sluis, P., van Hoeve, M. et al. (1993). Allelic loss of chromosome 1p36 in neuroblastoma is of preferential maternal origin and correlates with N-myc amplification. Nat. Genet. 4, 187-190.

Cascio, P., Hilton, C., Kisselev, AF. et al. (2001). 26S proteasomes and immunoproteasomes produce mainly N-extended versions of an antigenic peptide. EMBO J. 20, 2357-2366.

Cerundolo, V., Kelly, A., Elliott, T. et al. (1995). Genes encoded in the major histocompatibility complex affecting the generation of peptides for TAP transport. Eur. J.

60

Immunol. 25, 554-562.

Chambers, JE., Jessop, CE. and Bulleid, NJ. (2008). Formation of a major histocompatibility complex class I tapasin disulfide indicates a change in spatial organization of the peptide-loading complex during assembly. J. Biol. Chem. 283, 1862-1869.

Chan, HS., Gallie, BL., DeBoer, G. et al. (1997). MYCN protein expression as a predictor of neuroblastoma prognosis. Clin. Cancer Res. 3, 1699-1706.

Chang, S., Momburg, F., Bhutani, N. et al. (2005). The ER aminopeptidase, ERAP1, trims precursors to lengths of MHC class I peptides by a "molecular ruler" mechanism. Proc. Natl. Acad. Sci. U.S.A. 102, 17107-17112.

Cifaldi, L., Lo Monaco, E., Forloni, M. et al. (2011). Natural killer cells efficiently reject lymphoma silenced for the endoplasmic reticulum aminopeptidase associated with antigen processing. Cancer Res. 71, 1597-1606.

Cifaldi, L., Romania, P., Lorenzi, S. et al. (2012). Role of endoplasmic reticulum aminopeptidases in health and disease: from infection to cancer. Int J Mol Sci 13, 8338-8352.

Cohn, SL., Pearson, ADJ., London, WB. et al. (2009). The International Neuroblastoma Risk Group (INRG) classification system: an INRG Task Force report. J. Clin. Oncol. 27, 289-297.

Cohn, SL., Salwen, H., Quasney, MW. et al. (1990). Prolonged N-myc protein half-life in a neuroblastoma cell line lacking N-myc amplification. Oncogene 5, 1821-1827.

Corrias, MV., Occhino, M., Croce, M. et al. (2001). Lack of HLA-class I antigens in human neuroblastoma cells: analysis of its relationship to TAP and tapasin expression. Tissue Antigens 57, 110-117.

Corrias, MV., Scaruffi, P., Occhino, M. et al. (1996). Expression of MAGE-1, MAGE-3 and MART-1 genes in neuroblastoma. Int. J. Cancer 69, 403-407.

Cosman, D., Müllberg, J., Sutherland, CL. et al. (2001). ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 14, 123-133.

Cresswell, P., Ackerman, AL., Giodini, A. et al. (2005). Mechanisms of MHC class I-restricted antigen processing and cross-presentation. Immunol. Rev. 207, 145-157.

Cunningham, BA. (1977). The structure and function of histocompatibility antigens. Sci. Am. 237, 96-107.

Darnell, JEJ., Kerr, IM. and Stark, GR. (1994). Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264,

61

1415-1421.

Drew, PD., Franzoso, G., Becker, KG. et al. (1995). NF kappa B and interferon regulatory factor 1 physically interact and synergistically induce major histocompatibility class I gene expression. J. Interferon Cytokine Res. 15, 1037-1045.

Drew, PD., Lonergan, M., Goldstein, ME. et al. (1993). Regulation of MHC class I and beta 2-microglobulin gene expression in human neuronal cells. Factor binding to conserved cis-acting regulatory sequences correlates with expression of the genes. J. Immunol. 150, 3300-3310.

Dunn, GP., Bruce, AT., Ikeda, H. et al. (2002). Cancer immunoediting: from immunosurveillance to tumor escape. Nat. Immunol. 3, 991-998.

Dunn, GP., Koebel, CM. and Schreiber, RD. (2006). Interferons, immunity and cancer immunoediting. Nat. Rev. Immunol. 6, 836-848.

Ejeskär, K., Aburatani, H., Abrahamsson, J. et al. (1998). Loss of heterozygosity of 3p markers in neuroblastoma tumours implicate a tumour-suppressor locus distal to the FHIT gene. Br. J. Cancer 77, 1787-1791.

