I(g

GI

a

ARRAA

KBENAPR

1

ciiB(llcbo

hnoSt

0h

Vaccine 30 (2012) 4499– 4504

Contents lists available at SciVerse ScienceDirect

Vaccine

jou rn al h om epa ge: www.elsev ier .com/ locate /vacc ine

mmunocompetent truncated E2 glycoprotein of bovine viral diarrhea virusBVDV) expressed in Nicotiana tabacum plants: A candidate antigen for neweneration of veterinary vaccines

uillermo Nelson, Patricia Marconi, Osvaldo Periolo, José La Torre, María Alejandra Alvarez ∗

nstituto de Ciencia y Tecnología Dr. César Milstein, CONICET – Fundación Pablo Cassará, Saladillo 2468, Ciudad de Buenos Aires, C11440FFX, Argentina

r t i c l e i n f o

rticle history:eceived 16 August 2011eceived in revised form 16 April 2012ccepted 21 April 2012vailable online 1 May 2012

eywords:ovine viral diarrhea virus2icotiana tabacumgrobacteriumlant transient expression

a b s t r a c t

The bovine viral diarrhea virus (BVDV) is the etiological agent responsible for a wide spectrum of clin-ical diseases in cattle. The glycoprotein E2 is the major envelope protein of this virus and the strongestinductor of the immune response. There are several available commercial vaccines against bovine viraldiarrhea (BVD), which show irregular performances. Here, we report the use of tobacco plants as an alter-native productive platform for the expression of the truncated version of E2 glycoprotein (tE2) from theBVDV. The tE2 sequence, lacking the transmembrane domain, was cloned into the pK7WG2 Agrobacteriumbinary vector. The construct also carried the 2S2 Arabidopsis thaliana signal for directing the protein intothe plant secretory pathway, the Kozak sequence, an hexa-histidine tag to facilitate protein purificationand the KDEL endoplasmic reticulum retention signal. The resulting plasmid (pK-2S2-tE2-His-KDEL) wasintroduced into Agrobacterium tumefaciens strain EHA101 by electroporation. The transformed A. tume-faciens was then used to express tE2 in leaves of Nicotiana tabacum plants. Western blot and ELISA using

ecombinant vaccine specific monoclonal antibodies confirmed the presence of the recombinant tE2 protein in plant extracts.An estimated amount of 20 �g of tE2 per gram of fresh leaves was regularly obtained with this plantsystem. Injection of guinea pigs with plant extracts containing 20 �g of rtE2 induced the production ofBVDV specific antibodies at equal or higher levels than those induced by whole virus vaccines.

This is the first report of the production of an immunocompetent tE2 in N. tabacum plants, having they eve

advantage to be free of an

. Introduction

Bovine viral diarrhea (BVD) is a widespread cattle disease thatauses serious mucosal lesions and other clinical manifestationsncluding reproductive disorders, congenital defects, persistentnfections, enteritis, and mucosal alterations. It is estimated thatVD generates a negative economic impact in dairy operationsbetween $20 and $160 per adult cow per year), which includesoss of milk production, reproductive wastage, medication andabor to treat acute infections, and increased mortality [1]. The

ausative agent is the bovine viral diarrhea virus (BVDV), a mem-er of the genus Pestivirus (Flaviviridae) [2] whose genome consistsf a positive-stranded RNA of about 12,300 nucleotides encoding a

Abbreviations: BVDV, bovine viral diarrhea virus; KIN, kinetin; His-tag, hexaistidine-tag; GMP, good manufacture practices; MDBK, Madin–Darby bovine kid-ey cells; MS, Murashige and Skoog media; NAA, 1-naphtalene acetic acid; OD,ptical density; PMSF, phenylmethanesulfonyl fluoride; TSP, total soluble protein;DS, sodium dodecyl sulfate; WT, wild type; VNT, virus-neutralization test; tE2,runcated E2.∗ Corresponding author. Tel.: +54 11 4686 3687; fax: +54 11 4686 3687.

E-mail address: malvarez@conicet.gov.ar (M.A. Alvarez).

264-410X/$ – see front matter © 2012 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.vaccine.2012.04.068

ntual animal contaminant.© 2012 Elsevier Ltd. All rights reserved.

huge polyprotein that is cleaved into structural and non-structuralproteins. The glycoprotein E2, the main component of the virion[3], consists of about 370 amino acids with a theoretical molecularmass of 41 kDa. The C terminus of E2 includes a transmembranedomain of approximately 30 amino acids, which anchors it tothe membrane of the virus-infected cells [4]. E2 is the majortarget of the protective immune response elicited against BVDVinfection.

