Investigating mRNA Sequence Features That Regulate Nuclear ... · chromosome architecture and/or 3)...

Investigating mRNA Sequence Features That Regulate Nuclear Export

by

Abdalla Mahmoud Akef

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Biochemistry University of Toronto

© Copyright by Abdalla Mahmoud Akef 2016

ii

Investigating mRNA Sequence Features That Regulate Nuclear

Export

Abdalla Mahmoud Akef

Doctor of Philosophy

Department of Biochemistry University of Toronto

2016

Abstract In eukaryotes, the nucleus divides the cell into two compartments: the nucleoplasm, where RNA

is synthesized, processed and packaged, and the cytoplasm, where mature mRNA is translated

into proteins. The mechanisms that determine whether an mRNA should be exported from the

nucleus to the cytoplasm are poorly understood. The best established model postulated that

mRNAs need to be spliced or to contain nuclear export-promoting sequences so as to be

efficiently transported to the cytoplasm. However, this model suffered several problems since it

was known that many intronless mRNAs are efficiently exported to the cytoplasm independently

of splicing and they do not contain any known nuclear export-promoting sequences. In this

thesis, I sought to dissect the sequence features within a transcript that determine its cellular

localization. I discovered that intronless β-Globin (βG) mRNA contains a nuclear retention

element that inhibits its transport to the cytoplasm. This nuclear retention element can be

overcome when βG mRNA is either spliced or its length extended. The mRNA nuclear export

factor UAP56 binds to several intronless mRNAs including βG mRNA independently of

splicing. I also discovered that UAP56 is required for the egress of intronless mRNAs from

nuclear speckles. My results suggest that most mRNAs are exported to the cytoplasm

independently of splicing unless they contain a nuclear retention element.

iii

Acknowledgments I acknowledge Dr. Alex Palazzo. I would really like to thank my thesis committee

members, Dr. Craig Smibert and Dr. Fritz Roth for their time and feedback. Finally, I would like

to thank my mom.

iv

Table of Contents Abstract ............................................................................................................................... ii

Acknowledgments .............................................................................................................. iii

List of Tables ................................................................................................................... viii

List of Figures .................................................................................................................... ix

List of Abbreviations ......................................................................................................... xi

Chapter 1: Introduction ....................................................................................................... 1

1.1 Introduction ................................................................................................................... 2

1.1.1 The nucleus and the expansion of non-coding sequences: two features that distinguish

eukaryotes from prokaryotes ............................................................................................... 2

1.1.2 A key role of the nucleus is to sort transcripts that contain “mRNA identity” features from

spurious transcripts ............................................................................................................. 4

1.2 The coupling of mRNA processing with mRNA nuclear export .................................. 6

1.2.1 The mRNA nuclear export machinery ....................................................................... 6

1.2.1.1 CRM1 regulates the nuclear export of snRNAs and a subset of mRNAs .............. 8

1.2.2 Sorting promoter-driven transcripts from spurious transcription ............................ 10

1.2.3 Coupling transcription elongation to mRNA nuclear export ................................... 11

1.2.4 Coupling splicing to mRNA nuclear export ............................................................ 12

1.2.5 Coupling of 3’ processing to mRNA nuclear export ............................................... 13

1.2.6 Nuclear export as an arbiter of mRNA quality control ............................................ 15

1.2.7 Coupling mRNA nuclear localization to mRNA export .......................................... 16

v

1.2.8 The ultimate goal: Coupling mRNA export to translation ....................................... 17

1.3 Sequence features as an avenue for assessing mRNA identity by the nuclear export

machinery .......................................................................................................................... 18

1.4 Concluding remarks .................................................................................................... 20

1.5 Rationale of thesis research ........................................................................................ 21

1.5.1 The TREX complex is required for the egress of export-competent ftz mRNPs from nuclear

speckles ............................................................................................................................. 21

1.5.2 Splicing promotes the nuclear export of β-Globin mRNA by overcoming nuclear retention

elements ............................................................................................................................ 22

Chapter 2: The TREX complex is required for the egress of export-competent ftz mRNPs from

nuclear speckles ................................................................................................................ 23

2.1 Summary ..................................................................................................................... 24

2.2 Introduction ................................................................................................................. 25

2.3 Materials and Methods ................................................................................................ 27

2.4 Results ......................................................................................................................... 31

2.4.1 The extent of nuclear export of intronless mRNAs varies between reporter

transcripts .......................................................................................................................... 31

2.4.2 Nuclear speckle association is promoted by sequences within the reporter

transcript ........................................................................................................................... 31

2.4.3 MHC-ftz-Δi traffics through nuclear speckles .......................................................... 39

2.4.4 The nuclear export of MHC-ftz-Δi requires UAP56 and URH49 ............................ 40

2.4.5 UAP56 and URH49 are required for MHC-ftz-Δi to exit out of nuclear speckles ... 43

vi

2.4.6 UAP56 associates with MHC-ftz-∆i mRNA ............................................................ 44

2.4.7 CRM1 is required for the speckle egress and nuclear export of ftz mRNAs ........... 49

2.4.8 Examining the RNA sequence features that define the requirement for CRM1 in mRNA

nuclear export .................................................................................................................... 49

2.4.9 PHAX depletion is not sufficient to cause a block in the nuclear export of ftz

mRNPs .............................................................................................................................. 53

2.5 Discussion ................................................................................................................... 55

Chapter 3: Splicing promotes the nuclear export of β-Globin mRNA by overcoming nuclear

retention elements ............................................................................................................. 58

3.1 Summary ..................................................................................................................... 59

3.2 Introduction ................................................................................................................. 60

3.3 Materials and Methods ................................................................................................ 62

3.4 Results ......................................................................................................................... 66

3.4.1 Intronless β-Globin mRNA contains a nuclear retention element ........................... 66

3.4.2 Mapping the nuclear retention elements in βG-∆i ................................................... 72

3.4.3 The activity of the βG retention element(s) can be inhibited by splicing ................ 75

3.4.4 Nuclear/cytoplasmic distribution correlates with mRNA levels ............................. 75

3.4.5 The majority of βG-∆i at steady state is stable and retained in the nucleus ............ 78

3.4.6 The length of the poly(A) tail is unaltered by the nucleocytoplasmic distribution of the

mRNA ............................................................................................................................... 81

3.4.7 UAP56 is recruited to the βG-∆i mRNA ................................................................. 81

3.5 Discussion ................................................................................................................... 84

vii

Chapter 4: Conclusions and Future Directions ................................................................. 87

4.1 Summary of thesis ....................................................................................................... 88

4.2 Future Directions ........................................................................................................ 90

4.2.1 Identifying the molecular factors responsible for the nuclear retention of βG-∆i

mRNA ............................................................................................................................... 90

4.2.2 Examining the nuclear export kinetics of endogenous mRNAs .............................. 91

4.3 Concluding remarks .................................................................................................... 93

References ......................................................................................................................... 94

viii

List of Tables Table 1.1. Major role of different mRNA nuclear export factors ....................................... 7

Table 3.1. A description of the constructs used in Chapter 3. .......................................... 63

ix

List of Figures Figure 1.1. Coupling between mRNA nuclear export and various steps of gene

expression ........................................................................................................................... 5

Figure 2.1. The extent of nuclear export varies between reporter mRNAs ...................... 32

Figure 2.2. Analysis of mRNA localization to nuclear speckles ...................................... 35

Figure 2.3. MHC-ftz-Δi mRNA, but not dextran, colocalizes with SC35-containing nuclear

speckles ............................................................................................................................. 38

Figure 2.4. UAP56 and URH49 are required for the export of intronless ftz mRNA ....... 41

Figure 2.5. Depletion of UAP56 and URH49 causes an enrichment of MHC-ftz-Δi mRNA but not

βG-Δi mRNA in nuclear speckles ..................................................................................... 45

Figure 2.6. Co-depletion of UAP56/URH49 causes the remaining levels of UAP56 to associate

with speckles ..................................................................................................................... 47

Figure 2.7. MHC-ftz-Δi associates with UAP56 in vivo ................................................... 48

Figure 2.8. CRM1 inhibition causes the accumulation of ftz mRNAs in nuclear

speckles ............................................................................................................................. 50

Figure 2.9. CRM1 activity is required for the nuclear export of MHC-ftz-∆i-βG-∆i ....... 52

Figure 2.10. Depleting the expression of PHAX is not sufficient to cause the rescue the CRM1

mediated nuclear retention of ftz mRNAs ......................................................................... 54

Figure 2.11. Model linking mRNP formation with the trafficking of mRNAs through nuclear

speckles ............................................................................................................................. 57

Figure 3.1. Fusions of ftz fragments to full length βG mRNA are cytoplasmic at steady

State ................................................................................................................................... 67

x

Figure 3.2. RNA insertions into the 5’end of βG mRNA promotes nuclear export ......... 70

Figure 3.3. Extending the length of βG-∆i mRNA promotes its nuclear export .............. 73

Figure 3.4. The 3’end of βG-∆i is required for nuclear retention ..................................... 74

Figure 3.5. Splicing is sufficient to overcome the nuclear retention element present in βG-∆i

mRNA ............................................................................................................................... 76

Figure 3.6. The majority of the βG-∆i mRNA that is present at steady state is stable and retained

in the nucleus .................................................................................................................... 79

Figure 3.7. Strong UAP56-association with βG-∆i mRNA in vivo .................................. 82

Figure 3.8. Model of how the βG nuclear retention element affects mRNA nuclear

export ................................................................................................................................ 86

xi

List of Abbreviations 4E-SE: eIF-4E Sensitivity Elements

βG: β-Globin

BORG: BMP2-OP1 Responsive Gene

CAR-E: Cytoplasmic Accumulation Region-Element

CBC: cap binding complex

CRM1: Chromosomal Region Maintenance 1

CTD: carboxy-terminal domain

D. melanogaster: Drosophila melanogaster

eIF-4E: Eukaryotic Initiation Factor-4E

EJC: Exon Junction Complex

ePAT: extension Poly(A) Test

EU: 5-ethynyluridine

FACT: facilitates chromatin transcription

FISH: fluorescence in situ hybridization

FIRRE: functional intergenic repeating RNA element

ftz: fushi tarazu

HHT: homoharingtonine

hnRNPC1/C2: hetergenous nuclear Ribonucleoprotein C1/C2

INS: Insulin

xii

IGC: interchromatin granule clusters

IWS1: interacts with Spt6 1

LMB: Leptomycin B

lncRNA: long noncoding RNA

MALAT1: metastasis-associated lung adenocarcinoma transcript 1

MHC: Major Histocompatibility Complex

mRNA: messenger RNA

mRNP: messenger Ribonucleoparticle

NES: nuclear export signal

NMD: Nonsense-mediated mRNA Decay

NPC: Nuclear Pore Complex

ORF: Open Reading Frame

PAS: polyadenylation sites

Pol II: RNA Polymerase II

PP7CP: Pseudomonas Phage 7 Coat Protein

P-TEFb: positive transcription elongation factor b

qPCR: quantitative Polymerase Chain Reaction

RanGAP1: Ran GTPase Activating Protein 1

RanBP1: Ran Binding Protein 1

RNAi: RNA interference

xiii

RT-qPCR: Reverse Transcription- quantitative Polymerase Chain Reaction

S. cerevisiae: Saccharomyces cerevisiae

S. pombe: Schizosaccharomyces pombe

shRNA: small hairpin RNA

siRNA: small interfering RNA

snRNA: small nuclear RNA

snRNP: small nuclear ribonucleoprotein particles

SR: serine/arginine-rich

SSCR: Signal Sequence Coding Region

Swt1: synthetic with TREX 1

TREX: Transcription Export

X. lavis: Xenopus lavis

UAS: Upstream Activating Sequence

UIF: UAP56 Interacting Factor

1

Chapter 1

Introduction

Parts of this chapter were published in:

Palazzo, A.F., and Akef, A. (2012). Nuclear export as a key arbiter of “mRNA identity” in

eukaryotes. Biochim. Biophys. Acta 1819, 566–577.

2

1.1 Introduction

1.1.1 The nucleus and the expansion of non-coding sequences: two features that distinguish eukaryotes from prokaryotes The nucleus is the defining feature of the eukaryotic cell. It compartmentalizes the

cellular space into two distinct regions: the nucleoplasm, where RNA is synthesized, processed

and packaged, and the cytoplasm, where mature messenger RNA (mRNA) is translated into

proteins. This is in striking contrast to prokaryotes, where transcription and translation occur

concurrently in the same compartment. Another important difference between these two groups

is the percentage of their genomes that encode protein. In multicellular eukaryotes, protein-

coding sequences account for a fraction of the genome, varying from 1.5 to 36 percent (Gregory,

2005; Lynch, 2007; Lynch et al., 2011), while in prokaryotes, the majority of the genome is

protein-coding (Lynch, 2006). Eukaryotes have experienced a vast expansion in genomic

sequences that does not code for proteins (Gregory, 2005; Palazzo and Gregory, 2014). It has

been assumed by many that this increase was a consequence of natural selection acting to expand

the amount of functional information and organismal complexity (ENCODE Project Consortium,

2012; Mattick et al., 2010; Taft et al., 2007; Ecker et al., 2012; Pennisi, 2012; Kapusta and

Feschotte, 2014), which could have taken the form of an amplification in 1) functional non-

coding transcriptional products, 2) DNA regulatory sequences that direct RNA transcription and

chromosome architecture and/or 3) RNA regulatory sequences that impact alternative splicing

and other RNA processing events.

In support of the expansion of functional non-coding transcripts, several large-scale

analyses have indicated that most of the eukaryotic genome is transcribed, albeit at a low level

(ENCODE Project Consortium et al., 2007; Johnson et al., 2005; Djebali et al., 2012). However,

it has been suggested that these non-coding transcripts do not have a specific function since most

of the non-protein coding transcribed regions are poorly conserved (ENCODE Project

Consortium et al., 2007; Marques and Ponting, 2009; Wang et al., 2004; Doolittle et al., 2014)

and are rapidly degraded (Chekanova et al., 2007; Davis and Ares, 2006; Neil et al., 2009; Preker

et al., 2008; Thiebaut et al., 2006; Vasiljeva et al., 2008; Wyers et al., 2005; Xu et al., 2009;

Tisseur et al., 2011). An analysis of mouse nascent transcripts by RNA-Sequencing (RNA-Seq)

has revealed that the number of reads that map to intergenic regions of the genome is almost

3

equivalent to the number of reads that align to exonic regions (Menet et al., 2012). On the other

hand, most of the steady state polyadenylated RNA population mapped to exonic regions with

only a small percentage aligning to intergenic regions (Menet et al., 2012). However, it should be

pointed out that a short-lived transcript is not necessarily non-functional. Moreover, many

examples have been found that contradict these general features. Non-coding RNAs have been

found to regulate transcription (Martens et al., 2004), mRNA translation and stability (Fire et al.,

1998), histone modification (Tsai et al., 2010; Rinn et al., 2007), DNA methylation (Bartolomei

et al., 1991), DNA recombination (Kobayashi and Ganley, 2005), and even cross-regulate other

non-coding RNAs (Salmena et al., 2011).

In parallel to these studies, advances in population genetics have uncovered many of the

evolutionary forces that shape genomic content. One important principle derived from these

analyses is that the ability of natural selection to weed out mildly deleterious mutations, such as

the insertion of non-functional DNA sequences (i.e., introns and intergeneic sequences),

increases with the number of breeding individuals (Lynch, 2006; Lynch et al., 2011). As a

consequence, species that have a low population size, as is the case with most eukaryotes, cannot

effectively select out these genetic alterations. It appears that these entities are being eliminated

in certain eukaryotes whose effective population size must have recently increased (such as

Saccharomyces cerevisiae (S. cerevisiae), which has experienced a recent loss of introns (Csuros

et al., 2011; Irimia and Roy, 2008; Irimia et al., 2007; Rogozin et al., 2003) and intergenic

sequences (Chen et al., 2011; Kuo and Ochman, 2009). However, it is likely that these lineages

are the exception rather than the rule, as the level of intergenic sequence in most unicellular

eukaryotic genomes is about 50% (Lynch, 2007).

It has been proposed that intergenic regions are likely to contain cryptic transcriptional

start sites, whose sequences tend to be highly degenerate (Carninci et al., 2006; Froula and

Francino, 2007; Hahn et al., 2003; Lynch et al., 2005). This would explain why both the mouse

and human genomes contain about an order of magnitude more promoter regions as compared to

protein-coding genes (Carninci et al., 2006; ENCODE Project Consortium et al., 2007). It is also

worth noting that although RNA polymerase II (Pol II) does not efficiently initiate transcription

at non-promoter sites, the proliferation of non-functional DNA may also increase the frequency

of spurious transcription initiation by increasing the amount of non-specific substrate. Indeed,

spurious initiation of Pol II-driven transcription has been observed at nucleosome-free sites in

vivo (Carninci et al., 2005; Cheung et al., 2008) and likely accounts for a substantial fraction of

4

all nascent RNAs (Menet et al., 2012; Palazzo and Gregory, 2014). As a result of all these forces,

we can begin to understand why a large fraction of active Pol II is associated with intergenic

regions throughout the yeast and human genomes (Buratowski, 2008; Cheung et al., 2008).

1.1.2 A key role of the nucleus is to sort transcripts that contain “mRNA identity” features from spurious transcripts From this vantage point the real question that we should be asking is how functional

transcripts are extracted from all the transcriptional noise resulting from the eukaryotic genome.

The answer appears to be that transcripts bearing hallmarks of protein-coding genes are

identified by an extensive network of feedback and feed-forward loops between various

machineries present at different steps of the gene expression pathway (Fig. 1.1). Thus at each

step, features associated with mRNA identity are acted on by one set of factors, and these

directly promote the activity of other machines responsible for subsequent and previous steps.

This phenomenon, generally known as “coupling” (Maniatis and Reed, 2002; Moore and

Proudfoot, 2009; Perales and Bentley, 2009), was previously viewed as a method for either

enhancing the efficiency of gene expression or distinguishing properly processed from

unprocessed mRNAs. However, through this extensive coupling network, a system for

identifying mRNAs from spurious transcription also emerges. It should be noted that the concept

of “mRNA identity” was originally used to describe how protein-coding transcripts are

differentiated from snRNA, tRNAs and other nuclear exported transcripts (Masuyama et al.,

2004; Ohno et al., 2002; Ullman, 2002). I would like to expand this concept to explain how cells

differentiate protein-coding mRNAs from transcriptional noise through coupling. The role of the

nuclear envelope within this context becomes apparent: by segregating RNA production and

processing from the translation machinery, it ensures that this coupling network completes its

task of separating mRNAs from transcriptional noise before allowing these products to be

translated into proteins (Martin and Koonin, 2006). As a consequence, the nuclear mRNA export

machinery is one of the central nodes of this coupling network (Fig. 1.1) and acts as a key arbiter

of mRNA identity. The coupling between the mRNA nuclear export machinery and the various

gene expression complexes will be discussed in the next section.

5

Figure 1.1. Coupling between mRNA nuclear export and various steps of gene expression.

Green arrows represent a positive feed-forward or feedback regulation while red lines represent a

negative feedback relationship.

6

1.2 The coupling of mRNA processing with mRNA nuclear export 1.2.1 The mRNA nuclear export machinery

Since the Transcription Export (TREX) sits at the center of many of the coupling

reactions outlined below, I will begin by reviewing its constituents and how it regulates mRNA

nuclear export (Table 1.1). In S. cerevisiae, the TREX complex is composed of the THO

complex (Hpr1p, Tho2p, Mft1p and Thp2p), the DEAD box RNA helicase Sub2p and the RNA

recognition motif containing protein, Yra1p (Chávez et al., 2000; Jimeno et al., 2002; Strässer

and Hurt, 2001; Strässer et al., 2002; Zenklusen et al., 2002). In metazoans, the THO complex

contains homologs for Hpr1p (THOC1), Tho2p (THOC2) and at least three proteins not found in

budding yeast (THOC5, THOC6 and THOC7) (Rehwinkel et al., 2004; Zenklusen et al., 2002).

Mammals have two homologs for Sub2p (UAP56 and URH49) (Masuda et al., 2005) and one

predominant Yra1p-like protein (Aly) (Luo et al., 2001).

The mammalian THO complex and UAP56 are thought to be assembled onto the mRNA

in nuclear speckles, foci where transcription, splicing, polyadenylation and general messenger

ribonucleoparticle (mRNP) assembly are thought to take place (Dias et al., 2010; Kota et al.,

2008). The mRNA nuclear export adaptor, Aly is then recruited to TREX by physically

interacting with UAP56 in its ATP-bound form (Dufu et al., 2010; Taniguchi and Ohno, 2008).

Then in response to an unknown stimulus, UAP56 hydrolyzes ATP, and the ADP-bound form is

then released from TREX and the mRNA (Taniguchi and Ohno, 2008). This exposes a domain

on Aly that can recruit the TAP/p15 heterodimer (Mex67p/Mtr2p in S. cerevisiae) to the

transcript (Dufu et al., 2010; Hautbergue et al., 2008; Strässer and Hurt, 2000; Strässer et al.,

2002; Stutz et al., 2000), and in mammalian cells this likely occurs within nuclear speckles

(Schmidt et al., 2006). After disrupting the association of Aly and the transcript, TAP/p15 ferries

the transcript across the nuclear pore complex (NPC) by interacting with nucleoporins

(Hautbergue et al., 2008; Katahira et al., 1999; Santos-Rosa et al., 1998; Segref et al., 1997).

Although this picture paints an extremely defined sequential series of events, there are

likely multiple mechanisms by which TREX mediates nuclear export of mRNA. For example, in

budding yeast Hpr1 can directly recruit TAP/p15 (Hobeika et al., 2007), while in

Schizosaccharomyces pombe (S. pombe), UAP56 recruits the conserved Rae1p to the transcript,

which then promotes a TAP/p15-independent mRNA export (Thakurta et al., 2007; Yoon et al.,

2000). In other systems Rae1p has been shown to bind to both TAP/p15 and nucleoporins, and is

7

Table 1.1. Major role of different mRNA nuclear export factors.

Export Factor Complex Major Proposed Role

Yeast Metazoan

Hpr1p THOC1 THO-TREX Recruits UAP56 to mRNA transcripts.

Tho2p THOC2 THO-TREX

Mft1p - THO-TREX

Thp2p - THO-TREX

- THOC5 THO-TREX Binds TAP.

- THOC6 THO-TREX

- THOC7 THO-TREX

Sub2p UAP56 TREX Recruits Aly to mRNA transcripts.

URH49

Yra1p Aly TREX Recruits TAP/p15 to transcripts.

Mex67p TAP Mex67/Mtr2 (TAP/p15)

Ferries transcripts across the nuclear pore.

Mtr2pa p15 Mex67/Mtr2 (TAP/p15)

Ferries transcripts across the nuclear pore.

Nab2 - Assists release of Aly from the mRNP.

Gle2p Rae1 Associates with TAP at the nuclear pore.

Sac3p GANP TREX-2/THSC Delivers TAP containing mRNPs to the nuclear pore.

Dbp5p Dbp5 Remodeling of the mRNP after crossing the pore.

Gle1p Gle1 Stimulates ATPase activty of Dbp5.

Npl3 SR proteins (ASF/SF2,

9G8, SRp20)

Recruits TAP/p15 to transcripts.

- UIF Recruits TAP/p15 to transcripts.

- Iws1 Recruits ALY to mRNA transcripts. a Mtr2p and p15 share structural but no sequence similarity.

8

essential for mRNA export (Bailer et al., 1998; Blevins et al., 2003; Pritchard et al., 1999; Yoon

et al., 2000). It should be also noted that additional mRNA export adaptors including UAP56

interacting factor (UIF) and Chtop have been shown to be redundant with Aly (Chang et al.,

2013; Hautbergue et al., 2009) likely providing an explanation for the fact that the depletion of

Aly by RNA interference (RNAi) neither impairs the nuclear export of bulk poly(A) mRNA nor

cell viability (Akef et al., 2013; Hautbergue et al., 2009). In addition, there are other NPC-

associated proteins whose roles are not fully understood. In S. cerevisiae, Gle1p stimulates the

helicase activity of Dbp5p at the cytoplasmic face of the pore (Alcázar-Román et al., 2006;

Weirich et al., 2006) where Dbp5p regulates the remodeling of the mRNP complex by removing

TAP/p15 from the mRNA (Lund and Guthrie, 2005). Dbp5p also interacts with Aly (Schmitt et

al., 1999), although the role of this interaction is not understood. Interestingly, while Dbp5p was

initially characterized as a cytoplasmic protein, Dbp5p appears to shuttle between the nucleus

and cytoplasm (Cáceres et al., 1998). Additionally, other “nuclear” proteins involved in mRNA

export, such as Hpr1, THOC5, UAP56, URH49 and Aly, also shuttle to the cytoplasm (Katahira

et al., 2009; Meignin and Davis, 2010; Thomas et al., 2011; Zhou et al., 2000). Finally, a group

of proteins that has been linked to mRNA nuclear export is the serine/arginine-rich (SR)

proteins. These recognize distinct RNA motifs and play various roles in RNA metabolism

including splicing, 3’end processing and export (Long and Caceres, 2009). In S. cerevisiae,

TREX components can recruit SR proteins to the transcript (Hurt et al., 2004), and in

mammalian cells, certain SR proteins promote TAP/p15-dependent export (Hautbergue et al.,

2008; Huang and Steitz, 2001; Huang et al., 2003) and likely accompany the mRNA into the

cytoplasm (Cáceres et al., 1998).

Thus in summary, it appears that there are several ways that components of the TREX

complex can mediate export. These alternatives to the canonical TREX pathway probably reflect

the plasticity of the entire mRNA export system. Importantly, the TREX activity has been shown

to be coupled to several different mRNA processing machineries, each of which are associated

with distinct identity elements.

1.2.1.1 CRM1 regulates the nuclear export of snRNAs and a subset of mRNAs

The Chromosomal Region Maintenance 1 (CRM1) is a member of the family of nuclear

transport receptors that interact with nucleoporins and transport cargoes across the NPC (Köhler

9

and Hurt, 2007). In the nucleus, CRM1 binds its cargo and the small GTPase Ran. Upon

reaching the cytoplasm, the concerted action of the cytoplasmically localized proteins Ran

GTPase Activating Protein 1 (RanGAP1) and Ran Binding Protein 1 (RanBP1) stimulate Ran to

hydrolyze its bound GTP to GDP (Köhler and Hurt, 2007). The conformational change of Ran

promotes the dissociation of the cargo from CRM1. Subsequently, CRM1 and Ran shuttle back

to the nucleus where the nuclear localized Ran Guanine nucleotide Exchange Factor (RanGEF)

protein catalyzes the exchange of GDP for GTP on Ran (Köhler and Hurt, 2007). As the complex

assembles in the nucleus and disassembles in the cytoplasm, the latter compartment acts as a sink

for nuclear export substrates.

CRM1 was initially shown to promote the nuclear export of small nuclear RNA (snRNA)

and nuclear export signal (NES)-containing proteins (Fornerod et al., 1997). While both mRNAs

and snRNAs share many similarities such as being Pol II-mediated transcription products and

having a 5’ cap, snRNAs and mRNAs are funneled through distinct nuclear export pathways.

