Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the...
Transcript of Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the...
![Page 1: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/1.jpg)
1029
Blood pressure (BP) displays daily variation in healthy peo-ple, peaking midmorning and falling during night-time
sleep.1 Loss or attenuation of the nocturnal BP dip (referred to as nondipping) incurs significant health risk by promoting cardiac, renal, and vascular injury.2 Nondipping is an early characteristic of diabetes mellitus preceding and predicting the development of microalbuminuria.3 In patients with chronic kidney disease, nocturnal hypertension is associated with a faster rate of decline in renal function.4,5 Even if clinic or mean 24-hour ambulatory BP is normal, loss of dipping significantly increases the risk of dialysis or incident cardiovascular mortal-ity.6,7 Lowering sleep BP alone reduces risk of cardiovascular disease,8 suggesting that restoration of normal day:night BP variation is an important therapeutic goal.
Clinical studies show that the day:night variation in BP is strongly correlated with renal sodium excretion.9 The kidney is an important long-term regulator of BP and impaired pressure
natriuresis may contribute to nocturnal hypertension10: BP remains elevated during sleep to facilitate sodium excretion and maintain 24-hour sodium balance.11,12 Certainly, hyper-tensive and prehypertensive patients have a blunted day:night pattern of sodium excretion and excrete a greater fraction of their daily output at night.13 Moreover, dietary sodium restric-tion can restore a dipping BP profile in salt-sensitive hyperten-sive patients,14 presumably by reducing sodium load below the day-time excretory threshold. Mechanistically, hydrochloro-thiazide, either alone15 or in combination with amlodipine16 or valsartan,17 reduces night-time BP and restores dipping BP in nondipping hypertensive patients. This suggests that inappro-priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP.
NCC activity is modulated by multiple hormonal sys-tems acting through a regulatory cascade of serine/threonine kinases, including WNKs, SPAK, and OSR1.18 These control
Abstract—Blood pressure (BP) normally dips during sleep, and nondipping increases cardiovascular risk. Hydrochlorothiazide restores the dipping BP profile in nondipping patients, suggesting that the NaCl cotransporter, NCC, is an important determinant of daily BP variation. NCC activity in cells is regulated by the circadian transcription factor per1. In vivo, circadian genes are entrained via the hypothalamic–pituitary–adrenal axis. Here, we test whether abnormalities in the day:night variation of circulating glucocorticoid influence NCC activity and BP control. C57BL6/J mice were culled at the peak (1:00 AM) and trough (1:00 PM) of BP. We found no day:night variation in NCC mRNA or protein but NCC phosphorylation on threonine53 (pNCC), required for NCC activation, was higher when mice were awake, as was excretion of NCC in urinary exosomes. Peak NCC activity correlated with peak expression of per2 and bmal1 (clock genes) and sgk1 and tsc22d3 (glucocorticoid-responsive kinases). Adrenalectomy reduced NCC abundance and blunted the daily variation in pNCC levels without affecting variation in clock gene transcription. Chronic corticosterone infusion increased bmal1, per1, sgk1, and tsc22d3 expression during the inactive phase. Inactive phase pNCC was also elevated by corticosterone, and a nondipping BP profile was induced. Hydrochlorothiazide restored rhythmicity of BP in corticosterone-treated mice without affecting BP in controls. Glucocorticoids influence the day:night variation in NCC activity via kinases that control phosphorylation. Abnormal glucocorticoid rhythms impair NCC and induce nondipping. Night-time dosing of thiazides may be particularly beneficial in patients with modest glucocorticoid excess. (Hypertension. 2016;67: 1029-1037. DOI: 10.1161/HYPERTENSIONAHA.115.06977.) • Online Data Supplement
Key Words: cardiovascular disease ■ circadian rhythm ■ diabetes mellitus ■ hypertension ■ risk factors
Received December 31, 2015; first decision January 11, 2016; revision accepted February 8, 2016.From the The British Heart Foundation Centre for Cardiovascular Science (J.R.I., W.O., T.S.P., A.R.H., R.W.H., N.D., D.J.W., J.W.D., M.A.B.) and The
Centre for Integrative Physiology (P.W.F.), The University of Edinburgh, Edinburgh, United Kingdom; and Dietetics, Nutrition, and Biological Sciences Department, Queen Margaret University, Musselburgh, United Kingdom (E.A.S.A.-D.).
The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA. 115.06977/-/DC1.