Commercially available inactivated and modified-live BVDVvaccines (MLV) have been extensively used for fighting the dis-ease. Even though both types of vaccines are in use, there is still acontroversy regarding their efficiency [5–7]. Thus, the E2 subunitvaccines have been considered as an alternative to induce protec-tion in immunized animals [1,8–10]. Nevertheless, the recombinantE2 (rE2) expressed in bacteria did not induce neutralizing antibod-ies in rabbits, which was attributed to a misfolding of E2 whenexpressed in prokaryotes [11] or it is produced as an aggregatedinsoluble protein [12]. In this last case the costs of solubilization

and endotoxin removal have to be considered when analyzing theproduction costs. On the other hand, the rE2 expressed in the bac-ulovirus system produced neutralizing antibodies but at low titers[8].

4500 G. Nelson et al. / Vaccine 30 (2012) 4499– 4504

Fig. 1. Construct analysis. (a) Schematic diagram of the transformation vector pK-2S2-tE2-His-KDEL. CaMV35S, cauliflower mosaic virus 35S promoter; nptII, neomycinphosphotransferase gene; 35S terminator, cauliflower mosaic virus 35S transcription terminator; 2S2, Arabidopsis secretory signal; KDEL, KDEL-ER retention signal; tE2,truncated E2 version lacking its transmembrane domain; RB, T-DNA right border; LB, T-DNA left border. (b) PCR of Agrobacterium carrying pK-tE2-His-KDEL. Amplificationwas performed using primers E2 Fw and E2 Rv (see Section 2). Lane 1: ladder 100pb (Invitrogen®), lane 2: transformed A. tumefaciens, lane 3: vector pss-E2, (plasmidDNA as positive control), lane 4: A. tumefaciens wild type. (c) Coomassie brilliant blue staining of denatured protein extracted from N. tabacum leaves analyzed by 10% ofS ® ue wiA e read

anphdcpbncbtiwawstsrtfats

2

2

cM(fiAApsMTth

DS-PAGE. 1, positive control; 2, see blue ladder (Invitrogen ); 3, agroinfiltrated tissgrobacterium. (For interpretation of the references to color in this figure legend, th

Alternatively, plants (both whole plants and in vitro cultures)re gaining attention for the large-scale production of recombi-ant proteins and particularly, as a promising platform for vaccineroduction [13–16] although a higher number of clinical trialsave to be performed in order to increase general acceptance. Toate, there is more than a dozen of plant-made biopharmaceuti-als in clinical developments [17]. Some of the advantages of thelant-based systems are that they can rapidly be bulked to largeiomass, its maintenance is relatively inexpensive, and they doot harbor mammalian proteins or pathogens. Protein productionould be achieved through stable or transient expression. The sta-le transformation methods, which are generally in use, modifyhe genetic background of the productive plant species generat-ng biosafety concerns [13,14]. The transient expression strategy,

here the foreign DNA is not integrated into the plant genome, has much shorter timeframe than nuclear or plastid transformationith yields that are in general higher to those obtained when a

table transformation is performed. Also, it has the ability to meethe stringent demands for high quality biologics and high biosafetytandards at a competitive scale and cost [18,19]. In this work weeport the expression of the BVDV truncated glycoprotein E2 inobacco plants by transient expression with Agrobacterium tume-aciens. Also, we tested the ability of the rtE2 to induce specificntibodies in guinea pigs, which is an accepted animal model foresting BVDV vaccines [6,20]. The results obtained indicate the fea-ibility to develop and produce a new generation of BVDV vaccines.

. Materials and methods

.1. Plasmid construction

The plasmid pss-E2 harboring the BVDV E2 glycoproteinDNA [21] was kindly provided by Dr. Marzocca (Argentineaninistry of Science and Technology). The E2 coding region

1029 nt) without its transmembrane domain was ampli-ed by polymerase chain reaction (PCR) using 5′CACCATGGC-AACAAGCTCTTCCTCGTCTGCGCAACTTTCGCCCTCTGCTTCCTCCTC-CCAACGCTGACTTGGATTGCAAACCTG 3′ (E2 Fw) as a forwardrimer, carrying the NcoI restriction site, the Arabidopsis 2S2ignal (replacing the ss viral secretory signal peptide of Dr.

arzocca construct), the Kozak sequence, and 5′CTCGAGTCA-

TATAGCTCATCTTTATGATGATGATGATGATGGGACTC 3′ (E2 Rv) ashe reverse primer with the KDEL ER – retention signal and anexa-histidine tag (His-tag) placed before the KDEL in order to

th Agrobacterium carrying pK-tE2-His-KDEL; 4, tissue agroinfiltrated with wild typeer is referred to the web version of the article.)

facilitate protein purification. The amplified product was digestedwith NcoI/XhoI, and then purified and cloned into the correspond-ing sites of the Gateway® pENTR-4 vector previously digestedwith the same restriction enzymes (Invitrogen®) rendering thepENTR-2S2-tE2-His-KDEL plasmid. A following recombination stepbetween the plasmid pENTR-2S2-tE2-His-KDEL and the binaryvector pK7WG2 was performed using the Gateway® technologyaccording to the manufacturer’s instructions resulting in theplasmid pK-2S2-tE2-His-KDEL [22] (Fig. 1a).

