MOLECULAR AND CELLULAR BIOLOGY, May 1992, P. 2029-20360270-7306/92/052029-08$02.00/0Copyright C) 1992, American Society for Microbiology

Identification of a Negative Regulatory Element That Inhibitsc-mos Transcription in Somatic Cells

SANDRA S. ZINKEL, SUBRATA K. PAL, JOZSEF SZEBERENYI,tAND GEOFFREY M. COOPER*

Dana-Farber Cancer Institute and Department ofPathology,Harvard Medical School, Boston, Massachusetts 02115

Received 7 January 1992/Accepted 17 February 1992

We have used transient expression assays to identify a cis-acting region in the 5' flanking sequence of murinec-mos which, when deleted, allows expression from the c-mos promoter in NIH 3T3 cells. This negativeregulatory sequence, located 400 to 500 nucleotides upstream of the c-mos ATG, also inhibited expression froma heterologous promoter. In addition to NIH 3T3 cells, the c-mos negative regulatory sequence was active inBALB/3T3 cells, PC12 rat pheochromocytoma cells, and A549 human lung carcinoma cells. Site-specificmutagenesis identified three possibly interacting regions that were involved in negative regulatory activity,located around -460, -425, and -405 with respect to the ATG. RNase protection analysis indicated that oncethe negative regulatory sequences were deleted, transcription in NIH 3T3 cells initiated from the sametranscription initiation sites normally utilized in spermatocytes, approximately 280 nucleotides upstream of theATG. Deletions beyond the spermatocyte promoter, however, allowed transcription initiation from progres-sively downstream c-mos sequences. Deletion or mutation of sequences surrounding the oocyte promoter at -53also had little effect on expression of c-mos constructs in NIH 3T3 cells. Therefore, the major determinant ofc-mos expression in NIH 3T3 cells was removal of the negative regulatory sequence rather than the utilizationof a unique promoter. The c-mos negative regulatory sequences thus appear to play a significant role intissue-specific c-mos expression by inhibiting transcription in somatic cells.

Expression of the c-mos proto-oncogene, which encodes aprotein-serine/threonine kinase, is detected almost exclu-sively in male and female germ cells, suggesting that it maybe involved in normal germ cell development or meiosis (8,12, 16, 17). Functional studies of c-mos in both Xenopus andmouse oocytes are consistent with such a role. Microinjec-tion of oocytes of both species with c-mos antisense oligo-nucleotides prevents normal progression through meiosis(14, 19). Recent studies indicate a direct relationship be-tween the c-mos gene product and maturation-promotingfactor, with c-mos acting as a cytostatic factor in Xenopuslaevis (20) and maintaining maturation-promoting factor ac-tivity by stabilizing cyclin B in mouse eggs (13).

In addition to its tissue specificity, an interesting feature ofc-mos expression is the use of distinct promoters in male andfemale germ cells. Transcription initiation in mouse sperma-tocytes has been mapped to a region centered around 280 bpupstream of the c-mos ATG (16), whereas in oocytes, themajor transcription initiation site is 53 bp upstream of theATG (15). Both transcripts are unspliced and share a com-mon 3' terminus (16). Neither the spermatocyte nor theoocyte promoter region is associated with CCAAT, TATA,or GC boxes. The stringent tissue specificity of c-mosexpression combined with the use of distinct promoters inmale and female germ cells suggests an important role fordevelopmental regulation of c-mos transcription.We have previously investigated the sequences required

for c-mos expression in mouse oocytes (15). Transientexpression studies indicated that sequences up to 20 bpupstream of the major oocyte transcription start site could be

* Corresponding author.t On leave from the Department of Biology, University Medical

School of Pecs, P6cs, Hungary.

deleted without any significant loss of promoter activity.However, deletion or point mutations of sequences within 20bp downstream of the transcription initiation site resulted ina 10-fold reduction in gene expression. This region of DNAcontained the consensus sequence PyPyCAPyPyPyPyPyfound in the initiator (Inr) element recently identified in themouse terminal deoxynucleotidyltransferase gene (21), andmutations within this sequence were found to significantlyreduce transcription from the c-mos promoter. In c-mos,however, this region is distinct in that transcription initiates9 bp upstream of the Inr-related sequences rather than withinthe element.

In mouse oocytes, therefore, c-mos expression seems torequire only a simple promoter, consisting of sequencesimmediately surrounding the transcription start site. How-ever, the involvement of additional sequences in tissue-specific regulation might be expected. In this study, we haveinvestigated the potential regulatory roles of c-mos upstreamsequences and have identified a cis-acting region in the 5'flanking sequence of c-mos which, when deleted, allowsexpression of the c-mos promoter in NIH 3T3 and othersomatic cell types. This negative regulatory element thusappears to play a significant role in inhibiting c-mos tran-scription in somatic cells.