Elliott, T. and Williams, A. (2005). The optimization of peptide cargo bound to MHC class I molecules by the peptide-loading complex. Immunol. Rev. 207, 89-99.

Esteban, F., Concha, A., Huelin, C. et al. (1989). Histocompatibility antigens in primary and metastatic squamous cell carcinoma of the larynx. Int. J. Cancer 43, 436-442.

Evnouchidou, I., Momburg, F., Papakyriakou, A. et al. (2008). The internal sequence of the peptide-substrate determines its N-terminus trimming by ERAP1. PLoS ONE 3, e3658.

Fehling, HJ., Swat, W., Laplace, C. et al. (1994). MHC class I expression in mice lacking the proteasome subunit LMP-7. Science 265, 1234-1237.

Feltner, DE., Cooper, M., Weber, J. et al. (1989). Expression of class I histocompatibility antigens in neuroectodermal tumors is independent of the expression of a transfected neuroblastoma myc gene. J. Immunol. 143, 4292-4299.

Finco, TS. and Baldwin, AS. (1995). Mechanistic aspects of NF-kappa B regulation: the emerging role of phosphorylation and proteolysis. Immunity 3, 263-272.

Firat, E., Saveanu, L., Aichele, P. et al. (2007). The role of endoplasmic reticulum-associated aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178, 2241-2248.

Fong, CT., Dracopoli, NC., White, PS. et al. (1989). Loss of heterozygosity for the short arm of chromosome 1 in human neuroblastomas: correlation with N-myc amplification. Proc. Natl. Acad. Sci. U.S.A. 86, 3753-3757.

62

Fonsatti, E., Sigalotti, L., Coral, S. et al. (2003). Methylation-regulated expression of HLA class I antigens in melanoma. Int. J. Cancer 105, 430-1; author reply 432-3.

Fontana, R., Bregni, M., Cipponi, A. et al. (2009). Peripheral blood lymphocytes genetically modified to express the self/tumor antigen MAGE-A3 induce antitumor immune responses in cancer patients. Blood 113, 1651-1660.

Forloni, M., Albini, S., Limongi, MZ. et al. (2010). NF-kappaB, and not MYCN, regulates MHC class I and endoplasmic reticulum aminopeptidases in human neuroblastoma cells. Cancer Res. 70, 916-924.

Fruci, D., Ferracuti, S., Limongi, MZ. et al. (2006). Expression of endoplasmic reticulum aminopeptidases in EBV-B cell lines from healthy donors and in leukemia/lymphoma, carcinoma, and melanoma cell lines. J. Immunol. 176, 4869-4879.

Fruci, D., Giacomini, P., Nicotra, MR. et al. (2008). Altered expression of endoplasmic reticulum aminopeptidases ERAP1 and ERAP2 in transformed non-lymphoid human tissues. J. Cell. Physiol. 216, 742-749.

Fruci, D., Niedermann, G., Butler, RH. et al. (2001). Efficient MHC class I-independent amino-terminal trimming of epitope precursor peptides in the endoplasmic reticulum. Immunity 15, 467-476.

Garrido, F., Cabrera, T., Concha, A. et al. (1993). Natural history of HLA expression during tumour development. Immunol. Today 14, 491-499.

Gilbert, F., Feder, M., Balaban, G. et al. (1984). Human neuroblastomas and abnormalities of chromosomes 1 and 17. Cancer Res. 44, 5444-5449.

Gilman, AL., Ozkaynak, MF., Matthay, KK. et al. (2009). Phase I study of ch14.18 with granulocyte-macrophage colony-stimulating factor and interleukin-2 in children with neuroblastoma after autologous bone marrow transplantation or stem-cell rescue: a report from the Children's Oncology Group. J. Clin. Oncol. 27, 85-91.

Giorda, E., Sibilio, L., Martayan, A. et al. (2003). The antigen processing machinery of class I human leukocyte antigens: linked patterns of gene expression in neoplastic cells. Cancer Res. 63, 4119-4127.

Glickman, MH. and Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol. Rev. 82, 373-428.

Gobin, SJ., Keijsers, V., van Zutphen, M. et al. (1998). The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor kappa B. J. Immunol. 161, 2276-2283.

