Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C

j ourna l homepage: www.e lsev ie r.com/ locate /cbpc

Glutathione S-transferase in the white shrimp Litopenaeus vannamei:Characterization and regulation under pH stress

Jun Zhou, Wei-Na Wang ⁎, An-Li Wang ⁎, Wen-Yin He, Qi-Ting Zhou, Yuan Liu, Jie XuKey Laboratory of Ecology and Environmental Science in Guangdong Higher Education, College of Life Science, South China Normal University, Guangzhou 510631, PR China

⁎ Corresponding authors. Tel./fax: +86 20 8521 7322E-mail addresses: weina63@yahoo.com.cn (W.-N. W

(A.-L. Wang).

1532-0456/$ – see front matter © 2009 Elsevier Inc. Adoi:10.1016/j.cbpc.2009.04.012

a b s t r a c t

a r t i c l e i n f o

Article history:Received 17 February 2009Received in revised form 25 April 2009Accepted 26 April 2009Available online 5 May 2009

Keywords:Litopenaeus vannameiGSTpH challengeQuantitative real-time PCRWestern blot

We first expressed a Mu-class GST from white shrimp Litopenaeus vannamei in Escherichia coli, and thencharacterized the purified recombinant enzyme with respect to the effects of pH, temperature on its catalytic(1-chloro-2, 4-dinitrobenzene-glutathione conjugation) activity. We also analyzed its expression profile in L.vannamei tissues, and assessed changes in Mu-GST expression, GST activity profiles and mortality ratesfollowing exposure of white shrimp to low and high pH (5.6 and 9.3, respectively). Realtime-PCR analysisshowed that Mu-GST transcripts were expressed in all examined L. vannamei tissues, but were mostabundant in the hepatopancreas. At low pH Mu-GST transcript levels in the hepatopancreas were highestafter 12 h, and then declined to their original levels after 24 h. After 12 h they were also upregulated inhaemocytes, but downregulated in the gills, and unchanged in the stomach following exposure to pH stress.Western blot analyses confirmed that the Mu-GST protein was strongly expressed in the hepatopancreasafter 12 h at low pH and remain unchanged in the stomach after exposure to pH stress. pH-Related changes inGST activities in the shrimp hepatopancreas were similar to those displayed by the Mu-GST mRNA andprotein profiles. In addition, the mortality of L. vannamei was higher at high pH than at low pH. These resultssuggest that L. vannamei Mu-GST expression is stimulated by acidic pH and that it may play important rolesin detoxification of xenobiotics and antioxidant defenses.

© 2009 Elsevier Inc. All rights reserved.

1. Introduction

White shrimp Litopenaeus vannamei is naturally distributed alongthe Pacific coast of Central and South America, which has become theprimary economic species currently being cultured in Southeast Asiancountries. As one of the most important economic species inworldwide shrimp farming, L. vannamei has received increasingattention in recent years (Rosenberry, 2002; Chiu et al., 2007).

Environmental stress factors (including pH) may affect the ability tomaintain homeostasis and the metabolism, growth, survival, osmoticcapacity and immune system of penaeid shrimp, such as L. vannamei,and other crustaceans. Hence, changes in abiotic environmentalvariables may increase their vulnerability to bacteria normally presentin aquaculture ponds, leading to severe outbreaks of infectious diseasesand significant economic losses in the shrimp farming industry (Lavilla-Pitogo et al., 1998; Bachère, 2000; Le Moullac and Haffner, 2000;Lightner et al., 2006). Several authors have reported that variations inpHcan also be acutely toxic to decapod crustaceans, resulting in reductionsin rates of survival andgrowthamong them, sometimes accompaniedbyserious diseases or even mass death (Distefano et al., 1991; Wang et al.,

.ang), wangwn@scnu.edu.cn

ll rights reserved.

2002; Chen and Chen, 2003b; Li and Chen, 2008). Further, variations inpH inevitably occur in intensive aquaculture systems, notably the sludgeis generally deeper and more organic matter accumulates in the innerareas, hence the pH is generally lowest in the bottom water of innerparts. The sediments that penaeid shrimp reared in earth ponds areexposed to can also, in some instances, induce stress (Delgado et al.,2003; Lemonniera et al., 2004).

Glutathione-S-transferases are a family of dimeric multifunctionalenzymes that have been shown to be involved in: detoxification ofxenobiotics, protection from oxidative damage, and the intracellulartransport of hormones, endogenous metabolites and exogenouschemicals in diverse organisms (Eaton and Bammler, 1999; Sheehanet al., 2001; Frova, 2006; Goto et al., 2009).Most studies on theseenzymes in invertebrates have focused on insects, in which GSTs playroles (inter alia) in insecticide resistance and are often induced byplant chemicals and other xenobiotics (Tang and Tu, 1994; Brogdonand McAllister, 1998; Hemingway, 2000; Hemingway and Ranson,2000; Ranson et al., 2001). GSTs are expressed in insects at high levels,in multiple isoenzyme forms and exhibit different patterns at variousdevelopmental stages (Yu, 1996; Zhou and Sylvanen, 1997; Feng et al.,1999). GST activities have also been measured in, and GSTs have beenpurified from, a fewmarine invertebrates (Nies et al., 1991; Fitzpatricket al., 1995; Adewale and Afolayan, 2004; Contreras-Vergara et al.,2004, 2007), but there is very little information on the molecularcharacteristics of GSTs in these organisms. In the study presented here

Table 1PCR primers for fragment cloning and quantitative real time PCR amplification of genesof the LvGST and β-actin genes of the Pacific white shrimp, Litopenaeus vannamei.

Primer set Sequence(5′→3′) Position Product(bp) GenBank

Lv-GST-F AGAGGATGCTGCCCGTTTTAG 17–776 760 AY573381Lv-GST-R CTTGACCCCGGTTCTTCACATβ-actinF CCGCCCTTTTAGTAAAACA 58–1282 1225 AF300705β-actinR GCCGAATCCTTATCCTAATGG

For realtimeLv-GST-Fr AAGATAACGCAGAGCAAGG 210–355 146 AY573381Lv-GST-Rr TCGTAGGTGACGGTAAAGAβ-actinFr GCCCATCTACGAGGGATA 522–642 121 AF300705β-actinRr GGTGGTCGTGAAGGTGTAA

225J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

we examinedGSTexpression and activity profiles at near-neutral, highand low pH in L. vannamei.