MATERUILS AND METHODS

Plasmid DNAs. Plasmids containing mouse c-mos up-stream sequences linked to the chloramphenicol acetyltrans-ferase gene (CAT) were previously described (15). Theparent plasmid was pSVOCAT, a promoterless plasmid inwhich the simian virus 40 promoter of pSV2CAT (9) wasreplaced with a polylinker sequence. Plasmid pmos731 con-tains a 731-bp c-mos fragment (-16 to -746 with respect tothe c-mos ATG) inserted upstream of CAT. Plasmids con-

2029

Vol. 12, No. 5

2030 ZINKEL ET AL.

taining variable amounts of c-mos upstream sequence wereconstructed from pmos731 by BAL 31 deletion (15). In thisreport, these plasmids (pmos502, pmos392, pmos298,pmos223, pmosl91, pmosl35, pmos99, pmos79, pmos74,pmos54, and pmos42) are designated according to the posi-tion of the 5' deletion endpoint relative to the c-mos ATG.Thus, the 5' deletion endpoint of pmos74 is 74 nucleotidesupstream of the ATG, corresponding to 21 nucleotidesupstream of the oocyte transcription start site; this plasmidwas designated pmos2l in our previous study (15). PlasmidspmosM2 and pmosM3, containing mutations of the Inr-related sequences, were also previously described (15). Inthe experiments reported here, however, we used constructsthat did not contain the stuffer fragment previously incorpo-rated upstream of the c-mos sequences, since backgroundlevels of expression in NIH 3T3 cells were low relative to thepositive signals obtained.The protamine-CAT plasmids were constructed by using

pSVOCAT (minus the stuffer fragment) as a parent plasmid.The SphI-PstI fragment of the 5' flanking sequence of themouse protamine 2 gene was excised from pMP2 (10). Thisfragment contains sequences from 268 to 34 bp upstream ofthe ATG, including the CCAAT and TATA boxes. The endsof the molecule were filled in with T4 DNA polymerase, andHindIII linkers were added by using T4 DNA ligase. TheDNA fragment was then inserted into the HindIII site of thepolylinker in pSVOCAT. The orientation of the insert and theintegrity of the construct were verified by sequencing. DNAfragments containing c-mos sequences were generated bypolymerase chain reaction (PCR) as described below andinserted into the BamHI site of the polylinker, upstream ofthe protamine promoter.DNA molecules containing point mutations and insertions

were generated by PCR, with pmos731 as the templateDNA. For most mutations, an oligonucleotide correspond-ing to 27 bp of the polylinker was used to define the 5' end ofthe inserts. Mutations were produced by using 3' oligonu-cleotides corresponding to the c-mos sequence from a BclIsite at -384 to the region into which the desired deletions,insertions, or point mutations were to be introduced. Am-plified DNA fragments were then inserted into pmos731,which had been digested with EcoRV and BclI to removec-mos sequences from the polylinker to the BclI site. Theintegrity of all subcloned PCR fragments was verified bysequencing.The large distance from box 1 (c-mos sequence -467 to

-462) to the BclI site precluded the use of the PCR strategydescribed above. We instead used an oligonucleotide corre-sponding to -380 to -402 of the c-mos sequence (containingthe BclI site) to define the 3' end of the insert. The mutationwas introduced with a 5' oligonucleotide that contained aBamHI site followed by c-mos sequences from -502 to-452, containing the desired mutation. The amplified frag-ment was inserted into pmos502 after digestion with BamHIand Bcll as described above. The orientation and integrity ofthe insert were verified by sequencing.PCR reactions were performed in 100 ,ul of Boehringer

Mannheim Taq polymerase incubation buffer containing 100ng of template DNA, 0.4 mM each of the four deoxyribonu-cleoside triphosphates, 100 ng of each primer, and 2.5 U ofBoehringer Mannheim Taq polymerase. The reaction mix-ture was overlaid with 100 pul of mineral oil and amplified forone cycle of 2 min at 94°C, 2 min at 57°C, and 3 min at 72°C,followed by 35 cycles of 1 min at 94°C, 2 min at 57°C, 2.5 minat 72°C.

Transient expression assays. NIH 3T3 cells (106 cells per

60-mm plate) were transfected with 5 ,ug of CAT plasmidDNA, 12.5 ,ug of calf thymus DNA (as carrier), and 5 ,ug ofpCH110 DNA (which contains the simian virus 40 earlypromoter directly upstream of lacZ) in medium containing10% calf serum as described previously (4). For each sam-ple, one-third of the extract was assayed for ,-galactosidaseactivity according to the method of An et al. (1). Reactionmixtures were incubated at 37°C for 1 to 2 h, and enzymeactivity was measured by determining A414 by using anELISA scanner. The CAT activity of the remaining extract,normalized with respect to the ,-galactosidase activity, wasassayed by the method of Gorman et al. (9). The enzymereaction was performed at 37°C for 4 h, and CAT activitywas determined by thin-layer chromatography. The percentconversion of chloramphenicol to acetylated forms wasquantitated by using a beta scanner.

Transfection of BALB/3T3, PC12, and A549 cells wasperformed similarly, except that pCH110 DNA was notincluded and equal amounts of cell extracts were assayed forCAT activity. PC12 cells were cultured in medium contain-ing 10% fetal bovine serum plus 5% horse serum, and A549cells were cultured in medium containing 10% fetal bovineserum.RNase protection. The RNA probe was synthesized from

