Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B

j ourna l homepage: www.e lsev ie r .com/ locate /cbpb

Cathepsin B from the white shrimp Litopenaeus vannamei: cDNA sequence analysis,tissues-specific expression and biological activity

A. Stephens a, L. Rojo b, S. Araujo-Bernal a, F. Garcia-Carreño b, A. Muhlia-Almazan a,⁎a Aquatic Molecular Biology Lab. Centro de Investigacion en Alimentacion y Desarrollo (CIAD), A. C. Carretera a Ejido La Victoria Km 0.6. PO Box. 1735, Hermosillo, Sonora, 83000, Mexicob Biochemistry Lab. Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Mar Bermejo 195, Col. Playa Palo de Santa Rita, P.O. Box 128, La Paz, Baja California Sur 23090, Mexico

⁎ Corresponding author. Tel.: +52 6622892400x504;E-mail address: amuhlia@ciad.mx (A. Muhlia-Almaz

1096-4959/$ – see front matter © 2011 Elsevier Inc. Alldoi:10.1016/j.cbpb.2011.09.004

a b s t r a c t

a r t i c l e i n f o

Article history:Received 17 May 2011Received in revised form 5 September 2011Accepted 9 September 2011Available online 16 September 2011

Keywords:Cathepsin BCystein proteinasesGenes expressionShrimpStarvation

Cathepsin B is a cystein proteinase scarcely studied in crustaceans. Its function has not been clearly describedin shrimp species belonging to the sub-order Dendrobranchiata, which includes the white shrimp Litopenaeusvannamei and other species from the Penaeidae family. Studies on vertebrates suggest that these lysosomalenzymes intracellularly hydrolize protein, as other cystein proteinases. However, the expression of the geneencoding the shrimp cathepsin B in the midgut gland was affected by starvation in a similar way as other di-gestive proteinases which extracellularly hydrolyze food protein. In this study the white shrimp L. vannameicathepsin B (LvCathB) cDNA was sequenced, and characterized. Its gene expression was evaluated in variousshrimp tissues, and changes in the mRNA amounts were compared with those observed on other digestiveproteinases from themidgut gland during starvation. By using qRT-PCR it was found that LvCathB is expressedin most shrimp tissues except in pleopods and eye stalk. Changes on LvCathB mRNA during starvation suggestthat the enzyme participates during intracellular protein hydrolysis but also, after food ingestion, it partici-pates in hydrolyzing food proteins extracellularly as confirmed by the high activity levels we found in the gas-tric juice and midgut gland of the white shrimp.

fax: +52 6622800421.an).

rights reserved.

© 2011 Elsevier Inc. All rights reserved.

1. Introduction

Cathepsin B (CathB; EC 3.4.22.1), is the most well studied intracel-lular, acidic cystein proteinase in vertebrates and it shows the uncom-mon ability to accomplish a dual role: as an endopeptidase and adipeptidyl-carboxypeptidase (McGrath, 1999). Studies on humansand rats have evidenced that CathB plays an essential role in the in-tracellular activation of trypsin zymogens during the premature acti-vation of proteinases on human pancreatitis (Halangk et al., 2000;Lerch and Halangk, 2006), and it participates in the enzymatic cas-cade associated to some human pathologies (Sloane, 1990; Ellis,2004).

In invertebrate hematophagous species, as the nematode Hae-monchus contortus and the tick Ixodes ricinus, CathB has been con-firmed to contribute on the digestion of blood protein (Williamsonet al., 2003; Yatsuda et al., 2006; Franta et al., 2010). However, the in-formation concerning cystein-proteinases and their function frommarine and freshwater invertebrates is still scarce (Le Boulay et al.,1996; Cardenas-Lopez and Haard, 2005). In the northern shrimp Pan-dalus borealis the cDNA encoding a CathB, was found to be exclusivelyexpressed in the midgut gland (Aoki et al., 2003), and since extracel-lular activity of this enzyme was detected at acidic pH, it was

suggested that it may play a role on digestion. Recently it wasreported that the genes expression of two cystein proteinases was af-fected during bacterial and viral challenges in the midgut gland of theChinese shrimp, Fenneropenaeus chinensis, suggesting that both en-zymes may play a role in shrimp innate immunity (Ren et al., 2010).

The midgut gland of decapod crustaceans is recognized as theorgan where a battery of proteinolytic enzymes is synthesized to di-gest food protein. A series of studies have contributed to identify dif-ferent classes of enzymes, their biological function, and the conditionsgoverning its activity during protein hydrolysis (Muhlia-Almazan etal., 2008; Rojo et al., 2010). Among cystein-proteinases synthesizedin the midgut gland of shrimp, cathepsin L (CathL) is commonly rec-ognized as the enzyme responsible for protein hydrolysis (Hu andLeung, 2004). It has been reported that in caridean shrimp, Crangonspp., serine proteinases, as trypsin and chymotrypsin, are substitutedby cystein proteinases such as Cath L, this replacement seems not tobe related to the mode of feeding or to the nutritive status of shrimp(Teschke and Saborowski, 2004).

Several properties of CathL, as its gene characterization and ex-pression, and protein and enzyme activity, have been extensivelystudied in some crustacean species including Litopenaeus vannamei(Le Boulay et al., 1996) and Metapenaeus ensis (Hu and Leung,2004). Furthermore, its role during intracellular and extracellularprotein hydrolysis has been previously described (Hu and Leung,2007). However, the existence and the assumed role of other lyso-somal cystein proteinases, especially cathepsin B, during digestion

33A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

has not been assessed in the Penaeidae subfamily, which includes themost commercially important species of shrimp worldwide.