However, crustaceans (like all organisms) have arrays of defensesystems that enable them to meet diverse environmental challengesand, as mentioned above, GSTs are important components of variousdetoxification, antioxidant and stress-tolerance pathways. Since theyprotect against injury induced by environmental chemicals, they havealso been used as biomarkers to estimate exposure in aquatic organisms(Amado et al., 2006; Van der Oost et al., 2003). Thus, we hypothesizedthat their activities in overall stress mitigation in L. vannameimay offerinsights into general adaptive and defense responses of L. vannamei andsimilar species. Therefore, in this study, we expressed a Mu-class GST-encoding gene from L. vannamei (LvGST-M) in a prokaryotic expressionsystem (Escherichia coli), and purified the resulting recombinant LvGST-M protein. The identity of the recombinant LvGST was confirmed byaffinity-purification and enzyme activity assays, then various biochem-ical properties of the recombinantproteinwere evaluated. In addition, toassess the role of GSTs in detoxification/stress tolerance processes inmarine invertebrates, we investigated Mu-GST expression patterns andtotal GST activities in selected white shrimp tissues, and the effects ofexposure to pH stress (acidic and alkaline) on the shrimp and their GSTprofiles.

2. Materials and methods

2.1. Animals

Shrimp (L. vannamei), 6.86±0.39 cm long and weighing 3±0.53 g,were obtained from a local shrimp farm in Panyu (Guangdong, China)and reared in 20m3 cycling filtered fiberglass tanks inwhich the salinity(10‰) and temperature (20–22 °C) weremaintained at the same levelsas in standard shrimp culture ponds. Prior to experimental use, animalswere acclimated to the laboratory conditions for a week, and fed twicedaily with commercial shrimp feed until 24 h before the experimentaltreatments began, when feeding ceased.

2.2. pH challenge experiment

To assess the effects of pH on the shrimp and their GST profiles, 18plastic aquaria (50×35×30 cm, water volume 52 L) containing 10‰saltwater (pH 7.4) were prepared, and approximately 40 shrimp wereplaced in each aquarium. The pH was then raised to 9.3 in six aquariaby the gradual addition of 1 mol/L each of Na2CO3 and NaHCO3, andreduced to 5.6 in another set of six by adding 1 mol/L HCl. Over thefollowing day the pH was monitored, using a 228573-A01 pHelectrode (Orion Research Inc., Beverly, MA, USA) attached to anOrion320 pHmeter, and the shrimp's survival rates weremonitored ineach set of aquaria and sets of shrimp were harvested for the GSTprofiling at various time-points (0, 3, 6, 12 and 24 h). The pH testswere conducted according to our previous study (Zhou et al., 2008).

2.3. Hemolymph pH measurement

After 12 h of the pH treatments, hemolymphwas collected from 20shrimp subjected to each pH treatment and its pH was determined byinjecting 85 μL immediately into a pH/blood gas analyzer (Model ABL-5, Radiometer International A/S, Denmark) with the thermostat set to37 °C, and the values obtained were automatically adjusted tocorresponding values at 27 °C following the manufacturer's instruc-tions (Chen and Chen, 2003a).

2.4. RNA extraction

The hepatopancreas was collected from sets of four shrimprepresenting each of the pH-challenged groups and the control groupafter 0, 3, 6, 12 and 24 h of exposure, and the haemocytes, gills and

stomachs were also collected from the shrimp harvested after 0 and12 h. The sampled tissues were immediately ground in liquid nitrogen,and stored at −80 °C. Total RNA was then extracted from the samples,using Trizol (Invitrogen) following themanufacturer's instructions, andpreserved at −80 °C for quantitative real-time PCR. The purity of theRNA samples was verified by measuring their absorbance at 260 and280nmusing anND-1000 spectrophotometer (NanoDrop Technologies,USA) and its integrity was confirmed by 1% agarose electrophoresis.

2.5. Reverse transcription (RT)-PCR and subcloning

Single strand cDNA was transcribed from poly(A)RNA of thehepatopancreas, haemocytes, gills and stomachs RNA samples byincubating 2 μg of total RNA per sample with 100 U of M-MLV reversetranscriptase (Promega, Madison, WI, USA) at 42 °C for 90 min with20 μMoligo-d (T)18 primers, 2×RT buffer,10mMof each dNTP and 20Uof RNase inhibitor (Takara, Dalian, China) in 25 μL reactionmixtures. TheORFs (open reading frames) of the target genes were amplified withspecific primers based on L. vannamei mRNA sequences acquired fromNCBI (Genbank accession nos. AY573381 and AF300705, respectively;Table 1), and cloned into the pMD-20 T vector to establish standardcurves. (Wang et al., 2007; Zhou et al., 2008).

2.6. Quantitative real-time PCR assays after exposure to pH stress

Single strand cDNA, synthesized as described above, from the totalRNA prepared from the sampled hepatopancreas, haemocytes, gills andstomachs, was prepared and stored at −20 °C until used for real-time-quantitative PCR (qRT-PCR) analysis of GST and β-actin expression inthese tissues, using the specific primers (Lv-GST-Fr & Lv-GST-Rr for GSTand β-actinFr & β-actinRr for β-actin) shown in Table 1. Gene expressionwas assessed by SYBR Green quantitative real-time PCR (Takara), in anABI7300 real-time PCR machine (Applied Biosystems, Foster city, CA,USA), with a program consisting of 95 °C for 10 s, followed by 40 cycles of95 °C for 5 s, 60 °C for 31 s. The amplificationproducts obtained fromeachPCR reaction were subjected to melting curve analysis to confirm thatsingle PCR products had been amplified and detected. Relative quantita-tion resultswerenormalizedwithL. vannameiβ-actin as internal standardand analyzed by a combination of absolute and relative quantitationmethod (Wang et al., 2007; Asazuma et al., 2007; Zhou et al., 2008).

