Regulation of Substrate Recognition by the MiaA tRNAPrenyltransferase Modification Enzyme of Escherichia coli K-12*

(Received for publication, January 6, 1997, and in revised form, February 18, 1997)

Hon-Chiu Eastwood Leung, Yuqing Chen, and Malcolm E. Winkler‡

From the Department of Microbiology and Molecular Genetics, University of Texas Houston Medical School,Houston, Texas 77030-1501

We purified polyhistidine (His6)-tagged and nativeEscherichia coli MiaA tRNA prenyltransferase, whichuses dimethylallyl diphosphate (DMAPP) to isopenteny-late A residues adjacent to the anticodons of most tRNAspecies that read codons starting with U residues. Ki-netic and binding studies of purified MiaA were per-formed with several substrates, including syntheticwild-type tRNAPhe, the anticodon stem-loop (ACSLPhe)of tRNAPhe, and bulk tRNA isolated from a miaA mutant.Gel filtration shift and steady-state kinetic determina-tions showed that affinity-purified MiaA had the sameproperties as native MiaA and was completely active fortRNAPhe binding. MiaA had a Km

app (tRNA substrates) '3nM, which is orders of magnitude lower than that ofother purified tRNA modification enzymes, a Km

app

(DMAPP) 5 632 nM, and a kcatapp 5 0.44 s21. MiaA activity

was minimally affected by other modifications or non-substrate tRNA species present in bulk tRNA isolatedfrom a miaA mutant. MiaA modified ACSLPhe with akcat

app/Kmapp substrate specificity about 17-fold lower than

that for intact tRNAPhe, mostly due to a decrease inapparent substrate binding affinity. Quantitative West-ern immunoblotting showed that MiaA is an abundantprotein in exponentially growing bacteria (660 mono-mers per cell; 1.0 mM concentration) and is present in acatalytic excess. However, MiaA activity was stronglycompetitively inhibited for DMAPP by ATP and ADP(Ki

app 5 0.06 mM), suggesting that MiaA activity is inhib-ited substantially in vivo and that DMAPP may bind to aconserved P-loop motif in this class of prenyltransferases.Band shift, filter binding, and gel filtration shift experi-ments support a model in which MiaA tRNA substratesare recognized by binding tightly to MiaA multimers pos-sibly in a positively cooperative way (Kd

app '0.07 mM).

The tRNA prenyltransferase (EC 2.5.1.8) encoded by themiaA gene of Escherichia coli catalyzes the addition of a D2-isopentenyl group from dimethylallyl diphosphate (DMAPP)1

to the N6-nitrogen of adenosine adjacent to the anticodon atposition 37 of 10 of 46 E. coli tRNA species (i6A37, see Fig. 1and Refs. 1–4). On the basis of a theoretical model of yeasttRNASer structure, the N6-nitrogen of A37 in tRNA substratesof MiaA is recessed and points inward toward the center of theanticodon loop (5). In E. coli, the i6A37 tRNA modification isfurther methylthiolated by the action of the MiaB and MiaCenzyme activities to form ms2i6A37 (Fig. 1), except for tRNASec

(6). ms2i6A37-modified tRNA species read codons starting withU residues and include tRNAPhe, tRNATrp, tRNATyr (I and II),tRNACys, tRNALeu (IV and V), and tRNASer (II and III) but nottRNASer (I and V) (7, 8).

The E. coli MiaA prenyltransferase is an excellent model tostudy fundamental aspects of the modification process. Unlikemany modifications, the function of ms2i6A37 in translationhas been studied extensively in vivo and in vitro (reviewed inRefs. 3, 4, and 9). The ms2i6A37 tRNA modification is thoughtto stabilize tRNA-mRNA interactions by improving intrastrandstacking within tRNA anticodon loops and interstrand stackingbetween codons and anticodons (10, 11). ms2i6A37 also seems toinfluence the conformation of the tRNA anticodon loop andthereby affect interstrand stacking interactions between wob-ble bases at position 34 in tRNA and bases immediately 39 tocodons (4, 10). Lack of ms2i6A37 in the tRNA of miaA mutantsof E. coli and Salmonella typhimurium results in multipledefects in translation efficiency, codon context sensitivity, andfidelity (10–21). These translation defects impart broadly pleio-tropic phenotypes to miaA mutants that contain A37 instead ofms2i6A37 in their tRNA (Fig. 1) (3, 4), including decreasedgrowth rate and yield (12, 13), altered sensitivity to amino acidanalogs (12), increased oxidation of certain amino acids, andtricarboxylic acid cycle intermediates (22), altered utilization ofprimary carbon sources (22), moderately increased GC 3 TAtransversion frequency in nutritionally limited cells (19, 23),suppression of Tet(M)-protein-induced tetracycline resistance(24), decreased DNA oxidation damage in exponentially grow-ing cells,2 and temperature sensitivity for colony formation at45 °C (25). Lack of ms2i6A37 does not seem to affect the ami-noacylation of tRNA (21, 26, 27) or amino acid-tRNA-EFTuzGTP selection (4). Many of these miaA phenotypes maybe caused by disruptions in translational control mechanisms,such as the ones that regulate expression of the tryptophan(trp) (28, 29) and the tryptophanase (tna) (30, 31) operons.

The E. coli miaA gene was cloned (23, 32), sequenced (19),and found to be a member of a superoperon with unusualstructure and complex modes of regulation (22, 25, 33). Ho-mologs of E. coli miaA have also been sequenced in severalother organisms (34, 35). Notably, the miaA homolog of yeast,

* This work was supported by Grant MCB-9420416 from NationalScience Foundation. The costs of publication of this article were de-frayed in part by the payment of page charges. This article musttherefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

‡ To whom correspondence should be addressed: Dept. of Microbiol-ogy and Molecular Genetics, University of Texas Houston MedicalSchool, 6431 Fannin, JFB 1.765, Houston, TX 77030-1501. Tel.: 713-500-5461; Fax: 713-500-5499; E-mail: mwinkler@utmmg.med.uth.tmc.edu.

1 The abbreviations used are: DMAPP, dimethylallyl diphosphate;MiaA, tRNA dimethylallyl (D2-isopentenyl) transferase of E. coli; IPP,isopentenyl diphosphate; DTT, dithiothreitol; BSA, bovine serum albu-min; TMD buffer, 30 mM Tris-HCl (pH 7.5 at 24 °C), 10 mM MgCl2, 1mM DTT); TM buffer, TMD lacking DTT; PAGE, polyacrylamide gelelectrophoresis; ACSL, anticodon stem-loop; ACSLPhe, anticodonstem-loop of E. coli tRNAPhe; (wt), wild-type; T(0.1)E buffer, 10 mM

Tris-HCl (pH 8.0), 0.1 mM EDTA; NDPs, nucleotide diphosphates;NTPs, nucleotide triphosphates; bp, base pair(s); IPTG, isopropyl-1-thio-b-D-galactopyranoside.

2 H.-C. E. Leung and M. E. Winkler, manuscript in preparation.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 20, Issue of May 16, pp. 13073–13083, 1997© 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www-jbc.stanford.edu/jbc/ 13073

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

designated MOD5, has been developed into an important sys-tem to study subcellular localization of proteins (36). Over 20years ago, Rosenbaum and Gefter (37) and Soll and co-workers(38) partially purified E. coli MiaA. These pioneering studiesdemonstrated the substrates and some of the conditions re-quired for MiaA activity and established the sequential path-way for ms2i6A37 biosynthesis in tRNA (Fig. 1; reviewed inRefs. 3 and 4). In this paper, we report rapid methods of MiaApurification and analyses of MiaA steady-state kinetics andtRNA substrate utilization and binding. We also present directquantitation of the cellular amount of the MiaA tRNA modifi-cation enzyme. Our results show that MiaA substrate selectionis complicated and likely regulated by several mechanisms.

EXPERIMENTAL PROCEDURES

Materials—[a-32P]CTP (10 mCi per ml, .400 Ci per mmol) waspurchased from Amersham Corp. [1-3H]DMAPP (0.5 mCi per ml; 15 Ciper mmol) and cold DMAPP were from American Radiolabeled Chem-icals. Restriction enzymes, polynucleotide kinase, T4 DNA ligase, andRiboprobe and Ribomax RNA synthesis systems were purchased fromPromega. BstN1 and strain JM105 were obtained from New EnglandBiolabs. Plasmid pET-15b, E. coli strain HMS174, and biotinylatedthrombin were obtained from Novagen. Plasmid pKK223-3, a Superose12 HR 10/30 column, and PD-10 columns were from Pharmacia BiotechInc. W-POREX DEAE columns (250 3 4.6 mm) were from Phenomenex.DEAE-cellulose (DE-52) was from Whatman. ATP, ADP, and other bio-chemicals were purchased from Sigma. A protein isolation kit for sorbentidentification (PIKSI) was purchased from American International Chem-ical. Bradford and DC protein assay reagents were bought from Bio-Rad.

Construction of Expression Vectors pTX439 and pTX440—Cloningand other molecular biological procedures were done by standard meth-ods (39), unless indicated otherwise. A his6-tag-miaA1 gene fusionunder the control of the T7-phage promoter was constructed in vectorpET-15b by ligating together the following three fragments: (i) a 5.7-kilobase fragment of pET-15b digested with NdeI and BamHI; (ii) a519-bp NdeI-MslI fragment generated by polymerase chain reactionwith primers UMiaA and LMiaA (Table I) containing the amino-termi-nal segment of miaA with an NdeI site added at the miaA start codon;and (iii) a 579-bp MslI-BstYI fragment containing the carboxyl-terminalsegment of miaA1 obtained from plasmid pTX312 (22). This strategylimited the length of polymerase chain reaction-amplified DNA frag-ments used in the construction. Ligation mixtures were transformedinto strain JM105, and the desired construct, designated pTX439, wasidentified by restriction digestion patterns of purified plasmid DNA,DNA sequencing of the miaA segment generated by polymerase chainreaction amplification, and complementation of a miaA::Tn10 null mu-tation in E. coli strain DEV15 (14, 19). pTX439 was transformed into E.coli strain HMS174 to give strain TX3371, in which the His6-MiaAprotein was overexpressed (see Ref. 40).