In this study biochemical and molecular biology approaches wereused to identify and characterize the mRNA sequence encoding a ca-thepsin B in the midgut gland of shrimp, and to assess whether itsgene expression is affected during starvation following the same pat-tern as the main digestive enzymes trypsin, chymotrypsin, and ca-thepsin L. In addition, the analysis of its gene expression and itsenzymatic activity were evaluated in several tissues, to provide in-sights to better understand its basic biological function during proteindegradation. Finally, a phylogenetic analysis was included to inferabout shrimp species cathB from their sequence and structurehomologies.

2. Materials and methods

2.1. LvCathB cDNA sequencing

The complete cDNA sequence of cathepsin B from L. vannamei(LvCathB) was obtained by using specific oligonucleotides designedon the basis of a DNA sequence encoding a cathepsin B of Penaeusmonodon (GenBank accession no. EF213113) and a long EST fromL. vannamei (www.marinegenomics.org; MGID996966). The set ofoligonucleotides used to amplify LvCathB cDNA fragments is listedin Table 1.

The midgut gland cDNA used as template in the PCR reactions wassynthesized as described below. The complete LvCathB coding se-quence was amplified using oligonucleotides CBLvMFw and CBLvSRw,and the 3′-UT region was amplified using CBvanFw3 and an oligo-dT.PCR conditions were optimized to amplify different size DNA frag-ments at 95 °C for 3 min, 40 cycles of 94 °C for 1 min, 55 to 60 °C for1 min, 72 °C for 1 min and a final extension of 72 °C for 10 min. Dur-ing PCR amplification, reactions of 25 μL total volume included 1 μL ofeach oligonucleotide (100 pmol), 1 μL of template (250 ng of polya-denylated RNA equivalents), and 22 μL of supermix (Invitrogen, USA).

PCR products were analyzed by electrophoresis on a 1% agarose gelstainedwith SYBR safe (Molecular Probes, USA), and subsequently pu-rified and sequenced by the dideoxy chain-termination method at theLaboratory of Molecular and Systematic Evolution at the University ofArizona. The complete sequence was compared using protein and nu-cleotide data bases (Blast algorithm N and P; Altschul et al., 1997).

2.2. Starvation assay and shrimp tissues collection

Thirty adult shrimp (L. vannamei) were selected by size (18.0±1.0 g) and molt stage (intermolt) from CIBNOR facilities. Organismswere placed in 3 plastic tanks of 1200 L each (10 shrimp per tank)and maintained under controlled laboratory conditions during an ac-climatization period of 15 days (28 °C, 34 ppt, 6.0 mg/L). Shrimpwerefed once a day ad libitum with commercial food (Silver cup with 35%protein), uneaten food and feces were daily removed, and the totalvolume of marine water was daily exchanged.

Once acclimatized, shrimp were fed and their digestive tract wasexaminated to be full, and immediately after, two specimens weresampled from each tank, at 0 (control group), 24, 72 and 120 h

Table 1Specific oligonucleotides used for LvCathB sequencing from the midgut gland of thewhite shrimp L. vannamei.

Oligonucleotide name Sequence (5′–3′) cDNA position (nt)

CBvanFw3 GCGAGAAGGGCTACATAG 686–703CBvanRv4 GTTAGCGTTGTTGTATTTTGTG 1443–1422CBvanFw6 ACGACGGTAGGGAGTGTC 18–35CBvanRv6 GGAAGCCTCCGTTACATCC 517–499CBLvMFw ATGAGGGTTATCCTGGTCTTG 61–81CBLvSRv CTAATTCAACTTAGGCAACCC 1056–1036

(starved groups). Six individual shrimp were decapitated at each dif-ferent starvation time and their midgut gland (MG), were dissectedand frozen in liquid nitrogen. All samples were stored at −20 °C.

In order to understand LvCathB gene expression and enzyme ac-tivity in different shrimp tissues, one remaining control shrimp wasdecapitated and its various tissues were dissected. Samples of midgutgland (MG), gastric juice (GJ), intestine (gut), gills (G), muscle (M),hemocytes (Hm), pleopods (Pl), and terminal ampoule (Amp) werestored at −20 °C and then individually analyzed.

2.3. Total RNA isolation and complementary DNA synthesis

Total RNA was extracted from 100 mg of midgut gland from controland starved shrimp, and also from all the above mentioned shrimp tis-sues using themethod described by Chomczynsky and Sacchi (1987). Inbrief, each tissue was homogenized in 500 μL of Trizol® reagent (Invi-trogen) and samples were incubated at room temperature for 5 min.Then 200 μL of chloroform were added and tubes were shaken and in-cubated for 15 min, then centrifuged at 10,000 g for 15 min at 4 °C.The supernatant phase was transferred to clean tubes and 500 μL of ad-ditional TRizol were added. The following stepswere repeated and oncethe new aqueous phase was transferred to clean microtubes, 500 μL ofcold isopropyl alcohol were added to precipitate total RNA. Sampleswere incubated for 10 min at room temperature and centrifuged at16,000 g for 10 min at 4 °C. Total RNA samples were washed oncewith 1 mL of 75% ethanol (prepared with DEPC water), and centrifugedat 5000 g for 10 min at 4 °C. Samples were air-dried and dissolved innuclease-free water. Total RNA concentrations were measured at260 nm using a spectrophotometer (NanoDrop 1000, Wilmington, DE,USA) and their integrity was confirmed by 1% agarose-formaldehydegel electrophoresis (Sambrook and Russell, 2001).

Genomic DNA contamination of total RNA samples was eliminatedusing DNAse I (Sigma Aldrich, St. Louis, MO, USA) at 1 U/μg RNA. Sam-ples were incubated for 10 min at 37 °C. Once gDNAwas digested andits absence confirmed, RNA samples were used as template in thecomplementary DNA (cDNA) synthesis. Five micrograms of totalRNA were reverse transcribed using the SuperScript® III First-StrandSynthesis System (Invitrogen, Carlsbad, CA, USA) and oligo-dTprimers, following manufacturer instructions. cDNA samples wereused as template to evaluate mRNA relative amounts.

