History and Evolution of Vaccine Technologies · Yeast DNA Antigen DNA Strugnell R et al. Chapter 3...

History and Evolution of Vaccine Technologies Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public HealthGSK Vaccines

Immunize Nebraska

August 7, 2020

Disclosure

Employed by GSK where I am a vaccine research physician scientist

Presentation at the invitation of Dr. Meera Varman, Professor, Pediatric Infectious Diseases, Creighton University School of Medicine

Presentation is for educational purposes only; this is not a sales, marketing or promotional presentation

Content of presentation will not include unapproved or investigational uses of products or devices

1. CDC. List of Vaccines Used in United States. https://www.cdc.gov/vaccines/vpd/vaccines-list.html. Accessed Jan 2017.2. WHO. Vaccines and Diseases. http://www.who.int/immunization/diseases/en/. Accessed Jan 2017.3. CDC Achievements in Public Health, 1900-1999 Impact of Vaccines Universally Recommended for Children – United States, 1990-1998.https://www.cdc.gov/mmwr/preview/mmwrhtml/00056803.htm. Accessed Jan 2017.

Globally, Many Diseases are Currently Preventable by Vaccination

3

“Vaccines are one of the greatest achievements of biomedical science and public health”3

Global public health1 Regional focus2

Adenovirus AnthraxCholeraDengueEbolaJapanese encephalitisTick-borne encephalitisTyphoid feverRabiesYellow fever

DiphtheriaHaemophilus influenzae type b

Hepatitis AHepatitis BHerpes zosterHuman papillomavirusInfluenzaMeaslesMeningococcal A, B, C, W, YMumps

H5N1 fluPertussisPoliomyelitisPneumococcalRotavirusSmallpox and vacciniaTetanusTuberculosisVaricella

Vaccine Science: Two Centuries of Continuous Research, Improvements, and Achievements

4R. Thom, ‘Jenner: Smallpox is Stemmed, from "The History of Medicine,”’ Collection of the University of Michigan Health System, Gift of Pfizer.Bonanni P, et al. Chapter 1 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

The Science of Immunology Began in the 19th Century

5

Microorganisms were identified as the true cause of infectious diseases

Host cells that ingest and destroy invading microbes were discovered and called ‘phagocytes’

Passive immunotherapy of diphtheria with anti-diphtheria toxin antibodies discovered ‘immune serum’

The antibodies theory was formulated

The concept of ‘natural immunity’ to infection was born

Courtesy of CDC/Janice Haney Carr/Jeff Hageman M.H.S.

Bonanni P, et al. Chapter 1 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

New Technologies Make Vaccines PossibleThat Were Previously Impossible

6

Finco O, Rappuoli R. Front Immunol. 2014;5:1-6.

Reverse Vaccinology

Empirical Approach GlycoconjugationRecombinant

DNA

MenB, GBS, GAS, E. coli, S. aureus,

C. difficile

Diphtheria, Tetanus, Pertussis, Rabies,

Influenza, Smallpox, Polio, BCG

MenACWY, Pneumo,

Hib, GBS, S. aureus

Hepatitis B, Acellular Pertussis,

Lyme, Human papillomavirus

20101930 19901980

In the 1930s, Max Theiler at Rockefeller Foundation used an egg system for the development of an effective yellow fever vaccine, for which he was awarded the

Nobel Prize in Medicine in 1951

Enders, Weller and Robbins at Harvard received the Nobel Prize in Medicine

in 1954 for demonstrating the ability of polio viruses to grow in cell cultures

Cell culture (1950s)Embryonated eggs (1930s)

Courtesy of CDC

Growing Viruses

7

1930s–1950s

Bonanni P, et al. Chapter 1 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

Virus Vaccines

APC, antigen-presenting cell.Callaway E. Nature. 2020; 580(7805): 576–577.

Live-attenuated virusViruses are weakened by being passed through animal or human cells until they gain mutations that limit their ability to cause disease

Cell

Inactivated virusVirus is inactivated using chemicals or heatVirus replicates

APC

Live-attenuated, combined MMR vaccine developed in order to minimize the total number of injections in infantsClinical trial data demonstrate a combined antigen vaccine can be effective and can have an acceptable safety profile

MMR, measles-mumps-rubella

Measles Mumps Rubella

Bonanni P et al. Chapter 1 in: Garçon et al. Understanding Modern Vaccines, Perspectives in Vaccinology, Vol 1, Amsterdam, Elsevier, 2011.