The native MiaA protein was overexpressed from plasmid pTX440,

which was constructed by ligating a 1.1-kilobase FspI-ScaI fragmentcontaining the intact miaA1 gene from pTX312 (22) downstream of thePtac promoter in plasmid pKK223-3. Ligation mixtures were trans-formed into strain JM105 to give strain TX3367. The orientation of themiaA1 fragment in purified pTX440 plasmid was confirmed by restric-tion digestion patterns and DNA sequencing.

Overexpression and Purification of His6-MiaA—960-ml cultures ofstrain TX3371 were grown in LB medium containing 50 mg of carben-icillin per ml and induced with 1 mM IPTG as described before (40).His6-MiaA protein was purified by one-step batchwise Ni21-chelationaffinity chromatography as described previously (40), except that thewash buffer contained 40 mM imidazole instead of 60 mM imidazole.Eluted His6-MiaA was desalted on PD-10 columns into 2 3 TMD buffer(60 mM Tris-HCl (pH 7.5 at 24 °C), 20 mM MgCl2, and 2 mM dithiothre-itol (DTT)). Similar MiaA concentrations were found using the Bradfordand DC(Lowry) protein assays with bovine serum albumin (BSA) as thestandard. After desalting, an equal volume of 72% (v/v) glycerol wasadded to the His6-MiaA preparation, and the protein solutions weredivided into small volumes and stored at 270 °C. His6-MiaA sampleswere thawed only once and used immediately.

The His6-tag was cleaved from 50 mg of His6-MiaA by digesting atroom temperature for 3 h with 1 unit of biotinylated thrombin in thebuffer provided by the manufacturer. The resulting protein mixturewas used immediately for enzyme assays and binding studies withoutfurther purification. His6-MiaA purity and the extent of thrombin cleav-age were determined by SDS, 15% PAGE (5.6% stacking) as describedbefore (41).

Purification of Native MiaA Protein by Mimetic Dye Chromatogra-phy—Six 400-ml cultures of E. coli strain TX3367 were grown in LBmedium containing 50 mg of ampicillin per ml at 37 °C with shaking(300 rpm) until they reached a turbidity of 50 Klett (660 nm) units, uponwhich IPTG was added to a final concentration of 1 mM. Cultures wereincubated at 37 °C with shaking for 3 h longer, after which they werechilled on ice. All subsequent steps were carried out at 4 °C, unlessnoted otherwise. Cells were collected by centrifugation (5000 3 g) for 15min, and pellets were suspended in 300 ml of TMD buffer (30 mM

Tris-HCl (pH 7.5 at 24 °C), 10 mM MgCl2, and 1 mM DTT). Cells werecollected again by centrifugation (5000 3 g) for 15 min, and pellets weresuspended in 18 ml of TMD buffer. The cell suspension was passedtwice through a chilled French pressure cell at 20,000 p.s.i. Cell lysateswere centrifuged at 150,000 3 g for 60 min, and supernates werefiltered through 0.22-mm acetate filters (Micron Separations). 60 mg ofprotein extract was loaded by gravity flow onto each of the 10 differentmimetic dye PIKSI-kit columns, which had been equilibrated with TMDbuffer. Each column was washed by gravity flow with 5 ml of TMDbuffer containing 0.05 M KCl. Proteins were eluted by two consecutive5-ml washes of TMD buffer containing 0.2 M KCl followed by 0.8 M KCl.100-ml drops of the eluants from each column were placed on Type VSfilter disks (0.025 mm, Millipore), which had been floated on TMDbuffer, and the eluants were dialyzed against TMD buffer at 4 °C for 30min. 15 mg and 5 ng of the dialyzed eluants from each column wereanalyzed by SDS-PAGE and assayed for MiaA prenyltransferase activ-

FIG. 1. Biosynthesis of i6A37 intRNA molecules by the E. coli MiaAtRNA prenyltransferase. The MiaAsubstrate DMAPP is not derived in E. colidirectly from mevalonic acid as it is inmany other organisms (69). The i6A37modified base is further methylthiolatedto ms2i6A37 by the MiaB and MiaC activ-ities, which are not yet characterized (3,6). SAM, S-adenosylmethionine; Cys, cys-teine; SAH, S-adenosylhomocysteine.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase13074

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

ity (below), respectively. The samples eluted with 0.8 M KCl from theMimetic Redy2 A6XL and Mimetic Orangey1 A6XL columns had themost MiaA activity and fewest other contaminating bands (data notshown). The eluant from the Mimetic Red column was pumped (0.3 ml permin) onto a room temperature Superose 12 HR 10/30 column, which wasequilibrated and eluted with TMD buffer. Fractions were collected intochilled tubes and analyzed by SDS-PAGE and assayed for MiaA activity.The fractions that had a molecular mass of about 35 kDa and maximumMiaA enzyme activity were pooled, diluted with an equal volume of 72%(v/v) glycerol, distributed into small volumes, and stored at 270 °C.

Construction of Plasmids for in Vitro Synthesis of tRNAPhe, Anti-codon Stem-Loop of tRNAPhe (ACSLPhe), and Mutant Variants—A syn-thetic E. coli pheU gene encoding wild-type tRNAPhe (Fig. 2A, see“Results”) was constructed by ligating together six oligonucleotides(tRNAphe1 to tRNAphe6; Table I) to form an upstream SalI restrictionsequence, a T7-phage RNA polymerase promoter preceding the 76-basepair (bp) pheU gene, and downstream BstNI and BamHI restrictionsites (42). Positive strand oligomers tRNAphe1, tRNAphe2, andtRNAphe3 and negative strand oligomers tRNAphe4, tRNAphe5, andtRNAphe6 were phosphorylated with T4-phage polynucleotide kinaseand annealed together in T(0.1)E buffer (10 mM Tris-HCl (pH 8), 0.1 mM

EDTA) by heating at 90 °C for 5 min followed by slow cooling to roomtemperature. The annealed oligomers were ligated with an equalamount of pUC18 DNA that had been digested with SalI and BamHI,and the ligation mixture was transformed into strain JM105. Thedesired plasmid, designated pTX442, was identified by restriction di-gestion patterns, which were confirmed by DNA sequencing of theentire synthetic pheU gene.

A synthetic mutant pheU gene specifying tRNAPhe(U60C) (Fig. 2A,see “Results”) was constructed by replacing tRNAphe3 and tRNAphe4with U60C-forward and U60C-reverse (Table I) in the above cloningstrategy to give plasmid pTX476. A synthetic mutant pheU gene spec-ifying tRNAPhe(A37G) (Fig. 2A, see “Results”) was constructed by re-placing tRNAphe2 and tRNAphe5 with A37G-forward and A37G-re-verse (Table I) to give plasmid pTX475. A synthetic gene specifyingwild-type ACSLPhe (Fig. 2B, see “Results”) was constructed by anneal-ing together SL1 and SL2, which provided an upstream HindIII site, aT7-phage polymerase promoter abutting the 17-bp ACSLPhe gene, anddownstream SmaI and BamHI sites. The two oligomers were phospho-rylated and annealed as described above and ligated into pUC18 cutwith HindIII and BamHI to give plasmid pTX539. A mutant variant,ACSLPhe(A11G) (Fig. 2B, see “Results”), was constructed in the sameway by replacing SL1 and SL2 with SL-A37G1 and SL-A37G2 to giveplasmid pTX540.

In Vitro Synthesis and Purification of tRNAPhe, ACSLPhe, and MutantVariants—Plasmids pTX442, pTX475, pTX476, pTX539, and pTX540were purified using a MidiPrep kit (Qiagen). Purified plasmids pTX442,pTX475, and pTX476 or pTX539 and pTX540 were digested to comple-tion with BstNI or SmaI, respectively, which ultimately give the correct39-ends in the transcribed products (Fig. 2, A and B, respectively) (43).

Digestion mixtures were extracted once with an equal volume of TM (30mM Tris-HCl (pH 7.5 at 24 °C) 10 mM MgCl2)-saturated phenol:chloro-form (1:1) and four times with ethyl ether before being precipitated withethanol (39). Linearized DNA templates were transcribed in vitro byT7-phage RNA polymerase provided in the Riboprobe or Ribomax kitsaccording to the manufacturer’s instructions. Transcripts were labeledwith 32P by adding 5 ml of [a-32P]CTP per 100-ml transcription reactionmixture. Transcription reaction mixtures were incubated at 37 °C over-night. DNA templates were removed by digestion with RQ1 DNase (1unit per 1 mg of DNA) at 37 °C for 1 h. Digestion mixtures wereextracted once with an equal volume of TM-saturated phenol:chloro-form (1:1) and four times with ethyl ether before precipitation withethanol. Pellets were collected by centrifugation in a microcentrifuge,dried, and suspended in T(0.1)E buffer.

