Vol. 58, No. 4INFECTION AND IMMUNITY, Apr. 1990, p. 1065-10720019-9567/90/041065-08$02.00/0Copyright © 1990, American Society for Microbiology

Cloning, Expression, and Sequence Analysis of the Haemophilusinfluenzae Type b Strain M43p+ Pilin Gene

J. R. GILSDORF,1* C. F. MARRS,2 K. W. McCREA,l AND L. J. FORNEY3C. S. Mott Children's Hospital and The University of Michigan Medical School,' and School of Public Health,2

University of Michigan, Ann Arbor, Michigan 48109, and Synergen, Inc., Boulder, Colorado 803013

Received 11 October 1989/Accepted 2 January 1990

By using antiserum against Haemophilus influenzae type b (Hib) strain M43p+ denatured pilin, we screeneda genomic library of Hib strain M43p+ and identified a clone that expressed pilin, but not assembled pili, onits surface. Southern blot analysis revealed the presence of one structural gene, which was also present in strainM42p-, a nonpiliated variant. Five exonuclease III deletion mutants, two of which had deletions that extendedinto the structural gene and failed to express pilin, were used to obtain the nucleotide sequence of the structuralgene. The amino acid sequence of the open reading frame agrees with 38 of 40 amino acids from the publishedsequence of purified Hib M43p+ pilin. The pilin gene coded for a mature protein of 193 amino acids, with acalculated molecular mass of 21,101 daltons. Comparison of the Hib M43p+ pilin amino acid sequence withthose of pilins of other bacteria revealed strong conservation of amino- and carboxy-terminal regions in M43p+and Escherichia coli F17, type 1C, and several members of the P pili family, as well as Klebsiella pneumoniaetype 3 MR/K, Bordetella pertussis serotype 2, and Serratia marcesens US46 fimbriae.

Haemophilus influenzae type b (Hib) is an importantpathogen in infants and young children and causes seriousinfections, such as meningitis, facial cellulitis, pneumonia,septic arthritis, and epiglottitis, in approximately 20,000children in the United States annually (5). Infection with thisbacterium begins with Hib colonization of the nasopharynx,which is followed by mucosal invasion, bacteremia, andseeding of target organs.

Bacterial colonization of mucosal surfaces depends uponattachment of bacteria to mucosal epithelial cells by meansof pili or fimbriae (4), which are protein filaments that extendfrom the surface of bacteria. Expression of pili by H.influenzae is associated with bacterial adherence to epithelialcells and to erythrocytes (14, 35, 40). Although Hib pili havenot been studied as completely as those of some otherorganisms, pili from two Hib strains, strain M43p+ (alsocalled AO-2) (15) and strain Eagan (also called Elap+) (40;L. J. Forney, J. R. Gilsdorf, and D. C. L. Wong, submittedfor publication) have been purified to homogeneity. Likeother bacterial pili, Hib pili appear to be polymers of thesubunit proteins, pilins. Pilins of various Hib strains appearto vary in structure, since they show slight variation inmigration on sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) (25; J. R. Gilsdorf, K. W.McCrea, and L. J. Forney, submitted for publication); forexample, pilins of strain Elap+ (23.5 kilodaltons) have aslightly lower apparent molecular mass than those of strainM43p+ (24 kilodaltons). Immunologic variation among pili ofvarious Hib strains has also been demonstrated, whereas thepilus subunits, pilins, appear to share certain commonepitopes (25; Gilsdorf et al., submitted).The direct role of pili as a pathogenic factor in Hib

infection remains unclear, although Anderson et al. (1) haveshown that piliated Hib colonize the nasopharynges of ratsbetter than nonpiliated Hib do. A major impediment to thestudy of the role of pili in the pathogenesis of Hib infectionis the lability of pilus expression, as has also been observedwith other piliated bacteria (20, 39). A culture of organisms

* Corresponding author.

expressing one pilus phenotype (pilus negative or piluspositive) often contains low numbers of organisms express-ing the opposite pilus phenotype (14, 25, 40), thus makingpathogenesis studies of Hib pili difficult to interpret. In orderto overcome this obstacle and to control for other potentiallypathogenic factors that may differ between phenotypic var-iants, we are interested in using nonpiliated genetic mutantsto study the role of pili in the pathogenesis of Hib infections.This paper describes the cloning and expression of the Hibstrain M43p+ pilin gene and compares the DNA nucleotidesequence of the pilin structural gene with a variety of otherpilin genes.

MATERIALS AND METHODSBacteria. The piliated Hib strain M43p+, the source of Hib

DNA for the cloning procedure, was originally isolated fromthe throat of a child with Hib meningitis. This strain adheresto human buccal epithelial cells, agglutinates human eryth-rocytes, and possesses pili, as seen by electron microscopy(11, 14). Unlike most other Hib clinical isolates that are notpiliated upon receipt from the clinical laboratory but requireenrichment by hemagglutination to select for piliated vari-ants (7), Hib M43p+ is piliated without enrichment. For allexperiments, Hib was grown on Levinthal agar (29) at 37°Cin 5% CO2.The host Escherichia coli cells used in the cloning and

subcloning experiments were strain BB4 {supF58 supE44hsdR5J4 (rK- MK ) galK2 galT22 trpRSS metBI tonA X-A(arg-lac)U169 [F' proAB 1acIqZl&M15 TnlO (Tetr)]} andXL1-Blue {endAl hsdRJ7 (rK iK) supE44 thi-J X recAlgyrA96 RelAl (Lac-) [F' proAB lacIqZAMJ5 TnJO (Tetr)]},obtained from Stratagene Cloning Systems, San Diego,Calif. They were grown on Luria broth agar containing 100,ug of carbenicillin per ml. E. coli strain DH5 (16) was usedfor the creation of deletion derivatives.DNA isolation and manipulation. Total bacterial DNA was

prepared from Hib strain M43p+ by the method of Hull et al.(18), and bacteriophage and plasmid DNAs were isolated asdescribed previously (28).