Gobin, SJ., Peijnenburg, A., Keijsers, V. et al. (1997). Site alpha is crucial for two routes of IFN gamma-induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA. Immunity 6, 601-611.

63

Gobin, SJ., van Zutphen, M., Westerheide, SD. et al. (2001). The MHC-specific enhanceosome and its role in MHC class I and beta(2)-microglobulin gene transactivation. J. Immunol. 167, 5175-5184.

Gobin, SJ., van Zutphen, M., Woltman, AM. et al. (1999). Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. J. Immunol. 163, 1428-1434.

Gray, JC. and Kohler, JA. (2009). Immunotherapy for neuroblastoma: turning promise into reality. Pediatr Blood Cancer 53, 931-940.

Groh, V., Bahram, S., Bauer, S. et al. (1996). Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium. Proc. Natl. Acad. Sci. U.S.A. 93, 12445-12450.

Guo, C., White, PS., Weiss, MJ. et al. (1999). Allelic deletion at 11q23 is common in MYCN single copy neuroblastomas. Oncogene 18, 4948-4957.

Hammer, GE., Gonzalez, F., Champsaur, M. et al. (2006). The aminopeptidase ERAAP shapes the peptide repertoire displayed by major histocompatibility complex class I molecules. Nat. Immunol. 7, 103-112.

Hammer, GE., Gonzalez, F., James, E. et al. (2007). In the absence of aminopeptidase ERAAP, MHC class I molecules present many unstable and highly immunogenic peptides. Nat. Immunol. 8, 101-108.

Hammer, GE., Kanaseki, T. and Shastri, N. (2007). The final touches make perfect the peptide-MHC class I repertoire. Immunity 26, 397-406.

Hattori, A., Matsumoto, H., Mizutani, S. et al. (1999). Molecular cloning of adipocyte-derived leucine aminopeptidase highly related to placental leucine aminopeptidase/oxytocinase. J Biochem 125, 931-938.

Hayden, MS. and Ghosh, S. (2011). NF-κB in immunobiology. Cell Res. 21, 223-244.

Hicklin, DJ., Wang, Z., Arienti, F. et al. (1998). beta2-Microglobulin mutations, HLA class I antigen loss, and tumor progression in melanoma. J. Clin. Invest. 101, 2720-2729.

Higgins, CF. (1992). ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8, 67-113.

Johnson, DR. (2003). Locus-specific constitutive and cytokine-induced HLA class I gene expression. J. Immunol. 170, 1894-1902.

Khan, ANH., Gregorie, CJ. and Tomasi, TB. (2008). Histone deacetylase inhibitors induce TAP, LMP, Tapasin genes and MHC class I antigen presentation by melanoma cells. Cancer Immunol. Immunother. 57, 647-654.

64

Khan, S., van den Broek, M., Schwarz, K. et al. (2001). Immunoproteasomes largely replace constitutive proteasomes during an antiviral and antibacterial immune response in the liver. J. Immunol. 167, 6859-6868.

Koch, J., Guntrum, R., Heintke, S. et al. (2004). Functional dissection of the transmembrane domains of the transporter associated with antigen processing (TAP). J. Biol. Chem. 279, 10142-10147.

La Quaglia, MP. (2001). Surgical management of neuroblastoma. Semin. Pediatr. Surg. 10, 132-139.

Lampson, LA. and George, DL. (1986). Interferon-mediated induction of class I MHC products in human neuronal cell lines: analysis of HLA and beta 2-m RNA, and HLA-A and HLA-B proteins and polymorphic specificities. J. Interferon Res. 6, 257-265.

Lampson, LA. and Whelan, JP. (1983). Paucity of HLA-A,B,C molecules on human cells of neuronal origin: microscopic analysis of neuroblastoma cell lines and tumor. Ann. N. Y. Acad. Sci. 420, 107-114.

Lauvau, G., Kakimi, K., Niedermann, G. et al. (1999). Human transporters associated with antigen processing (TAPs) select epitope precursor peptides for processing in the endoplasmic reticulum and presentation to T cells. J. Exp. Med. 190, 1227-1240.

Le Bouteiller, P. (1994). HLA class I chromosomal region, genes, and products: facts and questions. Crit. Rev. Immunol. 14, 89-129.

