Hematodinium in the Context of

Other Dinoflagellate Populations in the MCBs

Hematodinium sp.

First described as a parasite of the green crab (Carcinus maenas) during the 1930’s off the French Coast

Invades hemolymph of host; consumes hemocyanin and

mobilized host metabolites; hemocyte numbers reduced

Combined lack of oxygen, nutrition, tissue damage leads to crab morbidity and/or death

Nagle, Place, Schott, Jagus, Messick, and Pitula; Diseases of Aquatic Organisms. 84:79-87, 2009.

Large Host Range in Diverse Ecosystems

Blue crab (Callinectes sapidus)

-Eastern and Southern US coastal waters

Edible Crab (Cancer pagurus)

-Northern Atlantic and Bay of Biscay

Snow Crab (Chionoectes opilio)

-Alaskan waters, Newfoundland Bay

Tanner crab(Chionoecetes bairdi)

-Alaskan waters

Blue swimmer crab (Portunus pelagicus)

-Moreton Bay, Australia

The Norway lobster (Nephrops norvegicus)

-Northeastern Atlantic

Ridgetail white prawn shrimp (Exopalaemon carinicauda)

-Aquaculture ponds in East China Sea

Various amphipods

- Eastern and Southern US coastal waters

Proposed Life Cycle in the Blue Crab

How do blue crabs become infected?

a) Physical- Blue crab eats infected crabs or intermediate host

b) Dinospore- stage in water possibly encapsulated in a

sporocyst. Acquired through gills?

http://www.americanscientist.org/templat

e/AssetDetail/assetid/37182/

page/2;jsessionid=aaa5LVF0#37425

Dinospores Are Emitted from Diseased Crustaceans

Motile cells observed following death

of a crab with Hematodinium.

Dr. Sue Marrs in Stentiford and Shields DAO,

2005, 66: 47-70 http://www.vims.edu/~jeff/biology/stentiford%20and%20shields%202005.pdf

Cancer pagurus

Kim Jennings at IMET (Schott and Jagus lab)

2006 LMRCSC Internship

Messick and Shields 1994, Diseases of Aquatic Organisms

Hematodinium sp. Infection in Blue Crabs Has Seasonal Cycles

Goals of Our Lab

Very little is known about Hematodinium disease

transmission in nature

Find potential hotspots of Hematodinium in the Maryland

Coastal Bays (MCB)

a) Analyze its presence according to seasonal cycles

b) Uncover ecological variables that are associated with free-

living Hematodinium, and also discover potential alternate hosts

Chesapeake Bay

UMES CETRC/

NPS Chincoteague

Bay

Searching for Hematodinium Reservoirs

Collaboration with National Park Service in search of

Hematodinium sp. reservoirs in water and sediment samples.

Historically the coastal bays have shown high infection rates.

•Monthly monitoring sites of

the National Park Service

(blue ellipses).

•Surveys of the NPS sites

were conducted from

April-November of 2010

and 2011.

•All sites have an excellent

historical record through

NPS and MDDNR for

temperature, dissolved

oxygen, pH, and turbidity.