tRNAPhe, ACSLPhe, and mutant variants were further purified fromnucleotides and aborted transcripts by DEAE high performance liquidchromatography. Resuspended mixtures were applied at a flow rate of1 ml per min to a W-POREX DEAE column equilibrated with 20 mM

sodium phosphate buffer (pH 6.5). RNA molecules were eluted with alinear 0.2 to 1 M NaCl gradient (ramp 5 60 min) in 20 mM sodiumphosphate buffer (pH 6.5) (no urea) at room temperature. IntacttRNAPhe or ACSLPhe, which eluted at about 44 or 36 min, respectively,into the gradient, were pooled, precipitated with ethanol, and stored asdried pellets at 220 °C. Before use, the purified tRNAPhe and ACSLPhe

preparations were suspended in T(0.1)E buffer, heated at 90 °C for 2min, and cooled slowly to room temperature. Concentrations of thetRNAPhe and ACSLPhe molecules were determined by using A260 extinc-tion coefficients calculated from base compositions by the Oligo 4.0program (National Biosciences). The yield from the Riboprobe or Ribomaxkit was 7.5 mg of tRNAPhe from 5 mg of linearized DNA in a 100-ml reactionmixture or 400 mg of tRNAPhe from 20 mg of linearized DNA in a 200-mlreaction mixture, respectively. tRNAPhe(wt) preparations analyzed byurea-20%-PAGE lacked detectable contamination by an (n 1 1) tRNAPhe

product, which contains an extra 39-nucleotide (data not shown (43)).Purification of Bulk tRNA from E. coli—Bulk tRNA was purified

from 4 liters overnight LB cultures of strains NU398 (DEV15miaA::Tn10) and NU394 (DEV15 miaA1) as described previously (23)with some modifications. Briefly, cultures were chilled and cells werecollected by centrifugation (5000 3 g) for 10 min and suspended in 20 mlof cold TMD buffer. All remaining steps were performed at 4 °C, unlessnoted otherwise. 20 ml of TM-saturated phenol was added to the sus-pended cells, and the mixture was agitated vigorously on a wrist shakerfor 1 h. Lysed cells and phenol were removed by centrifugation(14,000 3 g) for 30 min. The aqueous phases were loaded by gravity flowonto separate low pressure DEAE-cellulose columns (2.5 3 3 cm) equil-ibrated with TM buffer containing 0.02 M NaCl. The columns werewashed with TM buffer 1 0.02 M NaCl at a flow rate of 2 ml per min for110 min and then eluted with a linear 0.02 M to 1 M NaCl gradient(ramp 5 110 min) in TM buffer. Samples with A260 . 1 were pooled,precipitated with ethanol, and stored as dry pellets at 220 °C. Forkinetic experiments, bulk tRNA was suspended in T(0.1)E buffer,heated at 90 °C for 2 min, and cooled slowly to room temperature.Concentrations of bulk tRNA were determined from A260 (extinctioncoefficient 5 40 mg per A260 unit). The yield of bulk tRNA was 15–25 mgper 10 g of wet cells.

Gel Filtration Shift Assays—Binding reaction mixtures (200 ml) con-tained TMD buffer and 100 mg of BSA per ml, usually 3.3 to 16.4 mM ofHis6-MiaA protein, and up to 3.3 mM of tRNAPhe(wt) or tRNAPhe(A37G).Binding reaction mixtures were incubated at 24 °C for 30 min beforebeing injected onto a Superose 12 HR 10/30 sizing column equilibratedwith TMD buffer (flow rate 5 0.3 ml per min at room temperature).Molecules were resolved in TMD buffer at the same flow rate anddetected by A280. The column was calibrated with size standards (thy-roglobulin, 669 kDa; b-amylase, 200 kDa; BSA, 66 kDa; chicken bovinealbumin, 35 kDa; carbonic anhydrase, 29 kDa; and cytochrome c, 12.4kDa) between runs of different samples.

Steady-state Kinetic Determinations—Reactions were optimized bychecking several conditions (see below). Standard reaction mixtures (50ml) contained TMD buffer and 100 mg of BSA per ml. DMAPP excessreactions contained 4.0 mM (0.105 Ci/mmol) [1-3H]DMAPP ('7 3 Km

app),and the tRNAPhe, bulk tRNA from a miaA mutant, or ACSLPhe concen-tration was varied from 0.004 to 0.16 mM (24 or 37 °C), 0.04 to 0.4 mM

(37 °C), and 0.04 to 0.4 mM (24 °C), respectively. tRNAPhe excess reac-tions contained 0.08 mM of wild-type tRNAPhe ('35 3 Km

app), and[1-3H]DMAPP (0.105 Ci/mmol) was varied from 0.1 to 10 mM. Reactionswere started by adding 5 ng of MiaA enzyme preparations, which hadbeen diluted from storage buffer into cold TMD buffer immediatelybefore use. Reactions were stopped at various times by adding 0.5 ml of

FIG. 2. tRNAPhe derivatives and microhelices based ontRNAPhe molecules synthesized in vitro for this study (see “Ex-perimental Procedures”). A, cloverleaf depictions of tRNAPhe(wt),tRNAPhe(U60C), and tRNAPhe(A37G). B, ACSLPhe(wt) andACSLPhe(A11G) microhelices. The A residue isopentenylated by MiaA isunderlined.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase 13075

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

cold 10% (w/v) trichloroacetic acid. Precipitates were collected onto25-mm Whatman GF/C filters, which were washed with 10 ml of cold10% trichloroacetic acid and then 10 ml of cold 100% ethanol. The filterswere dried for 10 min under an infrared heat lamp and counted in 3.5ml of Ultima Gold XR scintillation mixture (Packard). Product forma-tion was linear with time for at least 8 min at the highest and lowestconcentrations of substrates used, and initial velocities were usuallydetermined from 2-min reactions for intermediate substrate concentra-tions. ATP or ADP concentrations between 30 nM and 10 mM were addedto tRNAPhe excess reactions to test inhibition of MiaA for DMAPP.Kinetic parameters were calculated by using the Enzfitter nonlinearregression data analysis program (Biosoft).

As noted previously for partially purified preparations (37), the ac-tivity of purified His6-MiaA was strongly reduced in reaction mixturesat pH values below 6 and above 10, containing 50 mM NaPO4 buffer (pH7.5) instead of Tris-HCl (pH 7.5), and lacking reducing agent, such asDTT (data not shown) (37, 38). Omission of BSA from reaction mixturesreduced His6-MiaA activity by 42%, and plots of (product formation)versus (enzyme concentration) 3 (assay time) (44) indicated that BSAstabilized His6-MiaA in reaction mixtures at 37 °C (data not shown).His6-MiaA activity was maximal in reaction mixtures containing DTT,BSA, and 10 mM MgCl2 or 1 mM MnCl2, but was reduced to 53, 43, 6, or,1% when 10 mM MgCl2 was replaced by 20 mM MgCl2, 10 mM MgSO4,10 mM MnCl2, or 10 mM ZnSO4 or 1 mM EDTA (data not shown).His6-MiaA (5 ng) diluted into TMD containing 100 mg of BSA per ml wasthermally stable at 24 to 37 °C for at least 15 min but was rapidlyinactivated by incubation at temperatures above 45 °C (data not shown).

Quantitative Western Immunoblotting Blotting—We used purifiedHis6-MiaA as an antigen for the production of anti-MiaA polyclonalantibodies in rabbits (see Ref. 41). E. coli strains TX2494 (CC104miaA1) and TX2590 (CC104 miaA::VKmr) were grown in 400 ml ofVogel-Bonner (1 3 E) minimal salts medium supplemented with 0.4%glucose and enriched with 0.5% acid casein hydrolysate (Difco) (25).Subsequent steps was carried out as described previously (45), except thatHis6-MiaA or thrombin-treated His6-MiaA were used as standards. Air-dried immunoblots were scanned on a Hewlett-Packard ScanJet 4C scan-ner, and bands were quantitated by using SigmaScan software (Jandel).

Band Shift Assays—The binding reaction mixture (50 ml) containedTMD and 100 mg of BSA per ml. In protein excess titrations (46–48),the concentration of 32P-labeled tRNAPhe or ACSLPhe molecules wasfixed at 0.8 or 3.6 nM, respectively, and the concentration of His6-MiaAprotein was varied between 5.8 nM and 14.2 mM. In ligand excesstitrations (46–48), the concentration of His6-MiaA protein was fixed inthe range of 0.5 to 1.3 mM, and the concentration of 32P-labeled tRNAPhe

or ACSLPhe molecules was varied from 0.1 to 1.6 mM or 0.1 to 10 mM,respectively. Binding reaction mixtures were incubated for 30 min atroom temperature. RNA-protein complexes were resolved from freeRNA molecules by electrophoresis through native 6% (w/v) polyacryl-amide gels (29:1 acrylamide:bisacrylamide) containing 10 mM Tris ac-etate (pH 8.0), 0.1 mM EDTA, and 1 mM DTT. Gels were prerun at 200V at 4 °C for 2 h immediately before use. 30 ml of 40% sucrose was addedto samples before loading them onto gels. Gels were run at 200 V at 4 °Cfor 2 h. Radioactive bands were visualized by autoradiography of driedgels and were quantitated by direct counting in an Instant Imager(Packard).

Nitrocellulose Filter Retention Assays—Triplicate binding reactions

were carried out in 100 ml of TMD containing 100 mg of BSA per ml. Inprotein excess titrations, the concentration of 32P-labeled tRNAPhe orACSLPhe molecules was fixed at 20 pM or 1.8 nM, respectively, and theconcentration of His6-MiaA protein was varied between 0.56 nM to 15.9mM. In some protein excess titrations, 100 mg of BSA per ml was addedto filter soaking and washing solutions (48). In ligand excess titrations,the concentration of His6-MiaA protein was fixed in the range from 1.8to 2.2 mM, and the concentration of 32P-labeled tRNAPhe or ACSLPhe

molecules was varied from 10 nM to 5.0 mM. BSA was omitted from thefilter soaking and washing solutions used for ligand excess titrations,because we found that the saturation level for MiaAztRNAPhe complexformation was about 2-fold higher when BSA was omitted. Bindingreaction mixtures were incubated for 30 min at room temperature andpassed through soaked (TMD buffer for at least 1 h) nitrocellulosefilters (13 diameter, 0.45 mm pore size; Schleicher & Schuell) filterscontained in a manifold (Hoefer Scientific) connected to house vacuum(15–20 in Hg). Filters were washed twice with 300 ml of cold TMDbuffer, dried briefly on the manifold, and counted in Ultima Gold XRscintillation mixture (Packard). The background dpm of control reac-tions lacking His6-MiaA was less than 10% of the input radioactivityand was subtracted in all cases. The retention efficiency ofMiaAztRNAPhe(wt) complexes ranged from about 65% to about 85% atsaturation in protein excess titrations when BSA was added or omitted,respectively, from soaking and washing solutions. The retention effi-ciency of MiaAzACSLPhe(A11G) complexes was about 40% at saturationin protein excess titrations when BSA was omitted from soaking andwashing solutions. MiaAzACSLPhe(wt) complexes were not detected bythe filter binding assay.