The two RNA species are differentiated by the ability of the snRNA export adaptor PHAX to

selectively bind RNA species that are typically shorter than mRNAs and range from 200 to 300

nucleotides (Masuyama et al., 2004). Subsequently, PHAX recruits CRM1 which in turn ferries

the snRNA across the NPC to the cytoplasm. A recent study has shown that the heterogenous

nuclear ribonucleoproteins C1/C2 (hnRNPC1/C2) compete with PHAX for binding to mRNAs

(McCloskey et al., 2012). Moreover, depletion of hnRNPC1/C2 by RNAi enhances the

recruitment of PHAX to mRNA transcripts leading to their nuclear retention through an

unknown mechanism (McCloskey et al., 2012). These authors proposed that the hnRNPC1/C2

complex acts as a measuring stick in order to identify long RNAs (McCloskey et al., 2012).

These studies lent credence to the notion that the length of a transcript can serve as one potential

avenue for eukaryotic cells to distinguish various RNA species in the nucleus.

CRM1 and RanGTP were thought to be dispensible for mRNA nuclear export (Clouse et

al., 2001; Neville and Rosbash, 1999) However, several studies have suggested a role for CRM1

in mediating the nuclear export of several mRNAs in mammalian cells (Kimura et al., 2004;

Culjkovic et al., 2006). In one example, it was reported that the nuclear export of human

interferon-α mRNA required CRM1 (Kimura et al., 2004) while the TREX complex was

required in another study (Lei et al., 2011). This raises the possibility that CRM1 may in some

cases interact with canonical mRNA nuclear export factors such as the TREX complex and the

heterodimer TAP/p15 to regulate mRNA export to the cytoplasm.

10

1.2.2 Sorting promoter-driven transcripts from spurious transcription Cells need to identify transcripts emanating from Pol II rather than other polymerases.

This is accomplished through a particular feature of the largest subunit of Pol II, its carboxy-

terminal domain (CTD). This flexible extension is composed of a heptad amino acid sequence

(YSPTSPS) that is repeated in tandem (there are 52 repeats in the human Pol II) and acts as a

modifiable scaffold which recruits various complexes to Pol II, depending on the enzyme’s

history (for reviews see (Buratowski, 2009; Moore and Proudfoot, 2009)). For example, the

promoter-associated TFIIH complex promotes the phosphorylation of the fifth serine (Ser5) of

the CTD heptad repeats (YSPTSPS) (Feaver et al., 1994). This modified CTD recruits the

enzymes responsible for adding a 7-methylguanine cap to the nascent mRNA transcript (Cho et

al., 1997; McCracken et al., 1997; Yue et al., 1997). The 5’cap allows these transcripts to be

distinguished from those originating from Pol II initiation events at non promoter sequences. The

5’cap then recruits the nuclear cap binding complex (CBC), which in turn physically interacts

with Aly, thereby loading the TREX complex on the 5’ end of the transcript (Cheng et al., 2006).

Dbp5p has also been shown to associate with the 5’ end of newly transcribed Balbiani ring

transcripts in Chironomus tetans (Zhao et al., 2002) and may be recruited there through

interactions with Aly (Schmitt et al., 1999) or transcription factors such as TFIIH (Estruch and

Cole, 2003).

Additional promoter-proximal DNA elements may act to further identify protein-coding

transcripts. For example, upon gene activation in S. cerevisiae and Drosophila melanogaster (D.

melanogaster), a physical bridge is formed between upstream activation sequences (UAS) and

the NPC in a process referred to as gene gating (Blobel, 1985; Casolari et al., 2004; Kurshakova

et al., 2007). This phenomenon is thought not only to enhance the rate of gene expression, but

also to help reactivate genes at a later time point in a process known as transcriptional memory

(Brickner, 2009). In certain cases, gene gating in both S. cerevisiae and D. melanogaster is

mediated by the TREX-2/THSC complex, which forms a bridge between the UAS-associated

transcription co-activator SAGA and the NPC (Cabal et al., 2006; Fischer et al., 2002;

Kurshakova et al., 2007; Luthra et al., 2007). Importantly, the S. cerevisiae TREX-2/THSC

complex has been shown to be required for nuclear mRNA export (Fischer et al., 2002, 2004; Lei

et al., 2003; Rodríguez-Navarro et al., 2004). A key component of the S. cerevisiae TREX-

2/THSC complex is Sac3p, which can associate with both TAP/p15 and nucleoporins through

two distinct domains (Fischer et al., 2002). Despite the presence of at least one Sac3p homolog

11

in humans (GANP) (Jani et al., 2009; Wickramasinghe et al., 2010, 2014), there is no evidence

for gene gating in vertebrates (Perales and Bentley, 2009). GANP, however, is required for

mRNA export (Wickramasinghe et al., 2010, 2014). It is thus likely that the TREX-2/THSC has

other functions beyond gene gating, but these have yet to be elucidated.

It is thus clear that the majority of promoter-driven transcription events result in an RNA

molecule with associated factors that are fundamentally different from the products of spurious

transcription. In this context, conserved promoters with the right proximal-promoter elements

recruit machinery that then marks the nascent transcripts. These identity marks include the 5’cap

and the loading of proteins (such as Aly, Dbp5 and perhaps Sac3p/GANP) onto the transcript.

1.2.3 Coupling transcription elongation to mRNA nuclear export One important event that occurs during Pol II transcription is promoter clearance.

Promoter clearance allows initiated Pol II to progress to the elongation phase of transcription and

is likely a step where the gene expression machinery evaluates mRNA identity (Svejstrup, 2004).

This process requires phosphorylation of Ser2 in the Pol II CTD heptad repeats (YSPTSPS) by

the Ctk1p kinase in budding yeast and P-TEFb (positive transcription elongation factor b) in

mammalian cells (Bartkowiak and Greenleaf, 2011; Lenasi and Barboric, 2010). The successful

progression to this phase of transcription is coupled to the budding yeast homolog of Aly, which

interacts with the Pol II CTD that is phosphorylated on both Ser2 and Ser5 (MacKellar and

Greenleaf, 2011). A second important coupling event is the recruitment of the THO complex to

the transcript during elongation (Chávez et al., 2000; Strässer et al., 2002), although the exact

molecular details remain elusive. In S. cerevisiae, the THO complex may form a direct physical

interaction with Ctk1p kinase, and these two factors in turn recruit SR proteins to the CTD (Hurt

et al., 2004). PAF, another complex that is involved in Pol II elongation, also directly associates

with the THO complex (Chang et al., 1999). In D. melanogaster, the THO complex is recruited

to elongating Pol II by ENY2, a component of both TREX-2/THSC and SAGA complexes

(Kopytova et al., 2010). Interestingly, the THO complex is also required to promote transcription

elongation in S. cerevisiae, especially through regions containing high GC-content (Chávez et

al., 2001), and this function in transcription appears to be conserved in mammals (Wang et al.,

2006). Thus, once the nascent transcript has acquired sufficient identity marks and has recruited

the THO complex, not only is its elongation promoted, but the now localized THO complex may

feedback to promote the generation of subsequent transcripts from that same genetic locus.

12

Another set of factors that associate with transcribed regions and can thus serve to impart

identity marks onto the RNA are nucleosome remodeling complexes. These include the

facilitates chromatin transcription (FACT) complex, which disassembles nucleosomes and thus

enhances Pol II transcription elongation, and Spt6, which associates with Phospho-Ser2 CTD and

helps to reassemble these dissociated nucleosomes (Belotserkovskaya and Reinberg, 2004; Yoh

et al., 2007). Interestingly, disruption of either factor promotes spurious transcription, indicating

that they help to distinguish protein-coding regions from the rest of the genome (Kaplan et al.,

2003; Mason and Struhl, 2003). This may have to do with the maintenance of histone

modifications at protein-coding loci, which can serve as additional identity marks for protein-

coding genes. Importantly, these nucleosome remodeling factors also interact with TREX in

mammalian systems. Thus Spt6 binds to Aly through its interacting partner Iws1 (interacts with

Spt6) (Yoh et al., 2007, 2008), while FACT recruits UIF to the mRNA (Hautbergue et al., 2009).

UIF and Aly may work in redundant pathways to recruit TAP/p15 to the transcript (Hautbergue

et al., 2009).

Thus it appears that histone modifications, which provide an identity mark for protein-

coding genes, are coupled to TREX-dependent export through these remodeling factors. This

coupling could also work in the reverse direction: once a transcript has satisfied sufficient criteria

of mRNA identity and has thus acquired TREX, this may help Pol II acquire nucleosome

remodeling complexes that further promotes transcription.

1.2.4 Coupling splicing to mRNA nuclear export Splicing is a highly effective mRNA identity mark. Although the vast majority of human

protein-coding transcripts are spliced, most non-coding intergenic transcripts are not (van Bakel

et al., 2010). This mark may not be so critical in organisms that have few introns and small

intergenic regions, such as S. cerevisiae. Indeed, in most cases the elimination of introns from a

budding yeast gene has only a small impact on its expression and on the fitness of the mutant

strain (Parenteau et al., 2008), although exceptions do exist (Juneau et al., 2006; Parenteau et al.,

2008, 2011). However, the situation in organisms with low population numbers is quite different.

These organisms tend to have larger intergenic regions and more introns. Indeed in vertebrates

where many promoters are bidirectional, it was shown that recognition sites of the U1 snRNP

component of the splicing machinery are enriched in the correct forward transcript and depleted

from the reverse transcript (Almada et al., 2013). This pattern contrasted that seen with

polyadenylation sites (PAS) which are more enriched in the reverse transcripts. Interestingly,

13

disrupting the function of U1 snRNP caused a spike in promoter proximal cleavage and

polyadenylation of forward transcripts suggesting that U1 snRNP recruitment to nascent

transcripts inhibits premature 3’ cleavage (Almada et al., 2013). Moreover, splicing has a major

impact on several other RNA processes, such as 3’ cleavage (McCracken et al., 2002),

polyadenylation (Lutz et al., 1996), and nuclear export (Luo and Reed, 1999). Splicing was also

proposed to be required for promoting mRNA nuclear export in metazoans (Cheng et al., 2006;

Masuda et al., 2005). This last activity is mediated by the interaction of UAP56 with components

of the spliceosome (Fleckner et al., 1997; Luo et al., 2001; Masuda et al., 2005). It should also be

noted that UAP56 was originally identified as being required for proper splicing (Fleckner et al.,

1997) and spliceosome maturation (Shen, 2009). Thus, the recruitment of the TREX complex to

a transcript by other identity elements may in turn enhance the processing of proper mRNAs

over spurious transcripts. It is also likely that the mRNA nuclear export machinery evaluates

splicing post-transcriptionally. For example, the TREX complex is required for the splicing-

dependent export of microinjected intron-containing pre-mRNAs in both Xenopus lavis (X. lavis)

oocytes (Luo and Reed, 1999) and human cells (Palazzo et al., 2007). It should be noted that

many intronless mRNAs are efficiently exported in mammalian cells (Nott et al., 2003; Lu and

Cullen, 2003) and this is dependent on TREX activity (Hautbergue et al., 2009; Taniguchi and

Ohno, 2008). These results suggest that even in organisms that have large amounts of intergenic

DNA, splicing is not absolutely required for the export of an mRNA from the nucleus to the

cytoplasm.

Splicing also leads to the deposition of the exon junction complex (EJC), which is

involved in nonsense-mediated decay (Le Hir et al., 2001a), temporal regulation of mRNA

stability (Giorgi et al., 2007), the enhancement of translation (Ma et al., 2008; Nott et al., 2004)

and the proper cytoplasmic localization of mRNA (Hachet and Ephrussi, 2001, 2004; Le Hir et

al., 2001b). Although it has been reported that the EJC also interacts with TREX components (Le

Hir et al., 2001b; Schmidt et al., 2006) and SR proteins (Singh et al., 2012), the EJC is not

required for mRNA nuclear export (Nott et al., 2003; Palazzo et al., 2007). However, it is

possible that the physical interaction of these two complexes may again give an advantage to the

processing, export and translation of protein-coding mRNAs over spurious transcripts.

1.2.5 Coupling of 3’ processing to mRNA nuclear export The final identity mark that is associated with a protein-coding mRNA is the 3’ poly(A)

tail. This hallmark of protein-coding transcripts is added to the 3’ end due to the action of various

14

other mRNA identity cues. In S. cerevisiae, the remaining phospho-Ser2 CTD recruits the

cleavage factor (CF1A) and cleavage polyadenylation factor (CPF), which are required for

proper 3’processing. A second cue is the polyadenylation signaling elements, found near the end

of the transcript. These two identity elements are not only used to mark the transcript with a

poly(A) tail, but are directly coupled to TREX activity. In early experiments it was noted that as

polyadenylation factors were recruited to a transcript, the THO complex fell off, indicating that

the former displaced the latter from the mRNA (Kim et al., 2004). In addition, direct links have

been made between TREX and 3’processing machines. For example, in S. cerevisiae, 3’ end

processing signals are required to recruit yeast Aly to certain transcripts (Lei and Silver, 2002),

and this is likely mediated by the CF1A component Pcf11p (Johnson et al., 2009). Mutations of

TREX components in the budding yeast cause the accumulation of CF1A components and

TAP/p15 in mRNA-chromatin-protein complexes that are trapped at the NPC (Rougemaille et

al., 2008). Thus it is likely that TREX communicates with the 3’ end processing machinery and

if this fails, due to insufficient TREX-recruitment or weak 3’processing signals, nuclear export is

blocked.

TREX-recruitment also affects the degree of 3’ end processing. S. cerevisiae cells

harboring deletions in the TREX components sometimes show defects in the 3’ end cleavage of

certain transcripts (Libri et al., 2002) and defects in polyadenylation in others (Saguez et al.,

2008). Thus, other identity cues may feed forward to enhance polyadenylation through TREX. In

this light, the poly(A) tail is an mRNA identity mark that is not only responsive to 3’processing

cues and Pol II status, but also to other identity elements. One would thus expect that like

splicing, long poly(A) tails should strongly promote export, and this is exactly what was

observed in X. lavis oocyte mRNA microinjection experiments (Fuke and Ohno, 2008).

Although the mechanism in vertebrates remains unclear, the nuclear poly(A) binding protein

(Pabp2) is required for mRNA export in D. melanogaster (Farny et al., 2008). In S. cerevisiae,

the yeast-specific poly(A) binding protein Nab2p has been implicated in export (Green et al.,

2002; Hector et al., 2002) and forms a complex with yeast Aly and TAP/p15 on the

nucleoplasmic face of the NPC (Fasken et al., 2008; Iglesias et al., 2010).

Again, these various coupling events allow TREX to assess 3’end identity marks.

Moreover, it is possible that gene looping, or the proximity of the 5’ and 3’ ends of a highly

transcribed gene (Lainé et al., 2009), may allow the TREX complex to monitor identity marks

simultaneously on the 5’ and 3’ ends of a given transcript. However, it is apparent that there is a

15

complicated relationship between the TREX complex and the 3’ end. It appears that at this stage

TREX may play a role in mRNP quality control both positively and negatively. This topic will

be explored in the next section.

1.2.6 Nuclear export as an arbiter of mRNA quality control Most spurious transcripts are quickly degraded by the TRAMP poly(A) polymerase

complex and the nuclear exosome (Chekanova et al., 2007; Davis and Ares, 2006; Neil et al.,

2009; Preker et al., 2008; Thiebaut et al., 2006; Vasiljeva et al., 2008; Wyers et al., 2005; Xu et

al., 2009). It is thus likely that the failure to recruit the TREX complex redirects the mRNA to

this degradation machinery. This is supported by the observation that TREX inhibition in S.

cerevisiae causes the degradation of nuclear localized mRNAs by several complexes, which

include not only TRAMP, and the nuclear exosome, but also the CCR4-Not deadenylase

complex (Assenholt et al., 2011; Rougemaille et al., 2007). Indeed, several large-scale genetic

experiments have identified strong genetic interactions between TREX and components of the

TRAMP and exosome complexes (Milligan et al., 2008; Wilmes et al., 2008; Zenklusen et al.,

2002). However it appears that the TREX complex also plays an active role in this rerouting. For

example Yra1p, Nab2p and Dbp5p physically interact with the Ccr4-Not complex (Kerr et al.,

2011).

Another critical quality control step is the evaluation of mRNP composition and RNA

processing by Mlp1p/2p, two large proteins present at the nucleoplasmic face of the NPC (Galy

et al., 2004; Iglesias et al., 2010). If the mRNP passes this filter, Aly is ubiquitinated and

released from the Nab2p/TAP/p15 complex (Iglesias et al., 2010). It appears that this remodeling

occurs in response to quality control assessment and is required for export. In the event that

export fails it is likely that these transcripts are degraded by a specialized endonuclease Swt1p

(synthetic with TREX 1) (Skruzný et al., 2009). Since Mlp1 and 2 also interact with the Ccr4-

Not (Kerr et al., 2011), it is likely that this complex is also involved in the degradation of

aberrant transcripts. It is thus clear that mRNA nuclear export factors cross talk to mRNA

degradation complexes in order to partition transcripts that fail to meet a certain threshold of

mRNA identity.

Moreover, TREX activity has been linked to small interfering RNA (siRNA) mediated

heterochromatin formation and gene silencing. In S. pombe, siRNAs are generated from highly

repetitive heterochronic regions of the genome and are required for their transcriptional silencing

and chromatin remodeling (Moazed, 2009). This process is likely conserved in metazoans and

16

used to prevent the proliferation of transposons. Interestingly, S. pombe cells harboring

mutations in the Aly homolog Mlo3 show defects in siRNA production and no longer silence

heterochronic regions (Zhang et al., 2011). In plants, the THO complex is also required for the

production of siRNAs that are involved in post-transcriptional silencing (Jauvion et al., 2010;

Yelina et al., 2010). This putative role of TREX in heterochromatin silencing is likely conserved

and extends beyond siRNA generation, as the mutation, deletion or overexpression of the S.

cerevisiae homolog of UAP56 also affects siRNA-independent gene silencing at heterochronic

loci (Fan et al., 2001; Lahue et al., 2005; West and Milgrom, 2002), and the deletion of UAP56

in D. melanogaster suppresses the spreading of heterochromatin to subtelomeric regions (Eberl

et al., 1997). These studies lead to the provocative model that TREX components act to evaluate

transcripts and determine whether they contain sufficient mRNA identity elements, or whether

they are generated from heterochromatic loci or transposons and should be shunted towards a

silencing pathway.

1.2.7 Coupling mRNA nuclear localization to mRNA export The gene gating hypothesis postulated that genes are positioned in a non-random pattern

in proximity to nuclear pores (Blobel, 1985). As a result, mRNAs transcribed from a given gene

are transported to the cytoplasm through the nearest NPC to that gene (Blobel, 1985). Indeed, it

has been shown that transcriptional activation targets certain genes to the NPC in S. cerevisiae

(Casolari et al., 2004). Moreover, previous studies in S. cerevisiae indicate that certain mRNPs

are rendered export-competent in the vicinity of the nuclear pore (Cabal et al., 2006; Fasken et

al., 2008; Pascual-García et al., 2008). Intriguingly, gene gating has not been observed in mammalian cells (Hocine et al., 2010),

suggesting that the majority of mRNP formation occurs elsewhere in the nucleoplasm. Several

nonmembranous nuclear compartments have been discovered in mammalian cell nuclei

including nucleoli, nuclear speckles (also known as interchromatin granule clusters (IGC)),

paraspeckles and cajal bodies (Spector and Lamond, 2011). Among the various nuclear

compartments, the role of nuclear speckles as a potential site for transcription and mRNP

processing is particularly interesting. Indeed, it was shown that the chromosomal gene-poor

regions (G-bands) are less likely to be present along the edges of nuclear speckles than the gene-

rich regions (R-bands) (Shopland et al., 2003). Furthermore, components of the transcription

machinery (Pol II), the splicing machinery (small nuclear ribonucleoprotein particles (snRNPs)

and SR proteins), and the nuclear export machinery (TREX complex) have all been shown to

17

localize to nuclear speckles (Fu and Maniatis, 1990; Masuda et al., 2005; Spector and Lamond,

2011). Additional studies have provided evidence that the EJC and certain TREX components

are loaded onto mRNAs inside or in the vicinity of speckles (Schmidt et al., 2006; Teng and

Wilson, 2013) These results suggest that speckles might play a crucial role in recruiting mRNA

processing and transport factors to the mRNA. While it was shown that depleting components of

the TREX complex leads to the entrapment of spliced mRNAs produced from exogenously

introduced DNA plasmids in speckles (Dias et al., 2010), it should be also mentioned that only a

subset of spliced mRNAs produced from endogenous loci associate with speckles (Smith et al,

1999). Moreover, it was shown that post-transcriptional splicing occurs in speckles (Girard et al.,

2012), suggesting that the timing of intron splicing determines whether an mRNA localizes to

speckles. Therefore, it is plausible that different subsets of mRNAs are primed for nuclear export

in additional nuclear compartments.

1.2.8 The ultimate goal: Coupling mRNA export to translation As the export machinery identifies protein-coding transcripts, it would be expected that

these same factors are also preparing the mRNAs for translation. Indeed, both mRNA export

factors Dbp5p and Gle1p associate with polysomes and enhance translation (Alcázar-Román et

al., 2010; Bolger et al., 2008; Gross et al., 2007). Although TREX-associated complexes, such as

the EJC, also potentiate translation, future studies will have to be performed to determine

whether the TREX complex itself plays a more direct role in promoting the translatability of a

given mRNA.

18

1.3 Sequence features as an avenue for assessing mRNA identity by the nuclear export machinery

In the previous section I described how promoters, 5’capping, transcription elongation,

histone modifications, splicing, 3’ processing and polyadenylation all serve as identity elements

that indicate whether a given gene or its transcript will encode a protein. The question that

naturally arises is whether there are sequence features within the transcript that could potentially

be used as mRNA identity elements? Interestingly, it has been well documented that in plants

and metazoans, GC-content (i.e., the percentage of nucleotides that are either G or C) is higher in

exons than in either introns (Yu et al., 2002; Zhu et al., 2009) or local intergenic regions (Clay et

al., 1996). It is worth noting that members of the THO complex were originally identified as

proteins required for the transcription of GC-rich regions (Chávez et al., 2001). In light of these

patterns, the distribution of GC-content along a transcript is a likely candidate for an identity

marker of protein-coding genes.

Several RNA elements have been shown to promote mRNA nuclear export such as the

Signal Sequence Coding Region (SSCR), the Cytoplasmic Accumulation Region-Elements

(CAR-E) and the eIF-4E Sensitivity Elements (4E-SE) (Palazzo et al., 2007; Lei et al., 2011,

2012; Culjkovic et al., 2006).

SSCRs are present in the 5’end of the open reading frames (ORFs) that encode secretory

proteins. Due to the fact that these regions encode hydrophobic amino acids they contain codons

with particular features. The codons of these amino acids have U at their second coding position,

and are generally GC-rich and A-poor (Palazzo et al., 2007). Moreover, SSCRs are present in the

5’exon at levels greater than expected by chance and are enriched in certain GC-motifs, which

have been associated with enhanced EJC-association (Cenik et al., 2011; Singh et al., 2012).

Previous studies showed that the SSCR can promote the nuclear export of microinjected in vitro

transcribed ftz mRNA (Cenik et al., 2011; Palazzo et al., 2007). However, a more recent study

demonstrated that SSCRs do not enhance the nuclear export of ftz mRNAs that were transcribed

in vivo from microinjected or transfected plasmids (Lee et al., 2015). The mechanisms

underlying this discrepancy remain unknown. Moreover, an analysis of a handful of human

naturally intronless genes has led to the identification of putative CAR-E sequences that are

shared between these transcripts. CAR-E were shown to be sufficient for recruiting the TREX

complex to naturally intronless mRNA transcripts (Lei et al., 2011, 2012). Other RNA elements

19

have also been shown to funnel transcripts through specialized mRNA nuclear export pathways.

For example, the Eukaryotic Initiation Factor-4E (eIF-4E) is recruited to mRNAs that contain

4E-SEs. eIF-4E subsequently recruits the nuclear transport receptor CRM1 that mediates their

transport to the cytoplasm independently of the heterodimeric mRNA nuclear export recptor

TAP/p15 (Culjkovic et al., 2006; Topisirovic et al., 2009). Moreover, the naturally intronless

histone H2a mRNA has also been shown to contain a nuclear export-promoting element that

binds to the SR proteins SRp20 and 9G8 (Huang and Carmichael, 1997; Huang and Steitz,

2001).

Whether transcripts derived from noncoding loci contain sequences that impede their

nuclear export and thus antagonize any mRNA identity elements is also an interesting question.

Several studies have identified the presence of RNA elements within long noncoding RNAs

(lncRNAs) that caused their retention in the nucleus. Interestingly, when these elements were

eliminated, the lncRNAs were exported to the cytoplasm (Miyagawa et al., 2012; Zhang et al.,

2014). Nuclear retention RNA elements have been discovered in several lncRNAs such as

metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), BMP2-OP1 Responsive

Gene (BORG) and functional intergenic repeating RNA element (FIRRE) lncRNAs

(Hacisuleyman et al., 2014; Miyagawa et al., 2012; Wilusz et al., 2012; Zhang et al., 2014).

20

1.4 Concluding remarks In sum, the extensive coupling between factors involved in chromatin structure,

transcription, RNA processing, mRNA nuclear export, translation and RNA stability likely helps

eukaryotic cells distinguish mRNAs derived from protein-coding loci. In addition, sequence

features within a transcript confer information as to whether this transcript should be exported to

the cytoplasm or not. While none of these mRNA identity marks in isolation can be used to

separate protein-coding RNA from spurious transcripts; I propose that if a particular transcript

meets a critical threshold of these identity marks, then it will be efficiently transported to the

cytoplasm and translated to protein. Based on this model, it is likely that each transcript is

independently analyzed, and depending on its particular features, a subset of mRNA export

factors is engaged to export that transcript to the cytoplasm. This might explain why each

budding yeast and fly mRNA requires only a subset of RNA export factors for their efficient

export (Hieronymus and Silver, 2003; Kim Guisbert et al., 2005; Rehwinkel et al., 2004). It

should also be noted that there are other important quality control mechanisms that take

advantage of the coupling between gene expression steps to eliminate mis-processed mRNAs

such as the nonsense-mediated decay (NMD) pathway (Le Hir et al., 2001a; Lejeune and

Maquat, 2005). Indeed, it is likely that many biological processes operate as networks of

feedback and feed-forward loops rather than strictly linear pathways, and it is through these

interconnections that true biological function can emerge.

21

1.5 Rationale of thesis research My thesis research investigated the molecular mechanisms that regulate mRNA nuclear

export in mammalian cells. I sought to examine the sequence features that control the transport

of an mRNA to the cytoplasm. I also sought to unravel how these sequence features define the

nuclear localization where the early steps of mRNP assembly occur.