2.4. LvCathB qRT-PCR by real time

The relative mRNA amounts of cathepsin B, cathepsin L, chymo-trypsin, trypsin and L21 (as an internal control) were evaluated byreal time PCR using an iQ5 real time PCR detection system (BioRad,CA, USA). All samples were PCR-amplified in triplicates using totalvolume reactions of 25 μL which included 12.5 μL of 2x iQ Sybr-Green Supermix (BioRad), 0.7 μL of each 5 mM forward and reverseoligonucleotides, water and cDNA (200 ng of polyadenylated RNAequivalents) from each sample.

Specific oligonucleotides were designed using mRNA sequencesalready reported at the GenBank (Table 2). Trypsin (TryLvFw1 andTryLvRv1; Sanchez-Paz et al., 2003), chymotrypsin (ChymoLvFw1and ChymoLvRv1; GenBank accession nos. X66415, Y10664 andY10665), cathepsin L (CATLFw4 and CATLRv4; X99730.1), cathepsinB (CatB Fw2Lv and CatBRv1Lv; GU571199.1), and the ribosomal pro-tein L21 (L21LvFw2 and L21LvRv2; BE188654.1) was evaluated as aninternal control to normalize target gene expression.

Amplification conditions were 95 °C for 5 min and 40 cycles of95 °C for 30 s, 55–60 °C for 35 s, and 72 °C for 55 s. PCR products spec-ificity was confirmed by constructing a melt curve after amplificationraising temperature from 60 to 95 °C with an increase of 0.3 °C every20 s and a fluorescence reading at each temperature increase. No-template controls were included during each gene amplification.

Table 2Specific oligonucleotides used for PCR amplification of shrimp trypsin, chymotrypsin,cathepsin L, cathepsin B and L21 genes.

Gene Oligonucleotidename

Sequence(5′–3′)

PCR fragment size(bp)

Trypsin TryLvFw1 TCCTCTCCAAGATCATCCAA 255Trypsin TryLvRv3 GGCACAGATCATGGAGTCChymotrypsin ChymoLvFw1 GGCTCTCTTCATCGACG 266Chymotrypsin ChymoLvRv1 CGTGAGTGAAGAAGTCGGCathepsin L CatLFw4 CTCAGGACGGTAAGTGTCG 239Cathepsin L CatLRv4 TTCTTGACCAGCCAGTAGGCathepsin B CatBFw2Lv GGATGTAACGGAGGCTTC 212Cathepsin B CatBRv1Lv CTGTATGCTTTGCCTCCAL21 L21LvFw2 GTTGACTTGAAGGGCAATG 208L21 L21LvRv2 CTTCTTGGCTTCGATTCTG

34 A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

Data analysis was performed based on the comparison of PCR reac-tions efficiencies of each amplified gene, and the CT value of each sample(data not shown). The 2−(ΔΔCT) method was used to evaluate changes inthe relative mRNA amount of target genes. To determine the effects ofstarvation data were obtained from the following formula 2−(ΔΔCT)=(mean CTtarget−meanCTL21)starved−(mean CT target−CT21)control, to compareamong tissues the same formula was used and all tissues mRNA amountswere calculated relative to ampule that equals to 1 (Livak and Schmittgen,2001).

Statistical analyses were performed using Statistica 8 software(StatSoft, Inc). Chi-squared test was used to determine normal distri-bution, and Levene's test confirmed variances homogeneity. One-wayANOVA was performed to test the significance of starvation effects,and among tissues. Duncan test was used to determine differencesbetween means. Statistical significance differences were consideredat pb0.05 (Zar, 1984).

2.5. LvCathB enzyme activity assay

Cathepsin B (EC 3.4.22.1) specific activity was measured by usingthe fluorogenic substrate Z-Arg-Arg-7-amido-4-methycoumarin hy-drochloride (Z-Arg-Arg-AMC) (Sigma) in protein extracts obtainedfrom different tissues of L. vannamei including midgut gland, intes-tine, hemocytes, gills, eye stalk, muscle and pleopods; additionallygastric juice was obtained by leaking the liquid contained in theshrimp gastric chamber.

Assays were performed at 30 °C in black 96-well plates in a Syner-gy 4 (BioTek) fluorometer as follows: 5–20 μL of every tissue shrimpextract (ranging from 0.4 to 500 μg of protein depending on theassayed tissue) were mixed with a buffer solution containing100 mM sodium acetate, 1.5 mM EDTA, 2 mM DTT, 0.05% and TritonX-100, pH 5.5. The reaction was set by adding the fluorogenic sub-strate to a final concentration of 100 μM. Rates of hydrolysis wererecorded by measuring the increase of fluorescence in arbitraryunits (relative fluorescence units, RFU). The excitation and emissionwavelengths were 360 nm and 440 nm, respectively. A calibrationcurve was constructed by measuring the fluorescence of known con-centrations of fluorochrome 7-amino-4-methoxycoumarin (AMC)and by plotting the RFU versus picomoles of AMC. Cathepsin Bactivity is expressed in picomol of MCA liberated per minute per μgof protein. One unit of activity was defined as the release of 1 μmolof MCA per min per μg protein.