Restriction endonucleases were purchased from New En-

1065

1066 GILSDORF ET AL.

gland BioLabs, Inc., Beverly, Mass.; Bethesda ResearchLaboratories, Inc., Gaithersburg, Md.; Boehringer Mann-heim Biochemicals, Indianapolis, Ind.; or Promega Biotec,Madison, Wis. Restriction enzyme digests, agarose gel elec-trophoresis, hybridization, and isolation of restriction en-zyme-generated DNA fragments were carried out as de-scribed previously (22). DNA probes were made by digestingplasmid DNA with appropriate restriction enzymes andseparating the fragments on 1% agarose gels. The DNAfragments were cut from the gels, purified from the agaroseby using Gene-Clean (Bio 101, La Jolla, Calif.), and nicktranslated with 32P according to methods supplied by thevendor (Bethesda Research Laboratories).A library of genomic DNA from Hib strain M43p+ was

constructed by Stratagene Cloning Systems, San Diego,Calif., in the expression vector X-ZAP (38). The Hib DNAwas randomly sheared, and the fragments were attached toEcoRI linkers and then inserted into X-ZAP (which has aninsert capacity of up to 10 kilobases [kb]). The library wasconfirmed to contain Hib DNA inserts by probing genomicDNA from Hib strain M43p+ with nick-translated 32p_labeled DNA from three randomly selected recombinantplasmids, which had been subcloned from recombinantX-ZAP (data not shown).

Antisera. Rabbit serum R20 used to screen the DNAlibrary was prepared against the 24-kilodalton M43p+ pilinband cut from a SDS-PAGE gel. Outer membranes of Hibstrain M43p+ were prepared by the method of Barenkamp etal. (3), and the proteins were resolved on seven 1.5-mm-thick SDS-PAGE gels and stained with Coomassie brilliantblue. The pilin bands were excised from the gels and crushedwith a mortar and pestle. Each rabbit received 4 ml of thismaterial, without adjuvant, for the first injection and 2 ml foreach booster, given 3 and 6 weeks later. To decreasebackground signal from nonspecific antibodies, the serumwas adsorbed with Hib strain M42p- (the nonpiliated variantof M43p+), with E. coli BB4, and with two strains ofPasteurella multocida (kindly provided by Howard Rush,Unit for Laboratory Animal Medicine, University of Mich-igan, Ann Arbor).

Rabbit serum R13, which was used to confirm the expres-sion of Hib pili in recombinant E. coli, was prepared againsta 13-amino-acid peptide from M43p+ pilin. This peptide wasconstructed from amino acids 5 through 17 derived from thepublished amino terminal sequence of the M43p+ pilin (15)and conjugated to keyhole limpet hemocyanin through thecysteinyl sulfhydryl by using N-a-maleimidobutyrloxysuc-cinimide ester (Calbiochem-Behring, La Jolla, Calif.) ac-cording to the procedure suggested by the manufacturer.The rabbits received 500 jig of keyhole limpet hemocyanin-conjugated peptide mixed in Freund complete adjuvant to avolume of 1 ml by subcutaneous injection in four to six sites.Three and six weeks later, the rabbits were boosted with thesame antigen mixed in Freund incomplete adjuvant to avolume of 1 ml.

Rabbit serum Rl has been described elsewhere (25) andhas been shown to contain antibodies directed against struc-tural epitopes of Hib strain M43p+ pili.Immunoscreening of genomic library. The genomic Hib

M43p+ DNA library was screened by using antiserum R20(antipilin antiserum) for lytic recombinant phage that ex-pressed Hib M43p+ pilin. For each 90-mm agar plate to bescreened, 200 pA of an overnight suspension of E. coli strainBB4 in Luria broth was infected with 16 x 103 PFU of theX-ZAP genomic Hib M43p+ DNA library in 100 ,ll of 10 mMTris (pH 7.5) with 10 mM MgSO4 for 15 min at 37°C. Soft

agar (3 ml) was added to each tube, and the contents wereoverlaid onto Luria broth plates and incubated for about 6 h,until plaques became visible. Plaque lifts were performed byusing standard techniques (27), and the nitrocellulose mem-branes were processed by using a modification of the methodof Young and Davis (45). For some experiments in whichpilin expression by recombinant E. coli with the lacZ pro-moter of the XZAP vector was tested, the membrane filterswere wetted in 3 ml of 10 mM isopropyl-p-D-thiogalactopyranoside (IPTG) and dried prior to their use in plaque lifts.After drying overnight at 37°C, the membranes were incu-bated in Blotto (0.01 M phosphate-buffered saline [PBS], pH7.4, with 5% [wt/vol] dry skim milk powder) for 1 h. Themembranes were then incubated for 1 h in serum R20(containing antibodies against the pilin band cut from anSDS-PAGE gel) diluted 1:1,000 in Blotto containing 0.5 NNaCl, to reduce nonspecific binding. After being washed inPBS, the membranes were incubated in horseradish peroxi-dase-labeled goat anti-rabbit immunoglobulin G (CappelLaboratories, Malvern, Pa.), diluted 1:3,000 in PBS, for 1 h.After the membranes were again washed in PBS, the enzy-matic reaction was developed by using 0.5 mg of 3,3'-diaminobenzidine (Sigma Chemical Co., St. Louis, Mo.) perml in PBS with 0.01% (vol/vol) 30% H202 and stopped bywashing the membranes in water.

Subcloning. The cloned Hib M43p+ pilin gene was sub-cloned into the phagemid Bluescript-SK (p-Bluescript) byusing the in vivo excision technique that is a feature ofX-ZAP (38).Immunoassays and agglutination assays. The immunoas-

says and hemagglutination assays used in this study havebeen described elsewhere (25). The dot blot and slide agglu-tination assays (to evaluate antibody binding to native sur-face antigens on whole bacteria), as well as the Western blotassay (to evaluate antibody binding to denatured surfaceantigens), used antisera R13 (antipeptide) and R20 (antipi-lin). Development of the reactions in the dot blot andWestern blot (immunoblot) assays, which used suspensionsof whole bacteria as antigens, were performed as describedabove for the antibody screening of the genomic library.