1.5.1 The TREX complex is required for the egress of export-competent ftz mRNPs from nuclear speckles Rationale: Previous studies have demonstrated that several pre-mRNA splicing factors and

nuclear export factors localize to nuclear speckles (Dias et al., 2010; Kota et al., 2008; Masuda et

al., 2005). These results supported that pre-mRNA splicing and the recruitment of mRNA

nuclear export factors are spatially coupled in nuclear speckles. The crucial role of nuclear

speckles in proper mRNP assembly was further supported by the fact that depleting several

components of the TREX complex not only inhibited mRNA transport to the cytoplasm but also

resulted in trapping the mRNA in speckles (Dias et al., 2010). In contrary to the splicing-

dependent mRNA nuclear export model, several groups have reported that splicing is not a strict

requirement for mRNA nuclear export (Lu and Cullen, 2003; Nott et al., 2003) and that

components of the TREX complex are recruited to intronless mRNAs (Taniguchi and Ohno,

2008). However, it was unknown whether the assembly of intronless mRNAs into nuclear

export-competent mRNPs also occurs in nuclear speckles. I sought to investigate some of the

early steps of intronless mRNP assembly in the nuclei of mammalian cells.

Hypothesis: I hypothesized that nuclear export-competent intronless mRNAs also traffic through

nuclear speckles and that speckle association is dependent on sequence features present within

the mRNA.

Results: I discovered that the intronless fushi tarazu (ftz) mRNA traffics through the nuclear

speckle compartment on its route to being exported to the cytoplasm. I also discovered that

depleting the expression of the TREX components UAP56 and URH49 led to ftz mRNA

entrapment in speckles. In contrast, intronless human β-Globin (βG) mRNA was not efficiently

exported to the cytoplasm as previously reported (Valencia et al., 2008), and did not traffic

through speckles. The splicing of βG mRNA was sufficient to both promote the localization of

βG mRNA to nuclear speckles and promote its transport to the cytoplasm. Moreover, I also

investigated the role of CRM1 in mediating the nuclear export of ftz mRNA. CRM1 inhibition

22

led to the retention of ftz mRNAs in nuclear speckles, although it remains unclear if this is a

direct or indirect effect. These results suggest i) that a subset of intronless mRNAs traffic

through nuclear speckles, and ii) that components of the TREX complex and CRM1 are likely

required for mRNP maturation and release from these intra-nuclear domains.

1.5.2 Splicing promotes the nuclear export of β-Globin mRNA by overcoming nuclear retention elements Rationale: There has been an ongoing debate as to whether splicing is required for efficient

mRNA nuclear export in metazoans (Luo and Reed, 1999; Nott et al., 2003; Valencia et al.,

2008). The evidence supportive of splicing being required for an mRNA to be efficiently

exported to the cytoplasm was partially based on studies which used human βG mRNA as a

model reporter (Valencia et al., 2008). While spliced βG mRNA (βG-i) is efficiently exported to

the cytoplasm, intronless βG mRNA (βG-∆i) is retained in the nucleus (Valencia et al., 2008). In

contrast to βG mRNA, several intronless transcripts were shown to be efficiently exported to the

cytoplasm independently of splicing (Nott et al., 2003; Lu and Cullen, 2003).

Hypothesis: I hypothesized that βG-∆i mRNA contained an RNA element that impeded its

transport to the cytoplasm and that this element can be overcome when βG mRNA is spliced.

Results: I discovered that βG mRNA contained nuclear retention elements in the 3’ end of the

mRNA that inhibited its transport to the cytoplasm. These nuclear retention elements could be

overcome when βG mRNA was either spliced or when the length of the mRNA was extended.

These results provided an illustration of how mRNA identity, and thus its “exportability”, is

defined by the aggregate sum of the various nuclear export-promoting and export-inhibitory

features present within an mRNA.

23

Chapter 2

The TREX complex is required for the egress of export-competent

ftz mRNPs from nuclear speckles


Akef, A., Zhang, H., Masuda, S., and Palazzo, A.F. (2013). Trafficking of mRNAs containing

ALREX-promoting elements through nuclear speckles. Nucleus 4, 326–340.

I generated all the data presented in this chapter.

24

2.1 Summary

The nuclear speckle is a compartment within the nucleus where pre-mRNA splicing is

thought to occur. In addition, the TREX complex localizes to speckles where it is thought to be

recruited to the mRNA in a splicing dependent manner. Here, I demonstrate that the efficiently

exported intronless ftz mRNP is trafficked through nuclear speckles. In contrast, intronless βG

mRNA, which is not efficiently exported to the cytoplasm, did not co-localize with speckles.

Depletion of two TREX-associated RNA helicases, UAP56 and its paralog URH49, not only

inhibits ftz transport to the cytoplasm but also appears to trap these mRNAs in nuclear speckles.

Moreover, I show that intronless ftz mRNAs associate with UAP56 in vivo. Inhibiting the activity

of nuclear export receptor CRM1 also impairs the transport of ftz mRNAs to the cytoplasm and

causes their entrapment in nuclear speckles. In contrast, CRM1 inhibition did not affect the

export of spliced βG mRNA. By analyzing ftz-βG fusion constructs, I determined that the

splicing of the βG transcript renders the mRNA insensitive to CRM1. These results suggest that

RNA sequences within a transcript determine nuclear speckle-association where mRNA nuclear

export factors are recruited to the mRNA and thus promote its transport to the cytoplasm.

25

2.2 Introduction

In eukaryotes, mRNAs are synthesized in the nucleus where they are capped, spliced, and

polyadenylated. During these maturation steps, the mRNAs are loaded with several proteins to

form mRNP particles that are capable of crossing the nuclear pore to reach the cytoplasm where

the mRNAs are translated into proteins (Palazzo and Akef, 2012). It is believed that the majority

of mRNAs in vertebrate cells are exported from the nucleus in a splicing dependent export

pathway (Luo and Reed, 1999). This pathway is initiated during splicing of the first intron where

the spliceosome and the nuclear cap binding complex collaborate to deposit the TREX complex

at the 5’end of the mRNA (Cheng et al., 2006; Masuda et al., 2005). TREX is a multiprotein

complex that is composed of the THO subcomplex, the RNA helicase UAP56, the adaptor

molecules Aly and Chtop (Chang et al., 2013; Luo et al., 2001; Strässer et al., 2002; Zhou et al.,

2000). This complex acts to recruit the heterodimeric mRNA export receptor TAP/p15, which

directly binds to the mRNA (Viphakone et al., 2012) and ferries it across the nuclear pore to the

cytoplasm (Katahira et al., 1999; Segref et al., 1997; Strässer and Hurt, 2000).

Although it is generally believed that the nuclear export receptor CRM1 is not required

for the transport of mRNAs to the cytoplasm, many lines of evidence suggest that this might be

an oversimplification. The export of certain mRNAs, such as interferon-α mRNA, is sensitive to

both CRM1 (Kimura et al., 2004) and TAP (Lei et al., 2011) inhibition. This raises the

possibility that these two export pathways collaborate to promote nuclear export. Interestingly,

members of the Palazzo lab have observed that the nuclear export of ftz mRNA is sensitive to the

inhibition of RanGTP (H. Zhang and A.F. Palazzo, unpublished data). Since TAP/p15-dependent

export does not require the Ran gradient (Clouse et al., 2001), but CRM1-dependent export does,

these observations raise the interesting possibility that the nuclear export of ftz mRNA is partially

dependent on CRM1.

It is unclear where in the nucleoplasm the assembly of these mRNPs takes place. One

potential subnuclear compartment where mRNP assembly may occur is nuclear speckles. These

are nuclear aggregates that contain active Pol II, spliceosomal components, and splicing

cofactors such as SR proteins (Spector and Lamond, 2011). In addition, these structures contain

TREX complex components (Dufu et al., 2010; Kota et al., 2008; Masuda et al., 2005; Zhou et

al., 2000). Many mRNAs appear to be recruited to nuclear speckles by the act of splicing (Dias et

al., 2010; Tokunaga et al., 2006; Wang et al., 1991). In the vicinity of speckles, splicing is

26

completed and the mRNA acquires components of the exon junction and likely TREX

complexes (Daguenet et al., 2012; Schmidt et al., 2006; Vargas et al., 2011). Depletion of

UAP56, enhances the association of these spliced mRNAs with nuclear speckles (Dias et al.,

2010), suggesting that the TREX complex is required for mRNAs to exit these structures.

Finally, it is likely that TAP/p15 is itself loaded onto spliced transcripts within or in the vicinity

of nuclear speckles (Schmidt et al., 2006; Teng and Wilson, 2013). In contrast to spliced

mRNAs, it is less clear whether intronless mRNPs also associate with nuclear speckles prior to

their export to the cytoplasm.

In this current work, I characterized some of the earliest events in the assembly of ftz

mRNP. My data show that ftz mRNP traffics through nuclear speckles prior to being exported to

the cytoplasm. My data suggest that within speckles, mRNAs undergo a series of mRNP

maturation steps and that the TREX-associated RNA helicases UAP56 and URH49, and CRM1,

are required for the eventual release of ftz mRNAs from these structures.

27

2.3 Materials and Methods

Plasmid constructs. The MHC-ftz-Δi, c-ftz-Δi, c-ftz-i and INS-Δi constructs in pCDNA3 were

described previously (Palazzo et al., 2007). Human βG introns were amplified from U2OS

genomic DNA and inserted into pcDNA3 mammalian expression vector containing βG cDNA

(Valencia et al., 2008) by restriction-free cloning (van den Ent and Löwe, 2006) using the

following primer sequences, forward primer:

GTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG and the reverse primer:

GACCAGCACGTTGCCCAGGAGCTGTGGGAGGAAGATAAG. The mouse MHC SSCR,

which comprises the first 66 nucleotides from the mouse H2kb gene, was first constructed using

the following primers—forward primer:

CAAAAACTCATCTCAGAAGAGGATATGGTACCGTGCACGCTGCTCCTGCTGT and the

reverse primer 3: CTCCTCAGGAGTCAGATGCACCGCGCGGGTCTGAGTCGGAGC. This

product was then used in a subsequent PCR reaction to insert the MHC SSCR into the βG-

containing vector by restriction-free cloning. Subsequent to PCR amplification, products were

treated with DpnI (New England Biolabs) and incubated at 37 °C for 3–12 h. Products were then

purified using PCR purification kits (Qiagen). DH5α E. coli cells were transformed with the

cloned plasmids. MHC-ftz-βG-Δi and MHC-ftz-βG-i were constructed by amplifying MHC-ftz-Δi

using a reverse primer that contained a HindIII site just upstream of the stop codon. This PCR

product was digested with HindIII and ligated into either βG-Δi or βG-i pCDNA3 respectively

that was cut with the same enzyme. c-ftz-i-βG-i constructed by amplifying c-ftz-i using a reverse

primer that contained a HindIII site just upstream of the stop codon. This PCR product was

digested with HindIII and ligated into βG-i pCDNA3 that was cut with the same enzyme.

Cell lines and antibodies. Both human osteosarcoma (U2OS) and embryonic kidney 293T

(HEK293T) were maintained in high glucose DMEM (Wisent) containing 10% FBS (Wisent)

and antibiotics (Sigma). For CRM1 inhibition experiments, U2OS cells were treated with 20 nM

Leptomycin B (LMB).

The following antibodies were used: rat polyclonal anti-UAP56 (Yamazaki et al., 2010),

rabbit polyclonal anti-UAP56 (Sigma), rat polyclonal anti-URH49 (Yamazaki et al., 2010),

rabbit polyclonal anti-Aly (Zhou et al., 2000), rabbit polyclonal anti-PHAX (Masuyama et al.,

2004), rabbit polyclonal anti-THOC1 (Masuda et al., 2005), mouse monoclonal anti-α-tubulin

28

(DM1A, Sigma), mouse monoclonal anti-GAPDH (Millipore), mouse monoclonal anti-HA

(Clone HA-7, Sigma) and mouse monoclonal anti-SC35 (Clone SC35, Sigma).

Lentiviral mediated shRNA protein depletion. Human embryonic kidney 293 (HEK293T)

cells were transiently transfected with gene specific small hairpin RNA (shRNA) pLKO.1

plasmids (Sigma) along with the packaging (Δ8.9) and envelope (VSVG) expression vectors (Ma

et al., 2008) using LipoD 293 DNA In Vitro Transfection Reagent (SignaGen Laboratories)

following the manufacturer’s protocol. Viruses were harvested 48 h after transfection. Human

U2OS cells were transduced with viruses in the presence of 8 µg/mL Hexadimethrine Bromide.

One day after transduction, cells were treated with 2 µg/mL Puromycin every other day. The

efficiency of the knock-down was assessed 3 days post transduction for UAP56, URH49 and

PHAX and 4 days for THOC1 and Aly by immunoblotting. The decrease in protein was

measured by densitometry analysis. These viruses contained the following plasmids obtained

from Sigma: TRCN0000074386 (shRNA targeted to UAP56, with sequence

CCGGGATAGACATCTCCTCCTACATCTCGAGATGTAGGAGGAGATGTCTATCTTTTT

G), TRCN0000333247 (shRNA targeted to URH49, with sequence

CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTT

G), TRCN0000272632 (shRNA targeted to THOC1, with sequence

CCGGGTGCTCTATTCCAATTGATTACTCGAGTAATCAATTGGAATAGAGCACTTTTT

G), TRCN0000010518 (shRNA targeted to Aly, with sequence

CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTT,

TRCN0000219883 (shRNA targeted to PHAX with sequence

CCGGGCCCGAGTAGTGAGGATTATTCTCGAGAATAATCCTCACTACTCGGGCTTTTT

G.

Microinjection, fluorescence in situ hybridization (FISH), and immunostaining. For

microinjection experiments, cells were plated on 22 × 22 mm coverslips (VWR) in 35 mm

mammalian tissue culture dishes (Thermo Scientific) for 24 h prior to injection. For DNA

microinjections, DNA plasmids were prepared using Qiaprep Midi Kits (Qiagen).

Microinjections were performed as previously described (Gueroussov et al., 2010). Briefly, DNA

plasmids or mRNA transcripts were microinjected at 200 ng/µL with 70 kDa Dextran conjugated

to Oregon Green (Invitrogen) and Injection Buffer (100 mM KCl, 10 mM HEPES, pH 7.4). For

pulse chase experiments, cells were treated with 1 µg/mL α-amanitin (Sigma) 20 minutes after

injection. After incubating the cells for the appropriate time at 37 °C, they were washed twice

29

with Phosphate Buffer Saline (PBS) and fixed in 4% paraformaldehyde (Electron Microscopy

Sciences) in PBS for 15 minutes. Cells were then permeabilized using 0.1% TritonX-100 in PBS

(Thermo Scientific). In HHT experiments, cells were treated with 5 µM HHT (or DMSO as a

control) 30 minutes prior to microinjections. The cells were then maintained in HHT up until

they were fixed.

For mRNA staining, cells were washed twice in 1X Sodium Saline Citrate (SSC) buffer

supplemented with 60% formamide. Cells were then treated with hybridization buffer (60%

formamide, 100 mg/ml dextran sulfate, yeast tRNA, 5 mM VRC, 1X SSC) containing 200nM

Alexa 546-conjugated ssDNA probe (Integrated DNA Technologies) for 24 h. Subsequently,

coverslips were washed with 1X SSC supplemented with 60% formamide and the coverslips

were mounted on DAPI. The probe oligonucleotide sequences included anti-ftz

(GTCGAGCCTGCCTTTGTCATCGTCGTCCTTGATAGTCACAACAGCCGGGACAACAC

CCAT), anti-βG

(CTTCATCCACGTTCACCTTCGCCCCACAGGGCAGTAACGGCAGACTTCTCCTCAGGA

GTCA), or anti-insulin,

(GGTCCTCTGCCTCCCGGCGGGTCTTGGGTGTGTAGAAGAAGCCTCGTTCCCGCACA

CACTA). For poly(A) mRNA staining, cells were washed in 1X SSC supplemented with 25%

formamide. Cells were treated with poly(A) hybridization buffer (25% formamide, 100 mg/ml

dextran sulfate, yeast tRNA, 5 mM VRC, 1X SSC) containing 200nM Alexa 546-conjugated

ssDNA 60mer dT oligonucleotide (Integrated DNA Technologies). For immunostaining,

coverslips were first washed with PBS and then blocked with 5% BSA in PBS. Subsequently,

proteins were stained with either mouse anti HA antibodies (1:350), mouse anti SC-35 (1:500),

rabbit anti Aly (1:500) or rat anti UAP56 (1:500) for 1 h. Coverslips were washed in PBS and

then stained using anti-mouse, anti-rabbit or anti-rat secondary antibodies conjugated to Alexa

647 (1:1500, Molecular Probes) for one hour.

Imaging, and image analysis. Cells were imaged using an epifluorescence microscope (Nikon).

All images in a panel were taken using the same microscopy settings. Image analysis, including

the quantification of mRNA export, was performed using Nikon Imaging Software (NIS)

Elements Advanced Research (Nikon) as previously described (Gueroussov et al., 2010). Briefly,

regions of interest (ROI) were manually drawn to mark cell and nuclear boundaries. Mean RNA

intensity was multiplied by the area of the ROIs to calculate the total cellular and nuclear RNA

levels. Cytoplasmic RNA levels were calculated by subtracting the nuclear from the total RNA

30

levels and subsequently, the ratio of cytoplasmic to total RNA fluorescence was calculated. For

nuclear speckle colocalization analysis, rectangular regions of interest were drawn to cover a

single SC35-positive speckle and its surroundings (1‒4 μm2). Then Pearson correlation ratio

between RNA FISH and SC35 immunoflourescence was computed by NIS analysis software.

Examples are shown in Fig. 2.2C. For each experiment, the 10 brightest SC35-positive speckles

per cell were analyzed and the totals from 10 cells were compiled. This analysis was repeated

three times and the average and standard error were compiled. The Pearson correlation between

microinjected fluorescent dextran and SC35 was also assessed to determine background levels of

correlation.

To calculate the fraction of mRNA in speckles, thresholds were drawn on the SC35

immunofluorescence channel using NIS. The threshold was set so that 20% (+/- 0.5%) of the

nuclear area was selected per cell and the total fluorescence intensity was calculated. The total

integrated mRNA signal in the nucleus and the cell body was also computed.

RNA immunoprecipitation. Human U2OS cells were transfected with different ftz plasmids

using GenJet in vitro DNA Transfection Reagent for U2OS (SignaGen Laboratories). After

18‒24 h, cell lysate was incubated for 10–14 h with rat anti-UAP56 antibodies (Yamazaki et al.,

2010) prebound to protein G sepharose (Invitrogen). Subsequently, the beads were washed five

times. The RNA is eluted from the UAP56 bound beads using SDS and harvested using Trizol

(Invitrogen) as previously described (Keene et al., 2006; Laver et al., 2012). The RNA samples

were treated with DNase (Ambion) to remove DNA plasmid contamination. cDNA was

synthesized using SuperScript III (Invitrogen) according to the manufacturer’s protocol.

Quantitative PCR (qPCR) was performed by mixing the cDNA with Power Sybr Green Master

Mix (Invitrogen) and the reaction was run on a CFX384 Touch Real Time PCR Detection

System (Bio-Rad). The efficiency of the IP reaction was checked by immunoblotting with rabbit

anti-UAP56 antibodies (Sigma) and rabbit anti-Aly antibodies (Zhou et al., 2000).

31

2.4 Results 2.4.1 The extent of nuclear export of intronless mRNAs varies between reporter transcripts

In order to examine how various sequence features within a transcript contribute to their

nuclear export, DNA plasmids that contain various versions of intronless and intron-containing

ftz and βG genes (Fig. 2.1A) were microinjected into the nuclei of human Osteosarcoma (U2OS)

cells. The plasmids were injected along with a 70 kDa fluorescently labeled dextran, which

cannot passively cross the nuclear pore and thus can be used as a marker for injected cells. After

20 minutes, the RNA Pol II inhibitor α-amanitin was added to halt further transcription. Cells

were left for 2 h to allow the newly synthesized mRNA to be exported. Subsequently, cells were

fixed and processed for FISH. The intronless mRNAs either contained or lacked the SSCR from

the mouse Major Histocompatibility Complex (MHC) H2kb gene that was proposed to promote

the nuclear export of in vitro transcribed ftz mRNA (Palazzo et al., 2007) but not endogenously

transcribed ftz mRNA (Lee et al., 2015). While both intronless (MHC-ftz-Δi and c-ftz-Δi) and

spliced ftz transcripts (c-ftz-i) were efficiently exported to the cytoplasm, intronless βG mRNAs

(MHC-βG-Δi and βG-Δi) were retained in the nucleus (Fig. 2.1B, C). The fact that MHC-βG-Δi

was not efficiently exported, further confirmed the finding that SSCRs do not promote the

nuclear export of mRNAs produced in vivo. As shown in Fig. 2.1B, C, the nuclear retention of

βG-Δi mRNA was overcome when the mRNA was either spliced (βG-i) or its length extended by

generating a fusion construct, MHC-ftz-Δi-βG-Δi, where the sequence of MHC-ftz-Δi was

inserted upstream of intronless βG-Δi (Fig. 2.1A). The presence of nuclear retention elements in

βG mRNA is further discussed in Chapter 3.

These results suggest that intronless ftz and βG transcripts have different nuclear export

outcomes.

2.4.2 Nuclear speckle association is promoted by sequences within the reporter transcript

I hypothesized that the differences in the nuclear export of intronless ftz and βG

transcripts are attributable to variations in ftz and βG nuclear mRNP assembly. To test this

hypothesis, I examined the nuclear localization of the newly synthesized ftz and βG mRNAs.

DNA plasmids that contain various versions of intronless ftz and βG genes were injected into the

nuclei of U2OS cells. At various time points post-injection, cells were fixed and the mRNAs

32

Figure 2.1. The extent of nuclear export varies between reporter mRNAs.

33

(A) Schematic representation of the different constructs used in this figure. (B-C) Plasmids

containing the indicated constructs were microinjected into the nuclei of human U2OS cells.

After 20 minutes, cells were treated with α-amanitin and mRNA export was allowed to proceed

for 2 hours. Cells were then fixed, probed for ftz or βG mRNA by FISH, imaged (A) and nuclear

export was quantified (B). Scale bar = 20 µm. Each bar represents the average and standard error

of three independent experiments, each consisting of 15-60 cells.

34

were stained by FISH. In order to examine the subnuclear localization of the mRNAs, nuclear

markers were stained using immunofluorescence. Both MHC-ftz-Δi and c-ftz-Δi mRNAs

appeared to associate with foci within the nucleus that were reminiscent of nuclear speckles, also

known as interchromatin granules (Spector and Lamond, 2011). This observation was at odds

with previously published findings that indicated that the ability for mRNAs to associate with

these structures required an intron and was dependent on splicing (Dias et al., 2010; Tokunaga et

al., 2006; Wang et al., 1991). I compared the distribution of mRNA transcribed from

microinjected plasmids containing either MHC-ftz-Δi, c-ftz-Δi, or βG-Δi and examined their

association with nuclear speckles over time. I observed that both MHC-ftz-Δi and c-ftz-Δi

colocalized with SC35, a marker of nuclear speckles (Fu and Maniatis, 1990; Spector et al.,

1991), however this association was only apparent after at least 30 minutes of expression

(Fig. 2.2A, compare the distribution of MHC-ftz-Δi with SC35 at 15 minutes and 1 h post-

microinjection, arrows indicate examples of nuclear speckles enriched with MHC-ftz-Δi or c-ftz-

Δi mRNAs). The colocalization of MHC-ftz-Δi with SC35 was confirmed by line scans as shown

in Fig. 2.2B. In contrast, βG-Δi, mRNA displayed little to no colocalization with SC35

(Fig. 2.2A and B), as previously reported (Dias et al., 2010; Tokunaga et al., 2006).

In order to quantify the enrichment of the various mRNAs with nuclear speckles, we

assessed the Pearson correlation coefficient (R) between the mRNA FISH stain and SC35

immunofluorescence in individual speckles. This analysis indicates the degree of mRNA

enrichment in each nuclear speckle as compared with the surrounding regions. Examples of

highly correlated (R > 0.8), weakly correlated (0.8 > R > 0.5) and non-correlated (R < 0.5)

distributions are shown in Fig. 2.2C. This analysis confirmed that all of the various intronless ftz

transcripts, but not βG-Δi, strongly associated with nuclear speckles (Fig. 2.2D). To obtain a

control for random colocalization, we also examined the correlation between microinjected

fluorescent 70 kDa dextran and SC35, and these did not significantly overlap (Fig. 2.2D, Fig.

2.3). As a further control, we estimated the degree of random colocalization by overlaying each

FISH nuclear image onto an SC35 immunofluorescence image, which was obtained from a

different nucleus, and then repeated the Pearson correlations analysis. Again we did not detect

any significant colocalization (Fig. 2.2E). Interestingly, our analysis indicated that βG-Δi

displayed weak association with speckles that was above background [i.e., colocalization

35

Figure 2.2. Analysis of mRNA localization to nuclear speckles.

36

(A) U2OS cells were microinjected with plasmids containing the MHC-ftz-Δi, c-ftz-Δi or βG-Δi

constructs. After allowing expression for the indicated time points, the cells were fixed, probed

for ftz or βG mRNA by FISH, immunostained for the nuclear speckle marker SC35 and stained

for DNA using DAPI. Each row represents a single field of view. An overlay of the mRNA (red)

and SC35 (green) is shown in the right panels. Scale bar = 5 µm. (B). The fluorescence

intensities (y-axis) of mRNA (MHC-ftz-Δi top panel and βG-Δi, lower panel; red) and SC35

(green) were plotted along the length of the arrows (x-axis) as seen in the overlay images in (A).

(C) Representative examples of strong, weak and non-colocalization of mRNA and SC35. Again

each row represents a single field of view. The Pearson correlation coefficient for each pair of

images is shown on the right. Scale bar of 1µm is shown. (D) U2OS cells were microinjected

with various plasmids. After allowing expression for the indicated time points, the cells were

fixed, probed and imaged as in (A). For each time point, the percentage of SC35-positive nuclear

speckles that colocalized with MHC-ftz-Δi, c-ftz-Δi and βG-Δi mRNAs, was plotted. As a control,

the percentage of speckles showing different levels of colocalization with the microinjection

marker, 70 kDa Dextran conjugated to Oregon Green was also analyzed. Speckles were binned

into 6 categories based on their Pearson correlation coefficient (“Strong colocalization”, R>0.9;

R=0.9-0.8; R=0.8-0.7; R=0.7-0.6; “Weak colocalization”, R=0.6-0.5; “Not colocalized” R<0.5).

Each column represents the average of three experiments, each consisting of 100 SC35-positive

speckles (see methods section for more details). Error bars represent standard error of the mean.

(E) For each mRNA, FISH images from one set of nuclei (1 hour post-microinjection), were

superimposed over SC35 images from a separate set of un-injected nuclei to determine the rate

of random colocalization. The data was analyzed and plotted as in (D). (F) The percentage of

speckles that colocalized with different transcripts was plotted for cells, 1 hour after

microinjection of plasmids. Again, the data was analyzed and plotted as in (D). (G-H) Plasmids

containing the MHC-ftz-Δi gene were microinjected into the nuclei of U2OS cells and mRNA

was allowed to express for 20 minutes. Cells were then treated with α-amanitin and the

colocalization of MHC-ftz-Δi mRNA with SC35 over time (post-drug treatment, indicated on the

x-axes) was monitored. (G) The percentage of nuclear speckles that demonstrate different levels

of colocalization with MHC-ftz-Δi. Again, the data was analyzed and plotted as in (D). (H) The

amount of MHC-ftz-Δi mRNA that is present in nuclear speckles (as defined by the brightest

20% pixels in the nucleus, using SC35 immunofluorescence) as a percentage of either the

cellular or nuclear level. Each data point represents the average and standard error of the mean of

37

10 cells. (I) In vitro transcribed MHC-ftz-Δi mRNA was microinjected into the nuclei of U2OS

cells. Cells were left for various amounts of time to allow mRNA export. The amount of MHC-

ftz-Δi mRNA present in nuclear speckles was monitored as described in Figure 2.2H.