2.6. Phylogenetic analysis

A multiple alignment analysis including the cathepsin B deducedamino acid sequences from selected taxa and LvCathB was performed.Digestive cathepsin B sequences from 11 invertebrate species: Triatomainfestans (Kollien et al., 2004), Tenebrio molitor (Prabhakar et al., 2007),Pandalus borealis (Aoki et al., 2003), Haemonchus contortus (Yatsuda etal., 2006), Diabrotica virgifera (Bown et al., 2004), Ixodes ricinus (Sojka

et al., 2008), Ascaris suum (Rehman and Jasmer, 1999), Ancylostomacaninum (Harrop et al., 1995), Schistosoma mansoni (Sajid et al., 2003),Necator americanus (Ranjit et al., 2008) and Fasciola gigantica (Wilsonet al., 1998) were included. The selected sequences were aligned forcomparison using Clustal X v. 1.81 software (Thompson et al., 1994),and the alignment was used to construct a cladogram. For phylogeneticanalysis, 259 positions from the mature cathepsin B amino acidsequences from 26 species were used; pre-pro regions and C-terminalextensionswere excluded because of intrinsic high sequence variability.Based on the Jones et al. (1992) model of substitution, a cladogramusing the neighbor-joining algorithm (Saitou and Nei, 1987) wasconstructed, the Bootstrapmethodwas applied for assessing confidenceanalysis of the clades (Hillis and Bull, 1993) based on 1000 replicates inMEGA 4.1 software (Tamura et al., 2007).

3. Results

3.1. LvCathB cDNA and protein sequences

The full-length LvCathB cDNA sequence was shown to be 1560 nu-cleotides long, including a 60 nucleotides 5′-UT region, a 996 nucleo-tides coding region, and a 504 nucleotides 3′-UTR. Two putativepolyadenylation signals AATAAA occurred at positions 1522 and1544 and a poly A tail at position 1561 (Fig. 1). Although multipletranscripts have been found to result from alternative splicing in theuntranslated regions of rat cath B (Ellis, 2004), no clear evidence ofother LvCathB mRNA isoforms in shrimp was found since severalcDNA sequences from different tissues (data not shown) were ana-lyzed and no major differences among them were found.

The LvCathB deduced protein is 331 residues long, it is encoded asa preproenzyme that includes a 16-residue putative signal peptide(Dyrlov et al., 2004). Also it contains a propeptide_C1 at positions21–60, which is found in the N-terminal of those proteins that belongto the peptidase_C1 family as cathepsins, and the active peptidase ca-thepsin B which is coded by residues 79 to 326 (248 residues). Theputative LvCathB protein showed a high degree of identity to otherknown cathepsins B from crustacean species, especially with thosefrom the Penaeidae family, sharing 97 and 94% identity with P. mono-don and Marsupenaeus japonicus, respectively. However, the proteinsequence shared only 55% identity with that from the northernshrimp P. borealis that belongs to the Pandalidae family (Fig. 2).When compared to crustacean cathepsins as P. monodon,M. japonicus,and P. borealis, LvCathB showed a similar protein size, but when com-pared with cathepsins from various insect and vertebrate species itshowed to be slighty smaller.

The mature protein LvCathB of 248 amino acid residues long has acalculated molecular weight of 26.9 kDa and a theoretical pI of 6.1. Asobserved in Fig. 2, all compared sequences share some conservedcharacteristics of cathepsin B proteinases, as the three highly con-served residues forming the active site at C107, H276, and N296 andthe glutamine oxyanion hole at residue Q101, which is known to sta-bilize the transition state of the reaction catalyzed by cystein protein-ases (Menard et al., 1991). However, some other elements like theamino acid residues at the “occluding loop”, the GCNGG motif at po-sitions 147–151, and the six S2 sites located at F152-P153, A250,G274, A277 and E322, seem to be conserved only in the non-digestiveand L. vannamei cathepsin Bs (Fig. 2).

LvCathB possesses 15 cystein residues, with Cys107 (or Cys29according to human cathepsin B structure; Musil et al., 1991) repre-senting the active site cystein, 12 additional cystein residues whichare presumed to be involved in six disulphide bridges formation at po-sitions C92–C121, C104–C148, C140–C205, C141–C144, C177–C209,and C185–C196 are highly conserved among species, and an addition-al cystein residue which is not observed in species besides penaeidsand marine fish was found at C294, and finally C317 which is also aconserved cystein (Fig. 2).

Fig. 1. LvCathB nucleotide and deduced amino acid sequences of the full length cDNA from the midgut gland of the whiteleg shrimp L. vannamei. Start and stop codons are marked inblack squares. Both putative polyadenylation signals are double underlined. The shaded box indicates the predicted signal peptide; the open box indicates the predicted propepti-de_C1. The active peptidase is underlined.

35A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

Thedisulphidebridge between residues C185 andC196 in L. vannameicathepsin B sequence (Cys108 and Cys119 in human sequence) is sug-gested as the region were the occluding loop is formed. Also, H110 andH111 from human sequence are found in L. vannamei sequence at H187and H188, suggesting that the side chains of both residues are implicatedin exopeptidase activity (Musil et al., 1991). Finally LvCathB contains atthe carboxylic terminus, a five residues extension (L327–N331) with noresolved function.

3.2. Shrimp LvCathB tissue-specific expression and the effect of starvation

The LvCathB steady state mRNA levels of different shrimp tissueswere evaluated in triplicate by quantitative PCR. Each of the meltingcurves generated at the end of the real time-PCR reactions contained

a single PCR product for each gene in all samples. Fig. 3 shows the sta-tistical differences detected among tissues relative to the L21 ribo-somal protein transcripts (pb0.05). Higher mRNA amounts werefound in gillsNhemocytesNmidgut glandNgutN terminal ampu-leNmuscle. The higher values were 2 to 3-fold higher than ampuleconsidered the basis, since it was one of the tissues with lowerLvCathB mRNA amounts and equals to 1. No detectable LvCathBmRNA amounts were observed in pleopods and eye stalk.