pGEM3Z, into which the 731-bp c-mos fragment frompmos731 had been inserted, using T7 RNA polymeraseaccording to the procedure described by Gilman (7). Theplasmid was linearized with Scal, which cleaves 294 bpupstream of the c-mos ATG. To increase the specific activityof the probe, 125 ,uCi each of [a-32P]UTP and [a-32P]CTP(800 Ci/mmol, 40 mCi/ml; New England Nuclear) was addedto the transcription reaction mixture. The probe was purifiedby electrophoresis in a 5% polyacrylamide gel (20:1 acryl-amide/bis, 89 mM Tris-borate, 89 mM boric acid, 2 mMEDTA) at 300 V, excised, and recovered by soaking the gelslice for 4 to 12 h at 42°C in 2 M ammonium acetatecontaining 1% sodium dodecyl sulfate and tRNA (25 ,ug/ml).The probe was dissolved in hybridization buffer [80% form-amide, 40 mM piperazine-N,N'-bis(2-ethane sulfonic acid)(PIPES; pH 6.4), 400 mM NaCl, 5 mM EDTA], and thespecific activity was measured by counting 1/50 of thereaction mixture in a liquid scintillation counter.RNase protection was carried out as described by Zinn et

al. (23). RNAs were prepared from transfected NIH 3T3cells or from mixed populations of germ cells isolated fromtestes of adult mice (6, 18). RNAs were extracted as previ-ously described (5), except that RNA from transfected NIH3T3 cells was extensively digested with DNase to removecontaminating plasmid. Approximately 15 ,ug of total RNAwas hybridized to 2 x 10' cpm of RNA probe in 30 p,l ofhybridization buffer for 8 h at 37°C. Samples were electro-phoresed in a 10% denaturing polyacrylamide gel (50% urea,20:1 acrylamide/bisacrylamide, 89 mM Tris-borate, 89 mMboric acid, 2 mM EDTA).

RESULTS

Initial identification of a c-mos negative regulatory element.Previous studies indicated that Mos-CAT constructs con-taining either 2.4 kb or 731 bp of c-mos upstream sequencewere not expressed in NIH 3T3 cells (15). We thereforecommenced our search for c-mos negative regulatory se-quences with a set of Mos-CAT plasmids containing 5' BAL31 deletions of the c-mos sequences in pmos731. Transienttransfection assays indicated that a plasmid containing 502bp of c-mos sequence upstream of the ATG did not yield

MOL. CELL. BIOL.

c-mos NEGATIVE REGULATORY ELEMENT 2031

o o o o L = -.j

.

j . . .. .*LA L.L L. :P.

Q 6IF * li:

Mos-CAT B _ ut. J*Ja o>t sz4

construct0 w° xw

FIG. 1. Effect of 5' deletions on activity of the c-mos promoter inNIH 3T3 cells. NIH 3T3 cells were transfected with 5 pLg of theindicated Mos-CAT plasmids, 5 1Lg of pCH110 (consisting of thesimian virus 40 promoter immediately upstream of the ,B-galactosi-dase gene), and 12.5 ,ug of calf thymus carrier DNA. Cells wereharvested after 40 h of incubation, and one-third of the extract wasassayed for 13-galactosidase activity to normalize for transfectionefficiency. An appropriate amount of extract was then assayed forCAT activity. The percent conversion of chloramphenicol to acety-lated forms is indicated above the autoradiogram of the thin-layerchromatography plate. Lane mock indicates transfection with car-rier DNA alone; lane 0 indicates transfection with the promoterlessplasmid pSVOCAT. All other lanes are labeled according to the 5'endpoint of the c-mos sequence relative to the ATG (-746 refers tothe 5' endpoint of pmos731).

detectable CAT expression in NIH 3T3 cells, whereas dele-tion of an additional 110 bp, to 392 bp upstream of the ATG,resulted in high-level expression of the transfected CATgene (Fig. 1 and Table 1). The difference between these twodeletions thus defined a region of 110 bp, located from -100to 200 bp upstream of the spermatocyte transcription startsite, that harbors a negative regulatory region.

Additioial deletions through the spermatocyte transcrip-tion start site (around -280) continued to yield high levels ofCAT expression (Fig. 1 and Table 1). Surprisingly, even adeletion through the oocyte transcription start site (at -53),containing only 42 bp upstream of the ATG, resulted insubstantial CAT expression in transfected NIH 3T3 cells,although at a level approximately threefold lower than forplasmids retaining the oocyte promoter sequences (e.g.,pmos74 and pmos54). Nevertheless, pmos42 still appearedto direct mos-specific transcription, since plasmids devoid ofany 5' mos flanking sequence (pSVOCAT; Fig. 1) producedno detectable CAT activity. These results indicated thatonce the negative regulation of the c-mos promoter wasrelieved, transcription in NIH 3T3 cells was able to proceedwith no requirement for additional upstream regulatorysequences.We next wanted to determine whether the c-mos negative

TABLE 1. CAT activities of deleted c-mos promoter plasmidsaMos-CAT construct % Conversion

Mock.. 0.29 + 0.03 (14)0.. 0.33 + 0.09 (4)-746.. 0.32 + 0.03 (15)-502.. 0.38 + 0.03 (13)-392.. 4.6 + 0.43 (11)-74.. 4.0 + 1.8 (3)

% conversion 0.4 0.4 2.0 16 17

N_

Construct 3 0 prot. prot. prot.0

+ +

Pr 2 1

Protamine 5 DNA, -34 to -268 AkTG

1. Mos 5' DNA. -473 to -500or

2. Nos 5 DNA. -393 to -456

FIG. 2. Effect of c-mos negative regulatory sequences on activ-ity of the protamine promoter. NIH 3T3 cells were transfected andassayed for CAT activity as described for Fig. 1. The protaminepromoter constructs are shown below the autoradiogram. Theplasmid designated prot. contains the truncated protamine promoterupstream of CAT. The plasmids designated prot. +1 and prot. +2contain the indicated sequences of c-mos inserted upstream of theprotamine promoter fragment. Values for percent conversion arefrom a representative experiment.