2.7. Expression and purification of recombinant protein

The plasmid DNA (pMD-20 T vector) containing the shrimp Mu-GST ORF was digested with BamHI and HindIII, then sub-cloned intothe expression vector pProEX HT-b (Invitrogen) previously cut withthe same restriction enzymes. The ligated product was transformedinto DH5α cells, and the success of the ligation was confirmed bycolony cracking, restriction enzyme digestion and sequencing. Theexpression construct was designated pProEX HT-b/LvGST-M.

The recombinant L. vannamei Mu-GST was then over-expressed inE. coli DH5α cells by induction with isopropyl-β-thiogalactopyranoside

Fig. 1. The change in survival of white shrimp, L. vannamei at 0, 12, 18 and 24 h afterexposure to acidic pH (pH 5.6) and alkaline pH (pH 9.3), pH 7.4 was set as control group.The diagrams show the percent surviving shrimp after stimulation with different pH.Each panel shows a separate set of experiments, with two repetitions for eachtreatment.

Fig. 3. Determination of optimal temperature for recombinant LvGST-M enzymaticactivity. The enzymes were incubated in PBS (pH7) at temperatures ranging from 5 to95 °C for 30 min, and the resulting activities are shown relative to the maximal activity(at 15 °C). Experiments were replicated three times.

226 J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

(IPTG). After incubation at 37 °C for a further 4 h, the bacterial cells wereharvested by centrifugation at 8000 ×g for 10 min at 4 °C, re-suspendedin 50 mM phosphate buffered solution (PBS, pH 8.0) containing 0.3 MNaCl and 10 mM imidazole, and sonicated on ice. The cell debris wasremoved by centrifugation at 15,000 ×g for 20min, and the supernatantwas collected. The recombinant LvGST was then purified using aglutathione sepharose 4B affinity chromatography system from Amer-sham Pharmacia Biotech (Piscataway, NJ, USA) following the manufac-turer's protocol (Feng et al., 1999). The purified recombinant GST wasused for analysis by SDS-PAGE and protein concentrations weredetermined by the method of Bradford (1976) using bovine serumalbumin as a standard.

2.8. Analysis of enzymatic activity and biochemical properties ofrecombinant Lv-GST

Recombinant Lv-GST activity was analyzed according to Habiget al. (1974). Briefly, 25 μL portions (at least triplicates) of each dilutedsample were mixed with 1.4225mL of 100 mM PBS (pH 6.5) and 15 μLof 100 mM GSH. After pre-incubation at 25 °C for 5 min, 37.5 μL of40 mM CDNB was added to the mixture, and then the absorbance(OD) at 340 nm was measured every 30 s. Controls were similarlyprocessed, except that the purified samples were replaced by equalvolumes of eluted buffer. To characterize the recombinant LvGST-Mu,its enzymatic (CDNB-conjugating) activity was evaluated at tempera-

Fig. 2. Expression and purification of recombinant GST fusion protein. (a)Vector controlcrude extract, expressed LvGST-M crude extract and purified recombinant LvGST-Mprotein were separated by 12% SDS-PAGE and stained with Coomassie Brilliant Blue.(b) Western blotting with anti-GST-M polyclonal antibodies. M, Prestained protein sizemarkers (Fermentas); 1, vector control from E. coli DH5α; 2, crude extract from E. coliDH5α inducedwith 1mM IPTG and grown at 37 °C for 4 h; 3, purified recombinant LvGSTfusion protein.

tures ranging from 5 to 95 °C at 10 °C intervals (at pH 7), and pHranging from 5 to 10 at 1.0 pH intervals (at 25 °C), using acetate,phosphate, Tris–HCl, glycine–NaOH buffers to adjust the pH of thereaction mixture to 5, 6–7, 8–9 and 10, respectively. (Yao et al., 2004;Yamamoto et al., 2007).

2.9. Polyclonal antibody preparation and Western blotting

The purified recombinant L. vannamei GST was used to raiseantibodies in a New Zealand white rabbit. Approximately 1 mg of thepurified rm-GST was emulsified with Freund's complete adjuvant andinjected subcutaneously at multiple sites of the rabbit, and threebooster injections of 1.5 mg antigen (0.5 mg each time) mixed withFreund's incomplete adjuvant were subsequently administered sub-cutaneously at intervals of three weeks. Eight days after the finalbooster, blood was collected and serumwas prepared. Serum from thesame rabbit collected prior to immunizationwas used as a control. Theantisera were aliquoted and stored at −80 °C.

Shrimp hepatopancreas, haemocytes, gills and stomachs sampledafter 12 h pH treatment were each homogenized in 5 mL of 50 mMTris–HCl (pH 7.2) with 50 mM NaCl on ice, and centrifuged at10,000 ×g for 20 min at 4 °C (5 min each time). The resultingsupernatants were collected, and portions containing ca. 30 μg ofprotein (measured as described above) were loaded in separate lanesof a 12% SDS-PAGE gel, and electrophoretically separated. The gelswere thenwashed for 15min in 20mMPBS containing 0.1% Tween-20,and proteins in the gels were blotted onto a nitrocellulose membrane(Hybond, Amersham Pharmacia). Blotted membranes were incubated

Fig. 4. Determination of optimal pH for LvGST-M enzymatic activity. The enzyme wasincubated in solutions containing 50 mM of acetate (pH 5), phosphate (pH 6 and 7),Tris–HCl (pH 8 and 9), and glycine (pH 10) buffers for 5 min, its activity was thenassayedwith 1mMCDNB and 1mMGSH as substrates at 25 °C, and is expressed relativeto the maximal activity (at pH 7). Experiments were replicated three times.

Fig. 5. Expression of LvGST-M protein in the hepatopancreas (HAGSTM) and stomach(SGSTM)ofwhite shrimp Litopenaeus vannamei at 0h (Control) and12hof thepH treatment(pH 5.6, pH 7.4, pH 9.3). Thirty micrograms of protein were loaded into each lane.