Fig. 4 shows the changes produced by starvation in the amount ofmRNA for four proteinases in the midgut gland of the whiteshrimp. Two digestive enzymes as trypsin and chymotrypsin (serine-proteinases), cathepsin L and cathepsin B (cystein proteinases), wereincluded in order to compare results and infer about LvCathB function.Both, chymotrypsin and LvCathB were affected in a similar way, since

36 A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

an increase was detected in their mRNA amounts after 120 h of starva-tion (pb0.05); also a statistically significant increase of LvCathB wasdetected at 24 h (pb0.05). Trypsin and cathepsin L were less affectedby starvation, however, significant changes were detected between0 and 120 h (pb0.05), both changed in a same manner. Among allevaluated enzymes chymotrypsin and LvCathB were detected inhigher amounts at the end of the starvation period than trypsinand cathepsin L.

3.3. LvCathB enzyme activity

The resulting activities of cathepsin B from different shrimp tis-sues are shown in Table 3. Results show high specific activities in allthose tissues tightly related to the digestive function as the midgutgland, the intestine and also in the collected gastric juice. Also,

Fig. 2. Cathepsin B multiple protein alignment. Underlined scientific names are crustaceansubstitutions. In the LvCathB sequence, indicates the beginning of the active peptidase seqindicate the active sites and bold letters indicate the occluding loop.

LvCathB activity was recorded in gills, but not in the hemocyteswhere high amounts of mRNAwere previously found. Not enough tis-sue was available for determining LvCathB activity in the terminalampule.

3.4. Phylogenetic analysis

Since major differences were observed between the cathepsin Bsequences of Penaeidae and Pandalidae, an unrooted neighbor-joiningtree was constructed to assess on the phylogenetic relationshipamong the Crustacean cathepsin B and that of several other taxa, includ-ing digestive enzymes from various invertebrates (Fig. 5). While non-digestive and L. vannamei cathepsin B amino acid sequences show tobe highly conserved; the enzymes with digestive function showed awide range of variability including non conservative amino acid

species. (*) identical residues; (:) conservative substitutions; and (.) semiconservativeuence. indicates the glutamine oxyanion hole; shaded residues C107, H275 and N296

Fig. 2 (continued).

37A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

substitutions at sites related to substrate recognition, binding and hy-drolysis, e.g. the presence and sequence of the occluding loop includingthe HH residues involved in the exopeptidase activity, and the GCNGGmotif. The inconsistencies in the amino acid composition of digestivecathepsin Bs are reflected on their distribution on the constructed clad-ogram; e.g. all of the non-digestive cathepsin Bs from insects form awellresolved clade in which the digestive cathepsin B of the species T. infes-tans,Diabrotica vigifera and T. molitor are not included in such clade, butdistributed on non-resolved branches of the cladogram. The same isobserved for Decapods, P. borealis cathepsin B (digestive enzyme) isnot included in the Decapod branch (Fig. 5). Cathepsin B enzymesresponsible for hydrolysis of hemoglobin by blood-feeding helminthesshare a unique motif, YWLIANSWxxDWGE (Baig et al., 2002), andhelminths included in this analysis are not the exception.

4. Discussion

The deduced amino acid sequence for cathepsin B from L. vannameishares most of the common features from cystein proteinases(McGrath, 1999). The LvCathB pro-region, which is strictly required inall cystein proteinases for the expression of the native enzyme (Vernetet al., 1995), is less conserved than themature protein as commonly ob-served among these proteinases, except when compared with closerspecies as those of the Penaeidae family. The cathepsin B deduced pro-teins of the three shrimp species included in the multiple alignment(Fig. 2) do not include the conserved GNDF motif in the pro-region se-quence, which is in agreement with previous observations since thismotif appears in all papain group members, except cathepsins B and C(Vernet et al., 1995).

Fig. 3. LvCathB mRNA expression relative to ribosomal protein L21 in six differentshrimp tissues. (Hm) haemocytes, (M) muscle, (Amp) terminal ampoule, (Gut) intes-tine, (MG) midgut gland, and (G) gills. Data represent mean values±std. error. Differ-ent letters denote statistical differences (pb0.05).

Table 3LvCathB activity on various tissues of the white shrimp Litopenaeus vannamei.

Tissue Specific activity (U/μg protein)a,b,c

Gastric juice 270.42±62.01Midgut gland 666.95±96.53Intestine 63.29±13.7Hemocytes 0.01±0.006Gills 0.170±0.08Eye stalk NDMuscle 0.001±0.002Pleopods ND

a Means of three replicates±SD.b One unit of enzyme activity (U) was defined by 1 μmol AMC released per min

under the assay condition.c ND = not detected.

38 A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

Our analysis showed that LvCathB protein contains twelve con-served cysteine residues, which suggests the potential formation ofsix disulphide bridges, however, two additional cysteines at thevery end of the carboxyl-terminal are also found. One of these cyste-ines, C294, is not conserved among species but present in the threepenaeid shrimp sequences, and C317 is unique to cathepsin B butconserved among species (Musil et al., 1991). Further studies con-structing a predictive model or the solved crystal structure of L. van-namei cathepsin B, and the evaluation of kinetic parameters of theenzyme may help to understand the biological function of these cys-teine residues.

As part of our results, and in agreement with other lysosomal en-zymes from shrimp species (Hu and Leung, 2004), the LvCathB mRNAwas detected in most of the evaluated shrimp tissues. Large amountsof the LvCathB mRNA were found on both the midgut gland and gut,organs primarily involved in the process of food digestion, just asreported for cathepsin L in the midgut gland of Metapenaeus ensis(Hu and Leung, 2004). However, transcripts and the active enzymewere also detected in no-digestive tissues including hemocytes,gills, muscle, and terminal ampule. Studies dealing with cathepsin Bfrom invertebrate species have reported that it is involved in control-ling vitellogenin hydrolysis in mosquitoes (Cho et al., 1999), and itcontrols follicular atresia in Culex pipiens pallens (Uchida et al.,2001). It has also been suggested that this enzyme may play a rolein regulating larval metamorphosis and development in species asthe grass shrimp Palaemonetes pugio (Griffitt et al., 2006). However,the high amount of LvCathB mRNA detected in gills and hemocytes,remain to be explained.