Electron microscopy. Specimen grids were prepared byapplication of a Formvar film, by carbon coating, and byexposure to a glow discharge for 5 min. Washed bacterialcells (5 ,ul) suspended in PBS were applied to the grid for 1min. The grids were rinsed with PBS, blotted, and air dried.After the cells were negatively stained with 0.5% phospho-tungstic acid, pH 4.0, the grids were blotted, dried, andexamined by using a JEOL 100cx electron microscope.

Construction of deletion fragments. Plasmids containingthe Hib pilin gene insert were subjected to sequential exo-nuclease III digestion by using the Erase-a-Base kit(Promega) and following the protocols of the vendor. Toconstruct deletions into the 3' end, the recombinant plasmid(pHbpl) was cleaved with HindIII to provide a 4-base 5'overhang from which to initiate the deletions and with ApaI,leaving a 3' overhang resistant to exonuclease III, thusavoiding deletion of vector sequences. For deletions into the5' end, the recombinant plasmid (pHbpl) was cleaved withBamHI to provide a 4-base 5' overhang from which toinitiate the deletions and with SstI, leaving a 3' overhang toprotect the vector sequences. The sizes of the deletionplasmids were established by agarose gel electrophoresis,and the direction of the deletions was determined by cleav-ing the deletion plasmids with PvuII; PvuII sites are locatedin both ends of p-Bluescript just internal to the polylinkersand would be obliterated in plasmids in which deletions

INFECT. IMMUN.

CLONING OF H. INFLUENZAE TYPE b PILIN GENE 1067

erroneously proceeded into the vector instead of, or inaddition to, the insert.

Sequencing. Nucleotide sequencing of plasmid DNA fromselected exonuclease III deletion mutants was performed bythe dideoxy-chain termination method of Sanger et al. (36,37), using [-y-32P]ATP and either the DNA polymerase I largefragment (Klenow; Promega) or T7 polymerase (Sequenase;United States Biochemical Corp., Cleveland, Ohio) (41).The 3' deletions were sequenced by using the T7 primer inX-ZAP, while the 5' deletions were sequenced by using its T3primer. Sequence analysis and comparisons were performedby using DNAstar computer programs (DNAstar, Madison,Wis.).

A 1 2 3 4 5 6 7 8

4 5

36

2 9 _t

20.1

1 4.4

RESULTS

Identification of Hib pilin-expressing clone pHbpl. Inscreening the Hib DNA library in E. coli BB4, 12 membranefilters, each containing 16,000 plaques, were tested withantipilin antiserum R20. Seven potentially positive cloneswere identified, and two clones were selected for furtheranalysis. The lacZ promoter of the XZAP vector is inducedby IPTG, and both clones produced pilin in either thepresence or absence of IPTG, suggesting that the immuno-reactive gene product was expressed from a promoter in theH. influenzae-specific DNA rather than from the ,-galactosi-dase promoter of X-ZAP. The recombinant DNA was sub-cloned into p-Bluescript by using the in vivo excision featureof X-ZAP, and the resultant "phagemids" (pHbpl andpHbp2) were transformed into E. coli XL1-Blue. Theserecombinant E. coli were tested on Western blot assay, usingsera R20 (antipilin antiserum) and R13 (antipeptide antise-rum) (Fig. 1). The recombinant E. coli showed a reactiveband of -24 kilodaltons, which was consistent with the sizeof the pilin in H. influenzae, while the host E. coli with andwithout the vector plasmid p-Bluescript showed no reactiv-ity. These results suggest that the gene product was not a,B-galactosidase fusion protein, nor was it a truncated Hibpilin.

Subclone pHbpl was selected for further analysis of pilinexpression. In dot blot assays whole E. coli cells containingpHbpl reacted with rabbit serum Rl, whereas E. coli con-taining p-Bluescript without the Hib insert did not (data notshown). Rl contains antibodies against structural epitopes ofM43p+ pili, as demonstrated by its recognition of intact pilion whole bacteria by immunodot assay and failure of recog-nition of denatured pilins by Western blot assay (J. R.Gilsdorf, L. J. Forney, and J. J. LiPuma, Microbial Patho-genesis, in press). These results suggest that the recombi-nant E. coli assembled the pilins into a structure that can berecognized by Rl. However, electron microscopy (data notshown) of the recombinant E. coli revealed no surface pili.E. coli containing pHbpl also failed to hemagglutinate,further suggesting that erythrocyte-binding epitopes werenot produced by pHbpl-containing cells.

Deletion analysis of pHbpl. Exonuclease III digestion ofpHbpl into insert DNA from either the 3' or 5' side, followedby religation and transformation into E. coli DH5, was usedto produce a series of plasmids containing staggered dele-tions to facilitate sequence analysis. Figure 2 shows arestriction map ofpHbpl, with the relative sizes of several ofthe deletion plasmids. The 3' deletion mutants pHbpl-drl2and pHbpl-dr8 contained the intact pilin gene and expressedpilin on Western blot assay, although compared with that ofthe nondeleted plasmid, pHbpl, the intensity of the pHbpl-drl2 pilin band was diminished and that of pHbpl-dr8 was

B l 3 4 5 6 7 8 9 10

4 5

3

2 9.i

20.1

14 4

FIG. 1. Western blot analysis of recombinant E. coli containingHib M43 pilin gene. (A) Serum R20 (antidenatured pilin) was used;(B) serum R13 (antipeptide) was used. Lane 1, Hib-Elap+ purifiedpili; lane 2, Hib M43p+ (note: M43p+ pilin migrates slightly slowerthan that of Elap+); lane 3, blank; lane 4, E. coli XL1-Bluecontaining recombinant plasmid pHbpl; lane 5, E. coli XL1-Bluecontaining recombinant plasmid pHbp2; lane 6, blank; lane 7,Hib-M42p-; lane 8, E. coli XL1-Blue; lane 9, E. coli XL1-Blue withp- Bluescript; lane 10, blank. Molecular masses (in kilodaltons) areindicated on the left.

almost nondetectable (Fig. 3). pHbpl-drlO contains lessDNA than pHbp-drl2 or pHbp-dr8, and the deletion extendsinto the 3' end of the pilin gene; this plasmid did not expresspilin on Western blot. The 5' deletion mutant pHbpl-dl2 alsoincluded the intact pilin and expressed pilin, whereaspHbpl-dl67, in which the 5'-end of the pilin gene had beendeleted, no longer expressed pilin.