38

Figure 2.3. MHC-ftz-Δi mRNA, but not dextran, colocalizes with SC35-containing nuclear

speckles. (A) U2OS were microinjected with DNA plasmid that contains the MHC-ftz-Δi

construct along with the microinjection marker 70kDa Dextran. After 1 hour, cells were probed

for ftz mRNA, immunostained for the speckle marker SC35 and stained for DNA using DAPI.

All panels are from a single field of view. Overlays of either MHC-ftz-Δi or Dextran (red) and

SC35 (green) are shown. Scale bar = 5 µm. (B) The fluorescence intensities (y-axis) of either

MHC-ftz-Δi or Dextran (red) and SC35 (green) were plotted along the length of the arrow (x-

axis) as seen in the overlay images in (A).

39

between dextran and SC35 (Fig. 2.2D), and colocalization between βG FISH and SC35 from

different nuclei (Fig. 2.2E)].

While both intronless ftz mRNAs (MHC-ftz-Δi and c-ftz-Δi) associated with speckles,

neither intronless βG transcripts (MHC- βG-Δi and βG-Δi) localized to speckles 1 hour after the

plasmids were microinjected (Fig. 2.2F). Intronless human insulin mRNA (INS-Δi), an intronless

mRNA which is efficiently exported (Palazzo et al., 2007) also localized to speckles (Fig. 2.2F)

suggesting that this distribution was not unique to ftz. From these observations, I concluded that

various reporter mRNAs appear to have different abilities to localize to nuclear speckles. These

data suggest that mRNAs that associate with nuclear speckles were more efficiently exported to

the cytoplasm. Furthermore, robust speckle targeting was dependent on particular features within

the transcript.

2.4.3 MHC-ftz-Δi traffics through nuclear speckles I next investigated whether these mRNAs could target to the speckles post-

transcriptionally. To test this idea, plasmids containing MHC-ftz-Δi were microinjected and after

20 minutes the transcriptional inhibitor α-amanitin was added to the cells. This treatment

completely inhibits transcription of microinjected plasmids within 5 minutes (Gueroussov et al.,

2010). The distribution of MHC-ftz-Δi at various time points after transcriptional shut-down was

monitored. Our analysis indicated that over time, newly synthesized MHC-ftz-Δi transcripts

increased their degree of colocalization with SC35 (Fig. 2.2G), suggesting that they can target to

these structures post-transcriptionally.

Although colocalization studies can indicate whether a particular mRNA is enriched in

speckles, they do not indicate how much of that particular transcript partitions into these

structures. Moreover, monitoring the total level of speckle-associated mRNA over time may

provide insights into the kinetics of this process. To examine whether the localization to speckles

represented a transient event, we used the SC35 immunofluorescence signal to subdivide nuclei

into nuclear speckle regions and non-speckle regions (for details see the materials and methods

section) and monitored what fraction of MHC-ftz-Δi was present in these zones after α-amanitin

treatment. To limit the amount of variation between measurements, nuclear speckles were

defined by thresholding the brightest 20% (+/- 0.5%) of pixels in each nucleus using SC35

immunofluorescence. Generally, the amount of speckle-associated MHC-ftz-Δi mRNA decreased

over time (Fig. 2.2H, see Speckle/ Total mRNA). This result implied that this mRNA was

trafficking out of the nuclear speckles over the time course, although the possibility of enhanced

40

degradation of speckle-associated mRNAs can not be definitively ruled out. Interestingly, when

only the nuclear MHC-ftz-Δi mRNA levels were assessed, the amount associated with speckles

only slightly decreased over the same period (Fig. 2.2H, Speckle/Nuclear mRNA). From these

measurements, we could not determine whether any of the mRNA in the speckle was targeted

post-transcriptionally. However this data suggested that the partitioning of mRNA between the

non-speckle and speckle regions was close to equilibrium.

To obtain a clearer picture of post-transcriptional mRNA trafficking through nuclear

speckles, we microinjected in vitro synthesized, capped, and polyadenylated mRNA into nuclei

and measured the partitioning of this into speckles over time. Note that microinjected mRNA is

exported at a higher rate than endogenously transcribed transcripts. For example, the half-time of

export for microinjected MHC-ftz-Δi mRNA is about 15 minutes, while the figure for the same

mRNA that is transcribed endogenously from plasmids is 40–50 minutes (Palazzo et al., 2007). I

found that microinjected MHC-ftz-Δi mRNA very rapidly accumulated into nuclear speckles, and

this peaked at about 10 minutes post injection (Fig. 2.2I, Speckle/Nuclear mRNA). After this

point the amount of mRNA in nuclear speckles decreased. This result confirmed that mRNA was

likely trafficking through nuclear speckles and that this localization could occur post-

transcriptionally.

In summary these results suggest that intronless mRNAs traffic through nuclear speckles.

In light of the role of nuclear speckles in mRNA metabolism (Spector and Lamond, 2011), it is

likely that this speckle trafficking is linked to mRNP assembly. It should be noted that our data

could not exclude the possibility that only a fraction of the MHC-ftz-Δi mRNA transits through

nuclear speckles.

2.4.4 The nuclear export of MHC-ftz-Δi requires UAP56 and URH49 A previous study suggested that TREX components are required for spliced mRNAs to

exit nuclear speckles (Dias et al., 2010). In light of my localization findings, I investigated the

effect of depleting the expression of several components of the TREX complex on intronless and

spliced ftz mRNAs. I took advantage of a lentiviral delivery system to transduce U2OS with

plasmids that contain small hairpin RNA (shRNA) constructs that are complementary in

sequence to both UAP56 and URH49 mRNAs. As shown in Fig. 2.4A, treating cells with these

two viruses for three days caused a decrease in the level of UAP56 and URH49 protein levels in

comparison to cells which were treated with control viruses (UAP56 levels decreased by 73 +/-

41

Figure 2.4. UAP56 and URH49 are required for the export of intronless ftz mRNA.

(A) U2OS cells were treated with lentiviruses that mediate the delivery of either plasmids that

contain shRNAs directed against UAP56 and URH49 or an empty control plasmid. Cell lysates

were collected after 72 hours, separated by SDS-PAGE and analyzed by immunoblot using

antibodies against UAP56, URH49 and α-tubulin. (B-D) U2OS cells depleted of various proteins

72 hours post-infection were microinjected with plasmids containing MHC-ftz-Δi or c-ftz-i. After

42

allowing expression for 20 minutes, cells were treated with α-amanitin and allowed to export the

mRNA for an additional 2 hours. Cells were then fixed, and the mRNA was stained by FISH (B).

Scale bar = 20 µm. (C) Quantification of the fraction of MHC-ftz-Δi and c-ftz-i mRNA in the

cytoplasm. Each bar represents the average and standard error of at least three independent

experiments, each consisting of 15-30 cells. Note that for each experiment, depleted and control

cells were assayed in parallel to control for day-to-day variations in nuclear export levels. (D-E)

U2OS cells were treated with lentiviruses that mediate the delivery of shRNAs directed against

THOC1 (D), ALY (E) or an empty plasmid (D-E). Cell lysates were collected after 96 hours,

separated by SDS-PAGE and analyzed by immunoblot with antibodies against THOC1, ALY,

GAPDH and tubulin. Asterisk represents a nonspecific band that is absent from HeLa nuclear

extract. To account for unequal cell confluency several volumes of the knock-down lysate were

loaded (0.75x, 1x or 1.25x of the control cell lysate). (F) Quantification of the fraction of poly(A)

mRNA in the cytoplasm in cells co-depleted of UAP56 and URH49, or depleted of UAP56,

URH49, THOC1 or ALY, or treated with control lentiviruses. Each bar represents the average

and standard error of at least three independent experiments, each consisting of 15-30 cells. (G)

U2OS cells co-depleted of UAP56 and URH49, or treated with control lentiviruses, were

microinjected with DNA plasmids containing MHC-ftz-Δi. Cells were fixed two hours after

injection without the prior addition of the transcription inhibitor α-amanitin and the mRNA was

stained by FISH. Quantification of the fraction of cytoplasmic mRNA is shown. Each bar

represents the average of at least three independent experiments, each consisting of 11-30 cells.

Error bars represent standard error of the mean. (H) U2OS cells co-depleted of UAP56 and

URH49, or treated with control lentiviruses, were microinjected with either in vitro transcribed

and polyadenylated MHC-ftz-Δi or c-ftz-i mRNA. Cells were fixed 1 hour after microinjection

and the mRNA was stained by FISH. Quantification of the cytoplasmic mRNA distribution is

shown. Each bar represents the average and standard deviation of two independent experiments,

each consisting of 9-25 cells.

43

7%, while URH49 decreased 87 +/- 3%, n = 3). These cells were microinjected with plasmids

containing MHC-ftz-Δi or c-ftz-i. After allowing transcription to proceed for 20 minutes, α-

amanitin was added to shut off transcription, and the newly synthesized mRNA was allowed to

export for an additional 2 h. I observed that when UAP56 and URH49 were co-depleted, both

MHC-ftz-Δi and c-ftz-i mRNAs were fully retained in the nucleus (Fig. 2.4B, quantitation

Fig. 2.4C). In contrast, depletion of either helicase alone had only slight effects on export

(Fig. 2.4C). As previously published (Kapadia et al., 2006), co-depletion of UAP56 and URH49

also caused a drastic accumulation of poly(A) mRNA in the nucleus (Fig. 2.4F). In contrast,

depletion of either UAP56 or URH49 alone did not cause a change in poly(A) mRNA

distribution (Fig. 2.4F). Depletion of the THO complex member THOC1 (also known as hHpr1

and p84) or the adaptor Aly had little to no effect on the export of either MHC-ftz-Δi or c-ftz-i

mRNA (Fig. 2.4C-E). Furthermore, depletion of either THOC1 or Aly also had no effect on bulk

mRNA export (Fig. 2.4F).

Previous experimental results demonstrated that the nuclear export of the SSCR-

dependent in vitro synthesized MHC-ftz-Δi mRNA was independent of UAP56 and URH49 in

HeLa cells (Palazzo et al., 2007). One difference between the results reported in Palazzo et al.

(2007) and my current results is the use of α-amanitin in my experiments. Nevertheless, when α-

amanitin treatment was omitted from DNA injection experiments, MHC-ftz-Δi mRNA was still

retained in the nucleus in U2OS cells depleted of UAP56 and URH49 (Fig. 2.4G). It is possible

that microinjected mRNA, which is exported more rapidly than its in vivo transcribed

counterpart, is more efficient at utilizing the low levels of UAP56/URH49 remaining in cells,

regardless of the cell line. Indeed, the export of microinjected MHC-ftz-Δi mRNA was only

partially inhibited in U2OS cells that were depleted of UAP56 and URH49 (Fig. 2.4H). In

contrast, the export of microinjected c-ftz-i mRNA was more sensitive to the depletion of these

two factors. These differences could be due to the effect of the SSCR itself, which seems to

greatly affect the export of microinjected transcripts but not of endogenously produced mRNA.

These results suggest that endogenously transcribed intronless MHC-ftz-Δi mRNA is

dependent on the TREX complex components UAP56 and URH49.

2.4.5 UAP56 and URH49 are required for MHC-ftz-Δi to exit out of nuclear speckles

44

In the course of my experiments I observed that the depletion of UAP56 and URH49

caused MHC-ftz-Δi mRNAs to accumulate into large nuclear foci and these colocalized with

several nuclear speckle markers such as SC35 and Aly (Fig. 2.5A-B). In agreement with

previous findings (Dias et al., 2010), c-ftz-i also accumulated in nuclear speckles in

UAP56/URH49-depleted cells (Fig. 2.5C). The speckle localization of MHC-ftz-Δi was much

more pronounced in the UAP56/URH49 knockdown cells than in control cells, whether this was

calculated by Pearson correlation or by computing the total amount of mRNA associated with

these structures (Fig. 2.5D-E). Indeed, in the knockdown cells practically every SC35-positive

speckle had an enrichment of MHC-ftz-Δi mRNA (Fig. 2.5D). In contrast, the depletion of these

two helicases had minor effects on the speckle-association of βG-Δi mRNA (Fig. 2.5D and F).

These experiments indicate that intronless MHC-ftz-Δi mRNA requires UAP56/URH49

for its exit from speckles. Although it is possible that inhibition of components of the TREX

complex directly promote the targeting of mRNA to speckles, we favor the model that under

normal conditions these proteins enhance the rate of egress from nuclear speckles.

2.4.6 UAP56 associates with MHC-ftz mRNA In U2OS cells, UAP56 is distributed throughout the nucleoplasm with a slight enrichment in

nuclear speckles (Fig. 2.6A). However, upon UAP56/URH49 co-depletion, the remaining

UAP56 was predominantly associated with nuclear speckles (Fig. 2.6A). Interestingly this

change in distribution was seen across almost the entire cell population (Fig. 2.6B). Since this

shRNA treatment also promoted the enrichment of MHC-ftz-Δi in speckles, I determined whether

UAP56 associates with this mRNA in vivo. Previously, it had been demonstrated that UAP56 is

recruited to mRNAs in a splicing dependent manner using an in vitro splicing reaction (Masuda

et al., 2005). I thus immunoprecipitated UAP56 from cells expressing either intronless or spliced

ftz constructs and analyzed the interacting RNAs by reverse transcription-quantitative PCR (RT-

qPCR). To control for nonspecific binding, I repeated these experiments with rat non-immune

serum. UAP56 immunoprecipitates contained the UAP56-interacting protein Aly (Fig. 2.7A),

suggesting that the isolated complexes are stable throughout the purification procedure. Indeed, I

observed a higher level of MHC-ftz-Δi mRNA enrichment in UAP56 immunoprecipitates in

comparison to c-ftz-i (Fig. 2.7B). To further confirm my results, I compared the enrichment of

MHC-ftz-Δi mRNA and the 7SL RNA in UAP56 immunoprecipitates. 7SL is a very abundant

non-coding RNA that is part of the Signal Recognition Particle (SRP) and is exported to the

cytoplasm independently of the TREX-TAP mRNA export pathway (Takeiwa et al., 2015).

45

Figure 2.5. Depletion of UAP56 and URH49 causes an enrichment of MHC-ftz-Δi mRNA

but not βG-Δi mRNA in nuclear speckles.

(A-C, F) U2OS cells were treated with lentiviruses that either mediate the delivery of shRNAs

against UAP56 and URH49 or control plasmids. Three days post-infection, cells were

microinjected with plasmid containing MHC-ftz-Δi (A-B), c-ftz-i (C) or βG-Δi (F). After allowing

the plasmid to be transcribed for 20 minutes, cells were treated with α-amanitin and incubated

for an additional 2 hours. Cells were then fixed, probed for either ftz (A-C) or βG (F) mRNA and

immunostained for the nuclear speckle markers SC35 (A, C, F) or ALY (B). Each row represents

a single field of view. Overlays of mRNA (red) and SC35 (A, C, F) or ALY (B) (green) are

shown in the right panels. Scale bar = 5 µm. (D) The percentage of SC35-positive speckles that

colocalize with MHC-ftz-Δi, βG-Δi mRNA or dextran in control cells or cells depleted of UAP56

46

and URH49. The data was analyzed and plotted as in Figure 2.2D. (E) The percentage of total

cellular and nuclear MHC-ftz-Δi mRNA that is present in nuclear speckles in control cells or cells

depleted of UAP56 and URH49 as described in Figure 2.2H. Each bar represents the average and

standard error of the mean of 10 cells.

47

Figure 2.6. Co-depletion of UAP56/URH49 causes the remaining levels of UAP56 to

associate with speckles. (A) U2OS cells were treated with lentiviruses to deliver either shRNA

directed against UAP56 and URH49 or an empty control plasmid. Cells were then microinjected

with plasmids containing MHC-ftz-Δi. After 20 minutes, cells were treated with α-amanitin and

mRNA export was allowed to proceed for 2 hours. Cells were then fixed, probed for ftz mRNA

by FISH, and UAP56 by immunofluorescence (A). Each Column is a single field of view. Scale

bar = 20 µm. (B) Quantification of the percentage of cells showing either nucleoplasmic or

speckle distribution for UAP56. Each bar represents the average and standard error of three

experiments, each consisting of at least 80 cells.

48

Figure 2.7. MHC-ftz-Δi associates with UAP56 in vivo.

(A) UAP56 was immunoprecipitated from U2OS lysates using rat anti-UAP56 antibodies pre-

bound to protein G sepharose. The immunoprecipitates were analyzed by immunoblot using

rabbit polyclonals against UAP56 and ALY. Non-immune rat serum was used in the mock

immunoprecipitation reaction. (B-C) U2OS cells were transfected with plasmids containing

MHC-ftz-Δi (B-C) or c-ftz-i (B). One day after transfection cell lysates were collected and

immunoprecipitated with rat anti-UAP56 antibodies or rat non-immune serum. RNA was

collected from fractions and converted to cDNA using ftz specific primers (B) or random

hexamers (C). The fold enrichment of mRNAs in anti-UAP56 over non-immune serum

precipitates was quantified by RT-qPCR. Each bar represents the average of five (B) and three

(C) independent experiments. Error bars represent standard error of the mean.

49

Indeed, while MHC-ftz-Δi was enriched in the UAP56 immunoprecipitates, 7SL was not

(Fig. 2.7C). From these experiments, I conclude that MHC-ftz-Δi associates with UAP56 in vivo.

2.4.7 CRM1 is required for the speckle egress and nuclear export of ftz mRNAs In addition to the canonical TREX-TAP/p15 mRNA nuclear export pathway, several

mRNAs are exported by a distinct pathway that is mediated by the karyopherin CRM1

(Culjkovic et al., 2006). Preliminary observations from the Palazzo lab indicated that the nuclear

export of ftz mRNA was sensitive to inhibitors of the Ran gradient (H. Zhang and A.F. Palazzo,

unpublished data), upon which CRM1 dependent export relies. In order to test whether CRM1

plays a role in the nuclear export of ftz and βG mRNAs, I inhibited the activity of CRM1 by

treating the cells with the CRM1 inhibitor Leptomycin B (LMB) as previously described (Nishi

et al., 1994). DNA plasmids that contain MHC-ftz-∆i, c-ftz-i and βG-i genes were microinjected

in LMB treated cells. As expected, LMB treatment inhibited the nuclear export of microinjected

NES-GFP fusion protein, which contains the NES of HIV REV protein and is known to be

dependent on CRM1 for mediating its transport to the cytoplasm (Fornerod et al., 1997).

Inhibiting the function of CRM1 also caused a block in the nuclear export of MHC-ftz-∆i and c-

ftz-i (Fig. 2.8A-B). Moreover, MHC-ftz-∆i mRNA accumulated in nuclear speckles in LMB

treated cells (Fig. 2.8C). In contrast, inhibiting the activity of CRM1 had a negligible effect on

the nuclear export of βG-i mRNA (Fig. 2.8A-B).

These results suggest that additional factors such as CRM1 cooperate with UAP56 and

URH49 towards mediating the egress of ftz mRNAs from nuclear speckles.

2.4.8 Examining the RNA sequence features that define the requirement for CRM1 in mRNA nuclear export

Next, I investigated the RNA elements within a transcript that determine whether CRM1

activity is required for a transcript to be efficiently exported to the cytoplasm. Since the nuclear

export of MHC-ftz-∆i and c-ftz-i was dependent on CRM1 but βG-i was independent of CRM1, I

compared the dependence of the fusion mRNAs: MHC-ftz-∆i-βG-∆i, MHC-ftz-∆i-βG-i and c-ftz-

i-βG-i on CRM1 (Fig. 2.9A). I reasoned that if ftz contained a specialized RNA element that

required CRM1 activity, then the fusion constructs should also be dependent on CRM1. DNA

50

Figure 2.8. CRM1 inhibition causes the accumulation of ftz mRNAs in nuclear speckles.

Plasmids containing the indicated constructs were microinjected into the nuclei of human U2OS

cells treated with 20 nM LMB. After 20 minutes, cells were treated with α-amanitin and mRNA

export was allowed to proceed for 2 hours. Cells were then fixed, probed for ftz or βG mRNA by

FISH, imaged (A) and nuclear export was quantified (B). Each bar represents the average and

standard error of three independent experiments, each consisting of 15-60 cells. (C) Plasmids

51

containing MHC-ftz-∆i were microinjected into the nuclei of human U2OS cells treated with 20

nM LMB. Cells were then fixed, probed for ftz mRNA by FISH, and SC35 by

immunofluorescence. Each row represents a single field of view. Overlays of mRNA (red) and

SC35 (green) are shown in the right panels.

52

Figure 2.9. CRM1 activity is required for the nuclear export of MHC-ftz-∆i-βG-∆i.

(A) Schematic representation of the different constructs used in this figure. (B) U2OS cells were

treated with 20 nM LMB or Ethanol either immediately, “cotreatment”, or 1 hour prior,

“pretreatment”, to microinjecting DNA plasmids containing MHC-ftz-∆i-βG-∆i, MHC-ftz-∆i-βG-

i or c-ftz-i-βG-i. Cells were fixed two hours after injection without the prior addition of the

transcription inhibitor α-amanitin and the mRNA was stained by FISH. Quantification of the

fraction of cytoplasmic mRNA is shown. Each bar represents the average of at least three

independent experiments, each consisting of 15-25 cells. Error bars represent standard error of

the mean.

53

plasmids that contain the indicated constructs were microinjected in U2OS cells either

immediately after the cells were treated with 20 nM LMB, “cotreatment” or 1 hour after LMB

treatment, “pretreatment”. I found that that inhibiting the activity of CRM1 caused the nuclear

retention of MHC-ftz-∆i-βG-∆i. Moreover, the level of nuclear retained MHC-ftz-∆i-βG-∆i

mRNA increased when CRM1 was inhibited for 1 hour prior to microinjecting the DNA

plasmid. In contrast to MHC-ftz-∆i-βG-∆i, inhibiting the activity of CRM1 had a minor effect on

the nuclear export of either MHC-ftz-∆i-βG-i or c-ftz-i-βG-i mRNAs (Fig. 2.9B).

These results suggested that the splicing of βG-i mRNA rendered its nuclear export to be

less dependent on CRM1. Moreover, the longer the period of time that CRM1 was inhibited

before the plasmids were microinjected, the more MHC-ftz-∆i-βG-∆i mRNAs were retained in

the nucleus.

2.4.9 PHAX depletion is not sufficient to cause a block in the nuclear export of ftz mRNPs

A previous study has shown that the binding of the snRNA nuclear export adaptor PHAX

to mRNAs can inhibit their nuclear export (McCloskey et al., 2012). I therefore tested if PHAX

was responsible for the CRM1 mediated nuclear retention of ftz mRNAs. I depleted the levels of

PHAX using RNAi (Fig. 2.10A). Subsequently, the cells were treated with LMB and DNA

plasmids that contain either MHC-ftz-∆i or c-ftz-i were microinjected (Fig. 2.10B). In cells with

functional CRM1, depleting the levels of PHAX was insufficient to impair the nuclear export of

either MHC-ftz-∆i or c-ftz-i mRNAs (Fig. 2.10B). Since CRM1 activity is required for the

nuclear export of PHAX, I hypothesized that inhibiting the activity of CRM1 would cause the

nuclear retention of PHAX which would subsequently bind a subset of nuclear mRNAs and

inhibit their transport to the cytoplasm. To test this hypothesis, I inhibited the activity of CRM1

by treating cells with LMB and compared the nuclear export of MHC-ftz-∆i and c-ftz-i in cells

where PHAX was either expressed or depleted. However, the CRM1-mediated nuclear retention

of MHC-ftz-∆i and c-ftz-i mRNAs was not rescued when cells were depleted of PHAX (Fig.

2.10B).

These results suggest that CRM1 mediates the nuclear retention of ftz mRNAs through a

PHAX-independent pathway.

54

Figure 2.10. Depleting the expression of PHAX is not sufficient to rescue the CRM1-

mediated nuclear retention of ftz mRNAs.

(A) U2OS cells were treated with lentiviruses that mediate the delivery of either plasmids that

contain shRNAs directed against PHAX or an empty control plasmid. Cell lysates were collected

after 72 hours, separated by SDS-PAGE and analyzed by immunoblot using antibodies against

PHAX and α-tubulin. (B) U2OS cells depleted of PHAX 72 hours post-infection were treated

with 20 nM LMB and microinjected with plasmids containing MHC-ftz-Δi or c-ftz-i. After

allowing expression for 20 minutes, cells were treated with α-amanitin and allowed to export the

mRNA for an additional 2 hours. Cells were then fixed, and the mRNA was stained by FISH.

Quantification of the fraction of cytoplasmic mRNA is shown. Each bar represents the average

and standard error of three independent experiments, each consisting of 15-30 cells.

55

2.5 Discussion

Here I investigated some of the early steps of intronless ftz mRNP assembly. My results

suggest that the trafficking of mRNA through nuclear speckles is sensitive to certain features of

the reporter transcript. Two mRNAs, ftz, and insulin, traffic through nuclear speckles, while a

third, βG, shows weak association with these compartments. My results are consistent with the

idea that both egress from speckles and mRNA nuclear export require the RNA helicases UAP56

and URH49 and the nuclear transport receptor CRM1. From this data I propose that mRNAs are

targeted to speckles by several possible routes such as splicing or by virtue of the presence of

certain sequence features in the mRNA (Fig. 2.11). Within speckles, it is likely that components

of the TREX complex are recruited to the mRNA to help assemble the mRNA into an export-

competent mRNP. My data supports the model that egress of export-competent ftz mRNPs from

speckles requires UAP56 and URH49 paralogs and CRM1 activity. Egress from speckles may be

coupled with the release of UAP56/URH49 from the mRNP (Hautbergue et al., 2008; Taniguchi

and Ohno, 2008), although it is possible that UAP56/URH49 may stay on the mRNA and

accompany it to the cytoplasm (Thomas et al., 2011). Work from others in the Palazzo lab

suggests that the egress from speckles also requires a poly(A) tail and TAP/p15 activity (Akef et

al., 2013).

The sequence features within a transcript that determine speckle association are yet to be

defined. It has also been reported that a handful of naturally intronless mRNA do not associate

with speckles (Lei et al., 2011, 2012), and this may be due to the requirements of different

mRNA export pathways, although it could also be attributable to the fact that these transcripts

have a low level of speckle association, but that it is so transient that it is not detectable under

normal circumstances. It has also been documented that certain spliced mRNAs do not traffic

through speckles yet are still exported to the cytoplasm (Smith et al., 1999), although again it is

hard to determine whether these mRNAs have a low level of speckle association that is not

normally detectable.