Correspondence to Matthew A. Bailey, University/BHF Centre for Cardiovascular Science, The Queen’s Medical Research Centre, The University of Edinburgh, 47 Little France Crescent, Edinburgh EH16 4TJ, United Kingdom. E-mail [email protected]
© 2016 The Authors. Hypertension is published on behalf of the American Heart Association, Inc., by Wolters Kluwer. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution, and reproduction in any medium, provided that the original work is properly cited.
Glucocorticoids Induce Nondipping Blood Pressure by Activating the Thiazide-Sensitive Cotransporter
Jessica R. Ivy, Wilna Oosthuyzen, Theresa S. Peltz, Amelia R. Howarth, Robert W. Hunter, Neeraj Dhaun, Emad A.S. Al-Dujaili, David J. Webb, James W. Dear, Peter W. Flatman,
Matthew A. Bailey
Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYPERTENSIONAHA.115.06977
Circadian Rhythm
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 2: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/2.jpg)
1030 Hypertension May 2016
phosphorylation at conserved residues in the N terminus, and thereby influence NCC activity and trafficking into the api-cal membrane.18 The distal tubule also expresses the canoni-cal circadian transcription factors per1/2, bmal1, clock, and cry1/2,19 and a recent cell-line study demonstrated tran-scriptional regulation of NCC and WNK kinases by per1.20 It is increasingly evident that circadian transcription factors influence renal function.21 Glucocorticoids play an impor-tant role in the entrainment of renal clocks to the day:night cycle.22 In the aldosterone-sensitive distal nephron, glucocor-ticoid actions are normally limited because of metabolism by 11β-hydroxysteroid dehydrogenase type 2 (11βHSD2).23 However, modest glucocorticoid excess promotes sodium retention by activating transport in the aldosterone-sensitive distal nephron.24 Such perturbations, whether iatrogenic25 or because of conditions such as Cushing syndrome,26 also impair BP rhythmicity and induce a nondipping BP profile.
Because 11βHSD2 is only expressed in some cells of the distal convoluted tubule (DCT), we hypothesized that gluco-corticoids set the day:night variation of NCC activity. Using the complementary approaches of adrenalectomy and chronic corticosterone infusion, we found that flattening the day:night variation in hypothalamic–pituitary–adrenal axis activity also flattened the variation in NCC activity, inducing a nondipping BP, which could be restored by thiazide therapy.
MethodsDetailed Methods are available in the online-only Data Supplement.
AnimalsC57BL6J/Ola mice (Harlan, United Kingdom) were used between 2 and 4 months of age. Mice were acclimatized to a 12-hour light:dark cycle for at least 2 weeks before experiments and given free access to water and standard chow (maintenance diet 1; Special Diet Services, Essex, United Kingdom). The lights were turned on at 7:00 AM local time, and this was defined as Zeitgeber time 0 (ZT0); lights were turned off at 7 PM (ZT12). Experiments were performed under license from the UK Home Office and after approval by the University veterinary services.
Kidney CollectionMice were culled by cervical dislocation <1-minute after removal from the holding room. Culls were performed at both 1:00 PM (ZT6) and 1:00 AM (ZT18) local time. The kidneys were rapidly excised and decapsulated, snap-frozen on dry ice and stored at −80°C.
Bilateral AdrenalectomyThis was performed under isoflurane anesthesia and buprenorphine (Vetergesic 0.1 mg/kg sc) analgesia. After recovery, adrenalecto-mized and control mice were individually housed and given ad libi-tum access to 0.9% saline and tap water.
Chronic Corticosterone InfusionElastomer pellets were used to encapsulate corticosterone for slow release. In vitro, the release rate was ≈3.7 mg/kg per day, and this was maintained during a 4-week period. Pellets were implanted sub-cutaneously under isoflurane anesthesia and buprenorphine analgesia (Vetergesic 0.1 mg/kg sc).
Plasma Corticosterone MeasurementsApproximately 20-μL blood was sampled from conscious mice via the tail vein at local time 7:00 AM and 7:00 PM, unless otherwise stated. Plasma was stored at −80°C before measurement of corticosterone
concentration by commercial EIA (Enzo Life Sciences, Exeter, United Kingdom).