Lee, N., Ishitani, A. and Geraghty, DE. (2010). HLA-F is a surface marker on activated lymphocytes. Eur. J. Immunol. 40, 2308-2318.

Lehner, PJ. and Cresswell, P. (1996). Processing and delivery of peptides presented by MHC class I molecules. Curr. Opin. Immunol. 8, 59-67.

Lesinski, GB., Zimmerer, JM., Kreiner, M. et al. (2010). Modulation of SOCS protein expression influences the interferon responsiveness of human melanoma cells. BMC Cancer 10, 142.

Little, AM. and Parham, P. (1999). Polymorphism and evolution of HLA class I and II genes and molecules. Rev Immunogenet 1, 105-123.

Liu, Q., Hao, C., Su, P. et al. (2009). Down-regulation of HLA class I antigen-processing machinery components in esophageal squamous cell carcinomas: association with disease progression. Scand. J. Gastroenterol. 44, 960-969.

Longo, L., Panza, E., Schena, F. et al. (2007). Genetic predisposition to familial neuroblastoma: identification of two novel genomic regions at 2p and 12p. Hum. Hered. 63, 205-211.

López-Nevot, MA., Esteban, F., Ferrón, A. et al. (1989). HLA class I gene expression on

65

human primary tumours and autologous metastases: demonstration of selective losses of HLA antigens on colorectal, gastric and laryngeal carcinomas. Br. J. Cancer 59, 221-226.

Lou, Y., Vitalis, TZ., Basha, G. et al. (2005). Restoration of the expression of transporters associated with antigen processing in lung carcinoma increases tumor-specific immune responses and survival. Cancer Res. 65, 7926-7933.

Loukissa, A., Cardozo, C., Altschuller-Felberg, C. et al. (2000). Control of LMP7 expression in human endothelial cells by cytokines regulating cellular and humoral immunity. Cytokine 12, 1326-1330.

Maleno, I., Cabrera, CM., Cabrera, T. et al. (2004). Distribution of HLA class I altered phenotypes in colorectal carcinomas: high frequency of HLA haplotype loss associated with loss of heterozygosity in chromosome region 6p21. Immunogenetics 56, 244-253.

Maleno, I., Romero, JM., Cabrera, T. et al. (2006). LOH at 6p21.3 region and HLA class I altered phenotypes in bladder carcinomas. Immunogenetics 58, 503-510.

Mamane, Y., Heylbroeck, C., Génin, P. et al. (1999). Interferon regulatory factors: the next generation. Gene 237, 1-14.

Maris, JM. (2010). Recent advances in neuroblastoma. N. Engl. J. Med. 362, 2202-2211.

Maris, JM. and Matthay, KK. (1999). Molecular biology of neuroblastoma. J. Clin. Oncol. 17, 2264-2279.

Maris, JM., Weiss, MJ., Guo, C. et al. (2000). Loss of heterozygosity at 1p36 independently predicts for disease progression but not decreased overall survival probability in neuroblastoma patients: a Children's Cancer Group study. J. Clin. Oncol. 18, 1888-1899.

Maris, JM., White, PS., Beltinger, CP. et al. (1995). Significance of chromosome 1p loss of heterozygosity in neuroblastoma. Cancer Res. 55, 4664-4669.

Marshall, B., Isidro, G., Martins, AG. et al. (1997). Loss of heterozygosity at chromosome 9p21 in primary neuroblastomas: evidence for two deleted regions. Cancer Genet. Cytogenet. 96, 134-139.

Matthay, KK., George, RE. and Yu, AL. (2012). Promising therapeutic targets in neuroblastoma. Clin. Cancer Res. 18, 2740-2753.

Matthay, KK., O'Leary, MC., Ramsay, NK. et al. (1995). Role of myeloablative therapy in improved outcome for high risk neuroblastoma: review of recent Children's Cancer Group results. Eur J Cancer 31A, 572-575.

Miller, CHT., Maher, SG. and Young, HA. (2009). Clinical Use of Interferon-gamma. Ann. N. Y. Acad. Sci. 1182, 69-79.

66

Miyamoto, S. and Verma, IM. (1995). Rel/NF-kappa B/I kappa B story. Adv. Cancer Res. 66, 255-292.