1970s Combination Vaccines

Courtesy of CDC/Cynthia S. Goldsmith, William Bellini, PhD

Courtesy of CDC/Dr Fred Murphy Courtesy of CDC/Dr Erskine Palmer

1970s–1980s

Subunit/purified vaccineSplit vaccine

Whole virus vaccine

Pathogen fragmentation

eg, some influenza vaccines

eg, acellular pertussis components: PT, PRN, FHA, FIM; HA in some

influenza vaccines

– Antigen choice: provides immune protection & technologically achievable

– Often reduced immunogenicity versus whole pathogen– Non-infectious, low reactogenicity, acceptable

tolerability– No or limited availability of innate defensive triggers– For subunit vaccines with lower immunogenicity,

adjuvants often needed to compensate– Facilitate supply via synthetic production versus whole

pathogen

Split Pathogen and Subunit Vaccines

10

Strugnell R, et al. Chapter 3 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

New Technologies Make Previously Impossible Vaccines a Reality

11

Reverse Vaccinology


DNA


C. difficile

Diphtheria, Tetanus, Pertussis, Rabies,

Influenza, Smallpox, Polio, BCG

MenACWY, Pneumo,

Hib, GBS, S. aureus



20101930 19901980


Recombinant Protein Vaccines: HBV

12

Sequence gene encoding HBsAg

Insert gene into yeast expression system

Protein expression

Purification of recombinant protein encoding antigen

(natural assembly into spheres)

Administration as vaccine

Hepatitis B surface antigen

HBsAg= hepatitis B surface antigen; HBV= hepatitis B virus.Strugnell R, et al. Chapter 3 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

1980s

Yeast DNA

Antigen DNA

Strugnell R et al. Chapter 3 in: Garçon et al. Understanding Modern Vaccines, Perspectives in Vaccinology, Vol 1, Amsterdam, Elsevier, 2011.

Elicit immune

response

DNA encoding L1

Transcription Translation

Self-assembly into viral capsids (VLPs)

HPV viral capsid

HPV, human papillomavirus; VLP, virus-like particle

Self-assembly

into pentamers

Purification from

expression system

L1 capsid proteins

1990s Recombinant Protein Vaccines: HPV

Strugnell R et al. Chapter 3 in: Garçon et al. Understanding Modern Vaccines, Perspectives in Vaccinology, Vol 1, Amsterdam, Elsevier, 2011.

B-ce

ll +

antib

ody

quan

tity

Polysaccharide-conjugate vaccine

Polysaccharide vaccine

T-ce

ll qu

antit

y


No T-cell response to polysaccharide alone

Antibody, no memory

B-cell

T-cellAntibody

and memory


Polysaccharide vaccine

Conjugated protein

1980s-1990s Polysaccharide-conjugate vaccines

Rino Rappuoli, Matthew Bottomley, Ugo D’Oro, Oretta Finco, Ennio De Gregorio J Exp Med 2016:213;469-481

Classical Vaccinology

15

Rappuoli R, et al. J Exp Med. 2016;213:469-481.

Growing Pathogens Reverse Vaccinologydesign from information

Reverse Vaccinology: Human Immunology Instructs Vaccine Antigen Design

16

2000s

Classical Vaccinologygrowing pathogens

Reverse Vaccinologydesign from information

Rappuoli R, et al. J Exp Med. 2016;213:469-481.

B-cell

Express recombinant

proteins

In silico vaccinecandidates

Vaccine Candidates

Reverse Vaccinology: A Genomic Approach for a Meningococcus B Vaccine1,2

171. Ulmer JB, et al. Nat Biotechnol. 2006;24:1377-1383.2. Serruto D, et al. J Biotechnol. 2004;113:15-32.

600 potential vaccine candidates identified

350 proteins successfully expressedin E. coli

91 novel surface-exposedproteins identified

28 novel proteinshave bactericidal

activity

Vaccines Today: An Explosion of New Technologies

18

Reverse Vaccinology


DNA


C. difficile

Diphtheria, Tetanus, Pertussis, Rabies, Influenza, Smallpox, Polio,

BCG

MenACWY, Pneumo, Hib, GBS, S. aureus



Synthetic Biology/RNA/DNA Vaccines

Adjuvants

Structural Vaccinology

Systems Vaccinology

Next Generation Technologies

20101930 19901980 2015


Vectors

Increasethe level of the immune response

Challenging populationsdue to impaired immune system (eg, elderly, children, immunocompromised)

Current Challenges for Vaccines1

191. Garçon N, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011; Chapter 4: 89-113.2. Petrovsky N, Aguilar JC. Immunol Cell Biol. 2004;82:488-496.