Daily Variation in Renal ExcretionControl mice were single housed in metabolic cages, and after 5 days of acclimatization, food intake, water intake, urine output, and body weight were measured at 12-hour intervals. The concentration of sodium in urine was measured by flame photometry and used to calculate excretion rate in μmol/h. Urine concentration of both aldo-sterone and corticosterone was measured by ELISA.27
Measurement of NCC in Urinary ExosomesThe number of exosomes in urine samples was measured by Nanoparticle Tracking Analysis (NanoSight Ltd, Amesbury, United Kingdom), as described.28
ImmunoblottingWestern blots were performed on homogenized whole-kidney samples as we have described,29 using primary antibodies against NCC, pThr53-NCC, anti-pThr58-NCC, anti-pSer71-NCC, and anti-NKCC2. Images were developed by electrochemiluminescence and quantified by densitometry using ImageJ, as described.30 The cross-reactivity of NCC phospho-antibodies was determined by immuno-precipitation experiments. Anti-pThr53-NCC and anti-pSer71-NCC were selective for NCC but anti-pThr58-NCC showed significant cross-reactivity with NKCC2 (Figure S1).
Quantitative Polymerase Chain ReactionRNA was extracted from whole kidney and used for quantitative polymerase chain reactions with the Roche Universal ProbeLibrary (online-only Data Supplement; Table). TBP, HPRT, and 18S rRNAs were used as endogenous control genes.
ImmunofluorescenceKidneys were fixed by aortic perfusion of 4% paraformaldehyde and then embedded in paraffin, sectioned at 5 μm and mounted onto glass slides. Sections were double-immunostained to colocalize NCC expression with glucocorticoid receptor, mineralocorticoid receptor (MR), or 11βHSD2.
BP MeasurementRadiotelemetry devices were inserted into male C57BL/6 mice under isoflurane anesthesia. Data were collected during a 1-minute period every 30 minutes at an acquisition rate of 1 kHz. Basal measurements were obtained >7 days before corticosterone (n=5) or blank (n=6) elastomer pellets were implanted subcutaneously. After 11 days, hydrochlorothiazide (80 mg/kg per day) was administered in drinking water. Hydrochlorothiazide concentration in plasma samples taken on the final experimental day was measured by liquid chromatography–mass spectrometry.
Statistical AnalysisData are presented as mean±95% confidence interval. The number of biological replicates (n) for each experimental group is given in the figure legends along with the test used for statistical analysis. The arithmetic mean BP was calculated for periods of subjective day, when mice were asleep, and subjective night, when mice were awake. Cosinor analysis was also used to calculate mesor (rhythm-adjusted mean) as the central tendency, period, amplitude, and acrophase. Data were smoothed using a moving average during 5 hours. For each experimental phase (baseline, corticosterone, and thiazide), the smoothed data for each individual mouse was collected in bins of 5 consecutive days and fitted by the least squares methods to a cosinor curve using software available at www.circadian.org, as described.31 Robustness/prominence of the rhythm was calculated as the percent-age of the variance accounted for by the cosinor model. Statistical significance of the goodness of fit was P<0.000001 for each analysis and was corrected for multiple tests.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 3: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/3.jpg)
Ivy et al NCC Activity and the Daily Rhythm of BP 1031
Results
Basal Day:Night Variation in NCC PhosphorylationUnder basal conditions, BP and heart rate had a robust 24-hour rhythm, dipping during subjective day when mice were in the inactive phase (Figure S2). Urinary excretion of Na and K also had this variation, as did the urinary excretion of aldosterone and corticosterone (Figure S3).
Cosinor analysis identified peak systolic blood pressure (SBP) at ≈ZT 18 hours, (Table S2) with the nadir at ≈ZT 6 hours. We therefore assessed the renal mRNA expression of genes associated with circadian control, corticosteroid action, and within the NCC regulatory cascade at these 2 time points (Figure 1A). Of the circadian genes, per2, cry 1, and bmal1 had a higher expression when animals were active; but there was no difference in expression of per1 or cry2 at these time points. The expression of the glucocorticoid-response genes, sgk1 and tsc22d3 (glucocorticoid-induced leucine zipper protein), was higher when mice were active than during the inactive phase. We found no day:night variation for the genes encoding the MR, the glucocorticoid receptor, or 11βHSD2. Co-localization of MR and glucocorticoid receptor with NCC was confirmed (Figure S4), but 11βHSD2 was only expressed in a small number of distal-DCT cells (Figure S5).
We found no day:night variation in slc12a3 (encodes NCC) expression or in any other transcripts within the NCC regulatory cascade at these 2 time points. The transcriptional changes detected here are largely consistent with those pub-lished in the CIRCA database.32 We found no day:night varia-tion for per1, cry2, and wnk1 expression. These genes do have a circadian transcriptional profile,32 but our time points of ZT6 and ZT18 correspond to midway point between the peak and nadir of expression.