The constructs were checked by PCR, restriction endonucleasemapping and sequencing. Sequencing was done using a DNA ABI373A automated sequencer, according to the Sanger method [23].We have followed standard procedures for the plasmid manipula-tions [24].

2.2. Agrobacterium transformation

The pK-2S2-tE2-His-KDEL vector was introduced in A. tume-faciens strain EHA101 by electroporation [25]. A volume of 80 �lof competent cells was mixed with 200 ng plasmid DNA and sus-pended in an electroporation cuvette with an electrode distanceof 0.1 cm (Electroporation Cuvettes Plus). A single electric pulse of2.5 kV was applied using the 25 F capacitor (Gene pulser, Bio-Rad).After the pulse, cells were immediately transferred into 200 �l ofYEB and incubated at 28 ◦C during 3 h, before spreading on theYEB plates. Screening of different transformants was performedon YEB medium containing 50 �g ml−1 kanamycine, 20 �g ml−1

rifampicin, and 100 �g ml−1 spectinomycin. We have checked thecolonies by PCR analysis, and the purified plasmid by restrictionendonuclease map, and sequencing.

2.3. Plant transient expression

An overnight A. tumefaciens culture was inoculated in YEBmedium (1:5 v/v) supplemented with antibiotics (100 �g ml−1

kanamycine, 20 �g ml−1 rifampicin, 100 �g ml−1 spectinomycin)and 20 �M acetosyringone. Cultures were grown overnight at28 ◦C and 250 rpm. A. tumefaciens cells were then harvested bycentrifugation (4000 × g at 4 ◦C for 15 min) and re-suspended inMMA medium (MS salts, 10 mM MES, 20 g l−1 sucrose, pH 5.6,

and 200 �M acetosyringone) [26,27]. The A. tumefaciens (pK-2S2-tE2-His-KDEL) suspension was kept at room temperature for 2 hafter being used for plant transient expression. Nicotiana tabacumin vitro-grown plantlets were transferred to 330 cm3 pots filled

cine 30

wLfsSfnacS

2

eKp1a

2

i(abfwpTbicbw0fS

2

aucrn

apctTsi

2

sm2ov

G. Nelson et al. / Vac

ith soil and kept in greenhouse under controlled conditions.eaves of 2-week-old-plants were infiltrated with the A. tume-aciens (pK-2S2-tE2-His-KDEL) suspension by inoculation with ayringe without a needle by the abaxial side of the lamina [28].ome tobacco leaves were only infiltrated with wild type A. tume-aciens strain EHA101 suspension or with culture medium, asegative controls. Plants were then placed in a culture chambert 24 ± 1 ◦C under a 16 h photoperiod given by cool white fluores-ent light (57 �E m−2 s−1, TLT 110W/54 RS Philips day-light tubes).amples were taken at the 4th post-infiltration day.

.4. Protein extraction

An amount of 0.5 g of infiltrated leaves was grinded in 1 ml of PBSxtraction buffer (0.24 g l−1 KH2PO4, 1.44 g l−1 Na2HPO4, 0.2 g l−1

Cl, 8 g l−1 NaCl, 10 �g ml−1 leupeptin, 5 mM PMSF, 50 mM EDTA,H: 7.0–7.2), using a cold mortar and pestle and then, centrifuged at4,000 × g for 20 min at 4 ◦C. Total protein content was determinedccording to Bradford [29].

.5. ELISA

The sandwich ELISA test for determining the presence of tE2n plant extracts was performed in a polystyrene microtiter plateMaxisorp, NUNC). Plates were coated with anti-E2 monoclonalntibody 2.9H [20] at 4 ◦C overnight. The plates were then incu-ated with PBS–Tween 0.05% and 1% skim milk (blocking buffer)or 1 h at 37 ◦C. The blocking buffer was discarded, and the platesere washed three times with PBS–Tween 0.05%. Protein sam-les were added to the plates and incubated for 1 h at 37 ◦C.he plates were washed three times with PBS–Tween and incu-ated with positive sera obtained from seropositive experimental

nfected cows for 30 min at 37 ◦C. Horseradish peroxidase (HRP)onjugated goat anti-bovine IgG was used as the secondary anti-ody. The plates were then incubated for 30 min at 37 ◦C. Afterashing three times, the reaction was developed with H2O2 and

.05% 2,2′-azinobis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS)or 30 min. Color development was stopped by the addition of 5%DS. The absorbance was measured at 405 nm [30].