regulatory sequence could also affect expression from aheterologous promoter. For this purpose, we chose a 235-bpregion of the mouse protamine 2 promoter, which spanssequences from -34 to -268 relative to the ATG andharbors both a CCAAT and a TATAA box. Bunick et al. (3)showed that this fragment of the protamine promoter wasefficiently transcribed in HeLa cell extracts and thus ap-peared to represent a minimal promoter fragment that wasubiquitously expressed. This fragment of the protaminepromoter also yielded high levels of CAT expression in NIH3T3 cells (Fig. 2). We then constructed DNA molecules inwhich c-mos sequences from -500 to -473 and from -456to -397 were inserted directly upstream of the protaminepromoter fragment. The construct containing c-mos se-quence from -500 to -473 showed little or no decrease inCAT expression relative to the protamine promoter alone(Fig. 2). In contrast, insertion of c-mos sequences from -456to -397 produced a partial inhibition (approximately five-fold) in CAT activity, indicating that this region containednegative regulatory sequences. The absence of c-mos se-quences extending to -467 (which are shown below tocontribute to the negative regulatory element) is consistentwith the residual activity (approximately fivefold abovebackground) of the c-mos/protamine construct used in thisexperiment.

It was also of interest to determine whether the c-mosnegative regulatory sequence identified by transfection ofNIH 3T3 cells was active in other cell types. Mos-CATplasmids were therefore analyzed by transfection of BALB/3T3 mouse cells, PC12 rat pheochromocytoma cells, andA549 human lung carcinoma cells (Fig. 3). Mos-CAT plas-mids containing upstream c-mos sequences to -746 and-502 were not expressed in any of these cell types, whereas

% Conversion

a NIH 3T3 cells were transfected with the indicated Mos-CAT plasmids asdescribed in the legend to Fig. 1. Results from independent assays arepresented as means ± standard error of the means, with the number ofdeterminations in parentheses.

HI

VOL. 12, 1992

2032 ZINKEL ET AL.

A. BALB 3T3

% conversion 0.5

% conversion 0.2 0.3 0.3 2.4 1.1 1.3 0.6 0.50.1 0.2 2.7

a d a.- a

Mos-CATconstruct

B. PC'12

% conversion

0 -746 -502 - 392

0.4 0.2 0.4 24

6.so

Mos-CAIconstruct

0 - 746 - 502 392

C. A549

% conversion 0.3 0.3 0.5 1.2

f

Mos-CATconstruct

0 -746 502 -392

FIG. 3. Activity of c-mos negative regulatory sequences in othercell types. BALB/3T3, PC12, and A549 cells were transfected withthe indicated Mos-CAT plasmids and assayed for CAT activity.Values for percent conversion are averages from duplicate cultures.

deletion of c-mos sequences to -392 yielded CAT expres-sion in all cases. It therefore appears that mouse c-mosnegative regulatory sequences between -393 and -502inhibit c-mos expression in different types of somatic cells ofmouse, rat, and human origin. The activity of these mousec-mos sequences in rat and human cells is consistent withtheir conservation in these species, as reviewed in theDiscussion.

Mos-CAT mock -746 -502 -392 Mut Mut A Mutconstruct Box Box Box Box

1 3 2 2FIG. 5. Effects of mutations in the c-mos negative regulatory

region. NIH 3T3 cells were transfected and assayed for CATactivity as described for Fig. 1. Lanes Mut Box 1, Mut Box 2, A Box2, and Mut Box 3 refer to the mutant plasmids depicted in Fig. 4.Values for percent conversion are from a representative experiment.

Site-directed mutagenesis of the c-mos negative regulatoryregion. We next compared the DNA sequence of the 110-bpregion of c-mos (-393 to -502) with a 376-bp region of theprotamine 5' flanking sequence (-468 to -843 relative to theATG) that appears to contain a tissue-specific negativeregulatory element, which inhibits in vitro transcription fromthe protamine promoter in HeLa cell extracts (3). Threeregions of significant sequence similarity were noted. Themost upstream region was contained in the fragment ofc-mos DNA that did not significantly decrease expressionfrom the minimal protamine promoter fragment discussedabove. Therefore, this sequence was not characterized fur-ther. We have defined the remaining two regions of c-moslprotamine similarity as box 1 and box 2 (Fig. 4). The CTAGimmediately upstream of box 1 was not conserved in humanand mouse c-mos and therefore was not included in the box1 sequence. Further inspection of the c-mos sequence re-vealed two additional regions immediately downstream ofbox 2 which contained distinctive DNA structures: the runof 10 T residues (T box) and the run of six pyrimidineresidues (box 3).The possible roles of these sequences were investigated by

site-directed mutagenesis using appropriate mutagenic PCRprimers (Fig. 4). PCR products containing the desired muta-tions were incorporated into Mos-CAT plasmids and as-sayed for promoter activity by transfection of NIH 3T3 cells(Fig. 5 and Table 2). Plasmids containing mutated box 1sequences yielded levels of CAT expression that were about50% of those obtained from plasmids (e.g., pmos392) in

BOXI BOX 2 T BOX BOX 3GATTTAATGC,AGCTGGAGACTACXCACIAAC AATCATrATAG CCTGAAAAGIGTGCACCAAGFATrTCI I I ITIICITII

C-mos: -480 -470 -460 -450 -440 -430 -420 -410AATGC ACATGGAG C TAGCACI CACTCITC CIT

Prot.: (-491 to -478) (-764 to -755) (-501 to -511)