RESULTS

Purification of MiaA Protein—We set up rapid methods topurify large amounts of active MiaA protein for kinetic andbinding studies. We constructed an in-frame translation fusionbetween the His6-containing leader peptide encoded by vectorpET15b and the presumed translation start codon of MiaA (see“Experimental Procedures” (19)). IPTG induction of the T7-phage promoter driving the fusion caused 1,340-fold overex-pression of His6-MiaA in crude extracts as measured by quan-titative Western immunoblotting (Fig. 3, lanes 2 and 3;“Experimental Procedures”). Single-step, batchwise, metal ionaffinity chromatography on activated Ni21 resin resulted inelectrophoretically pure His6-MiaA (Fig. 3, lane 4). The yield ofHis6-MiaA from 960 ml of bacterial culture was 6 mg with aspecific activity of 700 nmol of i6A formed per min per mg ofprotein using synthetic tRNAPhe(wt) as a substrate (see below,and see “Experimental Procedures”). The His6-affinity tagcould be completely cleaved from the fusion protein by throm-bin protease (Fig. 3, lane 5; “Experimental Procedures”). Gelfiltration analyses indicated that the cleaved His6-affinity tagwas likely released from the MiaA protein (below).

We also devised a two-step purification of small amounts ofnative MiaA to allow comparisons with the kinetic properties of

TABLE IOligonucleotides used to construct synthetic genes transcribed into tRNAPhe(wt), ACSLPhe(wt), and mutant variants

See “Experimental Procedures” for construction of synthetic genes and in vitro transcription to produce RNA molecules.

Oligonucleotide designation Sequence (59 to 39)

UMiaA (26-mer) ATAAAAGCCCTGACATATGAGTGATALMiaA (22-mer) AAGCCTTTGTGGATCATTTGGAtRNAphe1 (32-mer) TCGACTAATACGACTCACTATAGCCCGGATAGtRNAphe2 (33-mer) CTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCtRNAphe3 (34-mer) GTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAGtRNAphe4 (30-mer) GATCCTGGTGCCCGGACTCGGAATCGAACCtRNAphe5 (33-mer) AAGGACACGGGGATTTTCAATCCCCTGCTCTACtRNAphe6 (36-mer) CGACTGAGCTATCCGGGCTATAGTGAGTCGTATTAGU60C-forward (34-mer) GTGTCCTTGGTTCGATCCCGAGTCCGGGCACCAGU60C-reverse (30-mer) GATCCTGGTGCCCGGACTCGGGATCGAACCA37G-forward (33-mer) CTCAGTCGGTAGAGCAGGGGATTGAAGATCCCCA37G-reverse (33-mer) AAGGACACGGGGATCTTCAATCCCCTGCTCTACSL1 (39-mer) AATTCTAATACGACTCACTATAGGGGATTGAAAATCCCCSL2 (35-mer) GGGGATTTTCAATCCCCTATAGTGAGTCGTATTAGSL-A37G1 (39-mer) AATTCTAATACGACTCACTATAGGGGATTGAAGATCCCCSL-A37G2 (35-mer) GGGGATCTTCAATCCCCTATAGTGAGTCGTAGTAG

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase13076

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

His6-MiaA and thrombin-treated MiaA. We overexpressed na-tive MiaA by IPTG induction of the Ptac promoter of plasmidpTX440 (see “Experimental Procedures”). The MiaA proteinwas purified by step-elution off a mimetic red dye columnfollowed by gel filtration (see “Experimental Procedures”). Thepurified preparation contained approximately equal amountsof one 46-kDa contaminant band and the 35-kDa MiaA band onCoomassie-stained SDS-polyacrylamide gels (data not shown).The yield of native MiaA from 2.4 liters of bacterial culture was0.02 mg with a specific activity of 440 nmol of i6A formed permin per mg of protein using synthetic tRNAPhe(wt) as a sub-strate (see below and see “Experimental Procedures”).

Number of MiaA Molecules Per Cell—We performed quanti-tative Western immunoblot analyses to determine the averagenumber of MiaA molecules present in an E. coli cell growingexponentially in enriched minimal salts/glucose medium at37 °C ((Fig. 4; see “Experimental Procedures”) (45). As stand-ards for these analyses, we added known amounts of purifiedthrombin-treated MiaA to crude extracts of a miaA null mutant(Fig. 4, lanes 4–9). We then loaded amounts of crude extractfrom miaA1 cells so that the MiaA detected was within thelinear range of the standards (Fig. 4, lanes 1–3). By this anal-ysis, we found about 4.0 ng of MiaA protein was present in 100mg of extract of E. coli K-12 growing exponentially in enrichedminimal salts/glucose medium at 37 °C. This amount corre-sponds to about 660 monomers of MiaA per cell and a cellularMiaA concentration of about 1.0 mM, where the volume of an E.coli cell was taken as 1.0 3 10212 ml (45). The spreading ofMiaA standard bands on gels (Fig. 4, lanes 5–9) was caused bysalt from the thrombin cleavage reaction. Similar quantitativeresults were obtained when His6-MiaA instead of thrombin-treated MiaA was used as a standard, in which case the stand-ard bands were as tight as those from the wild-type extracts(data not shown). Finally, the cellular amount of MiaA droppedabout 3-fold in cells in stationary phase (Fig. 4, lanes 1 and 2)

compared with exponential phase (Fig. 4, lane 3).Preparation of RNA Substrates—Seven RNA substrates

were purified for this study of MiaA enzymology. We chosewild-type E. coli tRNAPhe (Fig. 2A) as a model synthetic sub-strate for MiaA, because it had been characterized previouslyby Uhlenbeck and co-workers (49) in their analyses of amino-acyl-tRNAPhe synthetase. We synthesized tRNAPhe(wt) in vitroby using T7-phage RNA polymerase and purified thetRNAPhe(wt) away from aborted transcripts and nucleotides byDEAE high performance liquid chromatography (see “Experi-mental Procedures”). The synthetic tRNAPhe(wt) differed fromnative tRNAPhe in that it contained a 59-triphosphate instead ofa 59-monophosphate and was fully unmodified at all positions(Fig. 2A).

We also constructed and synthesized four mutant variants oftRNAPhe(wt) and purified bulk tRNA from an E. coli miaAmutant and its miaA1 parent strain. Mutant tRNAPhe(U60C)(in which U at position 60 is replaced by C; Fig. 2A) is readilycleavable by lead ions if the tRNA molecule folds properly (49).tRNAPhe(U60C) was synthesized in case tRNAPhe(wt) was notfully available as a substrate for MiaA. Mutant tRNAPhe(A37G)(Fig. 2A) was synthesized as a specificity control and was notexpected to be isopentenylated by MiaA. The synthetic ACSL-Phe(wt) and its corresponding (A11G) mutant (Fig. 2B) weresynthesized to test whether the determinants for i6A formationwere contained in the ACSLPhe. High performance liquid chro-matography analyses indicate that bulk tRNA isolated frommiaA mutants seems to contain all RNA base modificationsexcept for ms2i6A37 (23). Bulk tRNA from a miaA mutant alsocontains the majority of tRNA species that are not substratesfor MiaA. tRNA isolated from the miaA1 strain should be fullymodified, including with ms2i6A37, and was not expected to bea substrate for purified MiaA.

Binding Activity of His6-MiaA to Synthetic tRNAPhe(wt), AC-SLPhe(wt), and tRNAPhe(A37G)—We determined whether thepurified His6-MiaA was fully active for binding to tRNAPhe(wt)and vice versa by using a gel filtration shift assay (Fig. 5).tRNAPhe(wt) and bulk tRNA from a miaA mutant ran anoma-lously with an apparent molecular mass of 78 kDa instead of 25kDa on a calibrated Superose 12 HR 10/30 sizing column (Fig.5A). Purified His6-MiaA and thrombin-treated MiaA (23 mg)had apparent molecular masses of about 34 kDa (Fig. 5B) and37 kDa, respectively, which approximated the 34-kDa mono-mer molecular mass predicted for MiaA from its amino acidsequence (19). The slightly lower mobility of His6-MiaA com-pared with thrombin-treated MiaA may have been caused byinteraction between the His6-tag and the column matrix. Arelatively large amount of crude extract (6 mg) from wild-typecells produced a single peak of MiaA activity with a molecular

FIG. 3. SDS-PAGE analysis of samples from different stages ofpurification of His6-MiaA protein from strain TX3371. Affinitypurification of His6-MiaA and thrombin cleavage to remove the His6-tagare described under “Experimental Procedures.” The gel was stainedwith Coomassie Brilliant Blue dye (41). Lane 1, polypeptide molecularmass markers (2 mg each); lane 2, 60 mg of crude extract from anuninduced culture; lane 3, 60 mg of crude extract from a culture inducedfor His6-MiaA overexpression with 1 mM IPTG for 3 h; lane 4, 3 mg ofsingle-step affinity-purified His6-MiaA; lane 5, 2 mg of thrombin-treatedMiaA lacking the His6-tag.

FIG. 4. Quantitative Western immunoblotting to determinethe amount of MiaA in E. coli cells growing exponentially or instationary phase in enriched minimal salts/glucose medium at37 °C. MiaA in 100 mg of total protein extract are shown as follows: lane1, a miaA1 culture grown for 24 h after reaching early stationary phase;lane 2, a miaA1 culture at early stationary phase (280 Klett (660 nm)units); lane 3, a miaA1 culture growing exponentially (50 Klett (660nm) units); and lane 4, a miaA::V(Kmr) null mutant grown for 24 h afterreaching early stationary phase. Lanes 5-9, standards containing thesame extract as in lane 4 and 32, 16, 8, 4, or 2 ng of added thrombin-treated MiaA, respectively. The gel was scanned, and MiaA bands werequantitated as described under “Experimental Procedures.” The entireexperiment was performed four times totally. The extra bands belowMiaA are cross-reacting proteins to the anti-MiaA antibody, which wasnot extensively purified, and served as controls for loading.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase 13077

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

mass of about 45 kDa on the same column (data not shown).Thus, His6-MiaA, thrombin-treated MiaA, and native MiaAbehaved as monomers under the experimental conditions usedhere.