227J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

in 20 mM PBS containing 3% BSA at 4 °C overnight, and then in therabbit anti-sera diluted 1:800 with 20 mM PBS containing 0.1%Tween-20 for 1 h. After washing in 20 mM PBS, the membranes wereincubated with peroxidase-conjugated anti-rabbit antibody diluted1:2000 at 25 °C for 1 h, then bands were visualized using DAB and0.03% H2O2 (Feng et al., 1999).

2.10. Glutathione transferase (GST) activity in tissue assays

Hemolymph was drawn directly from the hearts of the shrimpsampled 0 and 12 h post-challenge using a 1mL glass syringe, then theremaining hepatopancreas and gills were frozen immediately in liquidnitrogen and homogenized in nine volumes of 20 mM phosphatebuffer (pH 7.4), 1 mM EDTA and 0.1% Triton X-100, the homogenates

Fig. 6. (a) Quantitative real-time PCR analysis of glutathione S-transferase expression inwhitexpression in haemocytes, gills and stomachs of pH-challenged shrimp by real-time PCR at 0 amRNA/β-actin mRNA). Significant differences (Pb0.05) in GST expression between the chdifferences (Pb0.05) in GST expression between challenged and untreated shrimp (0 h) adeviation), n=4. All real-time reactions were performed in duplicate and with four shrimp

were centrifuged at 800 ×g, to remove debris, and the resultantsupernatants and collected hemolymph were used directly forenzyme assays (Wang et al., 2006; Mohankumar and Ramasamy,2006). The GST activity was measured by the method of Habig et al.(1974). The protein concentrations of the homogenates weredetermined using the Coomassie Brilliant Blue dye binding technique(Bradford, 1976) with bovine serum albumin (BSA) as the standard.

2.11. Statistical analysis

Quantitative data and GSTs activities assay results were expressedas means±SD (standard deviation). Statistical differences wereestimated by two-way ANOVA followed by Duncan's multiple rangetests; the significance level was set at P=0.05. All statistics wereperformed using SPSS 13.0 (SPSS, Chicago, IL, USA).

3. Results

3.1. Effects of external pH on survival and hemolymph pH

In the aquaria maintained at pH 7.4, all shrimp survived for the 24-h pH challenge period. After 12 h of the pH treatments, significantlymore shrimp exposed to pH 9.3 had died (Pb0.05) than those exposedto pH 5.6 (Fig.1). Subsequently, alkaline pH result in 55% of shrimp dieat 18 h post-challenged. The shrimp placed in pH 5.6 and pH 9.3 for24 h experienced almost the samemortality. Totally, it was 65 and 35%for shrimp acclimated to pH 5.6 and pH 9.3, respectively (Fig. 1), andwas significantly lower (Pb0.05) than at pH 7.4.

e shrimp hepatopancreas 0, 1.5, 3, 6, 12, 24 h after pH challenge. (b–d) Analysis of GST-Mnd 12 h post-challenge, respectively. Values shown are relative expression levels (targetallenged and control groups (pH 7.4) are indicated by the letters (a, b, c). Significantre indicated by asterisks. Each bar indicates the corresponding mean±SD (standardper time point and pH.

228 J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

The hemolymph pH of control shrimp ranged from 7.70 to 7.73 withan average of 7.72±0.02. After exposure to acidic and alkaline pH for12h, the shrimphemolymphpHhaddecreased significantly (Pb0.05) to7.58±0.03 and sharply risen, to 7.82±0.04 (Pb0.05), respectively.

3.2. Characterization of recombinant LvGST and antibody specificity

The purified recombinant LvGST-M with the His6 tag yielded asingle band of 29 kDa on SDS-PAGE gels after Coomassie blue staining(Fig. 2), and the recombinant LvGST-M showed catalytic activity(3.68±0.15 μmol/min/mg) toward CDNB. The specific activities ofrecombinant LvGST-M has been reported in another study (Contreras-Vergara et al., 2008) but the value (419.3±47.4 μmol/min/mg) are over100 times higher than that are reported in our study.

The percentage enzymatic activity relative to the maximal activity(at 15 °C) is plotted as a function of the reaction temperature (°C) inFig. 3. The relative activity decreased slightly from 15 to 45 °C, thensharply from 45 to 95 °C. With respect to pH, the activity was maximal(designated 100%) at pH 7, high at pH 8 (75%), lowest at pH 5, andmoderate at pH 6, 9 and 10 (Fig. 4).

Rabbit antiserum was obtained against the purified recombinantLvGST-Mwith a titre of 1:600, which reacted inWestern analysis with aconstituent (apparent molecular weight, 29 kDa) of the supernatant ofthe cell lysate of IPTG-induced E. coli DH5α carrying the expressionvector, but not with any constituents of a corresponding preparation ofE. coliDH5α containing the expression vector prior to induction by IPTG(Fig. 2). The antiserum was also reactive with a constituent (apparentmolecular weight ca. 25 kDa, corresponding to the molecular masspredicted for LvGST cDNA) of the shrimp hepatopancreas and stomachhomogenates, (Fig. 5). These findings show that the rabbit antiserumhad marked antigen-specific reactivity.

3.3. LvGST-Mu mRNA and protein expression after exposure to pH stress

The GST-Mu was found to be expressed in all tested tissues, but moststrongly in hepatopancreas (Fig. 6a, b, c and d). In the pH 5.6-exposedshrimp, the GST-Mu transcript level in the hepatopancreas significantlyincreased from 6 h onward and peaked at 12 h, relative to controls, thendeclined to original levels at 24h (Fig. 6a). In addition, after 12h-exposureto low pH, GST-MumRNA levels were significantly higher in haemocytesof the exposed shrimp than in the controls, but down-regulated in gills(Fig. 6b and c). No significant changes in GST transcriptionwere detectedin the stomach after exposure to either low or high pH (Fig. 6d).