Modak, S. and Cheung, NV. (2010). Neuroblastoma: Therapeutic strategies for a clinical enigma. Cancer Treat. Rev. 36, 307-317.

Moretta, A., Bottino, C., Vitale, M. et al. (2001). Activating receptors and coreceptors involved in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19, 197-223.

Nagarajan, NA., Gonzalez, F. and Shastri, N. (2012). Nonclassical MHC class Ib-restricted cytotoxic T cells monitor antigen processing in the endoplasmic reticulum. Nat. Immunol. 13, 579-586.

Neefjes, JJ., Momburg, F. and Hämmerling, GJ. (1993). Selective and ATP-dependent translocation of peptides by the MHC-encoded transporter. Science 261, 769-771.

Ogino, T., Shigyo, H., Ishii, H. et al. (2006). HLA class I antigen down-regulation in primary laryngeal squamous cell carcinoma lesions as a poor prognostic marker. Cancer Res. 66, 9281-9289.

Ohnishi, K. (1983). Domain structures of cell surface glycopeptides encoded by class I and class II beta genes of the major histocompatibility complex. Nucleic Acids Symp. Ser. , 91-94.

Ortmann, B., Copeman, J., Lehner, PJ. et al. (1997). A critical role for tapasin in the assembly and function of multimeric MHC class I-TAP complexes. Science 277, 1306-1309.

Otto, T., Horn, S., Brockmann, M. et al. (2009). Stabilization of N-Myc is a critical function of Aurora A in human neuroblastoma. Cancer Cell 15, 67-78.

Park, JR., Eggert, A. and Caron, H. (2010). Neuroblastoma: biology, prognosis, and treatment. Hematol. Oncol. Clin. North Am. 24, 65-86.

Paun, A. and Pitha, PM. (2007). The IRF family, revisited. Biochimie 89, 744-753.

Pende, D., Rivera, P., Marcenaro, S. et al. (2002). Major histocompatibility complex class I-related chain A and UL16-binding protein expression on tumor cell lines of different histotypes: analysis of tumor susceptibility to NKG2D-dependent natural killer cell cytotoxicity. Cancer Res. 62, 6178-6186.

Pule, MA., Savoldo, B., Myers, GD. et al. (2008). Virus-specific T cells engineered to coexpress tumor-specific receptors: persistence and antitumor activity in individuals with neuroblastoma. Nat. Med. 14, 1264-1270.

Raffaghello, L., Prigione, I., Airoldi, I. et al. (2004). Downregulation and/or release of NKG2D ligands as immune evasion strategy of human neuroblastoma. Neoplasia 6, 558-

67

568.

Raffaghello, L., Prigione, I., Bocca, P. et al. (2005). Multiple defects of the antigen-processing machinery components in human neuroblastoma: immunotherapeutic implications. Oncogene 24, 4634-4644.

Reale, MA., Reyes-Mugica, M., Pierceall, WE. et al. (1996). Loss of DCC expression in neuroblastoma is associated with disease dissemination. Clin. Cancer Res. 2, 1097-1102.

Reith, W. and Mach, B. (2001). The bare lymphocyte syndrome and the regulation of MHC expression. Annu. Rev. Immunol. 19, 331-373.

Restifo, NP., Esquivel, F., Kawakami, Y. et al. (1993). Identification of human cancers deficient in antigen processing. J. Exp. Med. 177, 265-272.

Rivoltini, L., Arienti, F., Orazi, A. et al. (1992). Phenotypic and functional analysis of lymphocytes infiltrating paediatric tumours, with a characterization of the tumour phenotype. Cancer Immunol. Immunother. 34, 241-251.

Rock, KL. and Goldberg, AL. (1999). Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17, 739-779.

Rock, KL., Gramm, C., Rothstein, L. et al. (1994). Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78, 761-771.

Rossig, C., Bollard, CM., Nuchtern, JG. et al. (2002). Epstein-Barr virus-specific human T lymphocytes expressing antitumor chimeric T-cell receptors: potential for improved immunotherapy. Blood 99, 2009-2016.

Rossig, C., Bollard, CM., Nuchtern, JG. et al. (2001). Targeting of G(D2)-positive tumor cells by human T lymphocytes engineered to express chimeric T-cell receptor genes. Int. J. Cancer 94, 228-236.