.6. Western blot semi quantification

Protein samples were re-suspended in loading buffer, denaturedt 95 ◦C for 10 min and subsequently analyzed on 10% SDS-PAGEnder non-reducing conditions [21]. Loading buffer for reducingonditions also contained 5% (v/v) �-mercaptoethanol (Sigma) toeduce disulfide bridges. The separated protein was blotted onto aitrocellulose membrane (Immobilon-P®, MILLIPORE).

Western blot was performed using the 2.9H mouse monoclonalntibody anti-E2, 1:100 dilution (C. Seki, ICT Milstein-CONICET,ersonnel communication), and a 1:500 goat anti-gamma mousehain-conjugated peroxidase antibody (Sigma). As a positive con-rol we have used recombinant tE2 expressed in baculovirus [21].he immune complexes were detected after incubation with Super-ignal West Pico Chemiluminiscent Substrate (Pierce Chem). Bandntensity was analyzed using Gel-Pro Analyzer.

.7. Guinea pig immunization schedule

Guinea pigs (60-day-old female, average weight, 413 g) wereubcutaneously immunized administering 0.5 ml of a vaccine for-

ulated combining agroinfiltrated tobacco leaf extract containing

0 �g of antigen (tE2 glycoprotein in the plant extract) and anily adjuvant (Montanide ISA 70 SEPPIC®), in an antigen to adju-ant ratio of 40:60. In the case of the aqueous vaccine (Al(OH)3

(2012) 4499– 4504 4501

Hydrogel®), animals were subcutaneously inoculated administer-ing 0.5 ml of vaccine in an antigen to adjuvant ratio of 90:10.Control animals were primed and boosted with 0.5 ml of wildtype tobacco leaves extract plus each one of the two adjuvants(sham vaccine). We also included a whole virus vaccine formu-lated with 106.5 titer/dose containing the Singer strain, replicated inMDBK (Madin–Darby bovine kidney) cells inoculated with the sameschedule than the plant vaccine (C. Seki, ICT Milstein-CONICET,personnel communication). Blood samples were collected at thetime of immunization (0 day), and at the 15th and 30th days aftervaccination [31]. The bleed sera of each animal were used for per-forming the Virus Neutralization Test and the ELISA. During thewhole experiment the animals were clinically evaluated.

2.8. Virus Neutralization Test (VNT)

Sera neutralizing antibodies were detected by a Virus Neutral-ization Test (defined as the loss of infectivity through reaction of thevirus with specific antibody), as recommended by OIE [31]. Briefly,100 TCID50 of BVDV (Singer strain) were co-incubated with 75 �l of1/4 serial dilutions of the inactivated (20 min at 56 ◦C) serum sam-ples for 1 h at 37 ◦C. The mixture was then transferred to microtiterplates with 3 × 104 MDBK cells/well. The plates were incubated for72 h at 37 ◦C with 5% CO2. The respective titers were measured usingthe Reed and Muench [32] method. Titers were expressed as the logof the highest dilution able to inhibit 100 TCID50. Neutralizationtesting for all dilutions was run in duplicate.

2.9. Evaluation of anti-E2 specific antibodies by ELISA

Polystyrene microtiter plates (Maxisorp, NUNC) were coatedwith anti-E2 monoclonal 2.9H antibody at 4 ◦C overnight. The plateswere then incubated with PBS–Tween 0.05% and 1% skim milk(blocking buffer) for 1 h at 37 ◦C. The blocking buffer was dis-carded, and the plates were washed three times with PBS–Tween0.05%. The rE2 glycoprotein expressed in baculovirus [21] wasadded to the plates and incubated for 1 h at 37 ◦C. The plates werewashed three times with PBS–Tween 0.05% and incubated withthe sera obtained from the immunized guinea pigs, in serial dilu-tions ranging from 1/4 to 1/16,192, for 30 min at 37 ◦C. Horseradishperoxidase conjugated goat anti-guinea pig IgG 1:1500 (Jack-son ImmunoResearch Inc.) was used as the secondary antibody.The plates were incubated for 30 min at 37 ◦C. After washingthree times, the reaction was developed with H2O2 and 0.05%2,2′-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) for 30 min.Color development was stopped by the addition of 5% SDS.The absorbance was measured at 405 nm. [30] The titer of theserum was calculated as the reciprocal of the dilution in whichOD corresponds to twice the value of the OD of the negativecontrol.

Three replicates were made in all determinations, and analysisof variance (ANOVA) was performed in each test.