Addition of an equimolar amount of tRNAPhe(wt) to His6-

MiaA caused complete disappearance of the 34-kDa His6-MiaAmonomer peak, about a 50% reduction in the free tRNAPhe(wt)peak, and the appearance of a new 110-kDa leading peakcontaining the His6-MiaAztRNAPhe(wt) complex (Fig. 5C). Thisresult showed that the purified His6-MiaA was fully active forbinding to tRNAPhe(wt). Similar results were obtained forthrombin-treated MiaA (data not shown). Addition of His6-MiaA in a 10-fold molar excess over tRNAPhe(wt) caused thefree tRNAPhe(wt) peak to disappear completely with a corre-sponding increase in the 110-kDa peak containing the His6-MiaAztRNAPhe(wt) complex (Fig. 5D). This result showed thatthe tRNAPhe(wt) substrate was fully capable of binding to theHis6-MiaA enzyme. The above conclusions were confirmed bykinetic and quantitative binding studies (below).

Gel filtration shift assays were also performed with mixturesof His6-MiaA and the ACSLPhe(wt) microhelix (Fig. 2B) ormutant tRNAPhe(A37G) (Fig. 2A). Free ACSLPhe(wt) ran anom-alously with an apparent molecular mass of 25 kDa instead of5 kDa on the Superose 12 HR 10/30 column (data not shown).All of the ACSLPhe(wt) could be shifted into a His6-MiaAzACSLPhe(wt) complex with an apparent molecular massof about 45 kDa (data not shown), which approximated the sumof the predicted monomer molecular masses of His6-MiaA (36kDa) and ACSLPhe(wt) (5 kDa). The free His6-MiaA peak alsodisappeared completely from binding mixtures containingequimolar amounts of tRNAPhe(A37G) and His6-MiaA (Fig.5E). However, the resulting complex had an apparent molecu-lar mass of about 63 kDa, which approximated the sum of thepredicted monomer molecular masses of His6-MiaA (36 kDa)and tRNAPhe(A37G) (25 kDa). Thus, on the basis of complexsize, His6-MiaA bound to the ACSLPhe(wt) microhelix and mu-tant tRNAPhe(A37G) in an apparent 1:1 molar ratio, whereasHis6-MiaA and thrombin-treated MiaA seemed to form alarger, comparatively stable 110-kDa complex withtRNAPhe(wt). The stoichiometry of tRNAPhe(wt) binding is con-sidered below.

MiaA Enzyme Kinetics—We optimized an assay for deter-mining initial rates of [3H]DMA transfer to unlabeled RNAsubstrates at 24 and 37 °C (see “Experimental Procedures”).[3H]i6A-modified RNA was recovered by precipitation with tri-chloroacetic acid. Typical Lineweaver-Burk plots of His6-MiaAwith tRNAPhe(wt) and DMAPP are shown in Fig. 6, A and B,respectively, and steady-state kinetic data for various RNAsubstrates and MiaA preparations are compiled in Table II.The apparent substrate inhibition of His6-MiaA bytRNAPhe(wt) (Fig. 6A) was also observed for bulk tRNA from amiaA mutant (data not shown). Since the synthetictRNAPhe(wt) substrate and bulk tRNA were prepared by dif-ferent methods (see “Experimental Procedures”), it seems un-likely that this substrate inhibition (Fig. 6A) was caused by alow level contaminant in the synthetic tRNAPhe(wt) prepara-tions. tRNAPhe(A37G) and bulk tRNA from a miaA1 strainwere not modified by MiaA, confirming the specificity of the invitro i6A37 modification reaction (data not shown).

The Kmapp and kcat

app for tRNAPhe(wt) were the same withinexperimental error for His6-MiaA, thrombin-treated MiaA, andnative MiaA (Table II, lines 1, 5, and 6). Thus, the presence ofthe His6-tag did not appreciably affect the association state(above) or the kinetic properties (Table II) of the MiaA prenyl-transferase. Consequently, His6-MiaA was used in most subse-quent experiments and will be referred to simply as MiaAhereafter. tRNAPhe(wt) and tRNAPhe(U60C) showed equivalentkinetic properties (Table II, lines 1 and 2), implying that bothsubstrates were folded correctly enough to act as substrates forMiaA. Consistent with this interpretation, prolonged incuba-tion of reaction mixtures containing excess MiaA resulted in

FIG. 5. Gel filtration chromatographs of MiaA and complexesformed with synthetic tRNAPhe(wt) and tRNAPhe(A37G). Thecurves represent A280 plotted against elution times (earlier to later fromleft to right) from a Superose 12 HR 10/30 sizing column eluted iso-cratically with TMD buffer (flow rate 5 0.3 ml per min at room tem-perature; see “Experimental Procedures”). Binding mixtures containedthe following: 3.3 mM of tRNAPhe(wt) alone (A); 3.3 mM of purifiedHis6-MiaA alone (B); equimolar amounts (3.3 mM) of His6-MiaA andtRNAPhe(wt) (C); 10-fold molar excess of His6-MiaA (16.5 mM) overtRNAPhe(wt) (1.65 mM) (D); equimolar amounts (3.3 mM) of His6-MiaAand tRNAPhe(A37G) (E), shown at half the amplitude as C. The exper-iments in each panel were repeated at least one time.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase13078

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

complete i6A modification of tRNAPhe(wt) as judged by themolar amount of [3H]DMA incorporated (data not shown).MiaA had nearly the same Km

app and kcatapp for tRNAPhe(wt) and

bulk tRNA isolated from a miaA mutant (Table II, lines 1 and3). To make this comparison, the concentration of MiaA sub-strates was taken as 12.9% of all tRNA species in the bulktRNA isolated from a miaA mutant grown in LB medium at arate of 2.5 doublings per h (7).

The ACSLPhe(wt) microhelix (Fig. 2B) was also a substratefor the MiaA enzymes (Table II, line 8). These reactions werecarried out at 24 °C to prevent melting of the GC-rich ACSL-Phe(wt) (predicted Tm '63 °C from the Oligo 4.0 program (Na-tional Biosciences)). Control experiments showed that pro-longed incubation with excess MiaA led to complete i6Amodification of ACSLPhe(wt) and that mutant ACSLPhe(A11G)was not modified by MiaA (data not shown). The kcat

app/Kmapp

substrate specificity constant was about 17-fold lower for AC-SLPhe(wt) than for tRNAPhe(wt) due primarily to an 8-foldreduction in Km

app (lines 7 and 8).Competitive Inhibition of MiaA Activity by Nucleotide Di-

and Triphosphates and by tRNAPhe(A37G)—MiaA homologshave been sequenced from several organisms and share anATP/GTP P-loop binding motif (50). Hence, we checkedwhether ATP, ADP, and other nucleotide di- and triphosphates(NDPs and NTPs) affected MiaA enzyme activity in vitro. Wefound that MiaA activity was strongly inhibited by ADP (Fig.7A) and ATP (Fig. 7B). The inhibition was classically compet-

itive with respect to the DMAPP substrate with Kiapp(ATP) 5

0.07 mM and Kiapp(ADP) 5 0.05 mM. We tested other NTPs, such

as GTP and CTP, and found similar inhibition as with ATP(data not shown). Thrombin-treated MiaA lacking the His6-tagwas inhibited by ATP or ADP to the same extent as His6-MiaA(data not shown). Last, we found that mutant tRNAPhe(A37G)acts as a strong competitive inhibitor of i6A-37 modification intRNAPhe(wt) (Ki

app 5 4.23 nM (Fig. 7C)). This finding is consist-ent with the results from gel filtration (Fig. 5E) and bindingstudies (below).

Stoichiometry of MiaA Binding to RNA Substrates—We fur-ther investigated the composition of complexes formed betweenMiaA and synthetic tRNAPhe or ACSLPhe molecules by per-forming band shift and filter binding assays (Figs. 8–10; see“Experimental Procedures”). For both kinds of assays, we per-formed protein excess titrations, in which the tRNAPhe(wt)concentration was held constant far below the estimated Kd

app,and the MiaA concentration was varied (Figs. 8A and 10). Wealso performed ligand excess titrations, in which the MiaAconcentration was held constant near its estimated cellularconcentration ('1.0 mM; see above), and the tRNAPhe and AC-SLPhe concentrations were varied (Figs. 8B and 9).

Unexpectedly, the molar ratio of tRNAPhe(wt) ortRNAPhe(A37G) bound per MiaA at saturation was 0.5 for bothtypes of binding assays (Fig. 9, A and B). Given that the MiaApreparations were completely active for binding (Fig. 5), thisresult showed that a MiaA dimer, rather than a monomer,

FIG. 6. Representative Lineweaver-Burk plots of initial rate steady-state kinetic data for MiaA and its tRNAPhe(wt) and DMAPPsubstrates. A, tRNAPhe(wt) was varied in the presence of excess (4 mM) DMAPP. B, DMAPP was varied in the presence of excess (0.08 mM)tRNAPhe(wt). See “Experimental Procedures” for assay conditions and data analysis.

TABLE IIKinetic parameters of His6-MiaA, thrombin-treated MiaA, and native MiaA

Initial rates of RNA prenylation by [3H]DMAPP were measured and kinetic parameters were calculated by nonlinear regression analysis asdescribed under “Experimental Procedures.” Averages from several independent determinations are shown with S.E.