My results also demonstrate that while ftz requires CRM1 activity, the splicing of βG-i

renders the mRNA less dependent on CRM1 for their export to the cytoplasm. Moreover,

inhibiting the activity of CRM1 for 1 hour prior to expressing MHC-ftz-∆i-βG-∆i led to higher

levels of MHC-ftz-∆i-βG-∆i mRNA retention in the nucleus than if CRM1 was inhibited

immediately prior to plasmid microinjection. In contrast, the NES-GFP protein is completely

56

retained in the nucleus even when CRM1 was inhibited immediately prior to microinjecting the

protein. Since CRM1 has a well-established role in mediating protein nuclear export, I propose

that inhibiting the activity of CRM1 might lead to the nuclear accumulation of one or more NES-

containing proteins that inhibit the export of certain mRNAs. Subsequently, the accumulation of

these proteins in the nucleus leads to ftz mRNA nuclear retention through a mechanism that is yet

to be identified.

Previous studies in S. cerevisiae indicate that certain mRNPs are rendered export-

competent in the vicinity of the nuclear pore (Cabal et al., 2006; Fasken et al., 2008; Pascual-

García et al., 2008). This process is initiated by the anchoring of the transcribed gene to the pore

in a process known as gene-gating (Brickner, 2009; Casolari et al., 2004; Hocine et al., 2010).

Interestingly, this phenomenon has never been observed in mammalian cells (Hocine et al.,

2010), suggesting that the majority of mRNP formation occurs elsewhere in the nucleoplasm in

these organisms. My data lends support to the notion that in mammalian cells, the formation of

certain mRNPs occurs within speckles. Importantly, this may not be universally true for all

mRNPs. Of course, to understand this process would require further work to identify all the

critical steps in mRNP assembly and the RNA elements that modulate this process.

57

Figure 2.11. Model linking mRNP formation with the trafficking of mRNAs through

nuclear speckles.

The association of mRNAs with nuclear speckles is promoted by both splicing, and sequence

features within the mRNA. Within the speckle, mRNP maturation occurs through the activity of

the RNA helicases UAP56/URH49 and additional factors such as CRM1. This process primes

the mRNP for export to the cytoplasm.

58

Chapter 3

Splicing promotes the nuclear export of β-Globin mRNA by

overcoming nuclear retention elements


Akef, A., Lee, E.S., and Palazzo, A.F. (2015). Splicing promotes the nuclear export of β-globin

mRNA by overcoming nuclear retention elements. RNA 21, 1908–1920.

I generated all the results presented in this chapter.

59

3.1 Summary

Most current models of mRNA nuclear export in vertebrate cells assume that an mRNA

must have specialized signals in order to be exported from the nucleus to the cytoplasm. Under

such a scenario, mRNAs that lack these specialized signals would be shunted into a default

pathway where they are retained in the nucleus and eventually degraded. These ideas are based

on the use of selective model mRNA reporters. For example, it has been shown that splicing

promotes the nuclear export of certain model mRNAs, such as human βG, and that in the

absence of splicing, the cDNA-derived mRNA is retained in the nucleus and degraded. Here I

provide evidence that βG mRNA contains an element that actively retains it in the nucleus where

it is degraded. Interestingly, this nuclear retention activity can be overcome by increasing the

length of the mRNA or by including an intron. These results suggest that, contrary to many

current models, the default pathway for most intronless RNAs is to be exported from the nucleus,

unless the RNA contains elements that actively promote its nuclear retention.

60

3.2 Introduction

Eukaryotic cells contain two major compartments, the nucleoplasm where mRNA is

synthesized and processed, and the cytoplasm where this mRNA is translated into proteins. It is

currently believed that in vertebrate cells, mRNAs contain specialized cis-acting elements that

recruit nuclear export factors and permit their efficient export to the cytoplasm (Palazzo and

Akef, 2012). This contrasts to the situation in S. cerevisiae where nuclear export factors are

recruited to the transcript during transcription, regardless of their sequence or the presence of any

specialized cis-elements (Palazzo and Akef, 2012).

Much of the current thinking on this subject has been derived from studies of the main

export complex in eukaryotic cells, the TREX complex. In vertebrate cells, it is believed that the

TREX complex is primarily loaded onto the RNA in both a splicing and cap dependent manner

(Masuda et al., 2005; Strässer and Hurt, 2001; Zhou et al., 2000). TREX then recruits the

heterodimeric nuclear transport receptor TAP/p15 (also known as NXF1/NXT1), which ferries

the mRNA across the nuclear pore (Katahira et al., 1999; Stutz et al., 2000). Thus introns act as

de facto export-promoting cis-elements and this has been validated by the observation that

certain model mRNAs such as ftz and βG are only exported when they contain introns and thus

spliced (Luo and Reed, 1999; Valencia et al., 2008). In contrast, yeast TREX components are

loaded onto mRNAs co-transcriptionally by the action of RNA Pol II (Chávez et al., 2000;

Strässer et al., 2002; Jimeno et al., 2002; Zenklusen et al., 2002). The lack of a splicing

requirement in yeast is not surprising since the vast majority of their protein-coding genes are

intronless.

Within this context, it was assumed that human protein-coding genes that are naturally

intronless, would need some substitute cis-element to recruit the TREX complex in the absence

of splicing. This led to the identification of putative CAR-Es by the analysis of a handful of

human intronless genes (Lei et al., 2011, 2012). This idea was validated by fusing 16 copies of

the putative CAR-E to the 5’end of the intronless βG mRNA (βG-∆i) (Lei et al., 2012).

Inexplicably, the mutation of putative CAR-Es from intronless mRNAs did not affect their

nuclear export (Lei et al., 2012), suggesting that the export of naturally intronless mRNAs may

not be dependent on these elements.

61

In parallel with these studies, several groups have mapped and identified cis-elements

within lncRNAs that promote their nuclear retention. Interestingly, when these elements are

eliminated from these lncRNAs, even the intronless lncRNAs are efficiently exported to the

cytoplasm (Miyagawa et al., 2012; Zhang et al., 2014). This was true of many different small

fragments of lncRNAs (Miyagawa et al., 2012; Zhang et al., 2014). These observations would

indicate that either export-promoting elements are quite plentiful, or that in the absence of any

cis-elements, the default pathway for any given RNA is to be exported to the cytoplasm.

Recently, an RNA element present in certain ftz reporter plasmids has been found to

promote nuclear mRNA retention (Lee et al., 2015). This element, which is identical to the

consensus 5’ splice site motif, was present in the multi-cloning region of the plasmid,

downstream of the ftz gene and upstream of the 3’ cleavage site and was thus incorporated into

the 3’ UTR of the mature ftz mRNA. When this motif was eliminated, the resulting intronless ftz

mRNA was efficiently exported. These observations indicated that either the ftz mRNA has an

additional nuclear export- promoting element, or that when nuclear retention elements are

eliminated, all mRNAs become substrates for nuclear export. These two possibilities were

supported by the finding that UAP56, a central component of the TREX complex, is efficiently

loaded onto ftz without the requirement for splicing (Taniguchi and Ohno, 2008; Akef et al.,

2013).

Here I analyzed the export requirements of ftz and βG mRNAs. My results are consistent

with the idea that the 3’ end of the βG gene inhibits nuclear export. The data suggest that the

activity of this nuclear retention element can be over-ridden by extending the RNA at the 5’end

or by the inclusion of introns in the transcript. Importantly, my findings suggest that, in the

absence of any cis-element, an mRNA is exported to the cytoplasm. This is contrary to most

currently accepted models of mRNA nuclear export.

62

3.3 Materials and Methods

Plasmid Constructs. MHC-ftz-∆i, c-ftz-∆i, c-ftz-i, MHC-βG-∆i, MHC-ftz-∆i-βG-∆i, βG-∆i, βG-i

in pCDNA3 were described previously (Akef et al., 2013; Palazzo et al., 2007; Valencia et al.,

2008). The series of MHC-ftz-∆i and MHC-βG-∆i deletions were performed using primers that

anneal upstream and downstream of the sequence to be deleted. After the PCR reaction, the

products were treated with DpnI, Polynucleotide Kinase (PNK) and ligated using T4 DNA

ligase. The F1-βG-∆i to F4-βG-∆i constructs were generated using restriction free cloning (van

den Ent and Löwe, 2006), where the respective sequence was amplified using c-ftz-∆i as a

template. The PCR products were run on a gel and purified using DNA extraction kit (Qiagen).

The purified products were inserted right after the start codon of βG-∆i using a PCR reaction.

The RC-MHC-ftz-∆i-βG-∆i and βG-∆i-βG-∆i were constructed by amplifying MHC-ftz-Δi or βG-

∆i using a reverse primer that contained a HindIII site just upstream of the stop codon. The PCR

products were digested with HindIII and ligated into βG-Δi pCDNA3 that was cut with the same

enzyme. The series of B1-βG-∆i to B3-βG-∆i constructs were generated by amplifying 330

nucleotide sequences from βG-∆i using a reverse primer that contained a KpnI site and ligated

into βG-Δi pcDNA 3 that was cut with the same enzyme. To generate B1-Δi construct, a forward

primer that anneals downstream of the XhoI site and a reverse primer that anneals to the end of

the B1 insert in the B1-βG-Δi construct were used in a PCR reaction that had βG-Δi as a

template. The PCR products were DpnI treated, PNK treated and ligated using T4 DNA ligase.

The βG-ftz intron EJ1 and βG-ftz intron EJ2 constructs were generated by amplifying the intron

of ftz-i using primers that anneal at their 5’ends to the endogenous exon-exon junctions 1 and 2

of βG-Δi. These introns were then inserted into βG-Δi by restriction free cloning PCR

amplification. DH5α E. coli cells were transformed with the cloned plasmids. A description of

the various constructs used in this chapter is shown in Table 3.1.

Cell lines and Tissue culture. Human osteosarcoma (U2OS) cells were maintained in high

glucose DMEM (Wisent) containing 10% FBS (Wisent) and antibiotics (Sigma). Mouse

fibroblasts (NIH 3T3) were maintained in high glucose DMEM containing 10% calf serum

(Wisent) and antibiotics (Sigma). The following drugs were used: puromuycin (Sigma) was used

at 200 µM, homoharringtonine (HHT) (Tocris Bioscience) was used at 5µM and α-amanitin

(Sigma) was used at 1µg/mL.

63

Table 3.1. A description of the constructs used in Chapter 3.

Construct Description MHC-ftz-∆i See Palazzo et al. (2007) c-ftz-∆i See Palazzo et al. (2007) MHC-βG-Δi See Akef et al. (2013) βG-∆i See Valencia et al. (2008) βG-i See Akef et al. (2013) c-ftz-i See Palazzo et al. (2007) F1-βG-∆i Sequence -20 to 99 of c-ftz-∆i inserted downstream of nucleotide 3 of βG-∆i (A

of ATG as position 1) F2-βG-∆i Sequence 80 to 199 of c-ftz-∆i inserted downstream of nucleotide 3 of βG-∆i F3-βG-∆i Sequence 180 to 299 of c-ftz-∆i inserted downstream of nucleotide 3 of βG-∆i F4-βG-∆i Sequence 280 to 399 of c-ftz-∆i inserted downstream of nucleotide 3 of βG-∆i MHC-ftz-∆i Del 1 Sequence 67 to 116 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 2 Sequence 117 to 166 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 3 Sequence 167 to 216 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 4 Sequence 217 to 266 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 5 Sequence 267 to 316 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 6 Sequence 317 to 366 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 7 Sequence 367 to 416 deleted from MHC-ftz-∆i MHC-ftz-∆i Del 8 Sequence 417 to 468 deleted from MHC-ftz-∆i MHC-ftz-∆i-βG-∆i Sequence -20 to 465 of MHC-ftz-∆i inserted at the HindIII site upstream of βG-∆i RC-MHC-ftz-∆i-βG-∆i

The reverse complement of sequence -20 to 465 of MHC-ftz-∆i inserted at the HindIII site upstream of βG-∆i

βG-∆i-βG-∆i Sequence 1 to 441 of βG-∆i inserted at the HindIII site upstream of βG-∆i B1-βG-∆i Sequence -44 to 285 of βG-∆i inserted at the KpnI site upstream of βG-∆i B2-βG-∆i Sequence 61 to 390 of βG-∆i inserted at the KpnI site upstream of βG-∆i B3-βG-∆i Sequence 166 to 495 of βG-∆i inserted at the KpnI site upstream of βG-∆i MHC-βG-Δi Del 1 Sequence -44 to 2 deleted from MHC-βG-Δi MHC-βG-Δi Del 2 Sequence 64 to 120 deleted from MHC-βG-Δi MHC-βG-Δi Del 3 Sequence 121 to 230 deleted from MHC-βG-Δi MHC-βG-Δi Del 4 Sequence 231 to 340 deleted from MHC-βG-Δi MHC-βG-Δi Del 5 Sequence 341 to 450 deleted from MHC-βG-Δi MHC-βG-Δi Del 6 Sequence 429 to 555 deleted from MHC-βG-Δi βG-∆i-ftz intron EJ 1 Sequence 302 to 448 of c-ftz-i inserted downstream of nucleotide 92 of βG-∆i βG-∆i-ftz intron EJ 2 Sequence 302 to 448 of c-ftz-i inserted downstream of nucleotide 315 of βG-∆i B1-∆i Sequence 286 to 500 deleted from βG-Δi

64

Transfection, Microinjection, FISH, and Immunostaining. Cells were plated on 22x22 mm

acid-washed cover slips (VWR) in 35 mm mammalian tissue culture dishes (Thermo Scientific)

for 24 hours prior to injection or transfection. Cells were transfected using GenJet in vitro DNA

Transfection Reagent for U2OS (SignaGen Laboratories) according to the manufacturer’s

protocol. DNA microinjections were performed as previously described (Akef et al., 2013).

Fluorescence in situ hybridization (FISH) mRNA staining was performed as previously

described (Akef et al., 2013). The probe oligonucleotide sequences used included anti-ftz

(GTCGAGCCTG CCTTTGTCAT CGTCGTCCTT GTAGTCACAA CAGCCGGGAC

AACACCCCAT), anti-βG (CTTCATCCAC GTTCACCTTG CCCCACAGGG

CAGTAACGGCA GACTTCTCCT CAGGAGTCA), and anti-MHC probe (TCTGAGTCGG

AGCCAGGGCG GCCGCCAACA GCAGGAGCAG CGTGCACGGT).

Imaging, and Image Analysis. Cells were imaged using a fluorescence microscope (Nikon) as

previously described (Akef et al., 2013). Image analysis, including the quantification of mRNA

export, was performed using Nikon Imaging Software (NIS) Elements Advanced Research

(Nikon).

Northern blotting. Total RNA was isolated from transfected cells using Tri reagent (MRC)

according to the manufacturer’s protocol. The RNA was separated on a denaturing 1% agarose

gel in MOPS buffer. The gel was stained with ethidium bromide to visualize total RNA (mostly

comprising of rRNA) as a loading control. The RNA was transferred overnight to a

nitrocellulose membrane. Subsequently, the membrane was UV crosslinked and the RNA

hybridized to a 32P-labelled probe overnight in Church buffer 65°C. The membrane was imaged

using a Typhoon phosphoimager system. The probe was generated first restricting the plasmid

using HindIII and XhoI (NEB), gel purifying the restricted fragment and using Prime a gene kit

(Promega) in the presence of α32P-dATP.

Endpoint RT-PCR. To assess the efficiency of splicing for intron containing mRNAs, total

RNA was isolated from transfected cells. The RNA was reverse transcribed using SuperscriptIII

(Invitrogen) according to the manufacturer’s protocol. Subsequently, the cDNA was was

amplified using primers that are upstream and downstream of the introns. The amplicons were

separated on an agarose gel and stained with ethidium bromide. ePAT was performed as

previously described (Jänicke et al., 2012). Briefly, the RNA was isolated using Tri Reagent

65

(MRC) and extended using Klenow (NEB). Subsequently, the RNA was reverse transcribed

using SuperscriptIII (Invitrogen). The cDNA was amplified and separated on an agarose gel

which was stained with ethidium bromide.

RNA Immunoprecipitation. Cell lysate from transfected cells was incubated for 10-14 hours

with either rat anti-UAP56 antibodies (Yamazaki et al., 2010) or non-immune rat serum prebound

to protein G sepharose (Invitrogen). The cDNA was synthesized using SuperScript III

(Invitrogen) according to the manufacturer’s protocol. qPCR was performed by mixing the

cDNA with Power Sybr Green Master Mix (Invitrogen) and the reaction was run on a CFX384

Touch Real Time PCR Detection System (Bio-Rad). The efficiency of the IP reaction was

confirmed by separating the cell lysate and immunoprecipitates by SDS-PAGE, transferring the

proteins to nitrocellulose and immunoblotting for UAP56 using rabbit anti-UAP56 antibodies

(Sigma).

66

3.4 Results

3.4.1 Intronless β-Globin mRNA contains a nuclear retention element

Previous studies showed that the SSCR can promote the nuclear export of microinjected

in vitro trasncribed ftz mRNA (Cenik et al., 2011; Palazzo et al., 2007). However, a more recent

study demonstrated that SSCRs do not enhance the nuclear export of ftz mRNAs that were

transcribed in vivo from microinjected or transfected plasmids (Lee et al., 2015). Moreover, I

previously found that the SSCR could not promote the nuclear export of an intronless version of

the βG mRNA (βG-∆i) as described in chapter 2. In contrast, mRNA produced from a fusion

gene containing this SSCR, the ftz ORF (thus lacking its nuclear retention element) and βG-∆i

(MHC-ftz-∆i-βG-∆i) was efficiently exported (Fig. 2.1B-C). In light of these results, I

hypothesized that ftz mRNA might contain a cis-element that promotes its nuclear export.

To investigate this possibility, I divided the ftz gene into 4 fragments and fused each of

these to the 5’ end of βG-∆i (fusion constructs, F1-βG-∆i through F4-βG-∆i, are shown in Fig.

3.1A, for more details see Table 3.1). The plasmids were transfected into U2OS cells and the

mRNA was visualized by FISH. Subsequently, the cells were imaged using fluorescence

microscopy. To my surprise, all four of the constructs produced mRNA that was partially

cytoplasmic (Fig. 3.1B-C). In contrast βG-∆i was mainly nuclear, and the fusion of full length

MHC-ftz-∆i to βG-∆i, was primarily found in the cytoplasm (Fig. 3.1B-C).

Several models could explain these results. In the simplest model, each of the four ftz fragments

contains a distinct nuclear export-promoting element that functions in an additive manner.

However, when I investigated the distribution of mRNAs generated from various deletion MHC-

ftz-∆i deletion constructs (Fig. 3.1A), all of these were found in the cytoplasm at approximately

the same level (Fig. 3.1D-E). Although this result does not rule out the idea that ftz has multiple

nuclear export-promoting elements, this possibility became less likely.

In a second model, longer intronless mRNAs are simply more efficiently exported than

shorter ones. This would explain the relative degrees of cytoplasmic accumulation where

68

Figure 3.1. Fusions of ftz fragments to full length βG mRNA are cytoplasmic at steady

state.

(A) A schematic representation of the different constructs that were used in this figure. (B-E)

Plasmids containing the indicated constructs were transfected into human U2OS cells. After 14-

18 hours, the cells were fixed, permeabilized, and stained for mRNA using a FISH probed

directed against βG (B-C) or the MHC SSCR (D-E). The cells were imaged (B, D) and mRNA

distribution in the cytoplasm and nucleus was quantified (C, E). Each bar represents the average

and standard error of three independent experiments, with each experiment consisting of at least

30 cells. Scale bar = 20 µm.

69

MHC-ftz-βG-∆i is more cytoplasmic than any of the fusion constructs (F1-βG-∆i through F4-

βG-∆i), which in turn are more cytoplasmic than MHC-βG-∆i (Akef et al., 2013), which is

slightly more cytoplasmic than βG-∆i. Indeed, it has been previously shown that certain RNA

binding proteins are differentially recruited to RNAs of different lengths and that these binding

events can impact nuclear export (Masuyama et al., 2004; McCloskey et al., 2012). However,

this second hypothesis would not be able to explain the efficient export of intronless ftz, which is

approximately the same size as βG-∆i.

In the third model, I considered the possibility that βG had a cis-element that retained the

RNA in the nucleus, and that this activity could be overcome by either splicing (as is the case of

the intron containing βG, [βG-i]) or by the incorporation of extra sequence into the 5’end of the

transcript. If this idea was correct, I reasoned that the incorporation of any random sequence into

βG-∆i, provided that this additional RNA did not contain any additional nuclear retention

elements, should promote its export. Indeed I found that mRNA produced from the fusion of the

reverse complement of MHC-ftz-∆i to the 5’end of βG-∆i (to form RC-MHC-ftz-∆i-βG-∆i, see

Fig. 3.2A and Table 3.1) was distributed primarily to the cytoplasm in cells that were either

transfected with a plasmid that contains this fusion gene (Fig. 3.2B-C) or in cells that received

this plasmid by microinjection (Fig. 3.2D). I obtained the same result in microinjected NIH 3T3

cells (Fig. 3.2E-F), indicating that this effect was not cell-type specific. Furthermore, this

distribution was nearly identical to that of MHC-ftz-∆i-βG-∆i (Fig. 3.2B-F). In contrast, a

tandem repeat of βG-∆i (βG-∆i-βG-∆i, see Fig. 3.2A and Table 3.1) was retained in the nucleus,

to the identical extent as the original βG-∆i (Fig. 3.2B-C). This result can be explained by the

fact that this longer mRNA (βG-∆i-βG-∆i) now had a second putative nuclear retention element.

With the data that I collected thus far, I could not rule out the possibility that export-

promoting elements were found throughout ftz-∆i and in the reverse complement of MHC-ftz-∆i.

I reasoned that of all the transcripts that I have tested thus far, the most unlikely place to find an

export-promoting element would be in βG-∆i itself. I thus started off with the tandem construct

(βG-∆i-βG-∆i) and deleted portions of the first copy of βG-∆i with the goal of eliminate its

nuclear retention element (see B1-βG-∆i through B3-βG-∆i Fig. 3.2A and Table 3.1). Using this

approach I sought to effectively lengthen the βG-∆i mRNA without incorporating a second

nuclear retention element and at the same time avoiding the inadvertent insertion of a nuclear

71

Figure 3.2. RNA insertions into the 5’end of βG mRNA promotes nuclear export.

(A) A schematic representation of the different fusion constructs that were used in this figure.

(B-C) Plasmids containing the indicated constructs were transfected into human U2OS cells.

After 14-18 hours, the cells were fixed, permeabilized and stained for mRNA using a FISH

probed directed against βG. The cells were imaged (B) and mRNA distribution was quantified

(C). Each bar represents the average and standard error of three independent experiments, each

consisting of at least 30 cells. (D-F) Plasmids containing the indicated constructs were

microinjected into the nuclei of U2OS (D) or NIH 3T3 (E-F) cells. After 20 minutes, cells were

treated with α-amanitin and the newly synthesized mRNA was allowed to be exported for 2 h.

Cells were fixed, permeabilized, stained for mRNA using a FISH probed directed against βG and

imaged. Examples of mRNA FISH staining in NIH3T3 cells are shown in (E). mRNA

distribution was quantified for injected U2OS (D) and NIH3T3 (F), with each bar representing

the average and standard error of three independent experiments, with each experiment

consisting of at least 30 cells. (G-H) Plasmids containing the indicated constructs were

transfected into human U2OS cells. After 14-18 hours, the cells were fixed and permeabilized,

stained for mRNA using a FISH probed directed against βG, imaged (G) and mRNA distribution

was quantified (H). Each bar represents the average and standard error of three independent

experiments, each consisting of at least 30 cells. Scale bar = 20 µm.

72

export element. Since it appeared that the size of the insert dictated the level of export, I made

only small deletions to the first copy of βG-∆i. I found that one of the three new fusion

constructs (B1-βG-∆i) was indeed exported (Fig. 3.2G-H). When the nuclear export versus the

RNA length of the various βG-∆i fusion constructs was plotted, I saw a correlation between

these two variables (Fig. 3.3, see black data points). The only exceptions were the βG-∆i-βG-∆i

tandem construct, B2-βG-∆i and B3-βG-∆i (Fig. 3.3, see grey data points), likely because these

all had two copies of the nuclear retention element.

From these experiments I concluded that βG-∆i has a nuclear retention element near its

3’end. My data suggested that the activity of this element could be inhibited by simply extending

the length of the RNA at the 5’end, or by incorporating an intron in the pre-mRNA. While it is

still possible that the B1 region of βG-∆i has a nuclear export element, a counter-acting cis-

element would need to be invoked to explain why βG-∆i is not exported in the first place.

3.4.2 Mapping the nuclear retention elements in βG-∆i

To better define the retention element we tested various deletion constructs of βG-∆i (a

schematic illustration of the constructs is shown in Fig. 3.4A, also see Table 3.1). Since all of

the constructs contained the MHC SSCR, I could use FISH probes against this common region to

visualize all of the deletion constructs. I found that all of these constructs (MHC-βG-∆i Del1

through Del6) were distributed primarily to the nucleus (Fig. 3.4B-C). One possible explanation

for this result is that there are two redundant nuclear retention elements, both of which map to

the region that was deleted to form the B1-βG-∆i construct, and thus residing near the 3’end.

I generated a new construct, B1-∆i construct (Fig. 3.4A). The B1 region was identical to

the first part of the B1-βG-∆i construct (see Fig. 3.2A and Table 3.1) and was missing a 215

nucleotide fragment that matched the portions of βG-∆i that were deleted in MHC-βG-∆i Del5

and Del6 (Fig. 3.4A, Table 3.1). Since the βG FISH probe could detect this construct, I did not

need to add the MHC SSCR to the 5’end. The B1-∆i mRNA was more efficiently exported than

βG-∆i (Fig. 3.4D-E), confirming that the 3’ end of the βG-∆i was required for nuclear retention.

Interestingly, the B1-∆i mRNA was still not as efficiently exported as ftz-∆i or the MHC-ftz-∆i-

βG-∆i fusion. This leaves open the possibility that ftz-∆i may indeed contain nuclear export-

73

Figure 3.3. Extending the length of βG-∆i mRNA promotes its nuclear export.

For each of the fusion constructs in Figures 3.1A, 3.2A and 3.4A, the length of insertion added

upstream of the βG-∆i ORF mRNA is plotted against the percentage of cytoplasmic to total

mRNA. Consistent with the idea that the 3’ terminal portion of the βG-∆i mRNA contains a

nuclear retention element, constructs that contain one copy this region are in black and generally

follow one trend, while constructs that contain two copies of this region are in grey, are more

nuclear and follow a different trend. Note that the data were obtained from different experiments

that were not all done in parallel but all performed in U2OS cells.

74

Figure 3.4. The 3’end of βG-∆i is required for nuclear retention.

(A) A schematic representation of the different constructs that were used in this figure. (B-E)


18 hours, the cells were fixed, permeabilized and stained for mRNA using a FISH probed

directed against the MHC SSCR (B-C) or βG (D-E). The cells were imaged (B, D) and mRNA

distribution was quantified (C, E). Each bar represents the average and standard error of three

independent experiments, each experiment consisting of at least 30 cells. Scale bar = 20 µm.

75

promoting elements. Alternatively the B1 region may contain additional cis-elements that alter

mRNA export dynamics.