3. Results and discussion

3.1. Gene construct and Agrobacterium transformation

The correct insertion into pK7WG2 of the construct carrying thesequence for expressing the truncated version of E2 with the addi-tion of the signal sequence 2S2, the His-tag and the ER-retentionsequence KDEL was checked by PCR, restriction endonuclease map-

ping and sequencing (data non-shown). The introduction of thepK-2S2-tE2-His-KDEL in A. tumefaciens strain EHA101 by electro-poration was confirmed by PCR (Fig. 1b), restriction maps andsequencing (data non-shown). Those Agrobacterium strains bearing

4502 G. Nelson et al. / Vaccine 30 (2012) 4499– 4504

Fig. 2. Protein analysis in plant extract. (a) Western blot analysis showing the expression of tE2 glycoprotein in transient transformed N. tabacum leaves. In non-reducingconditions (lanes 1–3) the E2 is revealed as an 80 kDa protein whereas in reducing conditions (lanes 5–7) the protein is revealed as a 35 kDa protein. The crude proteinextracted from the leaves (30 �l) was separated on SDS-10% PAGE and western blot analysis was performed using a 2.9H specific mouse monoclonal antibody against E2.Lane 1, agroinfiltrated tissue with A. tumefaciens wild type; lane 2, tissue agroinfiltrated with Agrobacterium carrying pK-tE2-His-KDEL; lane 3, positive control (rE2 expressedin baculovirus); lane 4, rainbow ladder (GE); lane 5, tissue agroinfiltrated with A. tumefaciens wild type; lane 6, agroinfiltrated tissue with A. tumefaciens carrying pK-tE2-His-KDEL; lane 7, positive control (rE2 expressed in baculovirus). (b) Semi-quantitative western Blot. Lanes 1–4, different amounts of tE in the N. tabacum leaves extract (20 �l,15 �l, 10 �l, 5 �l); lanes 6–8, different amounts of positive control (200 ng, 50 ng, 25 ng, 12.5 ng), lane 5, rainbow ladder (GE®). (c) ELISA test to determine the presence oft bed ina abacum

ts

3l

il(SroctmbwtgtbnteEib

he antigen E2 in agroinfiltrated tobacco leaves extract. ELISA protocol was descrigroinfiltrated with A. tumefaciens carrying pK-tE2-His-KDEL; 3, mock infected N. t

he pK-2S2-tE2-His-KDEL were used to perform transient expres-ions in tobacco leaves.

.2. Expression of the recombinant tE2 glycoprotein in tobaccoeaves

N. tabacum leaves were infected and harvested (as describedn Section 2) at the 4th day post-infection when the maximumevel of tE2 expression is expected according to preliminary assaysdata non shown). Protein extraction was confirmed by a 10%DS-PAGE (Fig. 1c). The western blot analysis made under non-educing conditions clearly shows the expression of tE2 as a dimerf approximately 80 kDa, a pattern similar to that of the positiveontrol (Fig. 2a) [21]. The Western blot made under reducing condi-ions showed a band of 35 kDa, which corresponds to the expected

olecular weight of the tE2 monomer [21]. No immunoreactiveand was detected in mock-infected plants. Also, when stainedith concavaline A, tE2 pattern is the same as the one of the

E2 expressed in baculovirus (data non-shown). These results sug-est that the post-translational modifications of the recombinantE2 do not significantly differ from those of the one expressed inaculovirus that we have used as a control. The specific recog-ition of tE2 by the 2.9H monoclonal antibody [21] confirmedhat the native E2 antigenic distinctiveness was preserved upon

xpression into tobacco plants. Moreover, the dimeric form of2, as is expressed in our work, is considered to be the mostmmunogenic form [21,33,34,3]. Anyway, further experiments areeing carried on in order to characterize the protein regarding its

Section 2. 1, positive control (rE2 expressed in baculovirus); 2, extract of leaves leaves; 4, water.

glycosylation pattern. As for the semi quantitative Western blot(Fig. 2b), the analysis indicated an expression level of approxi-mately 20 �g g−1 of infected leaf, corresponding to 1.3% of totalsoluble protein. This expression level suggests that tobacco cellsare suitable for expressing the tE2 protein for mass scale produc-tion system [35,36]. Regarding the ELISA results, both the positivecontrol (tE2 expressed in baculovirus) and the leaves agroinfil-trated with A. tumefaciens carrying pK-tE2-His-KDEL, showed asimilar absorbance at 600 nm, whereas negative control (water)and mock agroinfiltrated tissue showed lower absorbance indicat-ing the presence of rE2 in the agroinfiltrated leaves (Fig. 2c).

3.3. Seroconversion of guinea pigs inoculated with plantrecombinant tE2

A growing body of evidence indicates the suitability of usingguinea pigs as a model for testing BVDV vaccines. An opti-mal correlation between bovine-guinea pig models was alreadydemonstrated [6,20], indicating that the guinea pigs could replacebovines when testing the immunogenicity of BVDV commercial orcandidate vaccines.