An increase in expression of the Mu-GST protein was observed inshrimp hepatopancreas at low pH, 12 h post-challenge using westernblotting (Fig. 5). However, no effect was observed in stomach at 12 h(Fig. 6). No GST-Mu protein was detected in any haemocyte or gillsamples by Western blotting.

3.4. Total GST activity assays

Significant differences in GST activities in various tissues betweenthe pH-treated and control shrimp at 0 and 12 h post-challenge were

Table 2Glutathione S-transferase (GST) activities in hemolymph, gill and hepatopancreas ofL. vannamei exposed to different pHa.

Enzymaticactivity

Tissues pH7.4(0 h)

pH5.6(12 hpc)

pH7.4(12 hpc)

pH9.3(12 hpc)

Glutathione-S-transferase

Hemolymph 3.89±0.25 3.74±0.21 3.86±0.18 3.3±0.32⁎

(nmol GSH/min/mgprotein)

Hepatopancreas 3.17±0.12 4.0±0.33⁎ 3.24±0.22 3.30±0.23

Gills 3.91±0.11 4.1±0.38⁎ 3.82±0.11 3.5±0.22⁎

a Results are mean±S.D. for four animals (n=4); hpc is hours post-challenge.⁎ Values are statistically significant at Pb0.05.

noticed. After 12 h exposure to low pH, there was a significantelevation of total GST activities in shrimp hepatopancreas and gillscompared with the control animals. In addition, significant reductionsin the activity of glutathione-S-transferase in the hemolymph and gillsof high pH-treated L. vannamei were observed (Table 2).

4. Discussion

Glutathione-S-transferases are a family of dimeric multifunctionalenzymes that have been shown to be involved in: detoxification ofxenobiotics, protection from oxidative damage, and the intracellulartransport of hormones, endogenous metabolites and exogenouschemicals in diverse organisms. In aquatic organisms they arebelieved to play roles in detoxification and protection from oxidativedamage (Blanchette et al., 2007). However, GSTs of few decapodcrustaceans have been identified and biochemically characterized todate. In our study, the specific activity of rm GST-M towards CDNBwasfound to be 3.68±0.15 μmol/min/mg protein. Contreras-Vergara et al(2007, 2008) report the sequence and characterization of GST-M fromgill in L. vannamei, and also produce recombinant GST-M. However,the specific activities of GST-M in their study are over 100 times higherthan the values that are reported in our study. Perhaps the main causeof the difference is different vectors and different E. coli engineeringstrains we use in the study. In addition, the enzymatic activity of thepurified recombinant LvGST-M was maximal at 15 °C, but was stillsubstantial (72% of maximal) at 45 °C. This is consistent with previousfindings that GSTs are generally active across a broad temperaturerange. For instance: the PvGST of the malaria parasite Plasmodiumvivax is more stable at 4 °C than 37 °C (Na et al., 2007); Menezes et al2006 found no significant effects on GST activities when the brownshrimp Crangon crangon was exposed to temperatures of 9, 20 and25 °C; and Yamamoto et al. (2005) found that a theta-class glutathioneS-transferase from silkworm Bombyx mori had high activity across therange 30–50 °C, although the enzyme was much less stable attemperatures exceeding 50 °C. The results of present study and othersworks suggest that white shrimp GST-M and other GST isoforms areexpressed, and may be involved in detoxification and antioxidantdefenses, across a wide range of temperatures.

With respect to pH, the activity of the recombinant LvGST-M wasmaximal at pH 7, it showed 70% relative enzymatic activity at pH 8,and moderate activity across a broad pH range (6, 9, 10). Similarly, theoptimal pH for the GST-S of Tigriopus japonicus is reportedly between7.5 and 8.0 (Lee et al., 2007), and the optimal pH of the GST-S ofHyphantria cunea is also 8.0, but it apparently retains more than 50%activity at up to pH 10.0 (Yamamoto et al., 2007).

We also found that the mortality of the white shrimp wasconsiderably higher at both low and high pH than at the control pH(7.4), but significantly higher at pH 9.3 than at pH 5.6, and that itshemolymph pH increased significantly after exposure to pH 9.3 for12 h, indicating that this species is sensitive to alkaline conditions and(to a lesser degree) acid conditions. These results are in accordancewith previous indications that freshwater crustaceans are generallyvery sensitive to both acidification and alkalization (Zanotto andWheatly, 1993). Indeed, its higher mortality rates at both acidic andalkaline pH, relative to controls, appear in accordance with wepreviously observed for Penaeus chinensis (Wang et al., 2002). Low pHwater has also been reported to retard the growth of P. monodon(Allan and Maguire, 1992) Havas et al. (1984,1985), to induce acidosisand kill several species of Daphnia, and to cause acid–base imbalancein crayfish and freshwater prawns (Morgan and McMahon, 1982;Chen and Lee, 1997). In addition, increases or decreases in pH alsoreportedly cause disturbances in their acid–base balance, ion regula-tion, ammonia excretion (Chen and Lee, 1997; Wood, 2001) andsuppression of their Na, K-ATPase activities (Wang et al., 2002).Further, Wheatly et al (1996) reported that the pH of Procambarusclarkii hemolymph significantly decreased following a single day's

229J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

exposure to a pH 4.0 medium, while Chen and Chen (2003b) foundthat the pH of Macrobrabium rosenbergii hemolymph decreased from7.69 to 7.60 following 12 h exposure to pH 5.6; very similar to theresponse to low pH observed in the present study. Chen and Chen(2003b) also found that the hemolymph HCO3

− level in M. rosenbergiiwas reduced following a single day's exposure to low pH, while itshemolymph pO2 level increased (which could induce the accumula-tion of reactive oxygen species, and thus cause direct or indirectdamage to membranes and DNA). Due to their open circulatingsystem, significant changes in hemolymph pH may also affect thefunction of other shrimp tissues. These may be contributory factors tothe observed mortality of the white shrimp L. vannamei exposed tolow and high pH.