3.4.3 The activity of the βG retention element(s) can be inhibited by splicing

Having uncovered evidence of a nuclear retention element localized to the 3’end of the

βG-∆i mRNA, I re-investigated how splicing of the intron-containing version of βG-i overcame

this activity. The human βG pre-mRNA has two introns, one in the 5’end of the transcript, and a

second one in the 3’end (Fig. 3.5A). The second intron lies within the 215 nucleotide sequence

that was required for nuclear retention. I reasoned that either the nuclear retention activity could

be overcome by splicing, that the endogenous βG introns have some specialized activity, or that

the second intron simply disrupted the retention element in the pre-mRNA. To distinguish

between these possibilities, I started off with the βG-∆i gene and inserted the ftz intron into the

position where either the first or second βG introns naturally reside (these being the first or

second exon junctions - EJ1 or EJ2, see βG-ftz intron EJ1 and EJ2, Fig. 3.5A). Constructs

containing the ftz intron at either position were efficiently spliced as assayed by northern blot

(Fig. 3.5B) and RT-PCR (Fig. 3.5C). Furthermore, both mRNAs were efficiently exported (Fig.

3.5D-E) comparable to a version of spliced βG mRNA (βG-i) that was generated from a pre-

mRNA containing its two endogenous introns (βG-i).

These results suggested that there is likely nothing special in the endogenous βG introns

that allow them to overcome the nuclear retention element. The data also indicates that the

introns do not promote export by disrupting the element in the pre-mRNA, as this element is

intact in the βG-ftz intron EJ1 construct. Rather, the results indicate that splicing per se,

regardless of where the splicing occurs, is sufficient to overcome the activity of the nuclear

retention element.

3.4.4 Nuclear/cytoplasmic distribution correlates with mRNA levels

While examining my FISH images, I noticed that all βG mRNAs that were primarily

localized to the nucleus also gave weak fluorescent signals. To further study this, I monitored the

76

Figure 3.5. Splicing is sufficient to overcome the nuclear retention element present in βG-∆i

mRNA.

(A) A schematic representation of the intron containing constructs used in this figure. (B-E)


18 hours, RNA was isolated (B-C) or cells were fixed, permeabilized, and stained for mRNA

using a FISH probed directed against βG (D-E). (B) Northern blot using βG-specific probes.

Total RNA (mostly comprising of rRNA) was stained with ethidium bromide as a loading

control. (C) Splicing efficiency of the different reporters was assessed by RT-PCR using RNA

isolated from transfected cells and primers that anneal to the first and third exons of βG-∆i

mRNA (see “RT” reactions). To determine the size of putative unspliced RNAs, PCR reactions

were performed on purified plasmid DNA (see “Plasmid”). To control for the amplification of

transfected plasmid DNA, amplification of isolated cellular RNA was performed without a

77

reverse transcription step (“No RT”). (D) Representative example of imaged cells. Scale bar =

20 µm. (E) mRNA distribution was quantified with each bar representing the average and

standard error of three independent experiments, each experiment consisting of at least 30 cells.

78

levels of each mRNA by northern blot (Fig. 3.5B). Indeed any βG mRNA that was poorly

exported (βG-∆i, βG-∆i-βG-∆i, B2-βG-∆i and B3-βG-∆i) also was present at low levels in

comparison to the well-exported mRNAs. Therefore, it is possible that these transcripts are

exported to the cytoplasm and then rapidly degraded, resulting in a low cytoplasmic/nuclear

ratio. For example, the transcripts can be degraded by non-sense mediated decay (NMD), which

eliminates mRNAs that have premature stop codons and/or aberrant 3’UTRs (Schweingruber et

al., 2013). NMD is activated by translating ribosomes and is eliminated by extended treatments

with translation inhibitors. However treatment of cells with two different translation inhibitors,

puromycin and homoharingtonine (HHT) at concentrations that effectively inhibit translation in

U2OS cells (Cui et al., 2012) had no effect on the cytoplasmic distribution of either βG-∆i or

MHC-βG-∆i Del3, which has a premature termination codon (Fig. 3.6A).

3.4.5 The majority of βG-∆i at steady state is stable and retained in the nucleus

To determine whether the distribution of βG-∆i was due to a high turnover rate, I

measured its half-life by treating transfected cells with the transcriptional inhibitor α-amanitin at

levels which completely block transcription of microinjected plasmids (Gueroussov et al., 2010),

and monitored the amount of βG-∆i mRNA remaining after various time points. Note that α-

amanitin treatment completely blocks transcription within the first 5 minutes of treatment

(Gueroussov et al., 2010). I could not detect any turnover of the mRNA even after a 4 hour

treatment (Fig. 3.6B), despite the fact that a pre-treatment with α-amanitin prevented the

synthesis of this transcript (“Pretreatment”, Fig. 3.6B). This stable RNA remained in the nucleus

throughout the entirety of this time course (Fig. 3.6C). Thus most of the βG-∆i mRNA that is

present in the cell at steady state is stable, yet fails to be exported to the cytoplasm. Similar

results were obtained with ftz mRNA containing the 5’ splice site (Lee et al., 2015). This motif

promoted the rapid turnover of only a fraction of the mRNA, while the portion that evaded this

initial decay step built up over time in the nucleus and represented the majority of the ftz mRNA

that was present at steady state. Like βG-∆i, this stable nuclear fraction of ftz mRNA remained

trapped in the nucleus and was not a substrate for export.

79

Figure 3.6. The majority of the βG-∆i mRNA that is present at steady state is stable and

retained in the nucleus.

(A) To test whether βG-∆i is a substrate for NMD, U2OS cells were transfected for 6 hours, then

treated with either DMSO, puromycin or HHT at levels that completely inhibit translation (see

Cui et al., 2012) for a further 8 hours. Cells were then fixed, permeabilized, stained for mRNA

using a FISH probed directed against βG for βG-∆i or MHC SSCR for MHC- βG-∆i Del 3 and

the levels of nuclear and cytoplasmic RNA were quantified (B-C). U2OS cells were transfected

for 14, then treated with α-amanitin for the indicated times. Then either RNA was collected and

80

analyzed by northern blot using βG-specific probes (B) or cells were then fixed, permeabilized,

stained for mRNA using a FISH probe directed against βG, and the levels of nuclear and

cytoplasmic RNA were quantified (C). To ensure that the α-amanitin inhibited transcription,

cells were first treated with drug then transfected (“Pretreatment”). Total RNA (mostly

comprising of rRNA) was stained with ethidium bromide as a loading control. Each bar in A and

C represents the average and standard error of 3 independent experiments, each of which consists

of at least 30 cells. (D) To compare the length of the poly(A) tail of βG-∆i, βG-i and MHC-ftz-∆i

βG-∆i, cells were transfected with the indicated constructs and the RNA was isolated after 14

hours. RNA was also isolated from untransfected cells to ensure that the specificity of the

detected signal. The length of the poly(A) tails was assessed using ePAT as described previously

(Jänicke et al., 2012). Reverse transcription reactions were performed with either the reverse

transcriptase added, “RT” or not added to the reactions, “No RT”.

81

From these results I conclude that the element present at the 3’ end of the βG-∆i mRNA

acts as a nuclear retention element and likely promotes the decay of a fraction of the newly

synthesized mRNA.

3.4.6 The length of the poly(A) tail is unaltered by the nucleocytoplasmic distribution of the mRNA

Previous studies have suggested a correlation between splicing and 3’ processing (Berg et

al., 2012). Therefore, I wanted to investigate whether the splicing or nucleocytoplasmic

distribution of an mRNA altered the length of the poly(A) tail of the transcript. Using extension

poly(A) test (ePAT) method, I compared the 3’ processing of βG-∆i, an mRNA that is neither

spliced nor exported; βG-i, an mRNA that is both spliced and exported and MHC-ftz-∆i-βG-∆i,

which is not spliced but exported to the cytoplasm (see Fig. 3.2A). Cells were transfected with

the indicated transcripts for 14 hours. Subsequently, the RNA was isolated, annealed to an

anchor primer that binds to the 3’ distal end of the poly(A) tail and extended using Klenow

enzyme as previously described (Jänicke et al., 2012). Next, the RNA was reverse transcribed to

cDNA using the anchor primer and then, amplified with a gene-specific forward primer. As a

control, I also isolated RNA from untransfected cells in order to ensure that the obtained

amplicons were specific to βG RNA. As shown in Fig. 3.6D, the poly(A) tails of βG-i, βG-∆i

and MHC-ftz-∆i-βG-∆i were comparable in length. No signal was obtained from untransfected

cells or when the reverse transcriptase was not added to the reaction.

These results demonstrate that βG 3’ processing is unaffected by the splicing or the

nucleocytoplasmic distribution of the mRNA. Importantly, these results rule out the possibility

that the nuclear retention of βG-∆i can be simply attributed to inefficient polyadenylation.

3.4.7 UAP56 is recruited to the βG-∆i mRNA

To gain further insight into how this nuclear retention element functions, I re-examined

whether components of the TREX complex are recruited to the RNA in a splicing-dependent

manner. I expressed various reporters in U2OS cells and then from these lysates

immunoprecipitated UAP56 (see Fig. 3.7A), a central component of the TREX complex, and

analyzed the precipitated RNA by RT-qPCR. I found that βG-∆i was more highly enriched in the

82

Figure 3.7. Strong UAP56-association with βG-∆i mRNA in vivo.

(A) UAP56 was immunoprecipitated from U2OS lysates using rat anti-UAP56 antibodies pre-

bound to protein G sepharose. The immunoprecipitates were analyzed by immunoblotting for

UAP56. Rat non-immune serum was used in the mock immunoprecipitation reaction. (B-C)

U2OS cells were transfected with plasmids containing βG-∆i (B-C) or βG-i (B). After 14-18

hours, cell lysates were collected and immunoprecipitated with either rat anti-UAP56 antibodies

or rat non-immune serum. RNA was collected and converted to cDNA using βG specific primers

(B) or random hexamers (C). The fold enrichment of mRNAs in anti-UAP56 over non-immune

precipitates was quantified by RT-qPCR. Each bar represents the average and standard error of

three independent experiments.

83

UAP56 precipitates than the spliced version of the transcript (βG-i) (Fig. 3.7B). This co-

precipitation was likely specific as 7SL, a highly abundant ncRNA which is exported by

exportin-5 in vertebrates independently of the TREX complex (Takeiwa et al., 2015), was not

significantly enriched in the precipitates (Fig. 3.7C). This result suggests that the nuclear

retention element traps the mRNA in a UAP56-bound state.

In summary, these results suggest that the presence of introns, and hence their splicing, is

not the sole determinant of UAP56 recruitment to the βG mRNA, as the standard mRNA nuclear

export models would suggest.

84

3.5 Discussion

There has been an ongoing debate as to whether splicing is required for the efficient

export of mRNAs in vertebrate cells (Nott et al., 2003; Valencia et al., 2008). Underlying this

debate is the question of whether mRNAs are natural substrates for nuclear export by the TREX

complex in the absence of either splicing, or any compensatory export-promoting element. The

idea that nuclear export requires specialized signals is based on two pieces of data. First, the

export of certain model mRNAs, such as ftz and βG, were found to be enhanced by splicing (Luo

and Reed, 1999; Valencia et al., 2008). Second, the recruitment of nuclear export factors to the

mRNA in HeLa-derived nuclear extracts were also found to be enhanced by splicing (Cheng et

al., 2006; Chi et al., 2013; Dufu et al., 2010; Masuda et al., 2005; Zhou et al., 2000). There are,

however, a few problems with this view. First, many cDNA-derived mRNAs are well exported

despite the fact that their endogenous genes contain introns (Palazzo and Akef, 2012). Second,

TREX components are known to associate with intronless mRNAs in vivo and are required for

their export (Rodrigues et al., 2001; Taniguchi and Ohno, 2008; Hautbergue et al., 2009; Akef et

al., 2013; Lee et al., 2015). The data suggest that certain cDNA-derived mRNAs, including many

of the ones being studied in various nuclear export labs, contain nuclear retention elements.

Although I cannot rule out the possibility that a wide range of nuclear-export promoting elements

exist in addition to these retention elements, on the whole we now believe that in the absence of

any specialized cis-element, mRNAs are substrates for nuclear export (Fig. 3.8). This also

resolves an apparent difference that emerged between mRNA export in vertebrates and yeast,

where splicing is known to be dispensable for nuclear export.

In light of my new findings, I can now re-interpret relevant previously published data. It

had been previously reported that the fusion of 16 CAR-E motifs to the 5’ end of the βG-∆i

mRNA promoted export, while the fusion mutant versions of these CAR-Es did not (Lei et al.,

2012). Our new data suggests that a simple extension of the βG-∆i mRNA promotes export by

overcoming nuclear retention elements present at the 3’ end of the transcript (Fig. 3.8). Looking

closely at the mutant CAR-E insertions, they contained a high level of pyrimidines, and were

found to be associated with poly-pyrimidine track-binding (PTB) protein as assessed by mass

spectrometry analysis (Lei et al., 2012). Interestingly, it has been previously reported that PTB

85

inhibits nuclear RNA export (Roy et al., 2013). Thus it is possible that the mutant CAR-Es acted

as nuclear retention elements.

It is likely that these nuclear retention elements are widely distributed, as many cDNA-

derived RNAs are known not to be efficiently exported (some examples include the major late

adenovirus RNA (Luo et al., 2001), a fragment of the Xenopus Smad 3 gene (Valencia et al.,

2008), Slu7 and DDX3 (Lei et al., 2012)). There have been a few reports describing how the

association of certain RNA binding proteins with an RNA promotes its nuclear retention. Factors

that are known to have this activity include not only PTB, but also hnRNP A2 (Lévesque et al.,

2006), hnRNP U (Hacisuleyman et al., 2014), U2AF65 (Takemura et al., 2011) and U170K

(Takemura et al., 2011). The data suggests that although splicing may not be required for the

export of every mRNA, splicing does help to export those that have certain nuclear retention

elements, such as the one found in the βG gene (Fig. 3.8). Interestingly, splicing does not

effectively overcome nuclear retention elements found in certain lncRNAs (Hacisuleyman et al.,

2014).

Large scale analyses of mRNA distribution, have indicated that a significant fraction of

human mRNAs are predominantly distributed to the nucleus at steady state (Djebali et al., 2012).

This diverse distribution of mRNA has a profound effect on the proteome of human cells.

Ultimately a deeper understanding of all the cis-elements that govern nuclear retention and

export will provide a better understanding of how various mRNAs are either exported or retained

in the nucleus.

86

Figure 3.8. Model of how the βG nuclear retention element affects mRNA nuclear export.

87

Chapter 4

Conclusions and Future Directions

88

4.1 Summary of thesis

The overarching aim of this thesis is to dissect the molecular mechanisms that regulate

mRNA nuclear export in mammalian cells. In particular, I sought to identify the sequence

features within a transcript that determine its cellular localization. The most well-established

model in the field postulated that for an mRNA to be efficiently transported to the cytoplasm, it

needs to possess certain hallmarks such as introns or nuclear export-promoting sequences such as

CAR-Es (Lei et al., 2011, 2012; Luo and Reed, 1999; Valencia et al., 2008). This model was

based on data demonstrating that spliced but not intronless βG mRNA was efficiently exported to

the cytoplasm (Valencia et al., 2008). The data also suggested that the TREX complex was

preferentially recruited to spliced mRNAs or mRNAs that contained several copies of CAR-E

(Cheng et al., 2006; Masuda et al., 2005; Lei et al., 2011, 2012). The coupling of splicing and

nuclear export was proposed to occur in nuclear speckles, a nuclear compartment where both

splicing factors and components of the TREX complex localize (Dias et al., 2010).

However, this model suffered several problems. First, many intronless mRNAs have been

reported to be efficiently exported to the cytoplasm independently of splicing (Lu and Cullen,

2003; Nott et al., 2003). Second, components of the TREX complex were demonstrated to bind

intronless mRNAs (Taniguchi and Ohno, 2008). Third, while several lncRNAs are spliced, many

of them are not efficiently exported to the cytoplasm suggesting that splicing is not sufficient to

promote mRNA transport to the cytoplasm (for example, see Hacisuleyman et al., 2014).

As a result, I re-examined the necessary features within a transcript that are required so as

to be efficiently exported to the cytoplasm. I discovered that intronless βG mRNA contained

nuclear retention RNA elements that inhibited its transport to the cytoplasm. This nuclear

retention activity can be overcome when βG mRNA was either spliced or its length extended. I

also discovered that the TREX component UAP56 was bound to intronless ftz and βG mRNAs

independently of splicing. The binding of UAP56 to the inefficiently exported βG-∆i suggested

that UAP56 recruitment to the mRNA was insufficient to overcome its nuclear retention. My

data also identified a correlation between an mRNA’s ability to partition to speckles and its

efficient export to the cytoplasm. My results suggested that the recruitment of UAP56 to

intronless ftz mRNAs occurs within speckles and that depleting the levels of UAP56 led to ftz

entrapment in speckles. I also discovered that certain TREX-dependent mRNAs also required

89

CRM1 activity for speckle egress and efficient export to the cytoplasm. In sum, these results

suggested that most mRNAs are exported to the cytoplasm independently of splicing unless they

contain a nuclear retention element.

90

4.2 Future Directions

4.2.1 Identifying the molecular factors responsible for the nuclear retention of βG-∆i mRNA

Rationale:

While my results demonstrate the presence of a nuclear retention element in βG-∆i

mRNA, the molecular mechanisms that impede the export of βG-∆i mRNA are still unknown. In

order to identify the factors that bind to βG-∆i mRNA and cause its nuclear retention, the mRNP

composition of βG-∆i and B1-βG-∆i will be compared using affinity purifications coupled to

mass spectrometry. B1-βG-∆i was chosen because it consists entirely of sequences derived from

the ORF of βG-∆i and it is efficiently exported to the cytoplasm as previously shown (Fig. 3.2G-

H).

Proposed experiments:

DNA plasmids that code for either the βG-∆i or B1-βG-∆i mRNA each containing an

aptamer (PP7) in its 3’ UTR will be expressed in mammalian cells. Subsequently, βG-∆i mRNPs

and B1-βG-∆i mRNPs can be affinity-purified using a pseudomonas phage coat protein (PP7CP)

that is fused to protein A. The whole complex can be isolated using rabbit IgG conjugated beads.

After several washes, the isolated proteins can be eluted by RNase treatment and identified using

mass spectrometry. This procedure has been previously reported (Hogg and Goff, 2010). Any

identified hit that might mediate mRNA nuclear retention can be tethered to the efficiently

exported ftz mRNA in order to investigate if that candidate protein has nuclear retention activity.

The tethering protocol involves co-expressing ftz mRNA that contains several MS2-binding

stem-loops and the identified candidate fused to the MS2 phage coat protein as previously

described (Bertrand et al., 1998; Fusco et al., 2003).

Potential shortcomings and alternative approaches:

Since the majority βG-∆i mRNAs are not stable in vivo (Fig. 3.5), it is conceivable that

insufficient amounts of βG-∆i mRNPs might be purified for mass spectrometry in order to

identify the factors bound to βG-∆i mRNAs in vivo. An alternative approach is to use in vitro

91

binding assays where the last 215 nucleotides of the ORF of βG-∆i mRNA are synthesized in

vitro. This RNA will be biotinylated and added to nuclear extract. Subsequently, the RNA will

be purified using streptavidin conjugated beads and the bound proteins eluted by RNase

treatment and sent for mass spectrometry. However, the disadvantage of this assay is that the

proteins bound to βG-∆i mRNA in vitro might not be binding to βG-∆i mRNA in vivo and thus

are not physiologically relevant. Any identified hits will be tethered to ftz mRNA as described

previously to examine if they mediate ftz mRNA nuclear retention.

4.2.2 Examining the nuclear export kinetics of endogenous mRNAs

Rationale:

The results described in this thesis were based on introducing DNA plasmids that code

for various reporter constructs in mammalian cells. Although my work has shown that mRNAs

do not require cis-elements for efficient nuclear export, many mRNAs may contain nuclear

retention elements and CRM1-sensitivity elements. Additionally, it is an open question whether

the conclusions derived from the results reported in this thesis can be generalized to describe the

mechanisms underlying the nuclear export of mRNAs transcribed from endogenous loci in

mammalian cells. Based on the splicing-dependent mRNA nuclear export model, all spliced

endogenous mRNAs should be comparably exported to the cytoplasm. An alternative hypothesis

is that endogenous mRNAs contain RNA elements that modulate the kinetics of their transport to

the cytoplasm. The proposed experiments below aim to identify whether different subsets of

endogenous mRNAs are transported to the cytoplasm at different rates and if this is the case,

what are the RNA elements that regulate the nuclear export of endogenous mRNAs.

Proposed Experiments:

In order to follow the kinetics of endogenously expressed mRNA transport to the

cytoplasm. The cells can be pulsed with 5-ethynyluridine (EU). EU is a nucleotide analogue that

will get incorporated into the nascent transcripts. After the EU pulse, the cells are washed and

left for various timepoints before the cells are biochemically fractionated into nuclear and

cytoplasmic fractions. Subsequently, total RNA from the cellular fractions will be isolated and

the labelled transcripts will be reacted with azide-conjugated biotin using click chemistry as

previously described (Jao and Salic, 2008). The isolated RNA can be affinity-purified using

92

streptavidin beads. Next, EU labelled mRNAs will be further enriched from total labelled RNAs

using oligo-dT beads. The nuclear and cytoplasmic mRNAs from the various timepoints will be

identified using RNA-Sequencing (RNA-Seq). For every expressed mRNA, the rate of its

nuclear export will be assessed by quantifying the cytoplasmic fraction of that transcript at the

different timepoints. These experiments could then be repeated in cells treated with LMB in

order to determine which mRNAs require CRM1 for their export.

Ultimately, the rates of nuclear export of endogenous mRNAs will be compared to assess

whether different subsets of endogenous mRNAs followed different nuclear export kinetics. If

this is the case, bioinformatic motif search will be employed in order to identify common RNA

motifs between transcripts that had comparable nuclear export kinetics. Bioinformatic

approaches have been previously developed and applied towards predicting short contiguous

sequences that are enriched in a subset of mRNAs within large scale transcriptomic datasets ( for

example, see Li et al., 2010; Laver et al., 2015). Any identified motifs will be inserted in mRNA

reporters in order to validate the results of the bioinformatic analyses. For example, a motif

identified to be enriched in mRNAs with slow nuclear transport kinetics will be inserted into the

efficiently exported ftz mRNA in order to test if that motif is sufficient to impede the transport of

ftz mRNA to the cytoplasm. In order to test whether that motif is necessary for slowing mRNA

nuclear export, several cDNAs that contain this motif will be subcloned into mammalian

expression vectors where the identified motif is either left intact or deleted from the mRNA.

Subsequently, these construct will be microinjected in mammalian cells and the nuclear export

kinetics of mRNAs that either contain or lack this motif will be compared.

Alternative approaches:

If various populations of endogenous mRNAs exhibit different nuclear export kinetics

but the bioinformatic analysis fails to pinpoint specific motifs that regulate mRNA nuclear

export, I will attempt to identify RNA sequences that regulate mRNA nuclear export by selecting

a representative sample of the most efficiently exported mRNAs and the least efficiently

exported ones. Subsequently, I will systemically generate truncation constructs where I will

delete fragments from the sequences of the cDNAs. I will express these constructs in U2OS cells

in order to empirically identify the sequences that are necessary for enhancing or impeding

mRNA nuclear export.

93

4.3 Concluding remarks

The results outlined in this thesis demonstrated that mammalian cells employ several

mechanisms such as trafficking through speckles and RNA nuclear retention elements to regulate

mRNA nuclear export. These layers of regulation likely function to help the cells identify which

transcripts should be transported to the cytoplasm and subsequently translated into proteins.

These results have advanced our understanding of the various mechanisms that eukaryotic cells

employ towards regulating post-transcriptional gene expression.

94

References Akef, A., Zhang, H., Masuda, S., and Palazzo, A.F. (2013). Trafficking of mRNAs containing

ALREX-promoting elements through nuclear speckles. Nucleus 4, 326–340.

Alcázar-Román, A.R., Tran, E.J., Guo, S., and Wente, S.R. (2006). Inositol hexakisphosphate

and Gle1 activate the DEAD-box protein Dbp5 for nuclear mRNA export. Nat. Cell Biol. 8,

711–716.

Alcázar-Román, A.R., Bolger, T.A., and Wente, S.R. (2010). Control of mRNA export and

translation termination by inositol hexakisphosphate requires specific interaction with Gle1. J.

Biol. Chem. 285, 16683–16692.

Almada, A.E., Wu, X., Kriz, A.J., Burge, C.B., and Sharp, P.A. (2013). Promoter directionality

is controlled by U1 snRNP and polyadenylation signals. Nature 499, 360–363.

Assenholt, J., Mouaikel, J., Saguez, C., Rougemaille, M., Libri, D., and Jensen, T.H. (2011).

Implication of Ccr4-Not complex function in mRNA quality control in Saccharomyces

cerevisiae. RNA 17, 1788–1794.

Bailer, S.M., Siniossoglou, S., Podtelejnikov, A., Hellwig, A., Mann, M., and Hurt, E. (1998).

Nup116p and nup100p are interchangeable through a conserved motif which constitutes a

docking site for the mRNA transport factor gle2p. EMBO J. 17, 1107–1119.

van Bakel, H., Nislow, C., Blencowe, B.J., and Hughes, T.R. (2010). Most “dark matter”

transcripts are associated with known genes. PLoS Biol. 8, e1000371.

Bartkowiak, B., and Greenleaf, A.L. (2011). Phosphorylation of RNAPII: To P-TEFb or not to

P-TEFb? Transcription 2, 115–119.

Bartolomei, M.S., Zemel, S., and Tilghman, S.M. (1991). Parental imprinting of the mouse H19

gene. Nature 351, 153–155.

Belotserkovskaya, R., and Reinberg, D. (2004). Facts about FACT and transcript elongation

through chromatin. Curr. Opin. Genet. Dev. 14, 139–146.

Berg, M.G., Singh, L.N., Younis, I., Liu, Q., Pinto, A.M., Kaida, D., Zhang, Z., Cho, S., Sherrill-

Mix, S., Wan, L., et al. (2012). U1 snRNP determines mRNA length and regulates isoform

expression. Cell 150, 53–64.

Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S.M., Singer, R.H., and Long, R.M. (1998).

Localization of ASH1 mRNA particles in living yeast. Mol. Cell 2, 437–445.

95

Blevins, M.B., Smith, A.M., Phillips, E.M., and Powers, M.A. (2003). Complex formation

among the RNA export proteins Nup98, Rae1/Gle2, and TAP. J. Biol. Chem. 278, 20979–20988.

Blobel, G. (1985). Gene gating: a hypothesis. Proc. Natl. Acad. Sci. U.S.A. 82, 8527–8529.

Bolger, T.A., Folkmann, A.W., Tran, E.J., and Wente, S.R. (2008). The mRNA export factor

Gle1 and inositol hexakisphosphate regulate distinct stages of translation. Cell 134, 624–633.

Brickner, J.H. (2009). Transcriptional memory at the nuclear periphery. Curr. Opin. Cell Biol.

21, 127–133.

Buratowski, S. (2008). Transcription. Gene expression--where to start? Science 322, 1804–1805.

Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle. Mol. Cell 36,

541–546.

Cabal, G.G., Genovesio, A., Rodriguez-Navarro, S., Zimmer, C., Gadal, O., Lesne, A., Buc, H.,

Feuerbach-Fournier, F., Olivo-Marin, J.-C., Hurt, E.C., et al. (2006). SAGA interacting factors

confine sub-diffusion of transcribed genes to the nuclear envelope. Nature 441, 770–773.

Cáceres, J.F., Screaton, G.R., and Krainer, A.R. (1998). A specific subset of SR proteins shuttles

continuously between the nucleus and the cytoplasm. Genes Dev. 12, 55–66.

Carninci, P., Kasukawa, T., Katayama, S., Gough, J., Frith, M.C., Maeda, N., Oyama, R., Ravasi,

T., Lenhard, B., Wells, C., et al. (2005). The transcriptional landscape of the mammalian

genome. Science 309, 1559–1563.

Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., Semple,

C.A.M., Taylor, M.S., Engström, P.G., Frith, M.C., et al. (2006). Genome-wide analysis of

mammalian promoter architecture and evolution. Nat. Genet. 38, 626–635.

Casolari, J.M., Brown, C.R., Komili, S., West, J., Hieronymus, H., and Silver, P.A. (2004).

Genome-wide localization of the nuclear transport machinery couples transcriptional status and

nuclear organization. Cell 117, 427–439.

Cenik, C., Chua, H.N., Zhang, H., Tarnawsky, S., Akef, A., Derti, A., Tasan, M., Moore, M.J.,

Palazzo, A.F., and Roth, F.P. (2011). Genome analysis reveals interplay between 5’UTR introns

and nuclear mRNA export for secretory and mitochondrial genes. PLoS Genetics 7, e1001366.

Chang, C.-T., Hautbergue, G.M., Walsh, M.J., Viphakone, N., van Dijk, T.B., Philipsen, S., and

Wilson, S.A. (2013). Chtop is a component of the dynamic TREX mRNA export complex.

EMBO J. 32, 473–486.

96

Chang, M., French-Cornay, D., Fan, H.Y., Klein, H., Denis, C.L., and Jaehning, J.A. (1999). A

complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p, and Ccr4p plays a role in

protein kinase C signaling. Mol. Cell. Biol. 19, 1056–1067.

Chávez, S., Beilharz, T., Rondón, A.G., Erdjument-Bromage, H., Tempst, P., Svejstrup, J.Q.,

Lithgow, T., and Aguilera, A. (2000). A protein complex containing Tho2, Hpr1, Mft1 and a

novel protein, Thp2, connects transcription elongation with mitotic recombination in

Saccharomyces cerevisiae. EMBO J. 19, 5824–5834.

Chávez, S., García-Rubio, M., Prado, F., and Aguilera, A. (2001). Hpr1 is preferentially required

for transcription of either long or G+C-rich DNA sequences in Saccharomyces cerevisiae. Mol.

Cell. Biol. 21, 7054–7064.

Chekanova, J.A., Gregory, B.D., Reverdatto, S.V., Chen, H., Kumar, R., Hooker, T., Yazaki, J.,

Li, P., Skiba, N., Peng, Q., et al. (2007). Genome-wide high-resolution mapping of exosome

substrates reveals hidden features in the Arabidopsis transcriptome. Cell 131, 1340–1353.

Chen, W.-H., Wei, W., and Lercher, M.J. (2011). Minimal regulatory spaces in yeast genomes.

BMC Genomics 12, 320.

Cheng, H., Dufu, K., Lee, C.-S., Hsu, J.L., Dias, A., and Reed, R. (2006). Human mRNA export

machinery recruited to the 5’ end of mRNA. Cell 127, 1389–1400.

Cheung, V., Chua, G., Batada, N.N., Landry, C.R., Michnick, S.W., Hughes, T.R., and Winston,

F. (2008). Chromatin- and transcription-related factors repress transcription from within coding

regions throughout the Saccharomyces cerevisiae genome. PLoS Biol. 6, e277.

Chi, B., Wang, Q., Wu, G., Tan, M., Wang, L., Shi, M., Chang, X., and Cheng, H. (2013). Aly

and THO are required for assembly of the human TREX complex and association of TREX

components with the spliced mRNA. Nucleic Acids Res. 41, 1294–1306.

Cho, E.J., Takagi, T., Moore, C.R., and Buratowski, S. (1997). mRNA capping enzyme is

recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-

terminal domain. Genes Dev. 11, 3319–3326.

Clay, O., Cacciò, S., Zoubak, S., Mouchiroud, D., and Bernardi, G. (1996). Human coding and

noncoding DNA: compositional correlations. Mol. Phylogenet. Evol. 5, 2–12.

Clouse, K.N., Luo, M.J., Zhou, Z., and Reed, R. (2001). A Ran-independent pathway for export

of spliced mRNA. Nat. Cell Biol. 3, 97–99.

97

Csuros, M., Rogozin, I.B., and Koonin, E.V. (2011). A detailed history of intron-rich eukaryotic

ancestors inferred from a global survey of 100 complete genomes. PLoS Comput. Biol. 7,

e1002150.

Cui, X.A., Zhang, H., and Palazzo, A.F. (2012). p180 Promotes the Ribosome-Independent

Localization of a Subset of mRNA to the Endoplasmic Reticulum. PLoS Biol 10, e1001336.

Culjkovic, B., Topisirovic, I., Skrabanek, L., Ruiz-Gutierrez, M., and Borden, K.L.B. (2006).

eIF4E is a central node of an RNA regulon that governs cellular proliferation. The Journal of

Cell Biology 175, 415–426.

Daguenet, E., Baguet, A., Degot, S., Schmidt, U., Alpy, F., Wendling, C., Spiegelhalter, C.,

Kessler, P., Rio, M.-C., Le Hir, H., et al. (2012). Perispeckles are major assembly sites for the

exon junction core complex. Mol. Biol. Cell 23, 1765–1782.

Davis, C.A., and Ares, M. (2006). Accumulation of unstable promoter-associated transcripts

upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc. Natl. Acad.

Sci. U.S.A. 103, 3262–3267.

Dias, A.P., Dufu, K., Lei, H., and Reed, R. (2010). A role for TREX components in the release

of spliced mRNA from nuclear speckle domains. Nat Commun 1, 97.

Djebali, S., Davis, C.A., Merkel, A., Dobin, A., Lassmann, T., Mortazavi, A., Tanzer, A.,

Lagarde, J., Lin, W., Schlesinger, F., et al. (2012). Landscape of transcription in human cells.

Nature 489, 101–108.

Doolittle, W.F., Brunet, T.D.P., Linquist, S., and Gregory, T.R. (2014). Distinguishing between

“function” and “effect” in genome biology. Genome Biol Evol 6, 1234–1237.

Dufu, K., Livingstone, M.J., Seebacher, J., Gygi, S.P., Wilson, S.A., and Reed, R. (2010). ATP is

required for interactions between UAP56 and two conserved mRNA export proteins, Aly and

CIP29, to assemble the TREX complex. Genes Dev 24, 2043–2053.

Eberl, D.F., Lorenz, L.J., Melnick, M.B., Sood, V., Lasko, P., and Perrimon, N. (1997). A new

enhancer of position-effect variegation in Drosophila melanogaster encodes a putative RNA

helicase that binds chromosomes and is regulated by the cell cycle. Genetics 146, 951–963.

Ecker, J.R., Bickmore, W.A., Barroso, I., Pritchard, J.K., Gilad, Y., and Segal, E. (2012).

Genomics: ENCODE explained. Nature 489, 52–55.

ENCODE Project Consortium, Birney, E., Stamatoyannopoulos, J.A., Dutta, A., Guigó, R.,

Gingeras, T.R., Margulies, E.H., Weng, Z., Snyder, M., Dermitzakis, E.T., et al. (2007).

98

Identification and analysis of functional elements in 1% of the human genome by the ENCODE

pilot project. Nature 447, 799–816.

ENCODE Project Consortium (2012). An integrated encyclopedia of DNA elements in the

human genome. Nature 489, 57–74.

Estruch, F., and Cole, C.N. (2003). An early function during transcription for the yeast mRNA

export factor Dbp5p/Rat8p suggested by its genetic and physical interactions with transcription

factor IIH components. Mol. Biol. Cell 14, 1664–1676.

Fan, H.Y., Merker, R.J., and Klein, H.L. (2001). High-copy-number expression of Sub2p, a

member of the RNA helicase superfamily, suppresses hpr1-mediated genomic instability. Mol.

Cell. Biol. 21, 5459–5470.

Farny, N.G., Hurt, J.A., and Silver, P.A. (2008). Definition of global and transcript-specific

mRNA export pathways in metazoans. Genes Dev 22, 66–78.

Fasken, M.B., Stewart, M., and Corbett, A.H. (2008). Functional significance of the interaction

between the mRNA-binding protein, Nab2, and the nuclear pore-associated protein, Mlp1, in

mRNA export. J. Biol. Chem. 283, 27130–27143.

Feaver, W.J., Svejstrup, J.Q., Henry, N.L., and Kornberg, R.D. (1994). Relationship of CDK-

activating kinase and RNA polymerase II CTD kinase TFIIH/TFIIK. Cell 79, 1103–1109.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent

and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature

391, 806–811.

Fischer, T., Strässer, K., Rácz, A., Rodriguez-Navarro, S., Oppizzi, M., Ihrig, P., Lechner, J., and

Hurt, E. (2002). The mRNA export machinery requires the novel Sac3p-Thp1p complex to dock

at the nucleoplasmic entrance of the nuclear pores. EMBO J. 21, 5843–5852.

Fischer, T., Rodríguez-Navarro, S., Pereira, G., Rácz, A., Schiebel, E., and Hurt, E. (2004).

Yeast centrin Cdc31 is linked to the nuclear mRNA export machinery. Nat. Cell Biol. 6, 840–

848.

Fleckner, J., Zhang, M., Valcárcel, J., and Green, M.R. (1997). U2AF65 recruits a novel human

DEAD box protein required for the U2 snRNP-branchpoint interaction. Genes Dev. 11, 1864–

1872.

Fornerod, M., Ohno, M., Yoshida, M., and Mattaj, I.W. (1997). CRM1 is an export receptor for

leucine-rich nuclear export signals. Cell 90, 1051–1060.

99

Froula, J.L., and Francino, M.P. (2007). Selection against spurious promoter motifs correlates

with translational efficiency across bacteria. PLoS ONE 2, e745.

Fu, X.D., and Maniatis, T. (1990). Factor required for mammalian spliceosome assembly is

localized to discrete regions in the nucleus. Nature 343, 437–441.

Fuke, H., and Ohno, M. (2008). Role of poly (A) tail as an identity element for mRNA nuclear

export. Nucleic Acids Res. 36, 1037–1049.

Fusco, D., Accornero, N., Lavoie, B., Shenoy, S.M., Blanchard, J.M., Singer, R.H., and

Bertrand, E. (2003). Single mRNA molecules demonstrate probabilistic movement in living

mammalian cells. Curr. Biol. 13, 161–167.

Galy, V., Gadal, O., Fromont-Racine, M., Romano, A., Jacquier, A., and Nehrbass, U. (2004).

Nuclear Retention of Unspliced mRNAs in Yeast Is Mediated by Perinuclear Mlp1. Cell 116,

63–73.

Giorgi, C., Yeo, G.W., Stone, M.E., Katz, D.B., Burge, C., Turrigiano, G., and Moore, M.J.

(2007). The EJC factor eIF4AIII modulates synaptic strength and neuronal protein expression.

Cell 130, 179–191.

Girard, C., Will, C.L., Peng, J., Makarov, E.M., Kastner, B., Lemm, I., Urlaub, H., Hartmuth, K.,

and Lührmann, R. (2012). Post-transcriptional spliceosomes are retained in nuclear speckles until

splicing completion. Nat Commun 3, 994.

Green, D.M., Marfatia, K.A., Crafton, E.B., Zhang, X., Cheng, X., and Corbett, A.H. (2002).

Nab2p is required for poly(A) RNA export in Saccharomyces cerevisiae and is regulated by

arginine methylation via Hmt1p. J. Biol. Chem. 277, 7752–7760.

Gregory, T.R. (2005). Synergy between sequence and size in large-scale genomics. Nat. Rev.

Genet. 6, 699–708.

Gross, T., Siepmann, A., Sturm, D., Windgassen, M., Scarcelli, J.J., Seedorf, M., Cole, C.N., and

Krebber, H. (2007). The DEAD-box RNA helicase Dbp5 functions in translation termination.

Science 315, 646–649.

Gueroussov, S., Tarnawsky, S.P., et al. (2010). Analysis of mRNA nuclear export kinetics in

mammalian cells by microinjection. J Vis Exp 46, 2387.

Hachet, O., and Ephrussi, A. (2001). Drosophila Y14 shuttles to the posterior of the oocyte and is

required for oskar mRNA transport. Curr. Biol. 11, 1666–1674.

Hachet, O., and Ephrussi, A. (2004). Splicing of oskar RNA in the nucleus is coupled to its

cytoplasmic localization. Nature 428, 959–963.

100

Hacisuleyman, E., Goff, L.A., Trapnell, C., Williams, A., Henao-Mejia, J., Sun, L., McClanahan,

P., Hendrickson, D.G., Sauvageau, M., Kelley, D.R., et al. (2014). Topological organization of

multichromosomal regions by the long intergenic noncoding RNA Firre. Nat. Struct. Mol. Biol.

21, 198–206.

Hahn, M.W., Stajich, J.E., and Wray, G.A. (2003). The effects of selection against spurious

transcription factor binding sites. Mol. Biol. Evol. 20, 901–906.

Hautbergue, G.M., Hung, M.-L., Golovanov, A.P., Lian, L.-Y., and Wilson, S.A. (2008).

Mutually exclusive interactions drive handover of mRNA from export adaptors to TAP. Proc.

Natl. Acad. Sci. U.S.A. 105, 5154–5159.

Hautbergue, G.M., Hung, M.-L., Walsh, M.J., Snijders, A.P.L., Chang, C.-T., Jones, R., Ponting,

C.P., Dickman, M.J., and Wilson, S.A. (2009). UIF, a New mRNA export adaptor that works

together with REF/ALY, requires FACT for recruitment to mRNA. Curr. Biol 19, 1918–1924.

Hector, R.E., Nykamp, K.R., Dheur, S., Anderson, J.T., Non, P.J., Urbinati, C.R., Wilson, S.M.,

Minvielle-Sebastia, L., and Swanson, M.S. (2002). Dual requirement for yeast hnRNP Nab2p in

mRNA poly(A) tail length control and nuclear export. EMBO J 21, 1800–1810.

Hieronymus, H., and Silver, P.A. (2003). Genome-wide analysis of RNA-protein interactions

illustrates specificity of the mRNA export machinery. Nat. Genet 33, 155–161.

Hobeika, M., Brockmann, C., Iglesias, N., Gwizdek, C., Neuhaus, D., Stutz, F., Stewart, M.,

Divita, G., and Dargemont, C. (2007). Coordination of Hpr1 and ubiquitin binding by the UBA

domain of the mRNA export factor Mex67. Mol. Biol. Cell 18, 2561–2568.

Hocine, S., Singer, R.H., and Grünwald, D. (2010). RNA processing and export. Cold Spring

Harb Perspect Biol 2, a000752.

Hogg, J.R., and Goff, S.P. (2010). Upf1 senses 3’UTR length to potentiate mRNA decay. Cell

143, 379–389.

Huang, Y., and Carmichael, G.G. (1997). The mouse histone H2a gene contains a small element

that facilitates cytoplasmic accumulation of intronless gene transcripts and of unspliced HIV-1-

related mRNAs. Proc. Natl. Acad. Sci. U.S.A. 94, 10104–10109.

Huang, Y., and Steitz, J.A. (2001). Splicing Factors SRp20 and 9G8 Promote the

Nucleocytoplasmic Export of mRNA. Molecular Cell 7, 899–905.

Huang, Y., Gattoni, R., Stévenin, J., and Steitz, J.A. (2003). SR splicing factors serve as adapter

proteins for TAP-dependent mRNA export. Mol. Cell 11, 837–843.

101

Hurt, E., Luo, M.-J., Röther, S., Reed, R., and Strässer, K. (2004). Cotranscriptional recruitment

of the serine-arginine-rich (SR)-like proteins Gbp2 and Hrb1 to nascent mRNA via the TREX

complex. Proc. Natl. Acad. Sci. U.S.A 101, 1858–1862.

Iglesias, N., Tutucci, E., Gwizdek, C., Vinciguerra, P., Von Dach, E., Corbett, A.H., Dargemont,

C., and Stutz, F. (2010). Ubiquitin-mediated mRNP dynamics and surveillance prior to budding

yeast mRNA export. Genes Dev. 24, 1927–1938.

Irimia, M., and Roy, S.W. (2008). Evolutionary convergence on highly-conserved 3’ intron

structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome. PLoS

Genet. 4, e1000148.

Irimia, M., Penny, D., and Roy, S.W. (2007). Coevolution of genomic intron number and splice

sites. Trends Genet. 23, 321–325.

Jani, D., Lutz, S., Marshall, N.J., Fischer, T., Köhler, A., Ellisdon, A.M., Hurt, E., and Stewart,

M. (2009). Sus1, Cdc31, and the Sac3 CID region form a conserved interaction platform that

promotes nuclear pore association and mRNA export. Mol. Cell 33, 727–737.

Jänicke, A., Vancuylenberg, J., Boag, P.R., Traven, A., and Beilharz, T.H. (2012). ePAT: a

simple method to tag adenylated RNA to measure poly(A)-tail length and other 3’ RACE

applications. RNA 18, 1289–1295.

Jao, C.Y., and Salic, A. (2008). Exploring RNA transcription and turnover in vivo by using click

chemistry. Proc. Natl. Acad. Sci. U.S.A 105, 15779–15784.

Jauvion, V., Elmayan, T., and Vaucheret, H. (2010). The conserved RNA trafficking proteins

HPR1 and TEX1 are involved in the production of endogenous and exogenous small interfering

RNA in Arabidopsis. Plant Cell 22, 2697–2709.

Jimeno, S., Rondón, A.G., Luna, R., and Aguilera, A. (2002). The yeast THO complex and

mRNA export factors link RNA metabolism with transcription and genome instability. EMBO J.

21, 3526–3535.

Johnson, J.M., Edwards, S., Shoemaker, D., and Schadt, E.E. (2005). Dark matter in the genome:

evidence of widespread transcription detected by microarray tiling experiments. Trends Genet.

21, 93–102.

Johnson, S.A., Cubberley, G., and Bentley, D.L. (2009). Cotranscriptional recruitment of the

mRNA export factor Yra1 by direct interaction with the 3’ end processing factor Pcf11. Mol.

Cell 33, 215–226.

102

Juneau, K., Miranda, M., Hillenmeyer, M.E., Nislow, C., and Davis, R.W. (2006). Introns

regulate RNA and protein abundance in yeast. Genetics 174, 511–518.

Kapadia, F., Pryor, A., Chang, T.-H., and Johnson, L.F. (2006). Nuclear localization of poly(A)+

mRNA following siRNA reduction of expression of the mammalian RNA helicases UAP56 and

URH49. Gene 384, 37–44.

Kaplan, C.D., Laprade, L., and Winston, F. (2003). Transcription elongation factors repress

transcription initiation from cryptic sites. Science 301, 1096–1099.

Kapusta, A., and Feschotte, C. (2014). Volatile evolution of long noncoding RNA repertoires:

mechanisms and biological implications. Trends Genet. 30, 439–452.

Katahira, J., Straszer, K., Podtelejnikov, A., Mann, M., Jung, J.U., and Hurt, E. (1999). The

Mex67p-mediated nuclear mRNA export pathway is conserved from yeast to human. EMBO J

18, 2593–2609.

Katahira, J., Inoue, H., Hurt, E., and Yoneda, Y. (2009). Adaptor Aly and co-adaptor Thoc5

function in the Tap-p15-mediated nuclear export of HSP70 mRNA. EMBO J 28, 556–567.

Keene, J.D., Komisarow, J.M., and Friedersdorf, M.B. (2006). RIP-Chip: the isolation and

identification of mRNAs, microRNAs and protein components of ribonucleoprotein complexes

from cell extracts. Nat Protoc 1, 302–307.

Kerr, S.C., Azzouz, N., Fuchs, S.M., Collart, M.A., Strahl, B.D., Corbett, A.H., and Laribee,

R.N. (2011). The Ccr4-Not complex interacts with the mRNA export machinery. PLoS ONE 6,

e18302.

Kim, M., Ahn, S.-H., Krogan, N.J., Greenblatt, J.F., and Buratowski, S. (2004). Transitions in

RNA polymerase II elongation complexes at the 3’ ends of genes. EMBO J. 23, 354–364.

Kim Guisbert, K., Duncan, K., Li, H., and Guthrie, C. (2005). Functional specificity of shuttling

hnRNPs revealed by genome-wide analysis of their RNA binding profiles. RNA 11, 383–393.

Kimura, T., Hashimoto, I., Nagase, T., and Fujisawa, J.-I. (2004). CRM1-dependent, but not

ARE-mediated, nuclear export of IFN-alpha1 mRNA. J. Cell. Sci. 117, 2259–2270.

Kobayashi, T., and Ganley, A.R.D. (2005). Recombination regulation by transcription-induced

cohesin dissociation in rDNA repeats. Science 309, 1581–1584.

Köhler, A., and Hurt, E. (2007). Exporting RNA from the nucleus to the cytoplasm. Nat. Rev.

Mol. Cell Biol. 8, 761–773.

Kopytova, D.V., Orlova, A.V., Krasnov, A.N., Gurskiy, D.Y., Nikolenko, J.V., Nabirochkina,

E.N., Shidlovskii, Y.V., and Georgieva, S.G. (2010). Multifunctional factor ENY2 is associated

103

with the THO complex and promotes its recruitment onto nascent mRNA. Genes Dev. 24, 86–

96.

Kota, K.P., Wagner, S.R., Huerta, E., Underwood, J.M., and Nickerson, J.A. (2008). Binding of

ATP to UAP56 is necessary for mRNA export. Journal of Cell Science 121, 1526–1537.

Kuo, C.-H., and Ochman, H. (2009). Deletional bias across the three domains of life. Genome

Biol Evol 1, 145–152.

Kurshakova, M.M., Krasnov, A.N., Kopytova, D.V., Shidlovskii, Y.V., Nikolenko, J.V.,

Nabirochkina, E.N., Spehner, D., Schultz, P., Tora, L., and Georgieva, S.G. (2007). SAGA and a

novel Drosophila export complex anchor efficient transcription and mRNA export to NPC.

EMBO J. 26, 4956–4965.

Lahue, E., Heckathorn, J., Meyer, Z., Smith, J., and Wolfe, C. (2005). The Saccharomyces

cerevisiae Sub2 protein suppresses heterochromatic silencing at telomeres and subtelomeric

genes. Yeast 22, 537–551.

Lainé, J.-P., Singh, B.N., Krishnamurthy, S., and Hampsey, M. (2009). A physiological role for

gene loops in yeast. Genes Dev. 23, 2604–2609.

Laver, J.D., Ancevicius, K., Sollazzo, P., Westwood, J.T., Sidhu, S.S., Lipshitz, H.D., and

Smibert, C.A. (2012). Synthetic antibodies as tools to probe RNA-binding protein function. Mol

Biosyst 8, 1650–1657.

Laver, J.D., Li, X., Ray, D., Cook, K.B., Hahn, N.A., Nabeel-Shah, S., Kekis, M., Luo, H.,

Marsolais, A.J., Fung, K.Y., et al. (2015). Brain tumor is a sequence-specific RNA-binding

protein that directs maternal mRNA clearance during the Drosophila maternal-to-zygotic

transition. Genome Biol. 16, 94.

Lee, E.S., Akef, A., et al. (2015). The Consensus 5’ Splice Site Motif Inhibits mRNA Nuclear

Export. PLOS ONE 10, e0122743.

Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, M.J. (2001a). The exon-exon junction

complex provides a binding platform for factors involved in mRNA export and nonsense-

mediated mRNA decay. EMBO J. 20, 4987–4997.

Le Hir, H., Gatfield, D., Braun, I.C., Forler, D., and Izaurralde, E. (2001b). The protein Mago

provides a link between splicing and mRNA localization. EMBO Rep. 2, 1119–1124.

Lei, E.P., and Silver, P.A. (2002). Intron status and 3’-end formation control cotranscriptional

export of mRNA. Genes Dev 16, 2761–2766.

104

Lei, E.P., Stern, C.A., Fahrenkrog, B., Krebber, H., Moy, T.I., Aebi, U., and Silver, P.A. (2003).

Sac3 is an mRNA export factor that localizes to cytoplasmic fibrils of nuclear pore complex.

Mol. Biol. Cell 14, 836–847.

Lei, H., Dias, A.P., and Reed, R. (2011). Export and stability of naturally intronless mRNAs

require specific coding region sequences and the TREX mRNA export complex. Proc. Natl.

Acad. Sci. U.S.A. 108, 17985–17990.

Lei, H., Zhai, B., Yin, S., Gygi, S., and Reed, R. (2012). Evidence that a consensus element

found in naturally intronless mRNAs promotes mRNA export. Nucleic Acids Res. 41, 2517–25.

Lejeune, F., and Maquat, L.E. (2005). Mechanistic links between nonsense-mediated mRNA

decay and pre-mRNA splicing in mammalian cells. Curr. Opin. Cell Biol. 17, 309–315.

Lenasi, T., and Barboric, M. (2010). P-TEFb stimulates transcription elongation and pre-mRNA

splicing through multilateral mechanisms. RNA Biol 7, 145–150.

Lévesque, K., Halvorsen, M., Abrahamyan, L., Chatel-Chaix, L., Poupon, V., Gordon, H.,

DesGroseillers, L., Gatignol, A., and Mouland, A.J. (2006). Trafficking of HIV-1 RNA is

mediated by heterogeneous nuclear ribonucleoprotein A2 expression and impacts on viral

assembly. Traffic 7, 1177–1193.

Li, X., Quon, G., Lipshitz, H.D., and Morris, Q. (2010). Predicting in vivo binding sites of RNA-

binding proteins using mRNA secondary structure. RNA 16, 1096–1107.

Libri, D., Dower, K., Boulay, J., Thomsen, R., Rosbash, M., and Jensen, T.H. (2002).

Interactions between mRNA export commitment, 3’-end quality control, and nuclear

degradation. Mol. Cell. Biol. 22, 8254–8266.

Long, J.C., and Caceres, J.F. (2009). The SR protein family of splicing factors: master regulators

of gene expression. Biochem. J. 417, 15–27.

Lu, S., and Cullen, B.R. (2003). Analysis of the stimulatory effect of splicing on mRNA

production and utilization in mammalian cells. RNA 9, 618–630.

Lund, M.K., and Guthrie, C. (2005). The DEAD-box protein Dbp5p is required to dissociate

Mex67p from exported mRNPs at the nuclear rim. Mol. Cell 20, 645–651.

Luo, M.J., and Reed, R. (1999). Splicing is required for rapid and efficient mRNA export in

metazoans. Proc. Natl. Acad. Sci. U.S.A 96, 14937–14942.