Sequence analysis of the pilin gene. Deletion mutants ofpHbpl were used to sequence the Hib pilin structural gene(Fig. 4), which was identified by the presence of an openreading frame coding for a protein whose amino-terminalsequence closely matched that described by Guerina et al.(15), who sequenced the first 40 amino acids at the aminoterminus of purified pilin of Hib strain M43p+ (also calledAO-2). Our sequence of the mature protein differed from thatof Guerina et al. at two sites (Fig. 4); the first amino acid inthe pilin from our analysis was aspartic acid and from theanalysis of Guerina et al. it was serine. Amino acid 37 in our

sequence was valine and in the analysis of Guerina et al. itwas predicted to be threonine. The remaining 38 amino acidswere identical, which provided final confirmation that we

have cloned the Hib M43p+ pilin gene.The entire M43p+ pilin gene contained 639 base pairs of

DNA, coding for 213 amino acids. Preceding the gene for themature pilin protein was a leader sequence of 20 aminoacids, which was preceded by a ribosomal binding site,

9 10

VOL. 58, 1990

1068 GILSDORF ET AL.

Hind Ill AcciEcoR. Cb I, sal1,1 I

Hinc 1II. Xho I, Kpn

x

Sst Xba Pst ISac 1l Sp* 1. Sma

Not BaroN

S' z 3'l

o~~~~~~0 0I l - l~~~~~i = -

probe AT T

_1--&rb

299M~P

pHbpl-dr 12

pHbpl dr 8

pHbpl-dr 10

pHbpl dl 2

pHbpl-di 67

poplpBluescript

Hb-M43 plin gene

DNA probes

-H 0.6 kikobses

FIG. 2. Restriction map of pHbpl (8.5 kb) including the p-Bluescript plasmid vector (3.0 kb), the insert region (5.5 kb), the Hib M43 pilingene region (-0.6 kb), and nucleotide probes A and B. Also shown are deletion plasmids pHbpl-drl2 (6.7 kb), pHbpl-dr8 (6.7 kb),pHbpl-drlO (6.5 kb), pHbpl-dl2 (6.1 kb), and pHbpl-dl67 (5.4 kb).

identified by the presence of the Shine and Dalgarno se-quence (12). We found the structural gene for the maturepilin from Hib strain M43p+ to contain 579 base pairs ofDNA coding for 193 amino acids; thus, the calculatedmolecular mass of the pilin is 21,101 daltons, whereas themolecular mass was estimated from SDS-PAGE to be 24,000daltons (lla, 25).

Nucleotide sequence analysis of the deletion mutantsfurther defined the relationship between DNA structure andpilin expression. pHbpl-drlO (which didn't express pilin)contained a deletion extending 123 base pairs into the 3' endof the pilin gene. pHbpl-dr8 and pHbpl-drl2 (which poorlyexpressed pilin) contained 20 and 31 base pairs, respectively,of DNA downstream from the termination of the pilin gene.pHbpl-dl2 contained the entire pilin gene (the deletion endedabout 240 base pairs upstream from the pilin gene) andexpressed pilin. pHbpl-dl67 contained a deletion extending232 base pairs into the 5' side of the pilin gene and didn'texpress pilin.

Determination of copy number of pilin gene. Results ofgenomic Southern hybridization analysis of DNA from bothM43p+ and M42p- (the nonpiliated variant of M43p+)

1 2 3 4 5 6 7 8

24 kDaa-,

FIG. 3. Western blot analysis of deletion mutants of pHpbl,using antipilin antisera. Lane 1, M43p+; lane 2, E. coli with pHbpl;lane 3, E. coli; lane 4, E. coli with pHbpl-dr8; lane 5, E. coli withpHbpl-drlO; lane 6, E. coli with pHbpl-drl2; lane 7, E. coli withpHbpl-dl2; lane 8, E. coli with pHbpl-dl67. The molecular mass ofa marker protein (in kilodaltons) is indicated on the left.

cleaved with a variety of restriction enzymes are shown inFig. 5. The probes were DNA fragments that flanked a NsiIsite located within the pilin gene (Fig. 2). Each probehybridized to only one NsiI band, and the bands weredifferent sizes for each probe. Therefore, only a single copy

GTCTTTCCCACGTAAGCTAAAGCCAACCTACGGCAAAATTAATTCAAAATAAAATATGAA

ATTTTTCAAAAAGAACTTTAATTATATATATATATATATATAATGGAAGCGTTTTTTACT

TTTTTTGGAAAAACAAATCTTGCTGTTTATTAAGCTTTAGCATTTTAATAAACGGTTTAT

ATTAATCTTTTGCCTTATTTATAAGGCACAAACCTCTTTATGGAGCAATTTATTATGAAAMetLys

AAAACACTTCTTGGTAGCTTAATTTTATTGGCATTTGCGGGAAATGTGCAGGCGGATATTLysThrLeuLeuGlySerLeulleLeuLeuAlaPheAlaGlyAsnValGlnAlaAspIle

>SerIle

AATACTGAAACATCTGGTAAAGTTACTTTTTTTGGTAAGGTTGTTGAGAATACTTGTAAAAsnThrGluThrSerGlyLysValThrPhePheGlyLysValValGluAsnThrCysLysAsnThrGluThrSerGlyLysValThrPhePheGlyLysValValGluAsnThrCysLys

GTGAAAACAGAGCATAAAAATCTGAGTGTAGTATTAAATGATGTGGGTAAAAATAGCTTAValLysThrGluHisLysAsnLeuSerValValLeuAsnAspValGlyLysAsnSerLeuValLysThrGluHisLysAsnLeuSerValValLeuAsnAspThrGlyLysAsn <

TCTACTAAAGTAAATACCGCAATGCCAACGCCATTTACGATTACATTACAAAATTGTGACSerThrLysValAsnThrAlaMetProThrProPheThrIleThrLeuGlnAsnCysAsp