Need for booster vaccinations

Recombinant antigensgenerally less immunogenic than live or attenuated organism vaccine2

Pathogensthat require broad and complex immune response

Need for antigen sparingpotential supply problems (eg, pandemic flu, SARS-CoV-2)

Prolong the duration of the immune response, improve immune memory, and protection

Overcomea weakened immunogenicity

Induce the generation of a high and broad immune response

Reduce the amount of antigen needed (dose-sparing)

Examples of Novel Approaches to Vaccine Design

20

DNA1 Novel adjuvants and adjuvant combinations3

Live vectors1 RNA2Reverse vaccinology1

1. Stanberry L, Strugnell R. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011; Chapter 6: 155-199.2. Geall A, et al. Semin Immunol. 2013;25:152-159. 3. Garçon N, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011; Chapter 3: 61-88.

• Pathogen-derived genetic material coding for the antigens contained in a non-replicating DNA plasmid

• Antigen is expressed by the cells of the vaccine recipient

• Substances included in a vaccine formulation to enhance the quality and strength of the immune response induced by the vaccine antigen(s)

• Targeted antigens encoded by gene(s) incorporated into the vector’s genetic material

• Antigens expressed by a vector (like virus or bacterium) that is non-pathogenic

• Synthetic virus particles include antigen proteins

• Once inside host cell cytoplasm, these self-amplify in large amounts, express antigen proteins and interact with the host immune system

• Computer analysis of the pathogen’s entire genome is conducted to find genes that may be antigenic

• Vaccine candidate identified based on prediction of protein sequences similar to pathogen’s genome sequences

– From Latin, adiuvare: to aid– Substance included in a vaccine to enhance and modulate the quality and/or strength of

the immune response induced by the antigen– Old technology, made new

Adjuvant1,2

21

Adjuvant

1. Bonanni P, et al. Chapter 5 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.2. Garçon N, et al. Chapter 4 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011.

Adjuvants have a long history in the fight against infectious diseases

22Hib=Haemophilus influenzae type b; HPV=human papillomavirus; IPV=inactivated polio vaccine; OPV=oral polio vaccine (live). *IPV is adjuvanted when formulated in combination with diphtheria, tetanus, pertussis-based vaccines but is not adjuvanted when formulated as a stand-alone vaccine.

1. Figure adapted from Di Pasquale A, et al. Vaccines. 2015;3:320-343. 2. CDC Pink Book 2018. https://www.cdc.gov/vaccines/pubs/pinkbook/appendix/appdx-b.html. Accesed September 2018.

No adjuvantAdjuvanted

RabiesTyphoidCholeraPlague

PertussisTetanusTuberculosis

DiphtheriaYellow fever

InfluenzaPneumococcus

Polio, inactivated*Polio, liveMeasles

MumpsRubellaInfluenza

Meningococcus ACWYHib

Pertussis

Hepatitis BHib

Hepatitis ATyphoid

Varicella

TyphoidMeningococcus

Pneumococcus

InfluenzaRotavirus

Meningococcus ACWY

HPVZoster

Smallpox

Adju

vant

dis

cove

ry Pandemic influenza

Influenza

Diphtheria, tetanus, pertussis-based combinations

1750 1800 1900 1910 1920 1940 1990 20101850 20001930 1950 1960 1970 1980

Zoster Hepatitis B

Meningococcus B InfluenzaMalaria

https://www.cdc.gov/vaccines/pubs/pinkbook/appendix/appdx-b.html

Rationale for adjuvant use in vaccinesWhy do antigens need help?

Strugnell R et al. Perspect Vaccinol 2011;1:61–88; Garçon N et al. Perspect Vaccinol 2011;1:89–113 (content on slide from pp. 61, 71, 72, 75, 76, 89, 111)

Illustrative figure based on Strugnell R et al. 2011; Garçon N et al. 2011

Imm

unog

enic

ity

Native pathogen

Replicating(live attenuated

pathogen) Non-replicating(whole inactivated

pathogen)Subunit

(toxoids, split virus,fragments of pathogens) Purified antigens

(recombinant proteins)

High

Low High

Adjuvants(increased immunogenicity and

may have increased reactogenicity)