Rubie, H., Delattre, O., Hartmann, O. et al. (1997). Loss of chromosome 1p may have a prognostic value in localised neuroblastoma: results of the French NBL 90 Study. Neuroblastoma Study Group of the Société Française d'Oncologie Pédiatrique (SFOP). Eur J Cancer 33, 1917-1922.

Ruiz-Cabello, F., Lopez Nevot, MA., Gutierrez, J. et al. (1989). Phenotypic expression of histocompatibility antigens in human primary tumours and metastases. Clin. Exp. Metastasis 7, 213-226.

Santhekadur, PK., Gredler, R., Chen, D. et al. (2012). Late SV40 factor (LSF) enhances angiogenesis by transcriptionally up-regulating matrix metalloproteinase-9 (MMP-9). J. Biol. Chem. 287, 3425-3432.

Saric, T., Chang, S., Hattori, A. et al. (2002). An IFN-gamma-induced aminopeptidase in

68

the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3, 1169-1176.

Sarkar, AK. and Nuchtern, JG. (2000). Lysis of MYCN-amplified neuroblastoma cells by MYCN peptide-specific cytotoxic T lymphocytes. Cancer Res. 60, 1908-1913.

Saveanu, L., Carroll, O., Lindo, V. et al. (2005). Concerted peptide trimming by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum. Nat. Immunol. 6, 689-697.

Savitsky, D., Tamura, T., Yanai, H. et al. (2010). Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer Immunol. Immunother. 59, 489-510.

Schindler, C. and Darnell, JEJ. (1995). Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64, 621-651.

Schreiber, RD., Old, LJ. and Smyth, MJ. (2011). Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 331, 1565-1570.

Seeger, RC., Brodeur, GM., Sather, H. et al. (1985). Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N. Engl. J. Med. 313, 1111-1116.

Seeger, RC., Wada, R., Brodeur, GM. et al. (1988). Expression of N-myc by neuroblastomas with one or multiple copies of the oncogene. Prog. Clin. Biol. Res. 271, 41-49.

Seliger, B. (2008). Molecular mechanisms of MHC class I abnormalities and APM components in human tumors. Cancer Immunol. Immunother. 57, 1719-1726.

Seliger, B. (2012). Novel insights into the molecular mechanisms of HLA class I abnormalities. Cancer Immunol. Immunother. 61, 249-254.

Seliger, B., Papadileris, S., Vogel, D. et al. (1996). Analysis of the p53 and MDM-2 gene in acute myeloid leukemia. Eur. J. Haematol. 57, 230-240.

Seliger, B., Schreiber, K., Delp, K. et al. (2001). Downregulation of the constitutive tapasin expression in human tumor cells of distinct origin and its transcriptional upregulation by cytokines. Tissue Antigens 57, 39-45.

Sen, R. and Baltimore, D. (1986). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46, 705-716.

Serwold, T., Gonzalez, F., Kim, J. et al. (2002). ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature 419, 480-483.

Shankaran, V., Ikeda, H., Bruce, AT. et al. (2001). IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 410, 1107-1111.

69

Shen, Y., Xia, M., Zhang, J. et al. (2009). IRF-1 and p65 mediate upregulation of constitutive HLA-A antigen expression by hepatocellular carcinoma cells. Mol. Immunol. 46, 2045-2053.

Shimada, H., Ambros, IM., Dehner, LP. et al. (1999). Terminology and morphologic criteria of neuroblastic tumors: recommendations by the International Neuroblastoma Pathology Committee. Cancer 86, 349-363.

Singer, DS. and Maguire, JE. (1990). Regulation of the expression of class I MHC genes . Crit. Rev. Immunol. 10, 235-257.

Sivori, S., Parolini, S., Marcenaro, E. et al. (2000). Involvement of natural cytotoxicity receptors in human natural killer cell-mediated lysis of neuroblastoma and glioblastoma cell lines. J. Neuroimmunol. 107, 220-225.

Slavc, I., Ellenbogen, R., Jung, WH. et al. (1990). myc gene amplification and expression in primary human neuroblastoma. Cancer Res. 50, 1459-1463.

Soong, TW. and Hui, KM. (1992). Locus-specific transcriptional control of HLA genes. J. Immunol. 149, 2008-2020.

Spies, T. and DeMars, R. (1991). Restored expression of major histocompatibility class I molecules by gene transfer of a putative peptide transporter. Nature 351, 323-324.