Protein preparation and substrate Kmapp Vmax

app kcatappa kcat

app/Kmappa

nM mmol/min/mg s21 nM21s21

37 °CHis6-MiaA

tRNAPhe(wt) 2.27 6 0.5 0.68 6 0.08 0.39 0.17tRNAPhe(U60C) 2.04 6 0.5 0.75 6 0.03 0.44 0.21Bulk tRNA from miaA mutant 4.26 6 0.2 0.56 6 0.02 0.33 0.08DMAPP 632 6 131 0.82 6 0.02 0.48 0.001

Thrombin-treated His6-MiaAtRNAPhe(wt) 4.9 6 0.6 0.54 6 0.02 0.32 0.06

Native MiaAtRNAPhe(wt) 2.85 6 0.4 0.53 6 0.03 0.31 0.11

24 °CHis6-MiaA

tRNAPhe(wt) 5.7 6 3 0.51 6 0.1 0.3 0.05ACSLPhe(wt) 45.4 6 15 0.23 6 0.01 0.14 0.003

a Calculation of kcatapp and kcatapp/Kmapp assumed that MiaA was fully active as a monomer for both tRNA and ACSLPhe substrates. Theassumption of full activity was a first approximation based on the finding that MiaA was completely active for tRNAPhe and ACSLPhe binding (Fig.5). If MiaA acts catalytically as a dimer for tRNA substrates and a monomer for ACSLPhe substrates as implied by binding studies (see“Discussion”), then kcatapp and kcatapp/Kmapp values will be doubled, except for the ACSLPhe(wt) substrate.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase 13079

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

bound to each intact tRNA molecule at saturation. Consistentwith this interpretation, the predicted molecular mass of aMiaA2ztRNAPhe(wt) complex (100 kDa) matched the 110-kDamolecular mass observed during gel filtration (Fig. 5C). Thediscrepancy between the predicted molecular mass of aMiaA2ztRNAPhe(A37G) complex (100 kDa) and the 63-kDa com-plex observed during gel filtration (Fig. 5E) may indicate dis-sociation of the MiaA2ztRNAPhe(A37G) complex upon dilutionduring gel filtration. In contrast to tRNAPhe(wt) binding, AC-SLPhe(wt) or ACSLPhe(A11G) bound MiaA in a 1:1 molar ratioat saturation (Fig. 9, A and B), suggesting that MiaA boundACSLPhe microhelices as a monomer. This result confirmed theconclusion that the MiaA enzyme preparations were com-pletely active for binding. The predicted molecular mass of a

MiaAzACSLPhe complex (41 kDa) was near that of the 45-kDacomplex observed during gel filtration (above).

Examination of the gels used for the band shift assays fur-ther confirmed a difference in the way tRNAPhe(wt) andtRNAPhe(A37G) bound to MiaA. In ligand excess titrations, theMiaAztRNAPhe(wt) complex formed at lower tRNAPhe(wt) con-centrations (Complex 1, Fig. 8B) had a lower mobility and waspossibly larger than the complex formed at saturation, whichcontained a 2:1 molar ratio of MiaA to tRNAPhe(wt) (Complex 2;Fig. 8B and Fig. 9). In contrast, Complex 1 predominated attRNAPhe(A37G) concentrations as high as 0.5 mM in ligandexcess titrations, whereas Complex 2 appeared and predomi-nated at tRNAPhe(A37G) concentration near saturation (datanot shown).

FIG. 7. Competitive inhibition of MiaA activity by ADP, ATP, and tRNAPhe(A37G). A and B, inhibition of MiaA for DMAPP by ADP andATP, respectively, in the presence of excess (0.08 mM) tRNAPhe(wt). ADP (open symbols) or ATP (closed symbols) were added at the followingconcentrations: crosses, none; triangles, 30 nM; circles, 100 nM; diamonds, 1 mM; squares, 10 mM. Each point is an average of two separatedeterminations. C, inhibition of MiaA for tRNAPhe(wt) by tRNAPhe(A37G) in the presence of excess (4.0 mM) DMAPP. tRNAPhe(A37G) was addedat the following concentrations: crosses, none; triangles, 10 nM; circles, 50 nM; diamonds, 200 nM.

FIG. 8. Representative protein excess and ligand excess titrations of His6-MiaA binding to 32P-labeled tRNAPhe(wt). Band shiftassays were performed as described under “Experimental Procedures.” A, protein excess titration containing 0.8 nM of 32P-labeled tRNAPhe(wt) andthe indicated amounts of His6-MiaA. B, ligand excess titration containing 1.3 mM of His6-MiaA and the indicated amounts of 32P-labeledtRNAPhe(wt). The areas counted as tRNAPhe(wt)zMiaA protein complexes and free tRNAPhe(wt) are indicated.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase13080

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Last, we used the concentration of MiaA at half-saturation inprotein excess titrations of filter binding assays (Fig. 10) toestimate Kd

app '0.07 mM for MiaA binding to tRNAPhe(wt) (46,47, 51). Because of MiaA’s complicated binding behavior(above), this Kd

app(tRNAPhe(wt)) is probably not a simple disso-ciation constant but rather a function of several binding con-stants (e.g. see Ref. 51). Protein excess titrations of band shiftassays (Fig. 8A) gave a Kd

app(tRNAPhe(wt)) '1.0 mM, which wasabout 10-fold greater than that obtained by filter binding. Thishigher Kd

app(tRNAPhe(wt)) may reflect dissociation of complexesduring electrophoresis. Since MiaA bound ACSLPhe(A11G) byan apparently simple (RzP3 R 1 P) mechanism, we estimatedKd(ACSLPhe(A11G)) 5 1.1 mM from ligand excess titrations offilter binding assays (Fig. 9B) (46, 47). The filter bindingmethod failed to detect binding between MiaA and the ACSL-Phe(wt) microhelix, suggesting that ACSLPhe(wt) bound toMiaA with a lower affinity than 1.0 mM.

DISCUSSION

We report here steady-state kinetic and binding studies ofthe E. coli MiaA tRNA prenyltransferase modification enzyme.Only a limited number of tRNA and rRNA modification en-zymes have been purified and studied to date, despite the factthat many different kinds and families of RNA modificationenzymes are present in all cells (3, 4, 9). Biochemical studies ofthese RNA modification enzymes are aimed at understandingthe mechanisms of RNA-protein recognition and catalysis andthe functions and regulation of RNA modification in cells. Theproperties of the MiaA enzyme show similarities and note-worthy differences compared with other purified tRNA mod-ification enzymes, including the E. coli TrmA m5U54-methyl-transferase (51–53), the E. coli TrmD m1G-methyltransfer-ase (54, 55), the E. coli HisT pseudouridine synthase I (56),and the E. coli and Zymomonas mobilis Tgt tRNA-guaninetransglycosylases (57–60).

Similar to the TrmA and Tgt enzymes (51, 58), MiaA canmodify a 17-mer synthetic microhelix stem-loop substrate, inthis case corresponding to the ACSL of tRNAPhe(wt) (Table II).Thus, the minimal recognition elements for the MiaA tRNAprenyl transfer reside in this limited ACSL structure. How-ever, the kcat

app/Kmapp substrate specificity is reduced significantly

by about 17-fold for the ACSLPhe(wt) microhelix compared withintact tRNA molecules (Table II) (or 34-fold if MiaA is catalyt-ically active as a dimer for tRNA and as a monomer for ACS-LPhe(wt) (below; see Table II)). In this regard, MiaA resemblesthe Tgt transglycosylases, whose Vmax

app /Kmapp is 5–10-fold lower

for an ACSLTyr microhelix compared with an intact tRNATyr

substrate (58). In contrast, the TrmA methyltransferase uses aT-loop microhelix as a substrate almost as well as intact tRNA

molecules (reduction of kcatapp/Km

app '2.5-fold; (51)). At the otherextreme, the TrmD methyltransferase depends strongly on in-tact tRNA tertiary structures and does not efficiently modify anACSL microhelix (reduction of Vmax

app /Kmapp '300-fold (54)).

Recently, an attempt was made to classify tRNA modifica-tion enzymes into two families (61). The TrmA methyltrans-ferase and other enzymes that modify the amino acid-acceptingminihelix, which is composed of the acceptor and T-loop micro-helices, generally do not depend on overall tRNA tertiary struc-ture for their activities (61). In contrast, TrmD methyltrans-ferase and other enzymes that modify the anticodon minihelix,which is composed of the anticodon and D-loop microhelices,have been found to strongly depend on intact tRNA three-dimensional structure (see Ref. 61). The exception to this clas-sification scheme is bacterial Tgt transglycosylases, whichmodify ACSL microhelices moderately efficiently (see above)(58, 62) and interact strongly, but not exclusively, with theACSL region of substrate tRNA molecules (57, 63). MiaA alsopresents an exception to the strictest application of this classi-fication scheme. However, the significantly reduced substratespecificity of MiaA for the ACSLPhe(wt) microhelix comparedwith intact tRNAPhe(wt) (Table II) suggests that interactions ofMiaA with regions other than the ACSLPhe are important foroptimal activity. This conclusion is further supported by bind-ing studies discussed below. Compilations of the tRNA mole-cules that contain ms2i6A37 or i6A37 modifications led to aconsensus ACSL that includes possible secondary structure

FIG. 10. Protein excess titrations of filter binding assays con-taining 20 pM 32P-labeled tRNAPhe(wt) and the indicatedamounts of His6-MiaA. Filter soaking and wash solutions eitherlacked (open diamonds) or contained 100 mg of BSA per ml (closeddiamonds, see “Experimental Procedures”). Averages from several in-dependent experiments are shown with standard errors.

FIG. 9. Stoichiometry of MiaA binding to tRNAPhe and ACSLPhe molecules at saturation. A, ligand excess titrations of band shift assayscontaining 1.3 or 0.8 mM of His6-MiaA and the indicated amounts of tRNAPhe(wt) (closed circles) and tRNAPhe(A37G) (open circles) or ACSLPhe(wt)(closed triangles) and ACSLPhe(A11G) (open triangles), respectively. Averages from several independent experiments are shown with standarderrors of the mean (S.E.). B, ligand excess titrations of filter binding assays containing 1.8 or 2.2 mM of His6-MiaA and the indicated amounts oftRNAPhe(wt) (closed circles) or ACSLPhe(A11G) (open triangles), respectively. Binding amounts were corrected using retention efficiencies ('85 or40% for tRNAPhe(wt) or ACSLPhe(A11G), respectively) determined from protein excess titrations (Fig. 10; see “Experimental Procedures”) (46–48).BSA was omitted from filter soaking and wash solutions. Averages of two or more experiments are shown with standard errors.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase 13081

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

and sequence-specific elements required for MiaA recognitionand modification (1, 8). Recent experiments by Y. Motorin andH. Grosjean3 using tRNASer isoaccepting species confirm thatoptimal MiaA activity may depend on primary, secondary, andtertiary interactions within tRNA substrates. The kinetic,binding, and footprinting properties of these and other mutantRNA substrates are currently being determined.