Very few studies have described the effects of changes inenvironmental variables (such as pH) on the expression of relatedgenes in shrimp. In crustaceans, the hepatopancreas is the keymetabolic centre for the production of reactive oxygen species, it playsa major role in their immune defenses (Söderhall and Cerenius, 1998),and it is involved in both the synthesis of digestive enzymes and thedetoxification of xenobiotics (Gibson and Barker, 1979; Vogt, 1994). Inthis study, therefore, we investigated the expression profile of Mu-GSTin the hepatopancreas (and other tissues) of shrimp exposed to bothhigh and low pH stress. The results indicate that there were significantincreases in the expression of Mu-GST mRNA and protein in thehepatopancreas of white shrimp following 12 h exposure to low pH,and an accompanying rise in GST activity, which may be responsesthat have evolved since they mitigate the toxic effects of acidosis and/or neutralize harmful free radicals generated by acidic pH treatment.In intestinal epithelial cell, acid exposure causes the production ofreactive oxygen species (ROS) and ROS-induced double strand breaks(DSBs) DNA damage (Zhang et al., 2008). However, the relationshipbetween pH and ROS generation is not well understood. CytoplasmicpH modification may represent an important signal for cytokine andchemokine syntheses and release, which can induce ROS production(Morel and Barouki, 1999; De Vito, 2006). In contrast, no changes inthe expression levels of Mu-GST transcripts or protein were observedin the stomachs of shrimp exposed to pH stress for 12 h. However, lowpH also stimulated GST-M transcription in hemocytes, but caused itsreduction in gills (no Mu-GST protein was detected in hemocytes orgills). Nevertheless, exposure to acidic pH induced increased GSTactivity in gills, suggesting that other classes of GSTs may be involvedin detoxification under pH stress in addition to Mu-GST. These resultssuggest hepatopancreas and gills are major tissues in shrimp involvedin detoxification after exposure to pH stress.

Interestingly, in a previous study we found that ferritin transcriptlevels peak at the same timewhenwhite shrimp are exposed to pH 5.6(Zhou et al., 2008), and that genes encoding the antioxidant enzymesmanganese superoxide dismutase (cMnSOD), catalase (CAT) andglutathione peroxidase (GPx) are upregulated in shrimp hepatopan-creas after exposure to acidic pH stress. Significant DNA damage in thehepatopancreas of shrimp exposed to pH stress for 12 h has also beendetected, but more at pH 9.3 than at pH 5.6 (unpublished data). Theinduction of these antioxidant enzyme genes and Mu-GST at low pHmay mitigate DNA damage in the hepatopancreas, and theseresponses probably contribute to protective mechanisms that reducethe potentially lethal effects of low pH. More specifically, Mu-GST maybe induced following exposure to acidic pH in response to oxidativestress caused by increased production of reactive oxygen species (e.g.the superoxide anion, the hydroxyl radical HO·, and/or organicperoxides), which can cause DNA strand breaks by directly interactingwith the ribose moieties of the DNA (Norbury and Hickson, 2001).Therefore, high levels of Mu-GST expression induced by low pH maybe beneficial to thewhite shrimp for detoxifying toxic metabolites andneutralizing reactive radicals.

In conclusion, the results of the present investigation indicate thatacute pH stress induces significant alterations in total GST activities

and levels of Mu-GST transcripts and protein in various white shrimptissues. Further, our results revealed lower mortality and strongerinduction of Mu-GST at pH 5.6 than at pH 9.3 suggests that Mu-GSTmay be heavily involved in the white shrimp in the elimination ofother potentially harmful substances generated by acidification andacid induced oxidative stress.

Acknowledgements

This research was supported by the National Natural ScienceFoundation of China (grant no. 30570287), and the Natural ScienceFoundation of Guangdong Province, P.R. China (grant nos. 06025052and 8151063101000035), and Guangdong Provincial Oceanic FisheriesScience and Technology Project (grant no. A200899D01).We sincerelythank Profs. Qili Feng and Sichun Zheng of the Laboratory of MolecularEntomology, South China Normal University.

References

Adewale, I.O., Afolayan, A., 2004. Purification and catalytic properties of glutathionetransferase from the hepatopancreas of crayfish Macrobrachium vollenhovenii(Herklots). J Biochem Mol Toxicol 18, 332–344.

Allan, G.L., Maguire, G.B., 1992. Effects of pH and salinity on survival, growth andosmoregulation in Penaeus monodon Fabricius. Aquaculture 107, 33–47.

Amado, L.L., Rosa, C.E., Leite, A.M., Morase, L., Pires, W.V., Leaes Pinho, G.L., Martins, C.M.G.,Robaldo, R.B., Nery, L.E.M.,Monserrat, J.M., Bianchini, A.,Martinez, P.E., Geracitano, L.A.,2006. Biomarkers in croakers Micropogonias furnieri (Teleostei: Sciaenidae) frompolluted and nonpolluted areas from the Patos Lagoon estuary (Southern Brazil):evidences of genotoxic and immunological effects. Mar. Pollut. Bull. 52, 199–206.

Asazuma, H., Nagata, S., Kono, M., Nagasawa, H., 2007. Molecular cloning and expressionanalysis of ecdysone receptor and retinoid X receptor from the kuruma prawn,Marsupenaeus japonicus. Comp. Biochem. Physiol. B 148, 139–150.

Bachère, E., 2000. Shrimp immunity and disease control. Aquaculture 191, 3–11.Blanchette, B., Feng, X., Singh, B.R., 2007. Marine glutathione S-transferases. Mar.

Biotechnol. 9, 513–542.Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72,248–254.

Brogdon, W.G., McAllister, J.C., 1998. Insecticide resistance and vector control. Emerg.Infect. Dis. 4, 605–613.

Chen, J.C., Lee, Y., 1997. Effects of nitrite exposure on acid–base balance, respiratoryprotein, and ion concentration of giant freshwater prawn Macrobrachiumrosenbergii at low pH. Arch. Environ. Contam. Toxicol. 33, 290–297.

Chen, S.M., Chen, J.C., 2003a. Effect of Low pH on the acid–base balance, osmolality andion concentrations of giant freshwater prawn Macrobrachium rosenbergii. J. Fish.Soc. Taiwan 30, 227–239.