23

Tolerability

Dose reduction and antigen sparing

e.g. Hepatitis B V, Pandemic flu V

Adjuvants are associated with several potential benefits for vaccine development

24

Increased durationof immune response

e.g. HPV, Herpes zoster V

Improved responses in special populations

e.g. Seasonal flu V, Herpes zoster V

Overcome poor immunogenicity

e.g. Malaria Vaccine

Leroux-Roels I, et al. PLoS One. 2008;3:e1665. RTS, S Clinical Trials Partnership. N Engl J Med. 2011;365:1863-1875. Lal H, et al. N Engl J Med. 2015;372:2087-2096. Roteli-Martins, et al. Hum Vaccin Immunother. 2012;8:390-397. Garçon N, et al. Chapter 4 in: Garçon, et al. Understanding Modern Vaccines: Perspectives in Vaccinology. Vol 1. Amsterdam: Elsevier; 2011. Knuf M, et al. Hum Vaccin Immunother. 2015;11(2):358-76. Denny L, et al. Vaccine. 2013;31:5745-5753. Di Pasquale A et al. Vaccines 2015;3:320–343

Adjuvants–Few Approved, Many in Development

25

Adjuvants in Licensed ProductsAdjuvant Mechanism or

ReceptorLicensedproduct

Aluminum salts Nalp3, ITAM,antigen delivery

Numerous (eg,pertussis, hepatitis,

pneumococcal)

AS04 TLR4 HPV

Emulsions(MF59, AS03)

Immune cellrecruitment,

antigen uptakeInfluenza

AS01 TLR4, inflammasome

Zoster

CpG ODN TLR9 Hepatitis B

Adjuvants in DevelopmentAdjuvant Mechanism or

receptorClinicalphase

ISCOMs (Matrix-M) Unknown 2

dsRNA analogues TLR3 1

Flagellin TLR5 1

C-type lectin ligands Mincle, Nalp3 1

CD1d ligands CD1d 1

GLA-SE TLR4 1

IC31 TLR9 1

CAF01 Mincle, antigendelivery 1

Adapted from Reed SG, et al. Nature Med. 2014;19:1597-1608.

Vaccine Game-changing Technologies

Reverse vaccinology

ATTTATACATGAGACAGACAGACCCCCAGAGACAGACCCCTAGACACAGAGAGAGTATGCAGGACAGGGTTTTTGCCCAGGGTGCAGTATG

Adjuvant Systems

Platform Technologies

Synthetic vaccines

(DNA/RNA) Viral Vectors

Structural vaccinology

Life science revolution driven by insights and data

Potential to improve efficacy; faster, simpler, more efficient development & manufacturing

Reverse Vaccinology and beyond

27

▪ Reverse Vaccinology was first successfully applied to MenB vaccine challenge1

▪ Subsequently Reverse Vaccinolgy was applied to other difficult pathogens, e.g.▪ Group B streptococcus (Maione D et al, Science, 2005)▪ E. coli (Gomes Moriel D et al, PNAS, 2010)

▪ Antigens identified by RV or other methods can potentially be further improved using new technologies e.g. Structural Vaccinology, Reverse Vaccinology 2.02

1. Rappuoli R, et al. Curr Op Microbiol. 2000;3:445-450.2. Rappuoli R, et al. J Exp Med. 2016;213:469-481.


28

▪ Can now use 3D knowledge of protein structure to design new vaccine antigens with optimized biological and immunogical features1

▪ E.g. design of RSV F antigen engineered as stable pre-fusion conformation2

1. Dormitzer PR et al. Nat Rev Microbiol; 2012;10:807-813.2) McLellan J et al. Science. 2013;342;592-598. 3. Swanson K et al. PNAS. 2011;108:9619-9624.

Example - Respiratory Syncytial Virus (RSV)

Post-fusion FSwanson K et al. (3)

Pre-fusion FMcLellan J et al. (2)

Same protein, different conformation

Concept of nucleic acid-based vaccines

Nucleic acid vaccine

– Express target antigens in the vaccinee

– Transformative,1 simpler technology2

– No requirement for cellculture-based manufacturing

– Scalable and flexible– Types of synthetic nucleic acid-based

vaccines– Plasmid DNA– messenger RNA

Cellular uptake

Immuneresponse

Manufacturein a cell-free system

Injectvaccine

1. Morrison C. Nat Rev Drug Discov 2016;15:521–522; 2. Brito LA et al. Mol Ther 2014;22:2118–2129

Antigen expression

Nucleic Acid Vaccines

APC, antigen-presenting cell; DNA, deoxyribonucleic acid; mRNA, messenger RNA; RNA, ribonucleic acid.Callaway E. Nature. 2020; 580(7805): 576–577.