A high degree of variability in the amino acid sequences at sites re-lated to substrate recognition, binding and catalysis was found amongdigestive cathepsin Bs which may be related to structural and

Fig. 4. Relative expression of four proteinases in the midgut gland of shrimp at differ-ent starvation times. Data represent mean values±std. error. Asterisks denote statisti-cal differences (pb0.05).

functional implications, influencing in their substrate specificity andsusceptibility to the effect of inhibitors (Cathers et al., 2002), such ef-fects may lead to lack of classic cathepsin B role in lysosomal physiol-ogy and signaling (Krupa et al., 2002).

In addition, it is worth noting that the nematode and trematode di-gestive cathepsin B protein sequences included in the analysis share themotif YWLIANSWxxDWGE previously described by Baig et al. (2002).This motif surrounds the N219 residue of LvCathB from the active siteregion where hydrogen binding plays a key role in catalysis (Wanget al., 1994). It has been suggested that single- or double-point muta-tions occurring at the motif region may provoke critical modificationsin the proteinolytic character of cysteine proteinases affecting its sub-strate specificity. Furthermore, the evidence suggests that this motifevolved independently in different linages, and that it may have arisenthrough convergent evolution, since themotif is present in phylogenet-ically diverse helminthes, being the mammalian hemoglobin the selec-tive force leading to the presence of the motif (Baig et al., 2002).

Arthropod cathepsin B activity with extracellular digestive func-tion has been reported in a broad diversity of taxa exhibiting widefeeding habits (Aoki et al., 2003; Prabhakar et al., 2007; Sojka et al.,2008), therefore the presence of digestive cathepsin B enzymes in ar-thropods cannot be explained in terms of a single alimentary selectiveforce. Since P. borealis digestive cathepsin B shows characteristics of acold-adapted enzyme, its presence has been explained as an adapta-tion to the cold environments where this species is distributed(Aoki et al., 2003). However, in the white shrimp that inhabits tropi-cal waters, LvCathB was found to be highly active in those tissues re-lated to digestive processes, confirming its participation during foodprotein hydrolysis.

According to the phylogenetic analysis performed in this study,LvCathB groups with other decapods' cathepsin B lysosomal enzymes.In this regard we suggest that LvCathB functions primarily as a lyso-somal enzyme, and given the holocrine secretion found in the midgutgland of crustaceans, this enzyme is released once the cells disruptand proceed to digest food extracelullarly. This hypothesis is sup-ported by our findings of LvCathB mRNA and activity not only in themidgut gland, but also in other tissues whose main function is not re-lated to food protein digestion but to intracellular protein hydrolysis.The pleiotropic functions of LvCathB in tissues other than midgutgland should be further analyzed.

As part of the multienzyme network which carries out the proteinhydrolysis in animals (Barrett et al., 2004; Delcroix et al., 2006), ser-ine proteinases, like trypsin and chymotrypsin, are known to be themain digestive enzymes synthesized in the midgut gland of L. vanna-mei (Muhlia-Almazan and Garcia-Carreño, 2002); however, this andother reports on the presence of two cysteine proteinases, cathepsinL and cathepsin B, in the shrimp digestive system, (Hu and Leung,2004), may suggest a far more complex molecular machinery in-volved in protein digestion (Navarrete del Toro et al., 2011). Studies

Fig. 5. Neighbor-joining phylogenetic tree of 26 cathepsin B sequences, including 259 amino acids. GenBank accession numbers are indicated in parenthesis. Bootstrap values arenoted at the nodes, values under 50% have been discarded. Cathepsin B enzymes reported as digestive are marked with a black triangle.

39A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

on the effect of starvation in the midgut gland proteinases from shrimphave shown that both the gene expression of trypsin (Sanchez-Pazet al., 2003) and the enzyme activity of trypsin and chymotrypsin aresignificantly affected (Muhlia-Almazan and Garcia-Carreño, 2002). Ad-ditionally, the participation of cathepsin L, another lysosomal cysteinproteinase found in the midgut gland of shrimp species, during proteinhydrolysis in the midgut gland during extracellular food protein diges-tion has been observed in the penaeid shrimp M. ensis (Hu and Leung,2007).

Finally, we conclude that since the LvCathB mRNA is significantlyaffected by starvation, in the same way as other digestive enzymesare, their activities could be complemented, operating in a coopera-tive manner as a network. We believe that the pH changes foundalong the shrimp digestive tract, including those in and out themidgut gland, may explain the spatio-temporal secretion and partic-ipation of each enzyme, however, whether cathepsins L or B are themajor cystein proteases, acting in food protein digestion remains tobe analyzed.

Further studies are required to reveal the complete protein diges-tion machinery working after shrimp food intake, including the

specific sites of synthesis and activation of each enzyme. To date,there are no reports of aspartic proteinases as cathepsin D, found inthe midgut gland of shrimp; however, other marine crustacean spe-cies as lobsters are known to synthesize these enzymes as part oftheir extracellular digestion mechanism (Rojo et al., 2010).

Acknowledgments

We acknowledge support from CONACYT for grant SEP-2007-80935 to FGC, and ASC thanks for received salary. We also thank Dr.Arturo Sanchez-Paz for critical reading of this manuscript.

References

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J.,1997. Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res. 25 (17), 3389–3402.

Aoki, H., Ahsan, M.N., Watabe, S., 2003. Molecular cloning and characterization of ca-thepsin B from the hepatopancreas of northern shrimp Pandalus borealis. Comp.Biochem. Physiol. B 134, 681–694.

Baig, S., Damian, R.T., Peterson, D.S., 2002. A novel cathepsin B active site motif isshared by helminth bloodfeeders. Exp. Parasitol. 101, 83–89.