Srivatsan, ES., Ying, KL. and Seeger, RC. (1993). Deletion of chromosome 11 and of 14q sequences in neuroblastoma. Genes Chromosomes Cancer 7, 32-37.

Tanaka, K. and Kasahara, M. (1998). The MHC class I ligand-generating system: roles of immunoproteasomes and the interferon-gamma-inducible proteasome activator PA28. Immunol. Rev. 163, 161-176.

Taniguchi, T., Ogasawara, K., Takaoka, A. et al. (2001). IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19, 623-655.

Tanioka, T., Hattori, A., Masuda, S. et al. (2003). Human leukocyte-derived arginine aminopeptidase. The third member of the oxytocinase subfamily of aminopeptidases. J. Biol. Chem. 278, 32275-32283.

Tao, J., Yang, J., Wang, L. et al. (2008). Expression of GLUT-1 in psoriasis and the relationship between GLUT-1 upregulation induced by hypoxia and proliferation of keratinocyte growth. J. Dermatol. Sci. 51, 203-207.

Thanos, D. and Maniatis, T. (1995). NF-kappa B: a lesson in family values. Cell 80, 529-532.

Thiele, CJ., Reynolds, CP. and Israel, MA. (1985). Decreased expression of N-myc precedes retinoic acid-induced morphological differentiation of human neuroblastoma. Nature 313, 404-406.

70

van den Elsen, PJ., Gobin, SJ., van Eggermond, MC. et al. (1998). Regulation of MHC class I and II gene transcription: differences and similarities. Immunogenetics 48, 208-221.

van den Elsen, PJ., Holling, TM., Kuipers, HF. et al. (2004). Transcriptional regulation of antigen presentation. Curr. Opin. Immunol. 16, 67-75.

van Endert, P. (2011). Post-proteasomal and proteasome-independent generation of MHC class I ligands. Cell. Mol. Life Sci. 68, 1553-1567.

van Endert, PM., Tampé, R., Meyer, TH. et al. (1994). A sequential model for peptide binding and transport by the transporters associated with antigen processing. Immunity 1, 491-500.

Van Roy, N., Laureys, G., Van Gele, M. et al. (1997). Analysis of 1;17 translocation breakpoints in neuroblastoma: implications for mapping of neuroblastoma genes. Eur J Cancer 33, 1974-1978.

Wake, CT. (1986). Molecular biology of the HLA class I and class II genes. Mol. Biol. Med. 3, 1-11.

Westermann, F., Muth, D., Benner, A. et al. (2008). Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas. Genome Biol. 9, R150.

Wetzler, M., Baer, MR., Stewart, SJ. et al. (2001). HLA class I antigen cell surface expression is preserved on acute myeloid leukemia blasts at diagnosis and at relapse. Leukemia 15, 128-133.

Wölfl, M., Jungbluth, AA., Garrido, F. et al. (2005). Expression of MHC class I, MHC class II, and cancer germline antigens in neuroblastoma. Cancer Immunol. Immunother. 54, 400-406.

Yan, J., Parekh, VV., Mendez-Fernandez, Y. et al. (2006). In vivo role of ER-associated peptidase activity in tailoring peptides for presentation by MHC class Ia and class Ib molecules. J. Exp. Med. 203, 647-659.

Yewdell, JW., Reits, E. and Neefjes, J. (2003). Making sense of mass destruction: quantitating MHC class I antigen presentation. Nat. Rev. Immunol. 3, 952-961.

York, IA., Brehm, MA., Zendzian, S. et al. (2006). Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims MHC class I-presented peptides in vivo and plays an important role in immunodominance. Proc. Natl. Acad. Sci. U.S.A. 103, 9202-9207.

York, IA., Chang, S., Saric, T. et al. (2002). The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8-9 residues. Nat. Immunol. 3, 1177-1184.

Zhou, F. (2009). Molecular mechanisms of IFN-gamma to up-regulate MHC class I

71

antigen processing and presentation. Int. Rev. Immunol. 28, 239-260.

Łastowska, M., Cotterill, S., Bown, N. et al. (2002). Breakpoint position on 17q identifies the most aggressive neuroblastoma tumors. Genes Chromosomes Cancer 34, 428-436.

72