Two different formulations of plant recombinant tE2 vaccineswere tested. One formulated with aqueous adjuvant (Al(OH)3) andthe other one with oily adjuvant (Montanide ISA 70). In order

to establish the production of an anti-BVDV response inducedin the animals vaccinated with the recombinant tE2, sera wastested both by an indirect ELISA [21] and by a Virus NeutralizationTest [31].

G. Nelson et al. / Vaccine 30

Fig. 3. Immune response of guinea pigs inoculated with plant extract. ELISA andVirus Neutralization Test to determine specific anti-E2 antibodies in sera of guineapigs inoculated with BVDV experimental vaccines prepared using plant extractsfrom agroinfiltrated N. tabacum leaves. The vaccines were prepared in oily (Mon-tanide ISA 70 SEPPIC®) or aqueous (Al(OH)3 Hydrogel®) formulations as describediSt

riwtwaotAvr(Asb

Sivoiaauvvfilofc

b0ouE(tfsa

[

n Section 2. Control animals were immunized with sham or whole virus vaccine.pecific antibodies were analyzed as described in Section 2. Each point representshe mean ± SD.

In both cases, it was established that values higher than 0.6 cor-esponding units (OD405 or VNT titer) were considered positive. Ast is shown in Fig. 3, in the indirect ELISA, high titers of antibodies

ere obtained from animals inoculated with the plant formula-ion we have prepared as a vaccine. In both cases the responseas positive besides the typical individual heterogeneity of any

nimal model [20]. In the case of the plant-made vaccine with anily adjuvant (Fig. 3), six out of seven animals showed titers higherhan 0.6 indicating a clear seroconversion of vaccinated animals.lthough the number of animals used is low, the 86% of serocon-ersion obtained suggests a good potential performance for theecombinant antigen. On the contrary, titers of sham-vaccinatedwithout antigen) animals remained below 0.6. In the case of thel(OH)3 adjuvant vaccine, the number of seroconverted animals,ix out of eight guinea pigs (75%), showed a clear seroconversionoth in the ELISA and VNT (data not shown).

After ELISA analysis sera were controlled by VNT as described inection 2. This technique demonstrated the induction of neutral-zing antibodies after inoculating guinea pigs with the plant-madeaccine we have developed. In the case of the oily adjuvant vaccinenly three out of seven animals produced neutralization antibod-es with titers ranging from 0.6 to 1. Whereas, in the case of thequeous vaccine adjuvant, all the animals showed neutralizingntibodies. Most important, titers were equal or higher when inoc-lated with the plant-made vaccine rather than with conventionalaccines consisting in whole virus formulations. In addition, shamaccines did not induce neutralizing antibodies. Regarding the dif-erence between oily and aqueous vaccine adjuvants and takingnto account that the emulsion was correctly prepared and stabi-ized, it can be speculated that the conformation or presentationf the plant-made tE2 to the immune system could be differentor each adjuvant. However, more work should be done in order toonfirm this hypothesis.

An E2 version was already expressed in alfalfa [37] by sta-le transformation with a yield oscillating between 0.05 and.50 mg g−1 TSP. Other authors have reported the expressionf E2 in insect cell lysates infected with recombinant bac-lovirus (10 �g E2 ml−1) [34], Drosophila melanogaster cells [21],scherichia coli (1–2 �g E2 ml−1) [10], and human cell culturesHEK293T cells) [38]. Concerning the commercial vaccines, none of

he available veterinary vaccines have demonstrated to be optimalor controlling the disease [39], producing several secondary effectsuch as immunosupression and congenital defects. Also, vaccinatednimals can generate persistent infections by non-cytopathic BVDV

[

(2012) 4499– 4504 4503

biotypes. Furthermore, modified live vaccines are a potential sourceof in utero infections and/or immunosupression. Finally, modified-live, attenuated or inactivated BVDV that are produced in bovinecell cultures can introduce contaminant pathogens adding the riskof intact virus release [40].

This is the first report on the expression of a BVDV tE2 glycopro-tein in tobacco plants. Also, the tE2 here expressed has the expectedreactivity and immunogenicity and also triggers the production ofneutralizing antibodies as the commercial vaccine formulations.Further experiments are being carried on in order to demonstratethat this plant transient expression system would be useful fordeveloping a vaccine for cattle against BVDV and the efficiency ofthe formulation we have used. Also, future work will be oriented tocharacterize the protein (glycosylation, His-tag maintenance, etc.),increase yields and optimize the down stream process of the pro-duced tE2.