Chen, S.M., Chen, J.C., 2003b. Effects of pH on survival, growth, molting and feeding ofgiant freshwater prawn Macrobrachium rosenbergii. Aquaculture 218, 613–623.

Chiu, C.H., Guu, Y.K., Liu, C.H., Pan, T.M., Cheng, W., 2007. Immune responses and geneexpression in white shrimp, Litopenaeus vannamei, induced by Lactobacillusplantarum. Fish Shellfish Immunol. 23, 364–377.

Contreras-Vergara, C.A., Harris-Valle, C., Sotelo-Mundo, R.R., Yepiz-Plascencia, G., 2004.A mu-class glutathione S-transferase from the marine shrimp Litopenaeusvannamei: molecular cloning and active-site structural modeling. J. Biochem. Mol.Toxicol. 18, 245–252.

Contreras-Vergara, C.A., Valenzuela-Soto, E.M., Arvizu-Flores, A.A., Sotelo-Mundo, R.R.,Yepiz-Plascencia, G., 2008. Role of invariant tyrosines in a crustacean mu-classglutathione S-transferase from shrimp Litopenaeus vannamei: site-directed muta-genesis of Y7 and Y116. Biochimie 90, 968–971.

Contreras-Vergara, C.A., Valenzuela-Soto, E., Sotelo-Mundo, R.R., Yepiz-Plascencia, G.,2007. A mu-class glutathione S-transferase from gills of the marine shrimp Lito-penaeus vannamei: purification and characterization. J. Biochem. Mol. Toxicol. 21,62–67.

Delgado, P.C., Avnimelech, Y., McNeil, R., Bratvold, D., Browdy, C.L., Sandifer, P., 2003.Physical, chemical and biological characteristics of distinctive regions in paddle-wheel aerated shrimp ponds. Aquaculture 217, 235–248.

De Vito, P., 2006. The sodium/hydrogen exchanger: a possible mediator of immunity.Cell. Immunol. 240, 69–85.

Distefano, R.J., Neves, R.J., Helfrich, L.A., Lewis, M.C., 1991. Response of the crayfishCambarus bartonii bartonii to acid exposure in southern Appalachian streams.Can. J. Zool. 69, 1585–1591.

Eaton, D.L., Bammler, T.K., 1999. Concise review of the glutathione S-transferases andtheir significance to toxicology. Toxicol. Sci. 49, 156–164.

Feng, Q.-L., Davey, K.G., Pang, A.S.D., Primavera, M., Ladd, T.R., Zheng, S.-C., Sohi, S.S.,Retnakaran, A., Palli, S.R., 1999. Glutathione S-transferase from the sprucebudworm, Choristoneura fumiferana: identification, characterization, localization,cDNA cloning, and expression. Insect Biochem. Mol. Biol. 29, 779–793.

Fitzpatrick, P.J., Krag, T.O.B., Hojrup, P., Sheehan, D., 1995. Characterization of aglutathione S-transferase and a related glutathione-binding protein from gill of theblue mussel, Mytilus edulis. Biochem. J. 305, 145–150.

230 J. Zhou et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 224–230

Frova, C., 2006. Glutathione transferases in the genomics era: new insights andperspectives. Biomol. Eng. 23, 149–169.

Gibson, O., Barker, P.L., 1979. The decapod hepatopancreas. Oceanogr. Mar. Biol. Annu.Rev. 17, 285–346.

Goto, S., Kawakatsu, M., Izumi, S., Urata, Y., Kageyama, K., Ihara, Y., Koji, T., Kondo, T.,2009. Glutathione S-transferase pi localizes in mitochondria and protects againstoxidative stress. Free Radic. Biol. Med. 46, 1392–1403.

Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. The first enzymatic step in mercapturic acidformation. J. Biol. Chem. 249, 7130–7139.

Havas, M., Hutchinson, T.C., Likens, G.E., 1984. Effect of low pH on sodium regulation intwo species of Daphnia. Can. J. Zool. 62, 1965–1970.

Havas, M., 1985. Aluminum bioaccumulation and toxicity to Daphnia magna in softwater at low pH. Can. J. Fish. Aquat. Sci. 42, 1741–1748.

Hemingway, J., 2000. The molecular basis of two contrasting metabolic mechanisms ofinsecticide resistance. Insect Biochem. Mol. Biol. 30, 1009–1015.

Hemingway, J., Ranson, H., 2000. Insecticide resistance in insect vectors of humandisease. Annu. Rev. Entomol. 45, 371–391.

Lavilla-Pitogo, C.R., Leano, E.M., Paner, M.G., 1998. Mortalities of pond-cultured juvenileshrimp, Penaeus monodon, associated with dominance of luminescent vibriosis inthe rearing environment. Aquaculture 164, 337–349.

Lee, Y.M., Lee, K.W., Park, H., Park, H.G., Raisuddin, S., Ahn, I.Y., Lee, J.S., 2007. Sequence,biochemical characteristics and expression of a novel Sigma-class of glutathioneS-transferase from the intertidal copepod, Tigriopus japonicuswith a possible rolein antioxidant defense. Chemosphere 69, 893–902.

Lemonniera, H., Bernardb, E., Boglioa, E., Goaranta, C., Cochardb, J.C., 2004. Influence ofsediment characteristics on shrimpphysiology: pHasprincipal effect. Aquaculture 240,297–312.

Le Moullac, G., Haffner, P., 2000. Environmental factors affecting immune responses inCrustacea. Aquaculture 191, 121–131.

Li, C.C., Chen, J.C., 2008. The immune response of white shrimp Litopenaeus vannameiand its susceptibility to Vibrio alginolyticus under low and high pH stress. FishShelfish Immunol. doi:10.1016/j.fsi.2008.01.007.

Lightner, D.V., Poulos, B.T., Tang-Nelson, K.F., Pantoja, C.R., Nunan, L.M., Navarro, S.A.,2006. Application of molecular diagnostic methods to penaeid shrimp diseases:advances of the past 10 years for control of viral diseases in farmed shrimp. Dev.Biol. (Basel) 126, 117–122.