One noteworthy difference between MiaA and other purifiedtRNA modification enzymes is its extremely low Km

app for nativeand synthetic tRNA substrates ('3 nM; Table II). By compari-son, the Km

app of the Tgt transglycosylases, TrmD methyltrans-ferase, and TrmA methyltransferase for synthetic tRNA sub-strates is 2.0, 3.3, and 2.8 mM, respectively (51, 54, 58), whichare about 3 orders of magnitude higher than that of MiaA(Table II). Likewise, the kcat

app or Vmaxapp of MiaA is about 10-fold

greater for synthetic tRNA substrates than that of the TrmAand Tgt enzymes (51, 58). Together, these results show thatMiaA is a comparatively active enzyme with a high apparentaffinity for its tRNA substrates. Consistent with this interpre-tation, the kinetic properties of MiaA for a synthetic, purifiedtRNAPhe(wt) substrate were very similar to those for bulktRNA isolated from a miaA mutant (Table II). Thus, the pres-ence of nonsubstrate, native tRNA molecules in the bulk tRNApreparations did not appreciably inhibit or affect MiaA sub-strate recognition or activity. This behavior contrasts with thepurified HisT pseudouridine synthase (56) and TrmD methyl-transferase,4 which are strongly inhibited by nonsubstratetRNA species. Moreover, the constancy of kinetic properties ofMiaA for synthetic, unmodified tRNAPhe(wt) and hypomodifiedbulk tRNA from a miaA mutant implies that the other modifi-cations present in tRNA molecules do not significantly affectMiaA activity. Transparency to other base modifications intRNA was also documented for the Tgt transglycosylase (62).

We used quantitative Western immunoblotting to determinethat there are about 660 MiaA monomers per cell in bacteriagrowing exponentially in enriched minimal salts/glucose me-dium (Fig. 4). Previously, the cellular amounts of tRNA modi-fication enzymes have been measured only indirectly by com-parisons of specific activities (e.g. see Ref. 64), and thesestudies have led to the generalization that tRNA modificationenzymes are present in few copies per cell (9). To the contrary,our results show that MiaA is a relatively abundant cellularprotein compared with other biosynthetic enzymes (see Ref.41). From the kcat

app of MiaA for tRNA (Table II) and the numberof MiaA monomers per cell, we calculate that the rate of i6A37synthesis can approach 15,400 modifications per min per cell.The equation for the rate of MiaA substrate tRNA synthesis inexponentially growing cells is (65): d(tRNA)/dt 5 ((ln2)/(celldoubling time)) 3 (number of MiaA substrate tRNA moleculesper cell) 5 (ln2/54 min) 3 (198,000 total tRNA molecules 312.9% MiaA substrates (7)) 5 328 MiaA substrate tRNA mol-ecules synthesized per min per cell. Thus, there is about a47-fold excess (15,400/328) of MiaA catalytic capacity in vivo.This calculation makes a number of necessary simplifying as-sumptions, including that MiaA substrates are not limiting invivo, that MiaA activity is not subjected to additional regula-tion (below), and that the in vitro kinetic properties of MiaAcan be extrapolated to the in vivo situation. We estimate thatthe in vivo steady-state concentration of MiaA is about 1.0 mM

in these exponentially growing bacteria (see “Results”). Bycomparison, the steady-state in vivo concentration of MiaAtRNA substrates can be calculated at about 42 mM, Km

app(tRNA)of MiaA '3 nM (Table II), and Kd

app(tRNA) of MiaA '0.07 mM in

the absence of DMAPP (below). Finally, we found that thecellular amount of MiaA was regulated and decreased about3-fold as bacterial cells entered stationary phase (Fig. 4), whichleads to a drop in the rate of tRNA synthesis (66).

Early work indicated that MiaA activity was strongly inhib-ited by unknown compounds in some substrate preparations(37). Overexpression of E. coli tRNAPhe(wt) in E. coli caused theaccumulation of hypomodified tRNA species lacking thems2i6A37 or i6A37 modifications (21), implying that MiaA ac-tivity can be saturated in vivo. We found that MiaA activitywas strongly inhibited by ADP, ATP, and other NTPs (see“Results”; Fig. 7, A and B). This inhibition was classicallycompetitive with the DMAPP substrate (Fig. 7) with a Ki

app ofabout 0.06 mM (Fig. 7, A and B).

The comparatively large cellular amount of MiaA and itshigh activity and substrate affinities are likely needed to over-come inhibition by NTPs and NDPs in vivo. We can estimatethis inhibition by first recalling that the number of MiaA sub-strate tRNA molecules synthesized per min is about 328 (seeabove) '0.54 mM (see “Results”). The Km

app(tRNA) of MiaA '3nM (Table II), so MiaA is saturated for its tRNA substrates. Theinhibition of MiaA catalytic capacity can be calculated from thestandard enzyme inhibition equation (v 5 Vmax

app [S]/([S] 1 Kmapp

(1 1 ([I]/Kiapp))) and will depend on the MiaA kinetic parame-

ters for DMAPP (Table II) and the free, but not total, intracel-lular concentrations of NTPs, NDPs, and DMAPP. To ourknowledge, these free concentrations are not known with cer-tainty for E. coli. Nevertheless, one estimate of [NTP]free is 50mM, based on the Km

app(ATP) of many kinases (67), and the factthat ATP is by far the most abundant nucleotide compound inenterobacterial cells (68). Assuming that [NTP]free 1 [NDP]free

actually approaches 100 mM, then [DMAPP]free would only haveto be about 25 mM to allow MiaA to fully modify newly synthe-sized tRNA substrate molecules. [DMAPP]free '25 mM seemsreasonable, because DMAPP and isopentenyl diphosphate(IPP) are precursors to ubiquinone, which is abundant in E. coli(Fig. 1) (69). Moreover, 25 mM is near the Km

app of IPPzDMAPPisomerases of yeast and other organisms (70). Thus, theamount and kinetic properties of MiaA and its inhibition byNTPs and NDPs seem balanced to just allow full tRNA sub-strate modification.

The competitive inhibition of MiaA by ATP or ADP likelyindicates an important structure-function relationship for thisclass of prenyltransferases. MiaA homologs from several organ-isms lack significant amino acid similarities with other en-zymes that use IPP and DMAPP as substrates, such as theAsp-Asp-Xaa-Xaa-Asp motif (71). MiaA homologs also lack con-served Cys and His residues positioned in possible metal bind-ing motifs (e.g. Ref. 59). On the other hand, they do share anATP/GTP P-loop binding motif, which is also present inAgrobacterium Ti-plasmid-encoded adenine isopentenyl-diphosphate transferases (ipt; tzs) that synthesize the free-baseplant hormone i6A (cytokinin) (19, 34). The conservation of theP-loop motif and the competitive inhibition of DMAPP by NDPsand NTPs suggests that these families of tRNA and adenineprenyltransferases may use the P-loop motif to bind DMAPPinstead of motifs used by other prenyltransferases (71, 72).This hypothesis will be tested in future studies. To our knowl-edge, MiaA is the first example of an RNA modification enzymewhose activity is regulated by compounds other than its sub-strates or products.

In the absence of the DMAPP substrate, MiaA bound towild-type and mutant synthetic tRNAPhe and ACSLPhe sub-strates in a surprisingly complicated way (Figs. 8–10). TheKd

app(tRNAPhe(wt)) of MiaA '0.07 mM (see “Results”; Fig. 10),which was about 11-fold lower than the Kd(ACSLPhe(A11G))

3 Y. Motorin and H. Grosjean, personal communication.4 W. M. Holmes, personal communication.

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase13082

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

(see “Results”). The stoichiometry of binding MiaA to intacttRNAPhe(wt) and tRNAPhe(A37G) was 2:1 at saturation (Fig. 9),whereas it was 1:1 for MiaA binding to ACSLPhe(wt) orACSLPhe(A11G) (Fig. 9). With the exception of the nonphysi-ological mutant tRNAPhe(A37G), these molar binding ratioswere consistent with complex sizes detected by gel filtrationchromatography (see “Results”; Fig. 5). As expectedtRNAPhe(A37G) and ACLS(A11G) were not modified by MiaA,but tRNAPhe(A37G) strongly and competitively inhibited MiaAfor tRNAPhe(wt) with a Ki

app 5 4.2 nM (Fig. 7C). Unexpectedlythe complexes formed between MiaA and tRNAPhe(wt) ortRNAPhe(A37G) at low tRNA to protein ratios were larger(Complex 1; Fig. 8B) than the MiaA2ztRNA dimers formed atsaturation (Complex 2; Fig. 8B and Fig. 9).

The results from gel filtration (Fig. 5), kinetic (Figs. 6 and 7),and binding (Figs. 8–10) experiments can be accounted for by amodel in which MiaA binds to ACSLPhe structures as a mono-mer but binds to intact tRNA molecules as a multimer, eithera dimer with half-site occupancy or a tetramer that dissociatesinto half-site occupied dimers. If intact tRNA molecules bind tothe MiaA multimer preferentially and only bind to the mono-mer at higher tRNA concentrations, then apparent substrateinhibition of MiaA by tRNAPhe(wt) would result (Fig. 6A). Oneattractive feature of this model is that only the correct tRNAsubstrates may bind tightly and possibly in a positively coop-erative way to MiaA multimers. Consequently, the associationstate of MiaA may contribute to the process of distinguishingbetween substrate and nonsubstrate tRNA molecules. Addi-tional studies are needed to test features of this model directly,determine the kinetic order of the modification reaction, andlearn whether DMAPP affects the MiaA association state.

Acknowlegments—We thank Dr. Chyau Liang, John DeMoss, JohnSpudich, George Garcia, William McClain, and members of this labo-ratory for critical comments and helpful discussions about this work.We thank Dr. Youri Motorin and Henri Grosjean for communicatingtheir unpublished work about MiaA recognition elements, and Dr. C.Dale Poulter for information about commercially available substrates.

Note Added in Proof—After submission of this paper, J. A. Moore andC. D. Poulter published an independent purification and characteriza-tion of the E. coli MiaA tRNA prenyltransferase (Moore, J. A., andPoulter, C. D. (1997) Biochemistry 36, 604–614). Their paper, whichlargely complements the work reported here, shows that the order ofsubstrate binding is tRNA then DMAPP. Apparent differences in thetwo studies in certain parameters, such as the Km

app (tRNAPhe) of MiaA,will be resolved by futher experiments.