4. Conclusions

It is demonstrated in the current study that a tE2 could betransiently expressed in N. tabacum leaves. In addition, we havedemonstrated that it is recognized by a specific monoclonal anti-body (2.9H) confirming that the recombinant protein has theexpected reactivity. Moreover, the plant-made recombinant tE2has the ability to generate a response in the immune system ofguinea pigs, with the production of specific antibodies as wasrevealed by the ELISA and the Virus Neutralization Test. Theseresults are promissory for developing an efficient plant-made vac-cine against BVDV as an alternative to the currently produced.

Acknowledgments

This work was supported by the Agencia Nacional de ProducciónCientífica y Tecnológica (ANPCyT) (PICT 2005 Start up n◦ 35644) andCONICET that also supported the PhD grants of G. Nelson. Dr. P Mar-coni, MA Alvarez and J La Torre are members of CONICET. We wishto thank Dr. Cristina Seki (ICT-Milstein, CONICET) for her techni-cal assistance and Ms Carlota Thompson for her careful revision ofEnglish.

References

[1] Houe H. Epidemiological features and economical importance of bovine virusdiarrhea viral (BVDV) infections. Veterinary Microbiology 1999;64:89–107.

[2] Wengler G. Family Flaviviridae. Classification and nomenclature of viruses. Fifthreport of the international committee on taxonomy of viruses. Archives ofVirology 1991;(Suppl. 2):223–33.

[3] Weiland F, Weiland E, Unger G, Saalmuller A, Thiel HJ. Localization of pestiviralenvelope proteins E(rns) and E2 at the cell surface and on isolated particles.Journal of General Virology 1999;80:1157–65.

[4] Rumenapf T, Unger G, Strauss JH, Thiel H-J. Processing of the envelope glyco-proteins of pestiviruses. Journal of Virology 1993;67:3288–94.

[5] Xue W, Mattick D, Smith L, Umbaugh J, Trigo E. Vaccination with a modified-live bovine diarrhea virus (VBDV) type 1a vaccine completely protected calvesagainst challenge with BVDV type 1b strains. Vaccine 2010;29:70–6.

[6] Fernández F, Constantini V, Barrandeguy M, Parreno V, Schiappacassp G,Maliandi F, et al. Evaluation of experimental vaccines for bovine viral diar-rhea in bovines, ovines and guinea pigs. Revista Argentina de Microbiología2009;41:86–91.

[7] van Oirschot JT, Bruschke CJ, van Rijn PA. Vaccination of cattle against bovineviral diarrhoea. Veterinary Microbiology 1999;64(2–3):169–83.

[8] Bolin SR, Ridpath JF. Glycoprotein E2 of bovine viral diarrhea virus expresedin insect cells provides calves protected from systemic infection and disease.Archives of Virology 1996;141:1463–77.

[9] Bruschke CJ, Hulst M, Moormann R, Van Rijn PA, Van Oirschot JT. GlycoproteinsErns of pestivirus induces apoptosis in lymphocytes of several species. Journalof Virology 1997;71:6692–6.

10] Toth RL, Nettleton PF, McCrae MA. Expression of the E2 envelope glycorpotein

of bovine viral diarrhoea virus (BVDV) elicits virus-type specific neutralisingantibodies. Veterinary Microbiology 1999;65:87–101.

11] Yu M, Gould AR, Morrissy CJ. Westbury HA high level expression of the envelopeglycoprotein (gp53) of bovine viral diarrhoea virus (Singer) and its potential useas diagnostic reagent. Virus Research 1994;34:178–86.

4 cine 30

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[[

[

[

[

[

[

[

[

504 G. Nelson et al. / Vac

12] Cavallaro A, Mahony D, Commins M, Mahony T, Mitter N. Endotoxin-free purifi-cation for the isolation of bovine viral diarrhoea virus E2 protein from insolubleinclusion body aggregates. Microbial Cell Factories 2011;10:57.

13] Desai PN, Shrivastava N, Padh H. Production of heterologous proteins in plants:strategies for optimal expression. Biotechnology Advances 2010;28:427–35.

14] Hellwing S, Drossard J, Twyman RM, Fischer R. Plant cell cultures forthe production of recombinant proteins. Nature Biotechnology 2004;22:1415–22.

15] Martínez C, Petruccelli S, Giulietti AM, Alvarez MA. Expression of the antibody14D9 in Nicotiana tabacum hairy roots. Electronic Journal of Biotechnology2005;8:170–6.

16] López J, Lencina F, Petruccelli S, Marconi P, Alvarez MA. Influence of the KDELsignal, DMSO and mannitol on the production of the recombination antibody14D9 by long-term Nicotiana tabacum cell suspension culture. Plant Cell, Tissueand Organ Culture 2010;103:307–14.

17] Faye L, Gomord V. Success stories in molecular farming—a brief overview. PlantBiotechnology Journal 2010;8:525–8.