Luo, M.L., Zhou, Z., Magni, K., Christoforides, C., Rappsilber, J., Mann, M., and Reed, R.

(2001). Pre-mRNA splicing and mRNA export linked by direct interactions between UAP56

and Aly. Nature 413, 644–647.

105

Luthra, R., Kerr, S.C., Harreman, M.T., Apponi, L.H., Fasken, M.B., Ramineni, S., Chaurasia,

S., Valentini, S.R., and Corbett, A.H. (2007). Actively transcribed GAL genes can be physically

linked to the nuclear pore by the SAGA chromatin modifying complex. J. Biol. Chem 282,

3042–3049.

Lutz, C.S., Murthy, K.G., Schek, N., O’Connor, J.P., Manley, J.L., and Alwine, J.C. (1996).

Interaction between the U1 snRNP-A protein and the 160-kD subunit of cleavage-

polyadenylation specificity factor increases polyadenylation efficiency in vitro. Genes Dev. 10,

325–337.

Lynch, M. (2006). Streamlining and simplification of microbial genome architecture. Annu. Rev.

Microbiol. 60, 327–349.

Lynch, M. (2007). The origins of genome architecture (Sunderland, Mass: Sinauer Associates).

Lynch, M., Scofield, D.G., and Hong, X. (2005). The evolution of transcription-initiation sites.

Mol. Biol. Evol. 22, 1137–1146.

Lynch, M., Bobay, L.-M., Catania, F., Gout, J.-F., and Rho, M. (2011). The repatterning of

eukaryotic genomes by random genetic drift. Annu Rev Genomics Hum Genet 12, 347–366.

Ma, X.M., Yoon, S.-O., Richardson, C.J., Jülich, K., and Blenis, J. (2008). SKAR links pre-

mRNA splicing to mTOR/S6K1-mediated enhanced translation efficiency of spliced mRNAs.

Cell 133, 303–313.

MacKellar, A.L., and Greenleaf, A.L. (2011). Cotranscriptional association of mRNA export

factor Yra1 with C-terminal domain of RNA polymerase II. J. Biol. Chem. 286, 36385–36395.

Maniatis, T., and Reed, R. (2002). An extensive network of coupling among gene expression

machines. Nature 416, 499–506.

Marques, A.C., and Ponting, C.P. (2009). Catalogues of mammalian long noncoding RNAs:

modest conservation and incompleteness. Genome Biol. 10, R124.

Martens, J.A., Laprade, L., and Winston, F. (2004). Intergenic transcription is required to repress

the Saccharomyces cerevisiae SER3 gene. Nature 429, 571–574.

Martin, W., and Koonin, E.V. (2006). Introns and the origin of nucleus-cytosol

compartmentalization. Nature 440, 41–45.

Mason, P.B., and Struhl, K. (2003). The FACT complex travels with elongating RNA

polymerase II and is important for the fidelity of transcriptional initiation in vivo. Mol. Cell.

Biol. 23, 8323–8333.

106

Masuda, S., Das, R., Cheng, H., Hurt, E., Dorman, N., and Reed, R. (2005). Recruitment of the

human TREX complex to mRNA during splicing. Genes Dev 19, 1512–1517.

Masuyama, K., Taniguchi, I., Kataoka, N., and Ohno, M. (2004). RNA length defines RNA

export pathway. Genes Dev. 18, 2074–2085.

Mattick, J.S., Taft, R.J., and Faulkner, G.J. (2010). A global view of genomic information--

moving beyond the gene and the master regulator. Trends Genet. 26, 21–28.

McCloskey, A., Taniguchi, I., Shinmyozu, K., and Ohno, M. (2012). hnRNP C tetramer

measures RNA length to classify RNA polymerase II transcripts for export. Science 335, 1643–

1646.

McCracken, S., Fong, N., Rosonina, E., Yankulov, K., Brothers, G., Siderovski, D., Hessel, A.,

Foster, S., Shuman, S., and Bentley, D.L. (1997). 5’-Capping enzymes are targeted to pre-mRNA

by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev.

11, 3306–3318.

McCracken, S., Lambermon, M., and Blencowe, B.J. (2002). SRm160 splicing coactivator

promotes transcript 3’-end cleavage. Mol. Cell. Biol. 22, 148–160.

Meignin, C., and Davis, I. (2010). Transmitting the message: intracellular mRNA localization.

Curr. Opin. Cell Biol 22, 112–119.

Menet, J.S., Rodriguez, J., Abruzzi, K.C., and Rosbash, M. (2012). Nascent-Seq reveals novel

features of mouse circadian transcriptional regulation. eLife 1.

Milligan, L., Decourty, L., Saveanu, C., Rappsilber, J., Ceulemans, H., Jacquier, A., and

Tollervey, D. (2008). A yeast exosome cofactor, Mpp6, functions in RNA surveillance and in the

degradation of noncoding RNA transcripts. Mol. Cell. Biol. 28, 5446–5457.

Miyagawa, R., Tano, K., Mizuno, R., Nakamura, Y., Ijiri, K., Rakwal, R., Shibato, J., Masuo, Y.,

Mayeda, A., Hirose, T., et al. (2012). Identification of cis- and trans-acting factors involved in

the localization of MALAT-1 noncoding RNA to nuclear speckles. RNA 18, 738–751.

Moazed, D. (2009). Small RNAs in transcriptional gene silencing and genome defence. Nature

457, 413–420.

Moore, M.J., and Proudfoot, N.J. (2009). Pre-mRNA processing reaches back to transcription

and ahead to translation. Cell 136, 688–700.

Neil, H., Malabat, C., d’Aubenton-Carafa, Y., Xu, Z., Steinmetz, L.M., and Jacquier, A. (2009).

Widespread bidirectional promoters are the major source of cryptic transcripts in yeast. Nature

457, 1038–1042.

107

Neville, M., and Rosbash, M. (1999). The NES-Crm1p export pathway is not a major mRNA

export route in Saccharomyces cerevisiae. EMBO J. 18, 3746–3756.

Nishi, K., Yoshida, M., Fujiwara, D., Nishikawa, M., Horinouchi, S., and Beppu, T. (1994).

Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in

control of higher order chromosome structure and gene expression. J. Biol. Chem. 269, 6320–

6324.

Nott, A., Meislin, S.H., and Moore, M.J. (2003). A quantitative analysis of intron effects on

mammalian gene expression. RNA 9, 607–617.

Nott, A., Le Hir, H., and Moore, M.J. (2004). Splicing enhances translation in mammalian cells:

an additional function of the exon junction complex. Genes Dev. 18, 210–222.

Ohno, M., Segref, A., Kuersten, S., and Mattaj, I.W. (2002). Identity elements used in export of

mRNAs. Mol. Cell 9, 659–671.

Palazzo, A.F., and Akef, A. (2012). Nuclear export as a key arbiter of “mRNA identity” in

eukaryotes. Biochim. Biophys. Acta 1819, 566–577.

Palazzo, A.F., and Gregory, T.R. (2014). The case for junk DNA. PLoS Genet. 10, e1004351.

Palazzo, A.F., Springer, M., Shibata, Y., Lee, C.-S., Dias, A.P., and Rapoport, T.A. (2007). The

signal sequence coding region promotes nuclear export of mRNA. PLoS Biol 5, e322.

Parenteau, J., Durand, M., Véronneau, S., Lacombe, A.-A., Morin, G., Guérin, V., Cecez, B.,

Gervais-Bird, J., Koh, C.-S., Brunelle, D., et al. (2008). Deletion of many yeast introns reveals a

minority of genes that require splicing for function. Mol. Biol. Cell 19, 1932–1941.

Parenteau, J., Durand, M., Morin, G., Gagnon, J., Lucier, J.-F., Wellinger, R.J., Chabot, B., and

Elela, S.A. (2011). Introns within ribosomal protein genes regulate the production and function

of yeast ribosomes. Cell 147, 320–331.

Pascual-García, P., Govind, C.K., Queralt, E., Cuenca-Bono, B., Llopis, A., Chavez, S.,

Hinnebusch, A.G., and Rodríguez-Navarro, S. (2008). Sus1 is recruited to coding regions and

functions during transcription elongation in association with SAGA and TREX2. Genes &

Development 22, 2811–2822.

Pennisi, E. (2012). Genomics. ENCODE project writes eulogy for junk DNA. Science 337, 1159,

1161.

Perales, R., and Bentley, D. (2009). “Cotranscriptionality”: the transcription elongation complex

as a nexus for nuclear transactions. Mol. Cell 36, 178–191.

108

Preker, P., Nielsen, J., Kammler, S., Lykke-Andersen, S., Christensen, M.S., Mapendano, C.K.,

Schierup, M.H., and Jensen, T.H. (2008). RNA exosome depletion reveals transcription upstream

of active human promoters. Science 322, 1851–1854.

Pritchard, C.E., Fornerod, M., Kasper, L.H., and van Deursen, J.M. (1999). RAE1 is a shuttling

mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex

through multiple domains. J. Cell Biol. 145, 237–254.

Rehwinkel, J., Herold, A., Gari, K., Köcher, T., Rode, M., Ciccarelli, F.L., Wilm, M., and

Izaurralde, E. (2004). Genome-wide analysis of mRNAs regulated by the THO complex in

Drosophila melanogaster. Nat. Struct. Mol. Biol 11, 558–566.

Rinn, J.L., Kertesz, M., Wang, J.K., Squazzo, S.L., Xu, X., Brugmann, S.A., Goodnough, L.H.,

Helms, J.A., Farnham, P.J., Segal, E., et al. (2007). Functional demarcation of active and silent

chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311–1323.

Rodrigues, J.P., Rode, M., Gatfield, D., Blencowe, B.J., Carmo-Fonseca, M., and Izaurralde, E.

(2001). REF proteins mediate the export of spliced and unspliced mRNAs from the nucleus.

Proc. Natl. Acad. Sci. U.S.A. 98, 1030–1035.

Rodríguez-Navarro, S., Fischer, T., Luo, M.-J., Antúnez, O., Brettschneider, S., Lechner, J.,

Pérez-Ortín, J.E., Reed, R., and Hurt, E. (2004). Sus1, a functional component of the SAGA

histone acetylase complex and the nuclear pore-associated mRNA export machinery. Cell 116,

75–86.

Rogozin, I.B., Wolf, Y.I., Sorokin, A.V., Mirkin, B.G., and Koonin, E.V. (2003). Remarkable

interkingdom conservation of intron positions and massive, lineage-specific intron loss and gain

in eukaryotic evolution. Curr. Biol. 13, 1512–1517.

Rougemaille, M., Gudipati, R.K., Olesen, J.R., Thomsen, R., Seraphin, B., Libri, D., and Jensen,

T.H. (2007). Dissecting mechanisms of nuclear mRNA surveillance in THO/sub2 complex

mutants. EMBO J. 26, 2317–2326.

Rougemaille, M., Dieppois, G., Kisseleva-Romanova, E., Gudipati, R.K., Lemoine, S., Blugeon,

C., Boulay, J., Jensen, T.H., Stutz, F., Devaux, F., et al. (2008). THO/Sub2p functions to

coordinate 3’-end processing with gene-nuclear pore association. Cell 135, 308–321.

Roy, D., Bhanja Chowdhury, J., and Ghosh, S. (2013). Polypyrimidine tract binding protein

(PTB) associates with intronic and exonic domains to squelch nuclear export of unspliced RNA.

FEBS Lett. 587, 3802–3807.

109

Saguez, C., Schmid, M., Olesen, J.R., Ghazy, M.A.E.-H., Qu, X., Poulsen, M.B., Nasser, T.,

Moore, C., and Jensen, T.H. (2008). Nuclear mRNA surveillance in THO/sub2 mutants is

triggered by inefficient polyadenylation. Mol. Cell 31, 91–103.

Salmena, L., Poliseno, L., Tay, Y., Kats, L., and Pandolfi, P.P. (2011). A ceRNA hypothesis: the

Rosetta Stone of a hidden RNA language? Cell 146, 353–358.

Santos-Rosa, H., Moreno, H., Simos, G., Segref, A., Fahrenkrog, B., Panté, N., and Hurt, E.

(1998). Nuclear mRNA export requires complex formation between Mex67p and Mtr2p at the

nuclear pores. Mol. Cell. Biol. 18, 6826–6838.

Schmidt, U., Richter, K., Berger, A.B., and Lichter, P. (2006). In vivo BiFC analysis of Y14 and

NXF1 mRNA export complexes: preferential localization within and around SC35 domains. J.

Cell Biol. 172, 373–381.

Schmitt, C., von Kobbe, C., Bachi, A., Panté, N., Rodrigues, J.P., Boscheron, C., Rigaut, G.,

Wilm, M., Séraphin, B., Carmo-Fonseca, M., et al. (1999). Dbp5, a DEAD-box protein required

for mRNA export, is recruited to the cytoplasmic fibrils of nuclear pore complex via a conserved

interaction with CAN/Nup159p. EMBO J. 18, 4332–4347.

Schweingruber, C., Rufener, S.C., Zünd, D., Yamashita, A., and Mühlemann, O. (2013).

Nonsense-mediated mRNA decay - mechanisms of substrate mRNA recognition and degradation

in mammalian cells. Biochim. Biophys. Acta 1829, 612–623.

Segref, A., Sharma, K., Doye, V., Hellwig, A., Huber, J., Lührmann, R., and Hurt, E. (1997).

Mex67p, a novel factor for nuclear mRNA export, binds to both poly(A)+ RNA and nuclear

pores. EMBO J. 16, 3256–3271.

Shen, H. (2009). UAP56- a key player with surprisingly diverse roles in pre-mRNA splicing and

nuclear export. BMB Rep 42, 185–188.

Shopland, L.S., Johnson, C.V., Byron, M., McNeil, J., and Lawrence, J.B. (2003). Clustering of

multiple specific genes and gene-rich R-bands around SC-35 domains: evidence for local

euchromatic neighborhoods. J. Cell Biol. 162, 981–990.

Singh, G., Kucukural, A., Cenik, C., Leszyk, J.D., Shaffer, S.A., Weng, Z., and Moore, M.J.

(2012). The cellular EJC interactome reveals higher-order mRNP structure and an EJC-SR

protein nexus. Cell 151, 750–764.

Skruzný, M., Schneider, C., Rácz, A., Weng, J., Tollervey, D., and Hurt, E. (2009). An

endoribonuclease functionally linked to perinuclear mRNP quality control associates with the

nuclear pore complexes. PLoS Biol. 7, e8.

110

Smith, K.P., Moen, P.T., Wydner, K.L., Coleman, J.R., and Lawrence, J.B. (1999). Processing of

endogenous pre-mRNAs in association with SC-35 domains is gene specific. J. Cell Biol. 144,

617–629.

Spector, D.L., and Lamond, A.I. (2011). Nuclear speckles. Cold Spring Harb Perspect Biol 3.

Spector, D.L., Fu, X.D., and Maniatis, T. (1991). Associations between distinct pre-mRNA

splicing components and the cell nucleus. EMBO J. 10, 3467–3481.

Strässer, K., and Hurt, E. (2000). Yra1p, a conserved nuclear RNA-binding protein, interacts

directly with Mex67p and is required for mRNA export. EMBO J. 19, 410–420.

Strässer, K., and Hurt, E. (2001). Splicing factor Sub2p is required for nuclear mRNA export

through its interaction with Yra1p. Nature 413, 648–652.

Strässer, K., Masuda, S., Mason, P., Pfannstiel, J., Oppizzi, M., Rodriguez-Navarro, S., Rondón,

A.G., Aguilera, A., Struhl, K., Reed, R., et al. (2002). TREX is a conserved complex coupling

transcription with messenger RNA export. Nature 417, 304–308.

Stutz, F., Bachi, A., Doerks, T., Braun, I.C., Séraphin, B., Wilm, M., Bork, P., and Izaurralde, E.

(2000). REF, an evolutionary conserved family of hnRNP-like proteins, interacts with

TAP/Mex67p and participates in mRNA nuclear export. RNA 6, 638–650.

Svejstrup, J.Q. (2004). The RNA polymerase II transcription cycle: cycling through chromatin.

Biochim. Biophys. Acta 1677, 64–73.

Taft, R.J., Pheasant, M., and Mattick, J.S. (2007). The relationship between non-protein-coding

DNA and eukaryotic complexity. Bioessays 29, 288–299.

Takeiwa, T., Taniguchi, I., and Ohno, M. (2015). Exportin-5 mediates nuclear export of SRP

RNA in vertebrates. Genes Cells.

Takemura, R., Takeiwa, T., Taniguchi, I., McCloskey, A., and Ohno, M. (2011). Multiple factors

in the early splicing complex are involved in the nuclear retention of pre-mRNAs in mammalian

cells. Genes Cells 16, 1035–1049.

Taniguchi, I., and Ohno, M. (2008). ATP-dependent recruitment of export factor Aly/REF onto

intronless mRNAs by RNA helicase UAP56. Mol. Cell. Biol. 28, 601–608.

Teng, I.-F., and Wilson, S.A. (2013). Mapping interactions between mRNA export factors in

living cells. PLoS ONE 8, e67676.

Thakurta, A.G., Selvanathan, S.P., Patterson, A.D., Gopal, G., and Dhar, R. (2007). The nuclear

export signal of splicing factor Uap56p interacts with nuclear pore-associated protein Rae1p for

mRNA export in Schizosaccharomyces pombe. J. Biol. Chem. 282, 17507–17516.

111

Thiebaut, M., Kisseleva-Romanova, E., Rougemaille, M., Boulay, J., and Libri, D. (2006).

Transcription termination and nuclear degradation of cryptic unstable transcripts: a role for the

nrd1-nab3 pathway in genome surveillance. Mol. Cell 23, 853–864.

Thomas, M., Lischka, P., Müller, R., and Stamminger, T. (2011). The cellular DExD/H-box

RNA-helicases UAP56 and URH49 exhibit a CRM1-independent nucleocytoplasmic shuttling

activity. PLoS ONE 6, e22671.

Tisseur, M., Kwapisz, M., and Morillon, A. (2011). Pervasive transcription - Lessons from yeast.

Biochimie 93, 1889–1896.

Tokunaga, K., Shibuya, T., Ishihama, Y., Tadakuma, H., Ide, M., Yoshida, M., Funatsu, T.,

Ohshima, Y., and Tani, T. (2006). Nucleocytoplasmic transport of fluorescent mRNA in living

mammalian cells: nuclear mRNA export is coupled to ongoing gene transcription. Genes Cells

11, 305–317.

Topisirovic, I., Siddiqui, N., Lapointe, V.L., Trost, M., Thibault, P., Bangeranye, C., Piñol-

Roma, S., and Borden, K.L.B. (2009). Molecular dissection of the eukaryotic initiation factor 4E

(eIF4E) export-competent RNP. EMBO J. 28, 1087–1098.

Tsai, M.-C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J.K., Lan, F., Shi, Y., Segal, E.,

and Chang, H.Y. (2010). Long noncoding RNA as modular scaffold of histone modification

complexes. Science 329, 689–693.

Ullman, K.S. (2002). RNA export: searching for mRNA identity. Curr. Biol. 12, R461–R463.

Valencia, P., Dias, A.P., and Reed, R. (2008). Splicing promotes rapid and efficient mRNA

export in mammalian cells. Proc. Natl. Acad. Sci. U.S.A 105, 3386–3391.

van den Ent, F., and Löwe, J. (2006). RF cloning: a restriction-free method for inserting target

genes into plasmids. J. Biochem. Biophys. Methods 67, 67–74.

Vargas, D.Y., Shah, K., Batish, M., Levandoski, M., Sinha, S., Marras, S.A.E., Schedl, P., and

Tyagi, S. (2011). Single-molecule imaging of transcriptionally coupled and uncoupled splicing.

Cell 147, 1054–1065.

Vasiljeva, L., Kim, M., Terzi, N., Soares, L.M., and Buratowski, S. (2008). Transcription

termination and RNA degradation contribute to silencing of RNA polymerase II transcription

within heterochromatin. Mol. Cell 29, 313–323.

Viphakone, N., Hautbergue, G.M., Walsh, M., Chang, C.-T., Holland, A., Folco, E.G., Reed, R.,

and Wilson, S.A. (2012). TREX exposes the RNA-binding domain of Nxf1 to enable mRNA

export. Nat Commun 3, 1006.

112

Wang, J., Cao, L.G., Wang, Y.L., and Pederson, T. (1991). Localization of pre-messenger RNA

at discrete nuclear sites. Proc. Natl. Acad. Sci. U.S.A. 88, 7391–7395.

Wang, J., Zhang, J., Zheng, H., Li, J., Liu, D., Li, H., Samudrala, R., Yu, J., and Wong, G.K.-S.

(2004). Mouse transcriptome: neutral evolution of “non-coding” complementary DNAs. Nature

431, 1 p following 757; discussion following 757.

Wang, X., Chang, Y., Li, Y., Zhang, X., and Goodrich, D.W. (2006). Thoc1/Hpr1/p84 is

essential for early embryonic development in the mouse. Mol. Cell. Biol. 26, 4362–4367.

Weirich, C.S., Erzberger, J.P., Flick, J.S., Berger, J.M., Thorner, J., and Weis, K. (2006).

Activation of the DExD/H-box protein Dbp5 by the nuclear-pore protein Gle1 and its coactivator

InsP6 is required for mRNA export. Nat. Cell Biol. 8, 668–676.

West, R.W., and Milgrom, E. (2002). DEAD-box RNA helicase Sub2 is required for expression

of lacZ fusions in Saccharomyces cerevisiae and is a dosage-dependent suppressor of RLR1

(THO2). Gene 288, 19–27.

Wickramasinghe, V.O., McMurtrie, P.I.A., Mills, A.D., Takei, Y., Penrhyn-Lowe, S., Amagase,

Y., Main, S., Marr, J., Stewart, M., and Laskey, R.A. (2010). mRNA export from mammalian

cell nuclei is dependent on GANP. Curr. Biol 20, 25–31.

Wickramasinghe, V.O., Andrews, R., Ellis, P., Langford, C., Gurdon, J.B., Stewart, M.,

Venkitaraman, A.R., and Laskey, R.A. (2014). Selective nuclear export of specific classes of

mRNA from mammalian nuclei is promoted by GANP. Nucleic Acids Res. 42, 5059–71.

Wilmes, G.M., Bergkessel, M., Bandyopadhyay, S., Shales, M., Braberg, H., Cagney, G.,

Collins, S.R., Whitworth, G.B., Kress, T.L., Weissman, J.S., et al. (2008). A genetic interaction

map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and

mRNA export and splicing. Mol. Cell 32, 735–746.

Wilusz, J.E., JnBaptiste, C.K., Lu, L.Y., Kuhn, C.-D., Joshua-Tor, L., and Sharp, P.A. (2012). A

triple helix stabilizes the 3’ ends of long noncoding RNAs that lack poly(A) tails. Genes Dev. 26,

2392–2407.

Wyers, F., Rougemaille, M., Badis, G., Rousselle, J.-C., Dufour, M.-E., Boulay, J., Régnault, B.,

Devaux, F., Namane, A., Séraphin, B., et al. (2005). Cryptic pol II transcripts are degraded by a

nuclear quality control pathway involving a new poly(A) polymerase. Cell 121, 725–737.

Xu, Z., Wei, W., Gagneur, J., Perocchi, F., Clauder-Münster, S., Camblong, J., Guffanti, E.,

Stutz, F., Huber, W., and Steinmetz, L.M. (2009). Bidirectional promoters generate pervasive

transcription in yeast. Nature 457, 1033–1037.

113

Yamazaki, T., Fujiwara, N., Yukinaga, H., Ebisuya, M., Shiki, T., Kurihara, T., Kioka, N.,

Kambe, T., Nagao, M., Nishida, E., et al. (2010). The closely related RNA helicases, UAP56 and

URH49, preferentially form distinct mRNA export machineries and coordinately regulate mitotic

progression. Mol. Biol. Cell 21, 2953–2965.

Yelina, N.E., Smith, L.M., Jones, A.M.E., Patel, K., Kelly, K.A., and Baulcombe, D.C. (2010).

Putative Arabidopsis THO/TREX mRNA export complex is involved in transgene and

endogenous siRNA biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 107, 13948–13953.

Yoh, S.M., Cho, H., Pickle, L., Evans, R.M., and Jones, K.A. (2007). The Spt6 SH2 domain

binds Ser2-P RNAPII to direct Iws1-dependent mRNA splicing and export. Genes Dev. 21, 160–

174.

Yoh, S.M., Lucas, J.S., and Jones, K.A. (2008). The Iws1:Spt6:CTD complex controls

cotranscriptional mRNA biosynthesis and HYPB/Setd2-mediated histone H3K36 methylation.

Genes Dev. 22, 3422–3434.

Yoon, J.H., Love, D.C., Guhathakurta, A., Hanover, J.A., and Dhar, R. (2000). Mex67p of

Schizosaccharomyces pombe interacts with Rae1p in mediating mRNA export. Mol. Cell. Biol.

20, 8767–8782.

Yu, J., Hu, S., Wang, J., Wong, G.K.-S., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X.,

et al. (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, 79–

92.

Yue, Z., Maldonado, E., Pillutla, R., Cho, H., Reinberg, D., and Shatkin, A.J. (1997).

Mammalian capping enzyme complements mutant Saccharomyces cerevisiae lacking mRNA

guanylyltransferase and selectively binds the elongating form of RNA polymerase II. Proc. Natl.

Acad. Sci. U.S.A. 94, 12898–12903.

Zenklusen, D., Vinciguerra, P., Wyss, J.-C., and Stutz, F. (2002). Stable mRNP formation and

export require cotranscriptional recruitment of the mRNA export factors Yra1p and Sub2p by

Hpr1p. Mol. Cell. Biol 22, 8241–8253.

Zhang, B., Gunawardane, L., Niazi, F., Jahanbani, F., Chen, X., and Valadkhan, S. (2014). A

novel RNA motif mediates the strict nuclear localization of a long noncoding RNA. Mol. Cell.

Biol. 34, 2318–2329.

Zhang, K., Fischer, T., Porter, R.L., Dhakshnamoorthy, J., Zofall, M., Zhou, M., Veenstra, T.,

and Grewal, S.I.S. (2011). Clr4/Suv39 and RNA quality control factors cooperate to trigger

RNAi and suppress antisense RNA. Science 331, 1624–1627.

114

Zhao, J., Jin, S.-B., Björkroth, B., Wieslander, L., and Daneholt, B. (2002). The mRNA export

factor Dbp5 is associated with Balbiani ring mRNP from gene to cytoplasm. EMBO J. 21, 1177–

1187.

Zhou, Z., Luo, M.J., Straesser, K., Katahira, J., Hurt, E., and Reed, R. (2000). The protein Aly

links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407, 401–405.

Zhu, L., Zhang, Y., Zhang, W., Yang, S., Chen, J.-Q., and Tian, D. (2009). Patterns of exon-

intron architecture variation of genes in eukaryotic genomes. BMC Genomics 10, 47.

Investigating mRNA Sequence Features That Regulate Nuclear ... · chromosome architecture and/or 3)...

Documents

Transcript of Investigating mRNA Sequence Features That Regulate Nuclear ... · chromosome architecture and/or 3)...