Commercial Harbor

O.C Inlet

Snug Harbor

Verrazano Bridge

South Point

Cedar Island

Whittington Point

Wildcat point

Assateague Channel

Tom’s Cove

Trappe Creek

Newport Bay

Johnson’s Bay

Taylor’s Landing

Greenbackville

Sinnickson

Chincoteague Channel

Procedures

YSI

DNA Isolation kits

20 micron plankton trawl

traditional PCR QPCR

Ponar Grab

ITS1

TCGCACGAAGAAAATAATAATATATTTTATTATTTTCGCACACAAACATTCACCGTGAACCTTAGCCATTAGCTAC

GACGACTACTAGCTAGCTACTGAGTGGGGCGGTGGTGTGTTGGTTACTACTGCTACTTCTTACTCGTAGCTGA

ACTGCACACACACTAGTACCCCTCTCTTGCTGGTAGGAGAAGTAGCTTCTACGGGGTGTGAGGGTACGGTGG

TAGTACACGCCTACCACTGAACTCCTCCATCCCACGTTTGCTTTCCATAAACACAACATCTCTAATTTCAGCTAT

TCATCTTGCTCTGCTCCCTTTCGCGGGGATAGGGCTTTCTTCAAACGTATGAC

5.8S

TAGAAAATTTTAGCGATGAATGCCTCGGCTCGGGTTACGATGAAGGACGCAGCGAATTGCGATAAGCAATGCG

AATTGCAGAATTCCGTGAATCATCAGATTTTTGAACGTACTCTACGCTCTCGGGTATCCCTGGGAGCATGTCTG

GTCTCAGC

ITS2

GTCTGTTCAACCTTTTGTGCCTCCTGGAGTTGTGAACATTCTCCTTCTTGGAAGCGATTTTGTGCACCAGTGA

GCCTCTTTCCACACACATGCTCTACGACGCCTTGTTGTTGTAGACAGCGGAAGATGGCCATTGACGCATTAAA

TATTAAGGGATTTGTAGAATGTTGTAGAGAGGGTTGGTTGCGTACGTCTCACCGTACGCACCAAAAGCTCTGC

ATGTTCCCCAACAACACTTATGACCCACTTTAGGTCTAATGCTTGTTGGCCGAAGGGTTACACTGCATGGTTAT

ACCGCTACTCTTCTTCCGCCCTTTACCGTGATAGTACACAGGTTTTCGGACTAGTGGCGCTATTGCAGCAGAA

ATATTTATATCTCTGTATATATTTACACATG

SSU

ITS2

5.8S

ITS1

NTS NTS LSU

Water Collection Dates Sediment Collection Dates

Site 1 Commercial Harbor 7_10 8_11

Site 2 Verrazano Bridge 9_10 4_10; 5_10; 7_10; 8_11

Site 3 Newport Bay 6_10; 9_10 6_10; 8_11

Site 4 Trappe Creek 4/10; 7/10 8_11

Site 5 Public Landing 6_10; 9_10 5_10; 8_11

Site 6 Whittington Point 8_10; 8_11

Site 7 Taylor's Landing 4/10; 6/10; 7/10

Site 8 Wildcat Point 8_10; 8_11

Site 9 Greenbackville 6_10 8_11

Site 10 Sinnickson

4_10; 6_10; 7_10; 8_10;

10_10 5_10; 7_10; 8_10; 10_10; 11_10

Site 11 Chincoteague Channel 7_10

Site 13 Tom's Cove 6_11 8_10; 10_10; 8_11

Site 14 Johnson's Bay 4_10; 6_10

Site 15 Cedar Island 7_10

Site 18 Snug Harbor 10_10 4_10; 6_10

Endpoint PCR Analysis for Environmental Detection

48 of 546 (8.8%) of environmental samples from the Maryland and Virginia

coastal bays were positive for Hematodinium sp.

Four sites had detectable signal in water in April: earliest detection date we

are aware of.

*

*

*

*

Hematodinium sp. “Hotpsots” 2010 2011

Water Sediment Water Sediment

April Trappe Creek Verrazano Bridge Taylors Landing Snug Harbor Sinnickson Johnson’s Bay May Verrazano Bridge Public Landing Sinnickson June Newport Bay Newport Bay Tom’s Cove Public Landing Snug Harbor Taylors Landing Greenbackville Johnson’s Bay July Commercial Harbor Verrazano Bridge Trappe Creek Sinnickson Taylor’s Landing Chincoteague Channel

Cedar Island August Whittington Point Commercial Harbor Wildcat Point Verrazano Bridge Sinnickson Newport Bay Tom’s Cove Trappe Creek Public Landing Tom’s Cove Whittington Point Wildcat Point Greenbackville Sept. Verrazano Bridge Newport Bay Public Landing Oct. Sinnickson Sinnickson Snug Harbor Nov. Tom’s Cove

http://www.mdcoastalbays.org/files/pdfs_pdf/Report_Card.pdf

Figure Courtesy Darlene Wells (MD-DNR)

and Roman Jessien (MCBP)