Menezes, S., Soares, A.M.V.M., Guilhermino, L., Peck, M.R., 2006. Biomarker responses ofthe estuarine brown shrimp Crangon crangon L. to non-toxic stressors: temperature,salinity and handling stress effects. J. Exp. Mar. Biol. Ecol. 335, 114–122.

Mohankumar, K., Ramasamy, P., 2006. White spot syndrome virus infection decreasesthe activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res. 115,69–75.

Morel, Y., Barouki, R.,1999. Repressionof geneexpressionbyoxidative stress. Biochem. J. 342,481–496.

Morgan, D.O., McMahon, B.R., 1982. Acid tolerance and effects of sublethal acidexposure on ionoregulation and acid–base status in two crayfish Procambarusclarkii and Orconectes rusticus. J. Exp. Biol. 97, 241–252.

Na, B.K., Kang, J.M., Kim, T.S., Sohn, W.M., 2007. Plasmodium vivax: Molecular cloning,expression and characterization of glutathione S-transferase. Exp. Parasitol. 116,414–418.

Nies, E., Almar, M.M., Hermenegildo, C., Monsalve, E., Romero, F., 1991. The activity ofglutathione S-transferase in hepatopancreas of Procambarus clarkii: seasonal varia-tions and the influence of environmental pollutants. Comp. Biochem. Physiol. C 100,65–66.

Norbury, C.J., Hickson, I.D., 2001. Cellular responses to DNA damage. Annu. Rev.Pharmacol. Toxicol. 41, 367–401.

Ranson,H., Rossiter, L.,Ortelli, F., Jensen, B.,Wang,X., Roth,C.W., Collins, F.H.,Hemingway, J.,2001. Identification of a novel class of insect glutathione S-transferase involved inresistance to DDT in the malaria vector Anopheles gambiae. Biochem. J. 359, 295–304.

Rosenberry, B., 2002. World shrimp farming 2002. Shrimp News Int. 27.Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure, function and evolution

of glutathione transferases: implications for classification of non-mammalianmembers of an ancient enzyme superfamily. Biochem. J. 360, 1–16.

Söderhall, K., Cerenius, L., 1998. Role of prophenoloxidase-activating system ininvertebrate immunity. Curr. Opin. Immunol. 10, 23–28.

Tang, A.H., Tu, C.P.D., 1994. Biochemical characterization of Drosophila glutathioneS-transferases D1 and D2. J. Biol. Chem. 269, 27876–27884.

Van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation andbiomarkers in environmental risk. Environ. Toxicol. Pharmacol. 13, 57–149.

Vogt, G., 1994. Life-cycle and functional cytology of the hepatopancreas cells of Astacusastacus (Crustacea, Decapoda). Zoomorphology 114, 83–101.

Wang, W.N., Wang, A.L., Chen, L., Liu, Y., 2002. Effects of pH on survival, phosphorusconcentration, adenylate energy charge and Na,K-ATPase activities of Penaeuschinensis Osbeck juveniles. Aquat. Toxicol. 60, 75–83.

Wang, W.N., Wang, A.L., Zhang, Y.J., 2006. Effect of dietary higher level of selenium andnitrite concentration on the cellular defense response of Penaeus vannamei.Aquaculture 256, 55–563.

Wang, Y.C., Chang, P.-S., Chen, H.-Y., 2007. Tissue expressions of nine genes important toimmune defence of the Pacific white shrimp Litopenaeus vannamei. Fish ShellfishImmunol. 23, 1161–1177.

Wheatly, M.G., De Souza, S.C.R., Hart, M.K., 1996. Related changes in hemolymph acid–base status, electrolytes, and ecdysone in intermolt crayfish (Procambarus clarkii) at23 °C during extracellular acidosis induced by exposure to air, hyperoxia, or acid.J. Crustac. Biol. 16, 267–277.

Wood, C.M., 2001. Toxic responses of the gill. In: Schlenk, D., Benson, W.H. (Eds.), TargetOrgan Toxicity in Marine and Freshwater Teleosts. Volume 1-Organs. InTaylor &Francis, London, pp. 1–89.

Yamamoto, K., Zhang, P., Miake, F., Kashige, N., Aso, Y., Banno, Y., Fujii, H., 2005. Cloning,expression and characterization of theta-class glutathione S-transferase from thesilkworm, Bombyx mori. Comp. Biochem. Physiol. B 141, 340–346.

Yamamoto, K., Fujii, H., Aso, Y., Banno, Y., Koga, K., 2007. Expression and characterizationof a Sigma-class glutathione S-transferase of the fall webworm, Hyphantria cunea.Biosci. Biotechnol. Biochem. 71, 553–560.

Yao, C.L., Wang, A.L., Wang, W.N., Sun, R.Y., 2004. Purification and partial characteriza-tion of Mn superoxide dismutase from muscle tissue of the shrimp Macrobrachiumnipponense. Aquaculture 241, 621–631.

Yu, S.J., 1996. Insect glutathione S-transferases. Zool. Stud. 35, 9–19.Zanotto, F.P.,Wheatly,M.G.,1993. The effect of ambient pHon electrolyte regulation during

the postmoult period in freshwater crayfish Procambarus clarkii. J. Exp. Biol. 178, 1–19.Zhang, H.Y., Zhang, X., Spechler, S.J., Souza, R.F., 2008. Acid induces DNA double strand

breaks via reactive oxygen species in benign Barrett's epithelial cells. Gastroenter-ology 134, A128.

Zhou, Z.H., Sylvanen, M., 1997. A complex glutathione transferase gene family in thehousefly Musca domestica. Mol. Gen. Genet. 256, 187–194.

Zhou, J., Wang, W.N., Ma, G.Z., Wang, A.L., He, W.Y., Wang, P., Liu, Y., Liu, J.J., Sun, R.Y.,2008. Gene expression of ferritin in tissue of the Pacific white shrimp, Litopenaeusvannamei after exposure to pH stress. Aquaculture 275, 356–360.