REFERENCES

1. Tsang, T. H., Buck, M., and Ames, B. (1983) Biochim. Biophys. Acta 741,180–196

2. Sprinzl, M., Hartmann, T., Weber, J., Blank, J., and Zeidler, R. (1989) NucleicAcids Res. 17, 1–172

3. Bjork, G. R. (1996) in Escherichia coli and Salmonella. Cellular and MolecularBiology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Resnikoff, W. S.,Riley, M., Schaechter, M., and Umbarger, H. E., eds) Vol. 1, pp. 861–886,ASM Press, Washington, D. C.

4. Bjork, G. R. (1995) Prog. Nucleic Acid Res. Mol. Biol. 50, 263–3385. Dock-Bregeon, A. C., Westhof, E., Giege, R., and Moras, D. (1989) J. Mol. Biol.

206, 707–7226. Esberg, B., and Bjork, G. R. (1995) J. Bacteriol. 177, 1967–19757. Dong, H., Nilsson, L., and Kurland, C. G. (1996) J. Mol. Biol. 260, 649–6638. Grosjean, H., Nicoghosian, K., Haumont, E., Soll, D., and Cedergren, R. (1985)

Nucleic Acid Res. 13(15), 5697–57069. Bjork, G. R. (1995) in tRNA: Structure, Biosynthesis, and Function (Soll, D.,

and RajBhandary, U., eds) pp. 165–205, ASM Press, Washington, D. C.10. Ericson, J. U., and Bjork, G. R. (1991) J. Mol. Biol. 218, 509–51611. Vacher, J., Grosjean, H., Houssier, C., and Buckingham, R. H. (1984) J. Mol.

Biol. 177, 329–34212. Ericson, J. U., and Bjork, G. R. (1986) J. Bacteriol. 166, 1013–102113. Mikkola, R., and Kurland, C. G. (1988) FEMS Microbiol. Lett. 56, 265–27014. Petrullo, L. A., Gallagher, P. J., and Elseviers, D. (1983) Mol. Gen. Genet. 190,

289–29415. Diaz, I., and Ehrenberg, M. (1991) J. Mol. Biol. 222, 1161–117116. Hagervall, T. G., Ericson, J. U., Esberg, K. B., Li, J., and Bjork, G. R. (1990)

Biochim. Biophys. Acta 1050, 263–26617. Bouadloun, F., Srichaiyo, T., Isaksson, L. A., and Bjork, G. R. (1986) J.

Bacteriol. 166, 1022–102718. Bjornsson, A., and Isaksson, L. A. (1993) J. Mol. Biol. 232, 1017–1029

19. Connolly, D. M., and Winkler, M. E. (1991) J. Bacteriol. 173, 1711–172120. Harrington, K. M., Nazarenko, I. A., Dix, D. B., Thompson, R. C., and

Uhlenbeck, O. C. (1993) Biochemistry 32, 7617–762221. Wilson, R. K., and Roe, B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 409–41322. Tsui, H. C. T., Leung, H. C. E., and Winkler, M. E. (1994) Mol. Microbiol. 13,

35–4923. Connolly, D. M., and Winkler, M. E. (1989) J. Bacteriol. 171, 3233–324624. Burdett, V. (1993) J. Bacteriol. 175, 7209–721525. Tsui, H.-C. T., Feng, G., and Winkler, M. E. (1996) J. Bacteriol. 178,

5719–573126. Buck, M., and Griffiths. (1982) Nucleic Acids Res. 10, 1609–262427. Gefter, M. L., and Russell, R. L. (1969) J. Mol. Biol. 39, 145–15728. Yanofsky, C., and Soll, L. (1977) J. Mol. Biol. 113, 663–67729. Eisenberg, S. P., Yarus, M., and Soll, L. (1979) J. Mol. Biol. 135, 111–12630. Gollnick, P., and Yanofsky, C. (1990) J. Bacteriol. 172, 3100–310731. Landick, R., Yanofsky, C., Choo, K., and Phung, L. (1990) J. Mol. Biol. 216,

25–3732. Caillet, J., and Droogmans, L. (1988) J. Bacteriol. 170, 4147–415233. Tsui, H.-C. T., and Winkler, M. E. (1994) Biochimie (Paris) 76, 1168–117734. Gray, J., Wang, J., and Gelvin, S. B. (1992) J. Bacteriol. 174, 1086–109835. Dihanich, M. E., Najarian, D., Clark, R., Gillman, E. C., Martin, N. C., and

Hopper, A. K. (1987) Mol. Cell. Biol 7, 177–18436. Zoladek, T., Vaduva, G., Hunter, L. A., Boguta, M., Go, B. D., Martin, N. C.,

and Hopper, A. K. (1995) Mol. Cell. Biol. 15, 6884–689437. Rosenbaum, N., and Gefter, M. L. (1972) J. Biol. Chem. 247, 5675–568038. Bartz, J. K., Kline, L. K., and Soll, D. (1970) Biochem. Biophys. Res. Commun.

40, 1481–148739. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith,

J. A., and Struhl, K. (eds) (1996) Current Protocols in Molecular Biology,John Wiley and Sons, New York

40. Feng, G., and Winkler, M. E. (1995) Biotechniques 19, 956–96541. Zhao, G., and Winkler, M. E. (1995) J. Bacteriol. 177, 883–89142. Sampson, J. R., and Uhlenbeck, O. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,

1033–103743. Milligan, J. F., and Uhlenbeck, O. C. (1989) Methods Enzymol. 180, 51–6244. Tipton, K. F. (1992) in Enzyme Assays. A Practical Approach (Eisenthal, R.,

and Danson, M. J., eds) pp. 1–58, IRL Press, Oxford45. Feng, G., Tsui, H. C. T., and Winkler, M. E. (1996) J. Bacteriol. 178,

2388–239646. Riggs, A. D., Suzuki, H., and Bourgeois, S. (1970) J. Mol. Biol. 48, 67–8347. Klig, L. S., Crawford, I. P., and Yanofsky, C. (1987) Nucleic Acids Res. 15,

5339–535148. Witherell, G. W., and Uhlenbeck, O. C. (1989) Biochemistry 28, 71–7649. Peterson, E. T., and Uhlenbeck, O. C. (1992) Biochemistry 31, 10380–1038950. Saraste, M., Sibbald, P. R., and Wittinghofer, A. (1990) Trends Biochem. Sci.

15, 430–43451. Gu, D., Ivanetich, K. M., and Santi, D. V. (1996) Biochemistry 35, 11652–1165952. Gu, X., and Santi, D. V. (1991) Biochemistry 30, 2999–300253. Kealey, J. T., and Santi, D. V. (1995) Biochemistry 34, 2441–244654. Holmes, W. M., Andraos-Selim, C., Roberts, I., and Wahab, S. Z. (1992) J. Biol.

Chem. 267, 13440–1344555. Holmes, W. M., Andraos-Selim, C., and Redlak, M. (1995) Biochimie (Paris) 77,

62–6556. Kammen, H. O., Marvel, C. C., Hardy, L., and Penhoet, E. E. (1988) J. Biol.

Chem. 263, 2255–226357. Romier, C., Reuter, K., Suck, D., and Ficner, R. (1996) EMBO J. 15, 2850–285758. Curnow, A. W., and Garcia, G. A. (1995) J. Biol. Chem. 270, 17264–1726759. Chong, S., Curnow, A. W., Huston, T. J., and Garcia, G. A. (1995) Biochemistry

34, 3697–370160. Garcia, G. A., Koch, K. A., and Chong, S. (1993) J. Mol. Biol. 231, 489–49761. Grosjean, H., Edqvist, J., Straby, K. B., and Giege, R. (1996) J. Mol. Biol. 255,

67–8562. Curnow, A. W., Kung, F., Koch, K. A., and Garcia, G. A. (1993) Biochemistry

32, 5239–534663. Mueller, S. O., and Slany, R. K. (1995) FEBS Lett. 361, 259–26464. Hjalmarsson, K. J., Bystrom, A. S., and Bjork, G. R. (1983) J. Biol. Chem. 258,

1343–135165. Bremer, H., and Dennis, P. P. (1987) in Escherichia coli and Salmonella

typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Ingraham,J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, H. E., eds)pp. 1527–1542, ASM Press, Washington, D. C.

66. Huisman, G. W., Siegle, D. A., Zambrano, M. M., and Kolter, R. (1996) inEscherichia coli and Salmonella typhimurium: Cellular and MolecularBiology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Lin, E. C. C., Low, K.B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., andUmbarger, H. E., eds) 2nd Ed., pp. 1672–1682, ASM press, Washington,D. C.

67. Neidhardt, F. C., Curtis, R., Ingraham, J. L., Resnikoff, W. S., Riley, M.,Schaechter, M., and Umbarger, H. E. (eds) (1996) Escherichia coli andSalmonella typhimurium: Cellular and Molecular Biology 2nd Ed., ASMPress, Washington, D. C.

68. Bochner, B. R., and Ames, B. N. (1982) J. Biol. Chem. 257, 9759–976969. White, R. H. (1996) in Escherichia coli and Salmonella typhimurium: Cellular

and Molecular Biology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Lin, E.C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M.,and Umbarger, H. E., eds) 2nd Ed., pp. 637–641, ASM Press, Washington,D. C.

70. Street, I. P., and Poulter, C. D. (1990) Biochemistry 29, 7531–753871. Song, L., and Poulter, C. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,

3044–304872. Tarshis, L. C., Yan, M., Poulter, C. D., and Sacchettini, J. C. (1994) Biochem-

istry 33, 10871–10877

Kinetic and Binding Properties of MiaA tRNA Prenyltransferase 13083

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Hon-Chiu Eastwood Leung, Yuqing Chen and Malcolm E. WinklerK-12 Escherichia coliModification Enzyme of

Regulation of Substrate Recognition by the MiaA tRNA Prenyltransferase

doi: 10.1074/jbc.272.20.130731997, 272:13073-13083.J. Biol. Chem. 

  http://www.jbc.org/content/272/20/13073Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/272/20/13073.full.html#ref-list-1

This article cites 65 references, 23 of which can be accessed free at

by guest on March 17, 2020

http://ww

w.jbc.org/

Dow

nloaded from