HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on...
-
Upload
ethelbert-lindsey -
Category
Documents
-
view
219 -
download
4
Transcript of HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on...
![Page 1: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/1.jpg)
HUMAN GENOME PROJECTHUMAN GENOME PROJECT101101
![Page 2: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/2.jpg)
Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001
![Page 3: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/3.jpg)
Human Genome Project
Begun in 1990, the U.S. Human Genome Project is a 13-year effort coordinated by the U.S. Department of Energy and the National Institutes of Health. The project originally was planned to last 15 years, but effective resource and technological advances have accelerated the expected completion date to 2003.
HGP goals are to: ■ identify all the approximately 35,000* genes in human DNA,
■ determine the sequences of the 3 billion chemical base pairs that make up human DNA,
■ store this information in databases, ■ improve tools for data analysis, ■ transfer related technologies to the private sector, and ■ address the ethical, legal, and social issues (ELSI) that may
arise from the project.
![Page 4: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/4.jpg)
![Page 5: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/5.jpg)
Human Genome DataHuman Genome Data
• Derived from the Human Genome Project
• sequence freeze date in anticipation of data release: 22 July 2000
• Release of First Draft Sequence of Human Genome :
Nature 409 (6822), 15 February 2001
Science 291 (5507), 16 February 2001
• Release of “Complete” Draft Sequence of Human Genome: April 2003
![Page 6: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/6.jpg)
GENE GENEIntragenic region
exons intronsinterspersed
repeatstandemrepeats
Fine Structure of Human Genomic DNA
ACGTTGTGTCGCTGATTAGCTAGACCAAGATAGTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATATATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTAGATG
![Page 7: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/7.jpg)
3.2 billion nucleotides
The
Human
Genome
How many genes?
![Page 8: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/8.jpg)
![Page 9: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/9.jpg)
>100,000 < 40,000
![Page 10: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/10.jpg)
But think of allall our traits, Jim-
bo!
Ours?! Are you of my species?
![Page 11: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/11.jpg)
Get lost, punk!
Ouch!
![Page 12: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/12.jpg)
The
Human
GenomeACGTTGTGTCGCTGATTAGCTAGACCAAGATAGTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATACGCWHENISAGENEAGENETATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGC
Comparative Genomics (Alignment)
Gene Prediction
Experimental Discovery (Genetics)
![Page 13: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/13.jpg)
Alignment
![Page 14: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/14.jpg)
CTCGCTGACTCAATCGGATTATGCTAGTCG
GCCCCCCCCCCCCTGAGTCAGGGGGGCTCGCTGCTGTGCTG
TGACTCAATCGGATTATGCTAGTCG
ATAGCCTAATAGCTGACTCAATCGGATTATGCTAGTCG
ATTTTTTTGACTCAATCGGATTA
CGGGGTGACTCAATCGGA
AAAAATATATTGACTCAATCGGATTATGCTAGTCG
GTCGTAGCTTGACTCAATCGGATTATGCTAGTCG
TCATATGACTCAATCGGATTATGCTAGTCG
![Page 15: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/15.jpg)
CTCGCTGACTCAATCGGATTATGCTAGTCG
GCCCCCCCCCCCCTGAGTCAGGGGGGCTCGCTGCTGTGCTG
TGACTCAATCGGATTATGCTAGTCG
ATAGCCTAATAGCTGACTCAATCGGATTATGCTAGTCG
ATTTTTTTGACTCAATCGGATTA
CGGGGTGACTCAATCGGA
AAAAATATATTGACTCAATCGGATTATGCTAGTCG
GTCGTAGCTTGACGGAATCGGATTATGCTAGTCG
TCATATGACTCAATCGGATTATGCTAGTCG
![Page 16: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/16.jpg)
CTCGCTGACTCAATCGGATTATGCTAGTCG
GCCCCCCCCCCCCTGAGTCAGGGGGGCTCGCTGCTGTGCTG
TGACTCAATCGGATTATGCTAGTCG
ATAGCCTAATAGCTGACTCAATCGGATTATGCTAGTCG
ATTTTTTTGACTCAATCGGATTA
CGGGGTGACTCAATCGGA
AAAAATATATTGACTCAATCGGATTATGCTAGTCG
GTCGTAGCTTGACGGAATCGGATTATGCTAGTCG
TCATATGACTCAATCGGATTATGCTAGTCG
![Page 17: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/17.jpg)
Gene Prediction
![Page 18: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/18.jpg)
![Page 19: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/19.jpg)
TTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGAATATAAAGGATAGATTACATGTGATATATGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTATGGATTGCGCTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATAGCGATATGACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATATGATATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAAATAATATAAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGC
![Page 20: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/20.jpg)
TTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGAATATAAAGGATAGATTACATGTGATATATGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTATGGATTGCGCTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATGCGATATAACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATAGCGATATGACCCAGGGGGGATACGCTATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAATATATAAGAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGCTTCGCTATAGGCTATAGCGATATAACCCAGGGGGGATATGATATTAGGAGGAGAGATATAGGATAGATTACATGTGATATATAGGAGAGAGAAATAATATAAGAGAGAGAGATTTTTTCTCCTGGTAAAAAGCTCGCTTAGGATTGCGC
![Page 21: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/21.jpg)
GENE GENEIntragenic region
exons intronsinterspersed
repeatstandemrepeats
Gene Prediction Algorithmsbased on consensus nucleotide sequences of
•tata boxes and start codons
•stop codons
•splice junctions
•CpG islands
![Page 22: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/22.jpg)
Comparative Gross Results from Model Genome
Projects
![Page 23: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/23.jpg)
![Page 24: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/24.jpg)
![Page 25: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/25.jpg)
Humans have about 35,000 genes!
You were right.
So what’s new!
![Page 26: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/26.jpg)
Human Genes
![Page 27: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/27.jpg)
Surprising Findings = !!
• !! Only 35,000 genes• most genes in euchromatin• GC/AT patchiness• !! Gene density higher & intron
size smaller in GC-rich patches• !! 1.4% translated, 28%
transcribed• !! Origins of genes
![Page 28: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/28.jpg)
Some Origins of Human Genes
• Most from distant evolutionary past(basic metabolism, transcription, translation,repli-cation fixed since appearance of bacteria and yeast)
• Only 94/1278 families vertebrate-specific• 740 are nonprotein-encoding RNA genes• many derive from partial genomes of viruses and
virus-like elements—genomic fossils• some acquired directly from bacteria
(rather than by evolution from bacteria)
![Page 29: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/29.jpg)
![Page 30: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/30.jpg)
Genomic Fossils
![Page 31: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/31.jpg)
Genomic Fossils(also known as Molecular Fossils)
• interspersed repeats
• generated by integration of transposable elements or retrotransposable RNAs
• active contemporary modifier of some vertebrate genomes (mouse)
• formerly active modifier of human genome
• some as prevalent as 1.5 million copies
![Page 32: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/32.jpg)
![Page 33: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/33.jpg)
Alu ElementsType of Short Interspersed Nuclear Element (SINE)
• transcribed by RNA polymerase III • 3’ oligo dA-rich tail• found only in primates• 1,500,000 copies • derived from 7SL RNA gene• dimer-like structure• most retroposition occurred 40 mya
A/T-richregion and3’-UTR
direct repeats
5’ 3’
A-rich regionRNA polymerase
III Promoter
AAAnA B
31 bp
50-300 bpAlu
![Page 34: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/34.jpg)
Reverse TranscriptionEssential for Retroposition and Proliferation of Retroelements
• Converts primed RNAs into cDNAs• catalyzed by RNA-dependent DNA pol
» (reverse transcriptase)
• pol encoded by retroviruses and active LINEs
Retroviral genomic RNA
Alu RNA
LINE RNA
![Page 35: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/35.jpg)
![Page 36: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/36.jpg)
Alu Subfamily Structure (millions of years)
Oldest [J]
Intermediate [S]
Youngest [Y]
Jo Jb (65)
S (50) Sq
Sp Sx
Sc Sg
Y (25)
Yb8 Ya5 Ya8
450,000 copies
50,000 copies
Alu Elements as Genomic Fossils
![Page 37: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/37.jpg)
Alu Subfamily Structure
PS [J]: Primate-Specific. Abundant in all primates.65-70 mya: Early Prosimian (strepsirhini)
![Page 38: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/38.jpg)
AS [S]: Anthropoid-Specific (haplorhini) 50-60 mya One mutation difference than PS.