40 A. Stephens et al. / Comparative Biochemistry and Physiology, Part B 161 (2012) 32–40

Barrett, A.J., Rawlings, N.D., Woessner, J.F., 2004. The Handbook of Proteolytic Enzymes,2nd ed. Academic Press, London. 1666 pp.

Bown, D.P., Wilkinson, H., Jongsma, M.A., Gatehouse, J.A., 2004. Characterisation of cys-teine proteinases responsible for digestive proteolysis in guts of larval westerncorn rootworm (Diabrotica virgifera) by expression in the yeast Pichia pastoris. In-sect Biochem. Mol. Biol. 34, 305–320.

Cardenas-Lopez, J.L., Haard, N., 2005. Cystein proteinase activity in jumbo squid (Dosi-dicus gigas) hepatopancreas extracts. J. Food Biochem. 29, 171–186.

Cathers, B.E., Barrett, C., Palmer, J.T., Rydzewski, R.M., 2002. pH Dependence of inhibi-tors targeting the occluding loop of cathepsin B. Bioorg. Chem. 30, 264–275.

Cho, W.L., Tsao, S.M., Hays, A.R., Walter, R., Chen, J.S., Snigirevskaya, E.S., Raikhel, A.S.,1999. Mosquito Cathepsin B-like protease latent extraovarian precursor. J. Biol.Chem. 274 (19), 13311–13321.

Chomczynsky, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidi-nium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.

Delcroix, M., Sajid, M., Caffre, C., Lim, K., Dvorak, J., Hsieh, I., Bahgat, M., Dissous, C.,McKerrow, J.H., 2006. A multienzyme network functions in intestinal protein di-gestion by a Platyhelminth parasite. J. Biol. Chem. 281 (51), 39316–39329.

Dyrlov, B.J., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction of signalpeptides: signal P 3.0. J. Mol. Biol. 340, 783–795.

Ellis, R.C., 2004. Characterization of Cathepsin B mRNA and protein expression, enzy-matic activity and cellular localization following contusion spinal cord injury inrats. PhD Thesis. University of Florida. 85 pp.

Franta, Z., Frantova, H., Konvickova, J., Horn, M., Sojka, D., Mares, M., Kopacek, P., 2010.Dynamics of digestive proteolytic system during blood feeding of the hard tickIxodes ricinus. Parasit. Vectors 3, 119.

Griffitt, R.J., Chandler, G.T., Greig, T.W., Quattro, J.M., 2006. Cathepsin B and glutathioneperoxidase show differing transcriptional responses in the grass shrimp, Palaemo-netes pugio following exposure to three xenobiotics. Environ. Sci. Technol. 40 (11),3640–3645.

Halangk, W., Lerch, M.M., Brandt-Nedelev, B., Roth, W., Ruthenbuerger, M., Reinheckel,T., Domschke, W., Lippert, H., Peters, C., Deussing, J., 2000. Role of cathepsin B in in-tracellular trypsinogen activation and the onset of acute pancreatitis. J. Clin. Invest.106, 773–781.

Harrop, S.A., Sawangjaroen, N., Prociv, P., Brindley, P.J., 1995. Characterization and lo-calization of cathepsin B proteinases expressed by adult Ancylostoma caninumhookworms. Mol. Biochem. Parasitol. 71, 163–171.

Hillis, D.M., Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessingconfidence in phylogenetic analysis. Syst. Biol. 42, 182–192.

Hu, K.J., Leung, P.C., 2004. Shrimp cathepsin L encoded by an intronless gene has pre-dominant expression in hepatopancreas, and occurs in the nucleus of oocyte.Comp. Biochem. Physiol. B 137, 21–33.

Hu, K.J., Leung, P.C., 2007. Food digestion by cathepsin L and digestion-related rapid celldifferentiation in shrimp hepatopancreas. Comp. Biochem. Physiol. B 146, 69–80.

Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation datamatrices from protein sequences. Comput. Appl. Biosci. 8, 275–282.

Kollien, A.H., Waniek, P.J., Nisbet, A.J., Billingsley, P.F., Schaub, G.A., 2004. Activity andsequence characterization of two cysteine proteases in the digestive tract of the re-duviid bug Triatoma infestans. Insect Mol. Biol. 13, 569–579.

Krupa, J.C., Hasnain, S., Nagler, D.K., Macnard, R., Mort, J.S., 2002. S2′ substrate specific-ity and the role of His110 and His111 in the exopeptidase activity of human ca-thepsin B. Biochem. J. 361, 613–619.

Le Boulay, C., van Wormhoudt, A., Sellos, D., 1996. Cloning and expression of cathepsinL-like proteinases in the hepatopancreas of the shrimp Penaeus vannamei duringthe intermolt cycle. J. Comp. Physiol. B 166, 310–318.

Lerch, M.M., Halangk, W., 2006. Human pancreatitis and the role of cathepsin B. Gut 55(9), 1228–1230.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2_ΔΔCT method. Methods 25, 402–408.

McGrath, M.E., 1999. The lysosomal cysteine proteases. Annu. Rev. Biophys. Biomol.Struct. 28, 181–204.

Menard, R., Carriere, J., LaFlamme, P., Plouffe, C., Khouri, H.E., Vernet, T., Tessier, D.C.,Thomas, D.Y., Storer, A.C., 1991. Contribution of the glutamine 19 side chain totransition-state stabilization in the oxyanion hole of papain. Biochemistry 30,8924–8928.

Muhlia-Almazan, A., Garcia-Carreño, F.L., 2002. Influence of molting and starvation onthe synthesis of proteolytic enzymes in the midgut gland of the white shrimpPenaeus vannamei. Comp. Biochem. Physiol. B 133 (3), 383–394.