Box I mutation AGALCTAGAT.GCCCAATCATTATABox 2 mutationBox 2 deletionBox 3 mutation

GTTAGcTrTArrATrMr TCTCTrCGTo-----------------------TTrIr TCTCTTCGTTCACTGTA CITTrIT T AC-AT

AI 0 GTTCACTGTA C---------------------CTCTrCA5 GTTCACTGTAC1TTTT------------cTCTrc+5 GTTCACTGTACITmTITrTCrAGAcTcTrc

+ 10 GTrCACFGTAcfrrTITTcTAGAACOAO crcrrcMutT GTrCACrGTACCAGATCTGAGcrcrrc

FIG. 4. Sequence elements in the c-mos negative regulatory region. The c-mos sequence (2) from -490 to -404 is shown on the top line,with three regions of similarity to the upstream protamine (Prot.) sequences (10) indicated underneath. Sequence elements discussed in thetext (box 1, box 2, box 3, and the T box) are indicated in the c-mos sequence. The mutations introduced into these sequences are shown inthe lower part of the figure.

MOL. CELL. BIOL.

c-mos NEGATIVE REGULATORY ELEMENT 2033

TABLE 2. CAT activities of mutated c-mos promoter plasmidsaMos-CAT construct % Conversion

Mock...... 0.26 ± 0.03 (8)-392...... 3.9 ± 0.58 (9)MutBoxl..... 2.1 ± 0.46 (10)MutBox2..... 0.45 ± 0.03 (8)MutBox3..... 1.8 ± 0.34 (6)MutT..... 0.41 ± 0.04 (2)AT...... 0.43 ± 0.04 (4)+T...... 3.8 ± 0.54 (4)

a NIH 3T3 cells were transfected with the indicated Mos-CAT plasmids(see Fig. 4). Data from the insertions (+5 and +10) and deletions (A5 and A10)to T-box sequences are pooled as +T and AT, respectively. Results fromindependent assays are presented as means ± standard errors of the means,with the number of determinations in parentheses.

which the entire negative regulatory region had been de-leted, indicating that box 1 participated in inhibition of geneexpression. Mutations in box 2 also yielded some CATexpression, but only about twofold above background. How-ever, mutations in box 3 (the region downstream of box 2and the run of T residues) again yielded high levels of CATexpression, corresponding to about 50% of that obtainedwith pmos392.Base substitutions in the run of 10 T residues resulted in

only about a twofold increase in CAT activity (Fig. 6 andTable 2), indicating that the sequence of this region upstreamof box 3 did not make a major contribution to negativeregulation. To determine whether regions surrounding thisrun of T residues cooperated in transcription regulation, wenext constructed mutants in which the spacing between box2 and box 3 was either decreased or increased by 5 or 10 bp.Deletion of either 5 or 10 of the T residues had no significanteffect on transcription from the c-mos promoter (Fig. 6 andTable 2). In contrast, insertions of either 5 or 10 bp in thisregion increased CAT expression more than 10-fold, tolevels which were approximately 50 to 80% of pmos392 (Fig.6 and Table 2). Since the 5-bp inserted sequence was similarto that used to generate the MutT plasmid, the effect of theinsertion appeared to result from the alteration in spacingrather than in sequence. It thus appeared that increasing thedistance between elements flanking the run of T residuesresulted in substantial deregulation of c-mos expression.Taken together, the effects of these mutations suggest thatnegative regulation of c-mos is mediated by several interact-ing sequence elements in the -467 to -404 region.

c-mos transcription in somatic cells and oocytes is regulatedby distinct mechanisms. Transcription of c-mos in oocytes

% conversion 0.2 0.2 6.4 0.4 0.5 4.5 3.0 0.4

04

.:P

Mos-CAT 3 -746 -392 A5 AIO +5 +10 MutTconstruct °

FIG. 6. Effects of point mutations, insertions, and deletionsbetween box 2 and box 3. NIH 3T3 cells were transfected withplasmids containing the mutations to T-box sequences (MutT) andthe insertions (+5 and +10) and deletions (A5 and A10) indicated inFig. 4.

% conversion 0.4 0.5

Mos-CAT 0 -746construct

2.3 1.2 1.0

-74 M2 M3

-50 -40 -30 -20WT CTACTCA7TIT CTCCCTAGTG TCTCATGTGA CTGTC

M2 CTACTCAT1rT CTAAGCKTFTC TGAGGTGTGA CTGTC..... ... .... ..o....

M13 GGTCGACGTC AGCCCTAGTG TCTCATGTGA CTGTCFIG. 7. Effects of mutations in Inr-related sequences. Mutants

M2 and M3 were introduced into pmos74 as previously described(15). The Inr-related sequences immediately downstream of thec-mos oocyte transcription start site are underlined in the wild-type(WT) sequence. Substitutions in the mutant sequences are indicatedby dashes.

initiates 53 bp upstream of the ATG and is controlled byInr-related sequences immediately downstream of the tran-scription initiation site (15). As noted above, a Mos-CATplasmid containing only 42 bp of c-mos sequence upstreamof the ATG was still efficiently expressed in NIH 3T3 cells(Fig. 1). It was therefore of interest to determine whether theInr-related sequences, which were required for efficientc-mos expression in oocytes (15), also played a role in c-mostranscription in NIH 3T3 cells. Two plasmids (pmosM2 andpmosM3) containing 74 bp of upstream c-mos sequence withmutations of the Inr-related sequences were therefore as-sayed for CAT expression in NIH 3T3 cells. Both of thesemutants decreased expression in NIH 3T3 cells by onlyabout 50% compared with pmos74 (Fig. 7), whereas thesame mutants reduced expression in oocytes by 10- to20-fold (15). The Inr-related element therefore appears to beless critical for c-mos expression in somatic cells.

