To Degrade or Not to Degrade: Substrate Recognition by Lon Protease
description
Transcript of To Degrade or Not to Degrade: Substrate Recognition by Lon Protease
To Degrade or Not to Degrade: Substrate Recognition by Lon
Protease
Amy Dinh
Department of Microbiology
Mentor: Janine E. Trempy, Ph.D.
Protein Misfolding Diseases
normal protein abnormal protein
protein aggregate
Treatment Issues
• Aggregates cause disease or caused by disease
• Cause of abnormal proteins?
• Result of malfunction of related protein?
ADDL aggregates (yellow) coating a neuron in Alzheimer’s Disease. Scientific American
Studying Human Lon with E. coli
• lon
– ATP dependent protease
– highly conserved in evolution
– four known substrates in E. coli
– NO known substrates in humans
Aims
• Study how E. coli Lon interacts with its substrates
• Help identify human Lon substrates
• Substrates with effects on central nervous system
• Identify relationship between CNS substrates and abnormal proteins
Research Methods
• E. coli Lon interactions with two substrates– RcsA– SulA
• Control physiological effects
• Clear phenotypes
RcsA– transcriptional activator of capsular polysaccharide genes
(mucoidy)
lon-lon+
RcsA intiates CPS transcription
RcsA initiates CPS transcription
Lon degrades RcsA RcsA not degraded
Non-mucoid cell Mucoid cell
SulA• SulA (SOS gene)
– halts cell division – filament formation
Cells exposed to MMS/UV
SulA causes filament formation
SulA degraded (lon+) SulA not degraded ((lon-)
Filaments resolved into new cells Cell death
Prior Research
RcsA
SulA
SulA
RcsA
Competition Hierarchy
Proteolytic Binding Site
Lon Domains
369
679
Ser
411 421351
ATP Binding Site
C-terminus
Proteolytic Bindng Site
aa residue #211-271
Met
7831
N-terminus velcro domain
RcsA recognition Site
SulA recognition Site?
Making Mutants
• Mutagenesis– K11 and Tll strains
– Contain antibiotic resistance gene linked to lon
– methylating agent: nitrosoguanidine (NTG)
– Generation of random point mutations
GCATTGCGGGGCTATCGGTCACACTGCATCGTCATCGAATCGGGCGCGCCCTGATTGACGTAACGCCCCGATAGCCAGTGTGACGTAGCAGTAGCTTAGCCCGCGCGGGACTAACT
Making Mutants
100/0
45
50
75
Tetr / Kanr
11 minutes
10 minuteslon
• DNA Packaging– P1vir Lysates– P1vir Bacteriophage– ~100 kb (20 genes)
Making Mutants
• Transduction– Infection of healthy E. coli with P1vir
Infection Recombination
tetr/ kanr
mutated lon
normal lon
E.coli P1 vir
tetr/ kanr
mutated lon
normal lon
P1 virE.coli
Making Mutants
• Requires several phases of screening– 1. Selection for mutations on lon
• Mutant behavior re: RcsA
Screening for Mutants
100/0
45
50
75
Tetr / Kanr
11 minutes
10 minuteslon
• Limited DNA capacity
Screening for Mutants
• Requires several phases of screening– 1. Selection for mutations on lon
• Mutant behavior re: RcsA
– 2. Screening using temperature selection
Temperature Selection Hypothesis
• Low temperatures• Protein folding normal• Wild type behavior
• High temperatures• Abnormal protein
folding• Mutant behavior
Screening for Mutants
• Requires several phases of screening– 1. Selection for mutations on lon
• Mutant behavior re: RcsA
– 2. Screening using temperature selection– 3. Screening using temperature selection and
MMS• Mutant behavior re: SulA
Mutant Classes
• I: Lon defective with RcsA
Normal cells Mucoid
Mutant Classes
• II: Lon defective with SulA
Normal CellFilamentation/
Cell Death
On MMS at 42º
• III: Lon defective with RcsA and SulA
Mutant Classes
Normal cells Mucoid On MMS at 42º
Cell Death
Mutant Classes
• IV: Lon Gone Wild
Normal Cell Cell Death
At 42º
Mutants Isolated
• 8 Class I Mutants– Lon Defective with RcsA
• 3 Class II Mutants– Lon Defective with SulA– Intermediate MMS sensitivity
• 2 Class IV Mutants– Lon Gone Wild– Validates Temperature Selection Hypothesis
Next Steps
• Mutant Verification/Identification– Presence of Lon/RcsA/SulA
• Western Blot
– Amplify lon using PCR – Sequence DNA– Compare Mutant Sequence with E. coli lon
sequence
Why Bother?
• Learn how Lon selects its substrates in E. coli
• A model for Lon in humans
• Help identify Lon substrates in humans
• Understand more about age-related protein misfolding diseases
Acknowledgements
• Dr. Janine Trempy
• Howard Hughes Medical Institute
• HHMI Selection Committee
• Undergraduate Research, Innovation, Scholarship and Creativity (URISC) Program
• URISC Selection Committee