Muhlia-Almazan, A., Sanchez-Paz, A., Garcia-Carreño, F.L., 2008. Invertebrate trypsins:a review. J. Com. Physiol. B 178 (6), 655–672.

Musil, D., Zucic, D., Turk, D., Engh, R.A., Mayr, I., Huber, R., Popovic, T., Turk, V., Towatari,T., Katunuma, N., Bode, W., 1991. The refined 2.15 X-ray crystal structure ofhuman liver cathepsin B: the structural basis for its specificity. EMBO J. 10 (9),2321–2330.

Navarrete del Toro, M.A., Garcia-Carreño, F.L., Cordova-Murueta, J.H., 2011. Comparisonof digestive proteinases in three penaeids. Aquaculture 317, 99–106.

Prabhakar, S., Chen, M.S., Elpidina, E.N., Vinokurov, K.S., Smith, C.M., Marshall, J.,Oppert, B., 2007. Sequence analysis and molecular characterization of larval mid-gut cDNA transcripts encoding peptidases from the yellow mealworm, Tenebriomolitor L. Insect Mol. Biol. 16, 455–468.

Ranjit, N., Zhan, B., Stenzel, D.J., Mulvenna, J., Fujiwara, R., Hotez, P.J., Loukas, A., 2008. Afamily of cathepsin B cysteine proteases expressed in the gut of the human hook-worm, Necator americanus. Mol. Biochem. Parasitol. 160, 90–99.

Rehman, A., Jasmer, D.P., 1999. Defined characteristics of cathepsin B-like proteinsfrom nematodes: inferred functional diversity and phylogenetic relationships.Mol. Biochem. Parasitol. 102, 297–310.

Ren, Q., Zhang, X.-W., Sun, Y.-D., Sun, S.-S., Zhou, J., Zhao, X.-F., Wang, J.-X., 2010. Twocysteine proteinases respond to bacterial and WSSV challenge in Chinese whiteshrimp Fenneropenaeus chinensis. Fish Shellfish Immunol. 29 (4), 551–556.

Rojo, L., Muhlia-Almazan, A., Saborowski, R., Garcia-Carreño, F., 2010. Aspartic Cathep-sin D endopeptidase contributes to extracellular digestion in clawed lobstersHomarus americanus and Homarus gammarus. Mar. Biotechnol. 12, 696–707.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstruct-ing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Sajid, M., McKerrow, J.H., Hansell, E., Mathieu, M.A., Lucas, K.D., Hsieh, I., Greenbaum,D., Bogyo, M., Salter, J.P., Lim, K.C., Franklin, C., Kim, J.H., Caffrey, C.R., 2003. Func-tional expression and characterization of Schistosoma mansoni cathepsin B and itstrans-activation by an endogenous asparaginyl endopeptidase. Mol. Biochem.Parasitol. 131, 65–75.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual, 3rd ed. ColdSpring Harbor Laboratory Press, NY.

Sanchez-Paz, A., Garcia-Carreño, F.L., Muhlia-Almazan, A., Hernandez-Saavedra, N.,Yepiz-Plascencia, G., 2003. Differential expression of trypsin mRNA in the whiteshrimp (Penaeus vannamei) midgut gland under starvation conditions. J. Exp.Mar. Biol. Ecol. 292, 1–17.

Sloane, B.F., 1990. Cathepsin B and cystatins: evidence for a role in cancer progression.Semin. Cancer Biol. 1 (2), 137–152.

Sojka, D., Franta, Z., Horn, M., Hajdusek, O., Caffrey, C., Mares, M., Kopacek, P., 2008. Pro-filing of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolu-tionarily conserved network of aspartic and cysteine peptidases. Parasit. Vectors1, 7–21.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA 4.1: molecular evolutionary ge-netics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

Teschke, M., Saborowski, R., 2004. Cysteine proteinases substitute for serine protein-ases in the midgut glands of Crangon crangon and Crangon allmani (Decapoda: Car-idea). J. Exp. Mar. Biol. Ecol. 316, 213–229.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivityof progressive multiple sequence alignment through sequence weighting, posi-tion-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,4673–4680.

Uchida, K., Ohmori, D., Ueno, T., Nishizuka, M., Eshita, Y., Fukunaga, A., Kominami, E.,2001. Preoviposition activation of cathepsin-like proteinases in degenerating ovar-ian follicles of the mosquito Culex pipiens pallens. Dev. Biol. 237 (1), 68–78.

Vernet, T., Berti, P.J., de Montigny, C., Musil, R., Tessier, D.C., Menard, R., Magny, M.C.,Storer, A.C., Thomas, D.Y., 1995. Processing of the papain precursor. J. Biol. Chem.270 (18), 10838–10846.

Wang, J., Xiang, Y.-F., Lim, C., 1994. The double catalytic triad, Cys25-His159-Asp158and Cys25-His159-Asn175, in papain catalysis: role of Asp158 and Asn175. ProteinEng. 7, 75–82.

Williamson, A.L., Brindley, P.J., Knox, D.P., Hotez, P.J., Loukas, A., 2003. Digestive prote-ases of blood-feeding nematodes. Trends Parasitol. 19, 417–423.

Wilson, L.R., Good, R.T., Panaccio, M., Wijffels, G.L., Sandeman, R.M., Spithill, T.W., 1998.Fasciola hepatica: characterization and cloning of the major cathepsin B proteasesecreted by newly excysted juvenile liver fluke. Exp. Parasitol. 88, 85–94.

Yatsuda, A.P., Bakker, N., Krijgsveld, J., Knox, D.P., Heck, A.J., de Vries, E., 2006. Identifi-cation of secreted cystein proteases from the parasitic nematode Haemonchus con-tortus detected by biotinylated inhibitors. Infect. Immun. 74 (3), 1989–1993.

Zar, J.H., 1984. Biostatistical Analysis, 4th ed. Prentice-Hall, NJ.