Initiation sites of c-mos transcription in somatic cells. Asc-mos transcription initiates from different promoters inspermatocytes and in oocytes, it was of interest to determinewhich of these promoters would be used in somatic cells. Toaddress this issue, we carried out RNase protection studiesusing a probe complementary to c-mos sequences from -294to -16 (Fig. 8). RNA was prepared from NIH 3T3 cells thathad been transfected with the various Mos-CAT constructs,including pmos731 as a negative control. For comparison,RNA was also isolated from mouse testicular germ cells.Two major transcripts were detected in male germ cell

RNA, originating at approximately 280 and 150 nucleotidesupstream of the ATG (Fig. 8). These transcripts are consis-tent with those previously reported (16), except that thetranscript initiating 150 bp upstream of the ATG was moreprominent in our experiments than it was in the study ofPropst et al. (16). The Mos-CAT constructs extending up-stream of the spermatocyte transcription start site at -280yielded protected RNA species corresponding to those de-tected in male germ cells. These constructs included themutants pmos+ 10 and pMutBox3 (Fig. 8) as well as pmos392and pmos298.As the deletions crossed the spermatocyte start site at

VOL. 12, 1992

0

tipt6 * 6

2034 ZINKEL ET AL.

-(--286

601

.........

I,

- 62x-58

o4-50

4- 45

DI 4. m -; 1. .. il K -L310 - -n C:) .,j o 41, tj w .112 , C),2 Ixp 0

>4

6'a -.Ilr.

C,

Sca I Probe

Spermatocyte Qocyte-746 X *.-7t-

17Tr74-

'-1

FIG. 8. RNase protection. RNAs from testicular germ cells(spermatogenic) and from NIH 3T3 cells transfected with theindicated Mos-CAT plasmids were analyzed as described in Mate-rials and Methods. The RNA probe was synthesized from pGEM3Z,into which the 731-bp c-mos fragment (consisting of sequences from-746 to -16) from pmos731 had been inserted. The template DNAwas digested with ScaI, which cleaves 294 bp upstream of the c-mosATG. The resulting probe hybridizes to c-mos sequences as well asto an additional 8 bp of the polylinker between the T7 transcriptionstart site and the c-mos insert. Since these polylinker sequences arealso present in RNAs expressed from Mos-CAT plasmids, theprotected RNAs from transfected cells are eight nucleotides longerthan those from the natural c-mos RNA of spermatocytes. The twoc-mos transcripts detected in spermatocytes are indicated on the leftby arrows. The mobility of marker fragments is indicated on theright. The 286- and 161-bp markers are RNAs prepared frompmos731 template digested with ScaI and DraIII, respectively. Theremaining markers are single-stranded DNAs.

-280, the longer transcript was no longer detected andadditional intermediate transcripts appeared. These tran-scripts initiated approximately 200 and 170 bp upstream ofthe ATG for pmos223 (data not shown) and pmosl91 (Fig. 8),respectively. Further deletions appeared to produce progres-

sively shorter transcripts: pmosl35 yielded a transcriptinitiating about 120 nucleotides upstream of the ATG, andpmos99 yielded a transcript initiating about 100 nucleotidesupstream of the ATG. The transcript produced from pmos54corresponded to the oocyte transcription start site 53 bpupstream of the ATG. However, since the apparent initiationsites of these transcripts were close to the endpoints of thedeletions, we cannot exclude the possibility that they repre-sent read-through from upstream plasmid sequences or arisefrom contaminating plasmid DNA in the RNA preparations.In contrast, we were not able to detect specific transcripts inRNAs purified from NIH 3T3 cells transfected with pmos42or pmosM3, which lacked the oocyte promoter and Inr-related sequences. Expression of CAT activity from theseplasmids (Fig. 1 and 7) thus appeared to result from initiationat undefined sites within the remaining c-mos sequences.

DISCUSSION

The principal result of this study is that sequences located400 to 500 bp upstream of the mouse c-mos ATG serve toinhibit c-mos transcription in somatic cells. The inhibitoryeffect of these sequences was observed in NIH 3T3 andBALB/3T3 mouse cells, PC12 rat pheochromocytoma cells,and A549 human lung carcinoma cells. In contrast, thesesequences did not inhibit the efficient expression of Mos-CAT plasmids in mouse oocytes (15). It thus appears thatthese c-mos upstream sequences constitute a negative regu-latory element that specifically inhibits c-mos transcriptionin somatic cells and therefore may be involved in tissue-specific regulation of the c-mos proto-oncogene.The negative regulatory sequences defined in this study