DNA vaccine

Cell

APC

mRNA

Viral proteins

RNA vaccine(with lipid coat)

The DNA or RNA encoding a viral peptide that promotes an immune response is inserted into human cells, which then

produce large quantities of the specific DNA or RNA

Long lasting, specificEarly, non-specific

Triggering the innate immune response

Triggering the adaptive immune response

• Organized structure and size ideal for pattern recognition receptors ➔efficient triggering of innate immunity1

• Non-pathogenic & no replication in host due to removal of essential genes1

• Infect many cell types, including Antigen Presenting Cells (APC)2

Viral vectors retain immune-stimulating properties of viruses without causing disease

31

• Antigen of interest inserted into viral genome2

• Antigen produced within APC triggering antibodies and cellular immune responses1,2

Image 160235651 from www.shutterstock.com

1. Vittelli A et al. Exp Rev Vaccines 2017; 16:1241-1252; 2.Tatsis N & Ertl H Mol. Ther. 2004; 10:616-629.

Viral Vector Vaccines

APC, antigen-presenting cell.Callaway E. Nature. 2020; 580(7805): 576–577.

Replicating viral vector (such as measles)

Cell

Non-replicating viral vector (such as adenovirus)

Virus replicates

APC

Viruses such as measles or adenovirus are weakened so they

cannot cause disease, and are genetically modified to produce target

antigen proteins

Several vaccine candidates

Repurpose existing tools

Platform technologies can act as ‘on-demand’ solutions to produce vaccines against multiple diseases

331. Strugnell R et al. Perspect Vaccinol 2011;1:61–88; 2. Gilbert SC, Warimwe GM. Vaccine 2017;35:4461–4464

Platform-based vaccine development2Traditional vaccinology1

One technological development

Onetechnological

platform

One vaccine candidate

Multiple rounds of refinement

Accelerated development

How Can These Technologies Help Our Society?

34

Reverse Vaccinology


DNA


C. difficile

Diphtheria, Tetanus, Pertussis, Rabies, Influenza, Smallpox, Polio,

BCG

MenACWY, Pneumo, Hib, GBS, S. aureus



Synthetic Biology

Adjuvants/Human Immune Response


Next Generation Technologies


Vectors

ElderlyFluGBSMeningococcalPneumococcalRSVZosterCandidaC. difficileE. coliKlebsiellaP. aeruginosaStaphBreast CancerColorectal CancerProstate Cancer

PregnancyCMVFluGBSHBVMeningococcalPertussisRSVTetanus

Vaccines For Every Age

35Rappuoli R, et al. Nature Rev Immunol. 2011;11:865-872.

Infants & ChildrenDiphtheriaFluGASHAVHBVHibIPVMeningococcalPertussisPneumococcalRotavirusRSVTetanusVaricella Measles

AdolescentsCMVDTaP boostEBVFluHSVHPVMeningococcal

AdultsDiphtheriaFluHBVMeningococcalPertussisRSVTetanus

-3 0 8 18 55 90MONTHS YEARS

Vaccines For Today’s Society

36

Rappuoli R. Vaccine. 2015;33S:B1–B2.

PovertyCholeraDengueETECHAVHBVHEVFluJEVMalariaMenBParasitic infectionsParatyphoidRabiesRotavirusSalmonellaS. entericaS. typhimuriumShigellaTBTyphoid fever

Emerging InfectionsAIDSAnthraxAvian influenzaCholeraCoronavirusesDiphtheriaDengueEbolaEV71MalariaSARSTBSmallpoxWest NileYersinia

TravelersCholeraDengueETECFluHAVHBVJEVMalariaMeningococcalParatyphoidRabiesShigellaTBTyphoid FeverYellow Fever

Patients with Chronic DiseasesCMVFluFungal infectionsP. aeruginosaParainfluenzaRSVStaphTB

Immunotherapy/ Therapeutic Vaccines?CancerAutoimmune diseasesAlzheimer’sChronic infections(HCV, HBV, HPV, HIV…)

Metabolic diseasesAllergyDrug addiction

History and Evolution of Vaccine Technologies Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public HealthGSK Vaccines

Immunize Nebraska

August 7, 2020

Discussion

History and Evolution of Vaccine Technologies · Yeast DNA Antigen DNA Strugnell R et al. Chapter 3...

Documents

Transcript of History and Evolution of Vaccine Technologies · Yeast DNA Antigen DNA Strugnell R et al. Chapter 3...