CCAACTACGGCAAATGGTACTGCAAATAAAGCTAATAAAGTTGGGCTATATTTCTATTCTProThrThrAlaAsnGlyThrAlaAsnLysAlaAsnLysValGlyLeuTryPheTyrSer

TGGAAAAATGTAGATAAAGAAAATAACTTTACGTTGAAAAATGAACAAACTACGGCAGATTrpLysAsnValAspLysGluAsnAsnPheThrLeuLysAsnGluGlnThrThrAlaAspTACGCAACTAATGTTAATATTCAACTTATGGAAAGTAATGGTACAAAGGCGATTTCAGTATyrAlaThrAsnValAsnIleGInLeuMetGluSerAsnGlyThrLysAlalleSerVal

GTGGGTAAAGAAACGGAAGATTTTATGCATACGAATAATAATGGAGTAGCATTAAACCAAValGlyLysGluThrGluAspPheMetHisThrAsnAsnAsnGlyValAlaLeuAsnGln

ACCCACCCAAATAATGCTCATATTTCAGGAAGTACACAATTAACCACTGGTACTAATGAAThrHisProAsnAsnAlaHislleSer6lySerThrGlnLeuThrThrGlyThrAsnGlu

CTTCCTCTCCACTTTATCGCCCAATATTACGCAACAAATAAAGCAACTGCTGGCAAAGTALeuProLeuHisPhelleAlaGlnTyrTyrAlaThrAsnLysAlaThrAlaGlyLysVal

CAATCCTCAGTTGATTTCCAAATTGCTTACGAATAATTCCTAATGTAATGCAAGAGAAACG6nSerSerValAspPheG6nIleAlaTyrG6uTERM

FIG. 4. Hib M43p+ pilin gene nucleotide sequence and transla-tion. The amino acid sequence of M43p+ pilin determined byGuerina et al. (15) is also shown between the arrowheads, withdisparate amino acids underlined.

INFECT. IMMUN.

CLONING OF H. INFLUENZAE TYPE b PILIN GENE 1069

U 4 5626a :~;- e-"11.1 a :1

PlinsM43F17Pap ATylCMrkABfmst2Smfa

4j_b0.r

D I N _l i. . .. Y DP T I P 33 0- V T/I NMAD TN V GE- D D

- A A D i H

21

FIG. 5. Southern hybridizations of Hib DNA digested with theindicated restriction enzymes. Lanes: 1, cleaved with EcoRI; 2,cleaved with NsiI; 3, cleaved with XhoI; 4, cleaved with ClaI; 5,cleaved with DraI; and 6, cleaved with RsaI. Lane a, M43p+ DNA;lane b, M42p- DNA. Panel A was hybridized with probe A (pHbpl)(NsiI-HindIII fragment); panel B was hybridized with probe B(pHbpl) (XhoI-NsiI fragment).

of the pilin gene is present in strain M43p+. Because DraIand RsaI cleaved within the probe regions, the DNA cutwith these enzymes showed more than one fragment hybrid-izing to the probes. Figure 5 also shows no differencesbetween M43p+ and M42p- DNA in the hybridizationpatterns when all six enzymes were used. Thus, we haveidentified no apparent genomic rearrangements associatedwith the expression of the Hib pilin gene.

Codon usage in Hib proteins. Table 1 contains a codonusage analysis of the pilin gene and compares our results tothose derived from sequence analysis of eight other genes ofH. influenzae (P1 [32], P2 [17, 33], P6 [34], bexA [21], pal [9],pcp [9], and the Hinfl endonuclease and methylase genes

[6]), as well as to codon usage frequencies for E. coli (13).Met and Trp, which are each encoded by a unique codon,have been excluded from the table.

DISCUSSION

This paper describes the cloning of the pilin gene of Hibstrain M43p+, the nucleotide sequence analysis of this gene,and the expression of the Hib pilin in recombinant E. coli.X-ZAP phage containing the Hib pilin gene was identified byscreening a H. influenzae genomic library with polyclonalantiserum that recognizes epitopes on denatured pilin. Afterin vivo subcloning, E. coli possessing the recombinantplasmid pHbpl was found to express pilin, as seen onWestern blot analysis by using two different antisera specificfor epitopes on Hib pilin. However, since intact pili were notseen by electron microscopy of the recombinant E. coli, thecomplete, assembled pili were apparently not expressed on

the cell surface. In addition, the recombinant E. coli did notagglutinate human erythrocytes, suggesting that the erythro-cyte-binding moieties that are associated with piliation were

also not expressed on the cell surface. Two deletion mutantswith a portion of either the 5' or 3' end of the gene deleteddid not express pilin. Possibly, a truncated pilin protein thatwas readily degraded in E. coli was produced by pHbpl-dr10, from which 123 base pairs of DNA was deleted from the3' end of the pilin gene. Although the two mutants pHbp-dr8and pHbp-drl2, which contained 20 and 33 base pairs,respectively, of DNA downstream of the stop codon of the

M43p+ - K 41F17 S w_T_PaPA - S M O K S A F GTyIC * A FMM3 SPMrk V S _ G3 S M _ { - T EBfmst2 E D P 3 P _r K W K-KSn -SfaSWP 3ANM43p+ _ 62

F17 G M G

PapA GGV

TZr1C V D - G A K6MTkC 1 -A K-Bfmst2 G IV R

Smfa 3/NG- G _ 3Q333 _Carbazy Terminal Regns

M43p+ 187

F17 - V Fw_-Pap K S G A MTy1C A- ^ T

MkA EP T A - TBfm et2/K K MGDV E W

Smfha 333aGE GE V

M43p+ P,G,D,FF17

PapATy1CMrIc

Bfmst2

FIG. 6. Comparison of amino acid sequences of the amino andcarboxy termini of pilin of Hib strain M43p+ and pilins from a

variety of other bacteria. M43, Hib strain M43p+; F17, E. coli F17;PapA, E. coli Pap; Ty1C, E. coli; type 1 c; mrkA, K. pneumonia,type 3; bfmst2, B. pertussis serotype 2; smfa, S. marcescens. Aminoacids that are identical or similar, as defined in the text, to those ofM43p+ are shaded.

pilin gene, expressed the pilin, the signal on the Western blotanalysis was faint, suggesting a smaller amount of pilinproduced. The deleted regions of these mutants may containgenes that regulate the production of pilin.