are distinct from the previously described c-mos UMSsequences (2, 22). The UMS is a sequence located between1,651 and 1,835 bp upstream of the c-mos ATG that wasidentified because it prevented activation of c-mos trans-forming potential by a 3' long terminal repeat (2, 22). It isthought to act as a transcription terminator, blocking tran-scription of c-mos from an upstream promoter. However,both the spermatocyte and oocyte transcription initiationsites are substantially downstream from the UMS, whichtherefore is unlikely to influence transcription from thesepromoters. In addition, expression of Mos-CAT constructsdirectly demonstrates that deletion of the UMS does notaffect c-mos transcription in either transfected NIH 3T3 cellsor microinjected mouse oocytes (15; this study).The c-mos negative regulatory sequences that we have

identified are contained within a highly conserved -200-bpregion of mouse and human upstream c-mos sequences,previously defined as the mouse upstream homology region(2). This region was initially identified as the only region ofhomology (-75% nucleotide identity) in the noncoding se-quences of the mouse and human c-mos genes (2). Compar-isons of the mouse c-mos sequence to human and rat c-mossequences (2, 11) indicate a high degree of conservation ofthe sequences that we have identified as negative regulatory

Species Coordinates

MOUSE -467 - -404

RAT

Box 1 Box 2

CACTAACAATCATTATAGCCTGAAAAGTGTGCACCAAGTTCACTGTACTTTTTTTTTTCTCC

-486 - -423

HUMAN -454 - -393

FIG. 9. Comparison of the negative regulatory region in mouse, rat, and human c-mos genes. Sequence identities are indicated by dashes,and alignment gaps are indicated by asterisks.

Box 3

MOL. CELL. BIOL.

c-mos NEGATIVE REGULATORY ELEMENT 2035

elements (Fig. 9). The sequences that we have defined asboxes 1, 2, and 3 are absolutely conserved in mouse and ratgenes. Box 1 is also completely conserved in the humangene, and the human box 2 and box 3 sequences differ fromthe mouse sequences only in one pyrimidine-to-pyrimidinesubstitution each. In addition, the spacing between thesethree regions is absolutely conserved in mouse and ratgenes; in the human c-mos sequence, box 3 is shifted 5' by 2bp. It is also of note that the negative regulatory sequence islocated at a similar distance from the ATG in all three c-mosgenes: at -393 to -454 in human c-mos, at -404 to -467 inmurine c-mos, and at -423 to -486 in rat c-mos. The highdegree of sequence conservation as well as the similarlocations of these sequences are consistent with the ability ofthe mouse c-mos element to inhibit expression of transfectedMos-CAT plasmids in rat and human cell lines.The c-mos negative regulatory region appears to be com-

plex, spanning at least 60 bp and apparently consisting ofmultiple interacting elements. It is noteworthy that two ofthe sequence elements within this region (box 1 and box 2)are similar to sequences in a putative negative regulatoryregion of the mouse protamine 2 gene, which may restrictnormal expression of this gene to spermatogenic cell types(3). Sequences downstream from these elements (box 3) alsoappear to be important in negative regulation of c-mos. Inaddition, increasing the distance between box 2 and box 3disrupted activity of the negative regulatory element, sug-gesting the possibility of interactions between factor-bindingsites surrounding this sequence. It appears that the relativeorientation of these elements is less important than theabsolute distance between them, as mutations which changethe orientation of the elements by half a helical turn have lesseffect on gene expression than do mutations that increase thespacing. The fact that insertions but not deletions increasedgene expression is consistent with the possibility of interac-tion between multiple proteins. Although our data do notallow us to distinguish whether this cis-acting region is thetarget for one or more regulatory factors, its large size (atleast 60 bp) also suggests that more than one protein may beinvolved. Further studies will be required to identify specificfactor-binding sites within this region.

Expression of the c-mos proto-oncogene is specific tospermatocytes and oocytes, in which it is transcribed fromdistinct initiation sites (approximately -280 and -53, re-spectively, with respect to the ATG). The negative regula-tory element located -100 to 200 nucleotides upstream ofthe spermatocyte start site does not inhibit expression inoocytes (15) but may play an important role in tissue-specificregulation by blocking transcription in somatic cells. Inconstructs from which it was deleted, transcription in NIH3T3 cells initiated at the same sites as in spermatocytes.Transcription of c-mos in spermatocytes, therefore, mayresult simply from a lack of effect of the negative regulatoryelement, without a requirement for any additional tissue-specific positive regulatory sequences. Interestingly, whensequences past -280 were deleted, transcription initiated atalternative downstream sites. It thus appears that the majordeterminant for c-mos expression in NIH 3T3 cells wasremoval of the negative regulatory sequences rather than theutilization of a unique promoter.

In oocytes, however, c-mos is specifically transcribedfrom the -53 initiation start site, and sequences immediatelysurrounding this site (including a downstream Inr-relatedelement) are required for efficient expression of Mos-CATconstructs (15). Constructs in which the -53 start site hadbeen deleted, or in which the Inr-related sequences had been

mutated, were still expressed in NIH 3T3 cells, with tran-scription initiating nonspecifically within the remainingc-mos flanking sequences. The same constructs were ex-pressed only at substantially reduced levels in oocytes (15).Transcription in oocytes may therefore require the addi-tional presence of a cell-specific positive regulatory ortargeting factor, which acts on the oocyte promoter andInr-related element.

ACKNOWLEDGMENTS

We are grateful to Clarke Millette for advice and assistance withtesticular germ cell preparations.

This investigation was supported by National Institutes of Healthgrant HD26594, NIH fellowship CA08667, and an InvestigatorAward from the Claudia Adams Barr Program for Cancer Research.