“hotspots” all correlate with higher

clay % soils

Water Gene Copies/ml

Sinnickson Apr 2010 2.1 X107

Newport Bay September 2010 6.2 x 105

Sinnickson October 2010 2.6 x 105

Tom's Cove June 2011 8.1 X 107

Sediment Gene Copies/g Sediment

Trappe Creek April 2010 1.7 x 105

Sinnickson May 2010 3.0 x 105

Newport Bay June 2010 4.5 X 105

Sinnickson July 2010 1.7 x 105

Trappe Creek July 2010 1.4 X 105

Sinnickson August 2010 2.6 x 107

Tom's Cove August 2010 1.1 x 107

Newport Bay August 2010 2.4 x 105

Trappe Creek August 2010 3.2 x 105

Newport Bay September 2010 3.9 x 107

Sinnickson October 2010 2.3 x 106

Tom's Cove November 2010 1.2 x 106

Quantification of High Incidence Locations by QPCR

In water samples, highest parasite levels were observed in spring months

(not what we hypothesized)

In sediment samples, highest parasite levels were in the late summer

(consistent with what we hypothesized)

Hematodinium Other species

April 15/16 1 unidentified nanoflagellate June 2/13 10 Heterocapsa rotundata, 1 Peridinium sp.

July/August 13/25 3 Gymnodinium sanguineum, 1 Gymnodinium sp., 3 H. rotundata

and 5 unidentified dinoflagellates

October 10/16 2 Pentapharsodinium tyrrhenicum, 1 G. simplex, 1 Gymnodinium sp.,

1 H. rotundata and 1 Dinophyceae sp. 1

Analysis of Hematodinium sp. at Sinnickson, Through

Clone Libraries Analysis of Dinoflagellate 18 S rRNA

Pitula, Dyson, Bakht, Njoku, and Chen; BMC Aquatic Biosystems 2012. In press

*

Averages for 2010 and 2011 in the MCBs

* *

*

*

Chl Chl

(ug/L) (ug/L)

Newport Bay-3 April 8.2 3.9

May 8.8 17.1

June 20.02 9.4

July 22.7 15.3

Aug. 25.9 16.8

Sept. 9.4

Oct. 14.7 8.3

Nov. 8.7 6.8

Trappe Creek-4

April 9.5 4.2

May 13 18

June 18.7 23.8

July 39.6 27.3

Aug. 28 27.1

Sept. NA 8.1

Oct. 12.3 9.5

Nov. 10.5 8.7

Public Landing-5

April 7.2 2.2

May 19.4 9.2

June 23.1 9.7

July 24.4 4.5

Aug. 15.4 9.3

Sept. 6

Oct. 19.2 3.6

Nov. 4 5.8

Taylor's Landing-7

April 5.4 4.9

May 9.8 8.9

June 23.4 8.1

July 21.7 11.5

Aug. 28.3 14.6

Sept. 6.2

Oct. 12.8 4.5

Nov. 3.3 2.7

In Summary…

a) We have detected in the water column and sediment samples from the

MD and VA Coastal Bays. About 9% of samples were detected positive.

b) Hematodinium sp. DNA is present in the environment throughout all

seasons although there was a surprising amount detected in early

spring, particularly in water

c) We have the expertise to monitor both for Hematodinium disease and

also for the relationships among resident dinoflagellates, including

potential HAB-forming species

Future Directions a) Quantify Hematodinium in environmental reservoirs using QPCR

b) Understand the nature of the “free-living” samples. Ie. Are they infective

dinospores? Are they reproductive forms? Are they in association with

zooplankton?

c) Is there a seasonal succession pattern in the development of HABs?

National Park

Service

Brian Sturgis

Eric Sherry

UMCES-IMET

Feng Chen

Ihuoma Njoku

Eric Schott

Ammar Hanif

Acknowledgements