Expression of the pilin appears to be under the control ofa Hib promoter, in spite of the fact that an expression vectorcontaining the lacZ gene promoter was used in the cloningexperiments. Evidence for this includes IPTG independentexpression, equal size of the expressed pilin and the M43p+pilin (a ,3-galactosidase fusion protein would be larger), andthe long segment ofDNA from the beginning of the insert tothe beginning of the pilin gene.

In contrast to Neisseria gonorrhoeae, which possessmultiple, although incomplete, copies of pilin genes (39), Hibstrain M43p+ tested here possessed one copy of the -pilingene. In addition, the gene was also present in strain M42p-,the nonpiliated variant. Although Southern blot analysisrevealed no genomic rearrangements to explain the pheno-typic difference between M43p+ and M42p-, small rear-

rangements that were not seen may be present.We have compared the translated amino acid sequence of

the M43p+ mature pilin (excluding the leader sequence) tothe published pilin sequences of a wide variety of otherbacteria. Only very few sequence similarities were foundwith E. coli pilins from K99, K88, and type 1 pili (31).However, other E. coli pilins, including F17 (23), type 1C(43), and members of the P-pili family, including PapA (2),F7, F72, and Fll (42), as well as the major subunit proteinsof type 3 MR/K fimbriae of Klebsiella pneumonia (10), of

4_-

VOL. 58, 1990

:..: 1. F" -51. 11- -i

c. E' -.

1070 GILSDORF ET AL.

TABLE 1. Codon usage of the H. influenzae M43 pilin gene compared with other H. influenzae and E. coli genes

Frequency of codon use (%) Frequency of codon use (%)Amino Codon M3pin Other Amino Codo OtherE.clacid M43gen H. influenzae E. co/i acid on M43 pilin H. influenzae E. co

gene genes gene genesgenes genes

Phe (F) UUU 78 73 47 Tyr (Y) UAU 50 69 44UUC 22 27 53 UAC 50 31 56

Leu (L) UUA 44 55 8 His (H) CAU 60 56 46UUG 13 15 8 CAC 40 44 54CUU 25 17 10CUC 6 4 10 Gln (Q) CAA 89 85 28CUJA 6 7 2 CAG 11 15 72CUG 6 2 62

Asn (N) AAU 92 70 31Ile (I) AUU 87 64 35 AAC 8 30 69

AUC 13 21 60AUA 0 15 5 Lys (K) AAA 89 86 74

AAG 11 14 26Val (V) GUU 35 45 38

GUC 0 3 14 Asp (D) GAU 86 74 49GUA 41 36 21 GAC 14 26 51GUG 24 16 26

Glu (E) GAA 80 84 73Ser (S) UCU 25 31 23 GAG 20 16 27

UCC 8 3 24UCA 25 19 8 Cys (C) UGU 100 94 43UCG 0 6 13 UGC 0 6 57

Pro (P) CCU 20 18 12 Arg (R) CGU 0 49 47CCC 0 9 11 CGC 0 13 35CCA 80 61 16 CGA 0 10 4CCG 0 11 61 CGG 0 5 6

AGA 0 21 5Thr (T) ACU 39 41 27 AGG 0 0.2 3

ACC 11 13 46ACA 25 36 8 Ser (S) AGU 25 32 12ACG 25 10 19 AGC 17 10 20

Ala (A) GCU 24 35 26 Gly (G) GGU 62 63 44GCC 6 6 23 GGC 8 21 40GCA 53 44 23 GGA 23 8 6GCG 18 14 28 GGG 8 8 10

a Underlined codons are ones which, in E. coli, are recognized by minor or weakly interacting tRNA molecules and which are very infrequently found withinhighly expressed genes (13).

serotype 2 Bordetella pertussis fimbriae (26), and of Serratiamarcescens US46 mannose-resistant fimbriae (30), all hadsignificant sequence similarity to H. influenzae M43p+ pilin(Fig. 6). Of these, F17, a pilin from a bovine enterotoxigenicE. coli strain (23), shows the highest sequence similarity tothe mature M43p+ pilin. Seven small and two large gaps inthe F17 amino acid sequence allow M43p+ and F17 pilins toalign with 70 of 186 (37.6%) identical amino acids and anadditional 22% similar amino acids. The definition of simi-larity of amino acids is based on the work of Lipman andPearson (24), in which a similarity matrix was derived bycomparing various closely related proteins and determiningthe probability that a given amino acid would be replaced byany other amino acid over a fixed period of time. Thus,counting both identical and similar amino acids as "match-es," M43p+ and F17 pilins match at 60% of the amino acids.

Figure 6 demonstrates that the M43p+ pilin is part of asuperfamily of pilins with conserved amino- and carboxy-terminal regions. The shaded areas are amino acids, eitheridentical or similar (as defined by Lipman and Pearson [24])to the amino acids found in M43p+ pilin. Although somegaps are required to optimize the sequence similarities,

regions of strong conservation are seen at both amino andcarboxy termini. At the amino-terminal end, the 14 aminoacids prior to and including the first cysteine residue arehighly conserved, without any gaps, and the remainder ofthe amino-terminal conservation continues through the prob-able cysteine loop, with some differences in the size of theloop among the different pilins. Overall, from amino acids 8to 62, the M43p+ pilin sequence is identical to two of theother six pilins in at least 55% of the positions and matchesfour of the other six pilins in at least 58% of the positions; allseven pilins match at 27% of the positions. At the carboxyterminus (M43p+ amino acids 169 to 193), the M43p+ pilinsequence is identical to that of two of the other six pilins at64% of the positions and matches that of four of the other sixpilins in at least 68% of the positions; all seven pilins matchin at least 16% of these positions.As noted previously, all the E. coli pilins, including K88

and K99, which are morphologically quite different fromtypes 1 and P pili, have regions of sequence similarity at boththe amino- and carboxy-terminal regions (20, 31). When K88and K99 are included, the sequence similarities are lesspronounced than those in Fig. 6 and span only about 20

INFECT. IMMUN.