REFERENCES1. An, G., K. Hidaka, and L. Siminovitch. 1982. Expression of

bacterial 0-galactosidase in animal cells. Mol. Cell. Biol.2:1628-1632.

2. Blair, D. G., T. G. Wood, A. M. Woodworth, M. L. McGeady,M. K. Oskarsson, F. Propst, M. A. Tainsky, C. S. Cooper, R.Watson, B. M. Baroudy, and G. F. Vande Woude. 1984. Prop-erties of the mouse and human mos oncogene loci, p. 281-289.In G. F. Vande Woude, A. J. Levine, W. C. Topp, and J. D.Watson (ed.), The cancer cell-oncogenes and viral genes 2. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

3. Bunick, D., P. A. Johnson, T. R. Johnson, and N. B. Hecht. 1990.Transcription of the testis-specific mouse protamine 2 gene in ahomologous in vitro transcription system. Proc. Natl. Acad.Sci. USA 87:891-895.

4. Copeland, N. G., and G. M. Cooper. 1979. Transfection byexogenous and endogenous murine retrovirus DNAs. Cell 16:347-356.

5. Feig, L. A., and G. M. Cooper. 1988. Inhibition of NIH 3T3 cellproliferation by a mutant ras protein with preferential affinity forGDP. Mol. Cell. Biol. 8:3235-3243.

6. Gerton, G. L., and C. F. Millette. 1984. Generation of flagella bycultured mouse round spermatids. J. Cell Biol. 98:619-628.

7. Gilman, M. 1989. Ribonuclease protection assay, p. 4.7.1-4.7.8.In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. E.Seidman, J. E. Smith, and K. Struhl (ed.), Current protocols inmolecular biology. Wiley-Interscience, New York.

8. Goldman, D. S., A. A. Kiessling, C. F. Millette, and G. M.Cooper. 1987. Expression of c-mos RNA in germ cells of maleand female mice. Proc. Natl. Acad. Sci. USA 84:4509-4513.

9. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

10. Johnson, P. A., J. J. Peschon, P. C. Yelick, R. D. Palmiter, andN. B. Hecht. 1988. Sequence homologies in the mouse prota-mine 1 and 2 genes. Biochim. Biophys. Acta 950:45-53.

11. Leibovitch, S. A., J.-L. Lenormand, M.-P. Leibovitch, M.Guiller, L. Mallard, and J. Harel. 1990. Rat myogenic c-moscDNA: cloning, sequence analysis and regulation during muscledevelopment. Oncogene 5:1149-1157.

12. Mutter, G. L., and D. J. Wolgemuth. 1987. Distinct develop-mental patterns of c-mos proto-oncogene expression in femaleand male mouse germ cells. Proc. Natl. Acad. Sci. USA84:5301-5305.

13. O'Keefe, S. J., A. A. Kiessling, and G. M. Cooper. 1991. c-mosis required for cyclin B accumulation during meiosis of mouseeggs. Proc. Natl. Acad. Sci. USA 88:7869-7872.

14. O'Keefe, S. J., H. Wolfes, A. A. Kiessling, and G. M. Cooper.1989. Microinjection of antisense c-mos oligonucleotides pre-vents meiosis II in the maturing mouse egg. Proc. Natl. Acad.Sci. USA 86:7038-7042.

15. Pal, S. K., S. S. Zinkel, A. A. Kiessling, and G. M. Cooper. 1991.c-mos expression in mouse oocytes is controlled by initiator-related sequences immediately downstream of the transcriptioninitiation site. Mol. Cell. Biol. 11:5190-5196.

VOL. 12, 1992

2036 ZINKEL ET AL. MOL. CELL. BIOL.

16. Propst, F., M. P. Rosenberg, A. Iyer, K. Kaul, and G. F. VandeWoude. 1987. c-mos proto-oncogene RNA transcripts in mousetissues: structural features, developmental regulation, and lo-calization in specific cell types. Mol. Cell. Biol. 7:1629-1637.

17. Propst, F., and G. F. Vande Woude. 1985. Expression of c-mosproto-oncogene transcripts in mouse tissues. Nature (London)315:516-518.

18. Romrell, L. J., A. R. Bellve, and D. W. Fawcett. 1976. Separa-tion of mouse spermatogenic cells by sedimentation velocity. Amorphological characterization. Dev. Biol. 49:119-131.

19. Sagata, N., M. Oskarsson, T. Copeland, J. Brumbaugh, andG. F. Vande Woude. 1988. Function of c-mos proto-oncogene inmeiotic maturation in Xenopus oocytes. Nature (London) 335:519-525.

20. Sagata, N., N. Watanabe, G. F. Vande Woude, and Y. Ikawa.1989. The c-mos proto-oncogene product is a cytostatic factorresponsible for meiotic arrest in vertebrate eggs. Nature (Lon-don) 342:512-518.

21. Smale, S. T., and D. Baltimore. 1989. The "initiator" as atranscriptional control element. Cell 57:103-113.

22. Wood, T. G., M. L. McGeady, B. M. Baroudy, D. G. Blair, andG. F. Vande Woude. 1984. Mouse c-mos oncogene activation isprevented by upstream sequences. Proc. Natl. Acad. Sci. USA81:7817-7821.

23. Zinn, K., D. DiMaio, and T. Maniatis. 1983. Identification of twodistinct regulatory regions adjacent to the human a-interferongene. Cell 34:865-879.