Alu Subfamily Structure
![Page 39: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/39.jpg)
CS[S]: Catarrhine-specific. Nine mutations arising30-40 mya: Platyrrhines (FN) (Marmoset)Catarrhine (DFN) (Macaque)
macaque
Alu Subfamily Structure
![Page 40: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/40.jpg)
HS [Y]: Human-specific. Five or more additional20-25 mya: Almost exclusively Hominids
Alu Subfamily Structure
![Page 41: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/41.jpg)
Master Gene Model of RetropositionP. Deininger, M. Batzer, Trends in Genetics 8:307, 1992
2. Master mutation
1. Amplification
TIME (m.y.)CO
PY
N
UM
BER
3’5’
3’5’
![Page 42: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/42.jpg)
Alu Subfamily Structure (millions of years)
Oldest [J]
Intermediate [S]
Youngest [Y]
Jo Jb (65)
S (50) Sq
Sp Sx
Sc Sg
Y (25)
Yb8 Ya5 Ya8
450,000 copies
50,000 copies
Alus as Genomic Fossils
![Page 43: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/43.jpg)
ALU INSERTIONS AND DISEASE
LOCUS DISTRIBUTION SUBFAMILY DISEASE REFERENCE
BRCA2 de novo Y Breast cancer Miki et al, 1996Mlvi-2 de novo (somatic?) Ya5 Associated with
leukemiaEconomou-Pachnis andTsichlis, 1985
NF1 de novo Ya5 Neurofibromatosis Wallace et al, 1991APC Familial Yb8 Hereditary desmoid
diseaseHalling et al, 1997
PROGINS about 50% Ya5 Linked with ovariancarcinoma
Rowe et al, 1995
Btk Familial Y X-linkedagammaglobulinaemia
Lester et al, 1997
IL2RG Familial Ya5 XSCID Lester et al, 1997Cholinesterase one Japanese family Yb8 Cholinesterase
deficiencyMuratani et al, 1991
CaR familial Ya4 Hypocalciurichypercalcemia and
neonatal severehyperparathyroidism
Janicic et al, 1995
C1 inhibitor de novo Y Complement deficiency Stoppa Lyonnet et al, 1990ACE about 50% Ya5 Linked with protection
from heart diseaseCambien et al, 1992
Factor IX a grandparent Ya5 Hemophilia Vidaud et al, 19932 x FGFR2 De novo Ya5 Apert’s Syndrome Oldridge et al, 1997GK ? Sx Glycerol kinase
deficiencyMcCabe et al, (personalcomm.)
![Page 44: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/44.jpg)
What’s New About Old Fossils?In the Human Genome
• Comprise nearly 50% of genome• 50% more Alu elements than were predicted by
molecular biology• scarce in highly-regulated regions (detrimental?)• enriched in GC regions (beneficial?)• little activity, but little scouring• occur frequently within exons• contribute to formation of genes encoding novel
proteins
![Page 45: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/45.jpg)
![Page 46: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/46.jpg)
3.2 billion bases
28% transcribed
<1.4% encodes protein
50% repeats
Only ~35,000 genes!
FEATURESFEATURESThe
Human
Genome
not many modern protein families
![Page 47: HUMAN GENOME PROJECT 101 Human Genome Program, U.S. Department of Energy, Genomics and Its Impact on Medicine and Society: A 2001 Primer, 2001.](https://reader035.fdocuments.us/reader035/viewer/2022062423/56649f295503460f94c41b03/html5/thumbnails/47.jpg)
Humans have about 35,000 genes!
Well, then…How can you
explain human complexity?