CLONING OF H. INFLUENZAE TYPE b PILIN GENE 1071

amino acids at the amino terminus, compared with the55-amino-acid region at the amino terminus shown in Fig. 6.

Clearly not all bacterial pilins are related to this superfam-ily. Another superfamily of pilins, the type 4 (MePhe) classof pilins present in a wide range of bacteria, including N.gonorrhoea, Pseudomonas aeruginosa, Moraxella bovis,and Bacteroides nodosus (8), appear to have no significantsequence similarity to M43p+ pilin or any of the othermembers listed in Fig. 6.As can be seen in Table 1, M43p+ pilin gene codon usage

agrees with the combined figures for eight other published H.influenzae genes. H. influenzae appears to have a biasedcodon usage pattern, but one that is clearly different fromthat of E. coli. The G+C ratio in E. coli is 51% and in H.influenzae is 39% (19). Winkler and Wood (44) have foundthat in even more dramatically A+T-rich bacteria, codonbias was determined by the use of U or A in the first andthird positions of the codon when possible. The bias forU+A-rich codons in H. influenzae is clear; the H. influenzaeM43p+ pilin gene as well as the other H. influenzae geneslisted in Table 1 use U+A-rich codons 73% of the time, whileE. coli only used U+A-rich codons 43% of the time.With the availability of the cloned pilin gene and the

descriptive information about the gene as outlined in thispaper, we are now able to construct specific pilin genemutations in E. coli and to transform the mutated genes backinto Hib. These genetic mutants will facilitate further studiesof the role of pili in the pathogenesis of Hib infection.

ACKNOWLEDGMENTS

We thank Tom Giddings, Boulder, Colo., for the electron micros-copy.

This work was supported in part by a grant from the Milton RatnerFoundation.

ADDENDUM IN PROOF

After submission of the manuscript, an article describingthe nucleotide sequence of the pilin gene of Hib strain770235f1b0 was published (S. M. van Ham, F. R. Mooi,M. G. SindLunata, W. R. Maris, and L. van Alphen, EMBOJ. 8:3535-3540, 1989). The nucleotide sequences of strains770235f+b° and M43p+ are identical, including the leadersequence.

LITERATURE CITED1. Anderson, P. W., M. E. Pichichero, and E. M. Connor. 1985.

Enhanced nasopharyngeal colonization of rats by piliated Hae-mophilus influenzae type b. Infect. Immun. 48:565-568.

2. Baga, M., S. Normark, J. Hardy, P. O'Hanley, D. Lark, 0.Olsson, G. Schoolnik, and S. Falkow. 1984. Nucleotide sequenceof the papA gene encoding the Pap pilus subunit of humanuropathogenic Escherichia coli. J. Bacteriol. 157:330-333.

3. Barenkamp, S. J., R. S. Munson, Jr., and D. M. Granoff. 1981.Subtyping isolates of Haemophilus influenzae type b by outermembrane protein profiles. J. Infect. Dis. 143:668-676.

4. Beachey, E. H. 1981. Bacterial adherence: adhesin-receptorinteractions mediating the attachment of bacteria to mucosalsurfaces. J. Infect. Dis. 143:325-345.

5. Centers for Disease Control. 1982. Prevention of secondarycases of Haemophilus influenzae type b disease. Morbid. Mor-tal. Weekly Rep. 31:672-680.

6. Chandrasegaran, S., K. D. Lunnen, and H. 0. Smith. 1988.Cloning and sequencing the Hinfl restriction and modificationgenes. Gene 70:387-392.

7. Connor, E. M., and M. R. Loeb. 1983. A hemadsorption methodfor detection of colonies of Haemophilus influenzae type bexpressing fimbriae. J. Infect. Dis. 148:855-860.

8. Dalrymple, B., and J. S. Mattick. 1987. An analysis of theorganization and evolution of type 4 fimbrial (MePhe) subunitproteins. J. Mol. Evol. 25:261-269.

9. Deich, R. A., B. J. Metcalf, and C. W. Finn. 1988. Cloning ofgenes encoding a 15,000-dalton peptidoglycan-associated outermembrane lipoprotein and an antigenically related 15,000-daltonprotein from Haemophilus influenzae. J. Bacteriol. 170:489-498.

10. Gerlach, G.-F., B. L. Allen, and S. Clegg. 1988. Molecularcharacterization of the type 3 (MR/K) fimbriae of Klebsiellapneumoniae. J. Bacteriol. 170:3547-3553.

11. Gilsdorf, J. R., and P. Ferrieri. 1984. Adherence of Haemoph-ilus influenzae to human epithelial cells. Scand. J. Infect. Dis.16:171-178.

11a.Gilsdorf, J. R., L. S. Forney, and J. J. LiPuma. 1989. Reactivityof Haemophilus influenzae type b anti-pili antibodies. Microb.Pathog. 7:311-316.

12. Gold, L. 1988. Post-transcriptional regulatory mechanisms inEscherichia coli. Annu. Rev. Biochem. 57:199-233.

13. Grosjean, H., and W. Fiers. 1982. Preferential codon usage inprokaryotic genes: the optimal codon-anticodon interactionenergy and the selective codon usage in efficiently expressedgenes. Gene 18:199-209.

14. Guerina, N. G., S. Langermann, H. W. Clegg, T. W. Kessler,D. A. Goldmann, and J. R. Gilsdorf. 1982. Adherence of piliatedHaemophilus influenzae type b to human oropharyngeal cells. J.Infect. Dis. 146:564.

15. Guerina, N. G., S. Langermann, and G. K. Schoolnik. 1985.Purification and characterization of Haemophilus influenzaepili, and their structural and serological relatedness to Esche-richia coli p and mannose-sensitive pili. J. Exp. Med. 161:145-159.

16. Hanahan, D. 1985. Techniques for transformation of E. coli, p.109. In D. M. Glover (ed.), DNA cloning, vol 1: a practicalapproach. IRL Press, McLean, Va.