18] Hiatt A, Pauly M. Monoclonal antibodies from plants: a new speed record. Pro-ceedings of the National Academy of Sciences of the United States of America2006;103:14645–6.

19] Pogue GP, Vodjani F, Palmer KE, Hiatt E, Hume S, Phelps J, et al. Productionof pharmaceutical-grade recombinant aprotinin and a monoclonal antibodyproduct using plant-based transient expression systems. Plant BiotechnologyJournal 2010;8:638–54.

20] Jordão RS, Ribeiro CP, Pituco EM, Okuda LH, DelFava C, de Stefano E, et al.Serological response of guinea pigs to oily and aqueous inactivated vaccinescontaining a Brazilian isolate of the bovine viral diarrhea virus (BVDV). Researchin Veterinary Science 2011, http://dx.doi.org/10.1016/jrvsc.2010.12.010.

21] Marzocca MP, Seki C, Giambiagi SM, Robiolo B, Schauer R, Dus Santos MJ, et al.Truncated E2 of bovine viral diarrhea virus (BVDV) expressed in Drosophilamelanogaster cells: a candidate antigen fora BVDV ELISA. Journal of VirologicalMethods 2007;144:49–56.

22] Karimi M, Inzé D, Depicker A. GATEWAY vector for Agrobacterium-mediatedplant transformation. Trends in Plant Science 2002;7:193–5.

23] Sanger F, Coulson AR. A rapid method for determining sequences in DNAby primed synthesis with DNA polymerase. Journal of Molecular Biology1975;94:441–8.

24] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory; 1989.

25] Nagel R, Elliot A, Masel A, Birch RG, Manners JM. Electroporation of binary Tiplasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes.FEMS Microbiology Letters 1990;67:325–8.

[

(2012) 4499– 4504

26] Van der Hoorn RAL, Laurent F, Roth R, De Wit PJGM. Agroinfiltration is a versatiletool that facilitates comparative analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced necrosis. Molecular Plant–Microbe Interactions 2000;13:439–46.

27] Murashige T, Skoog F. A revised medium for rapid growth and bioassays withtobacco tissue cultures. Physiologia Plantarum 1962;15:473–97.

28] Kapila J, De Rycke R, Van Montagu M, Angenon G. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Science1997;122:101–8.

29] Bradford MM. A rapid and sensitive method for the quantification of microgramquantities of protein utilizing the principle of protein-dye binding. AnalyticalBiochemistry 1976;72:248–54.

30] Pecora A, Perez Aguirreburualde MS, Rodriguez D, Seki C, Levy MS, Bochoeyer D,et al. Development and validation of an ELISA for quantitation of bovine viraldiarrhea virus antigen in the critical stages of vaccine production. Journal ofVirological Methods 2009;162:170–8.

31] OIE Manual of standards for diagnostic test and vaccines. 4th ed. 2004, p. 475.32] Reed LJ, Muench H. A simple method of estimating fifty percent endpoints.

American Journal of Hygiene 1938;27:493–7.33] Wandelt CI, Khan MR, Craig S, Schroeder HE, Spencer D, Higgins TJ. Vicilin

with carboxy-terminal KDEL is retained in the endoplasmic reticulum andaccumulates to high levels in the leaves of transgenic plants. Plant Journal1992;2:181–92.

34] Grigera PR, Marzocca MP, Capozzo AVE, Buonocore L, Donis RO, Rose JK. Pres-ence of bovine viral diarrhea virus (BVDV) E2 glycoprotein in VSV recombinantparticles and induction of neutralizing BVDV antibodies in mice. Virus Research2006;9:3–15.

35] Twyman R, Stoger E, Schillberg S, Christou P, Fischer R. Molecular farmingin plants: host systems and expression technology. Trends in Biotechnology2003;21:570–8.

36] Fischer R, Stoger E, Schillberg S, Christou P, Twyman RM. Plant-based produc-tion of biopharmaceuticals. Current Opinion in Plant Biology 2004;7:152–8.

37] Dus Santos MJ, Wigdorovitz A. Transgenic plants for the production of veteri-nary vaccines. Immunology and Cell Biology 2005;83:229–38.

38] Donofrio G, Bottarelli E, Sandro C, Flammini C. Expression of bovine diarrheavirus glycoprotein E2 as a soluble secreted form in a mammalian cell line.Clinical and Vaccine Immunology 2006;13:698–701.

39] Nobiro I, Thompson I, Brownlie J, Collins ME. Cytokine adjuvancy of BVDV DNA

vaccine enhance both humoral and cellular immune responses in mice. Vaccine2001;19:4226–35.

40] Erickson GA, Bolin SR, Landgraf JG. Viral contamination of fetal bovine serumused for tissue culture: risks and concerns. Developments in Biological Stan-dardization 1991;75:173–5.