17. Hansen, E. J., C. Hasemann, A. Clausell, J. D. Capra, K. Orth,C. R. Moomaw, C. A. Slaughter, J. L. Latimer, and E. H. Miller.1989. Primary structure of the porin protein of Haemophilusinfluenzae type b determined by nucleotide sequence analysis.Infect. Immun. 57:1100-1107.

18. Hull, R. A., R. E. Gill, P. Hsu, B. H. Minshew, and S. Falkow.1981. Construction of and expression of recombinant plasmidsencoding type 1 or D-mannose-resistant pili from a urinary tractinfection Escherichia coli isolate. Infect. Immun. 33:933-938.

19. Kilian, M., and E. L. Biberstein. 1984. Haemophilus, p. 558-569. In N. R. Krieg and J. G. Holt (ed.), Bergey's manual ofsystematic bacteriology, vol. 1. The Williams & Wilkins Co.,Baltimore.

20. Klemm, P. 1985. Fimbrial adhesins of Escherichia coli. Rev.Infect. Dis. 7:321-340.

21. Kroll, J. S., I. Hopkins, and E. R. Moxon. 1988. Capsule loss inH. influenzae type b occurs by recombination-mediated disrup-tion of a gene essential for polysaccharide export. Cell 53:347-356.

22. Labigne-Roussel, A. F., M. A. Schmidt, and W. Walz. 1985.Genetic organization of the afimbrial adhesin operon and nucle-otide sequence from a uropathogenic Escherichia coli geneencoding an afimbrial adhesin. J. Bacteriol. 162:1285-1292.

23. Lintermans, P., P. Pohl, F. Deboeck, A. Bertels, C. Schlicker, J.Vandekerckhove, J. Van Damme, M. Van Montagu, and H. DeGreve. 1988. Isolation and nucleotide sequence of the F17-Agene encoding the structural protein of the F17 fimbriae inbovine enterotoxigenic Escherichia coli. Infect. Immun. 56:1475-1484.

24. Lipman, D. J., and W. R. Pearson. 1985. Rapid and sensitiveprotein similarity searches. Science 227:1435-1441.

25. LiPuma, J. J., and J. R. Gilsdorf. 1988. Structural and serolog-ical relatedness of Haemophilus influenzae type b pili. Infect.Immun. 56:1051-1056.

26. Livey, I., C. J. Duggleby, and A. Robinson. 1987. Cloning andnucleotide sequence analysis of the serotype 2 fimbrial subunitgene of Bordetella pertussis. Mol. Microbiol. 1:203-209.

27. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular

VOL. 58, 1990

1072 GILSDORF ET AL.

cloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

28. Marrs, C. F., G. Schoolnik, and J. M. Koomey. 1985. Cloningand sequencing of a Moraxella bovis pilin gene. J. Bacteriol.163:132-139.

29. Michaels, R. H., and F. E. Stonebraker. 1975. Use of antiserumagar for detection of Haemophilus influienzae in the pharynx.Pediatr. Res. 9:513-516.

30. Mizunoe, Y., Y. Nakabeppu, and M. Sekiguchi. 1988. Cloningand sequence of the gene encoding the major structural compo-nent of mannose-resistant fimbriae of Serratia marcescens. J.Bacteriol. 170:3567-3574.

31. Mooi, F. R., and F. K. deGraaf. 1985. Molecular biology offimbriae of enterotoxigenic Escherichia coli. Curr. Top. Micro-biol. Immunol. 118:119-138.

32. Munson, R. Jr., and S. Grass. 1988. Purification, cloning, andsequence of outer membrane protein P1 of Haemophilus influ-enzae type b. Infect. Immun. 56:2235-2242.

33. Munson, R. Jr., and R. W. Tolan, Jr. 1989. Molecular cloning,expression, and primary sequence of outer membrane proteinP2 of Haemophilus influenzae type b. Infect. Immun. 57:88-94.

34. Nelson, M. B., M. A. Apicella, and T. F. Murphy. 1988. Cloningand sequencing of Haemophilus influenzae outer membraneprotein P6. Infect. Immun. 56:128-134.

35. Pichichero, M. E., M. Loeb, and P. Anderson. 1982. Do pili playa role in pathogenicity of Haemophiliis influenzae type b?Lancet ii:960-962.

36. Sanger, F., A. R. Coulson, and B. G. Barrell. 1980. Cloning insingle-stranded bacteriophage as an aid to rapid DNA sequenc-

ing. J. Mol. Biol. 143:161-178.37. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-

ing with chain terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

38. Short, J. M., J. M. Fernandez, and J. A. Sorge. 1988. X ZAP: abacteriophage A expression vector with in vivo excision proper-ties. Nucleic Acids Res. 16:7583-7600.

39. So, M. 1986. The pilus of Neisseria gonorrhoeae: phase andantigenic variation. In M. Inouye (ed.), Bacterial outer mem-branes. John Wiley and Sons, Inc., New York.

40. Stull, T. L., P. M. Mendelman, and J. E. Haas. 1984. Charac-terization of Haemophiluis influenzae type b fimbriae. Infect.Immun. 46:764-796.

41. Tonneguzzo, F., S. Glynn, and E. Levi. 1988. Use of a chemi-cally modified T7 DNA polymerase for manual and automatedsequencing of supercoiled DNA. BioTechniques 6:460-469.

42. van Die, I., W. Hoekstra, and H. Bergmans. 1987. Analysis ofthe primary structure of P-fimbrillins of uropathogenic Esche-richia coli. Microb. Pathog. 3:149-154.

43. van Die, I., B. van Geffen, and W. Hoekstra. 1985. Type 1Cfimbriae of a uropathogenic Escherichia coli strain: cloning andcharacterization of the genes involved in the expression of the1C antigen and nucleotide sequence of the subunit gene. Gene34:187-196.

44. Winkler, H. H., and D. 0. Wood. 1988. Codon usage in selectedAT-rich bacteria. Biochimie 70:977-986.

45. Young, R. A., and R. W. Davis. 1983. Efficient isolation of genesby using antibody probes. Proc. Natl. Acad. Sci. USA 80:1194-1198.

INFECT. IMMUN.