At the protein level, total NCC abundance had no day:night variation (Figure 1B), whereas the abundance of NCC phos-phorylated on Thr53 (henceforth pNCC) was higher during the active phase in both male (Figure 1C) and female mice (Figure S6). The phosphorylation of NCC on Ser71 had no day:night variation (Figure S7).
Phosphorylation of Thr53 increases the half-life of NCC in the apical membrane33 and closely correlates to transporter activity.34 We measured the excretion of NCC in urinary
exosomes as a noninvasive surrogate of transporter abundance in the DCT apical membrane. As for pNCC abundance, exo-somal NCC excretion had a marked day:night variation and was higher during the active phase (Figure 1D).
Adrenalectomy Reduces NCC Expression and Blunts Day:Night pNCC VariationAdrenalectomy significantly reduced circulating corticos-terone levels and abolished day:night variation (Figure 2A). Although slc12a3 mRNA levels were not changed by adrenal-ectomy (Figure S8), total NCC protein was reduced by ≈50% (Figure 2B). There was no significant day:night variation in pNCC levels in adrenalectomized mice (Figure 2C), and the variation in tsc22d3 expression was blunted (Figure S8). The day:night variation in the circadian genes per2, cry1, and bmal1 was maintained after adrenalectomy (Figure S8).
Clamping Plasma Corticosterone Abolishes Daily pNCC VariationNext, we implanted slow-release corticosterone pellets, which eliminated the day:night variation and clamped corticosterone in the midphysiological range at ≈200 nmol/L (Figure 3A). The day:night variation in aldosterone levels was not affected by this maneuver (Figure 3B). Slc12a3 mRNA (Figure S9) and total NCC abundance (Figure 3C; Figure S10) were not changed by chronic corticosterone infusion but pNCC varia-tion was abolished (Figure 3D; Figure S10). This reflected increased pNCC levels during the inactive phase in corticos-terone-treated mice. Glucocorticoid clamping also increased expression of tsc2233 and sgk1 during the inactive period, as well as levels of cry1, bmal1 and per1 (Figure S9). A small but significant reduction in active phase urinary sodium excre-tion was recorded in corticosterone-treated mice (Figure 3E), which was not attributable to reduced food intake (Figure 3F). Sodium excretion during the inactive phase was not different from controls.
Clamping Plasma Corticosterone Induces a Nondipping BP ProfileSBP (Figure 4A) and diastolic blood pressure (DBP; Figure 4B) were measured in mice by radiotelemetry before and after implantation of slow-release corticosterone (n=5)
Table. Cosinor Analysis of Systolic Blood Pressure in C57BL6 Mice Treated With Chronic Corticosterone or Vehicle Followed by Chronic Hydrochlorothiazide Treatment (80 mg/kg)
Baseline Pellet HCTZ
Variable Vehicle Corticosterone Vehicle Corticosterone Vehicle Corticosterone
Period, h 24 h 10 min±0 h 16 min
24 h 12 min±0 h 20 min
24 h 05 min±0 h 13 min
23 h 12 min±4 h 25 min
23 h 40 min±0 h 34 min
24 h 18 min±0 h 34 min
Acrophase (ZT) 16 h 59 min±0 h 37 min
16 h 50 min±0 h 53 min
16 h 56 min±0 h 47 min
14 h 50 min±0 h 53 min
17 h 16 min±1 h 12 min
16 h 13 min±1 h 29 min
Amplitude, mm Hg 9.9±2.6 9.3±2.9 8.4±1.9 4.4±3.2* 8.6±1.07 6.7±2.3 ‡
MESOR, mm Hg 123±3 123±6 123±2 130±5† 121±3 126±3
Robustness, % 72.5±11.2 76.2±7.4 73.1±9.4 39.6±28.0† 70.5±12.6 62.7±15.9
HCTZ indicates hydrochlorothiazide; and ZT, Zeitgeber time. Data are mean±95% confidence interval and were analyzed by matched 2-way ANOVA with Sidak post-test made between baseline, pellet, and HCTZ. Values that are significantly different from baseline are italicized.
*P<0.0001; †P<0.001, ‡P<0.01.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 4: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/4.jpg)
1032 Hypertension May 2016
or control (n=6) pellets and then during thiazide therapy. Before implantation, daily rhythms of BP, heart rate, and locomotor activity were robust; acrophase, amplitude, and mesor were not different between groups (Table). Pellets were then implanted and, after recovery from anesthetic, the vehicle group immediately regained the daily rhythm of SBP (Figures 4A, 5A, and 5C) and DBP (Figures 4B and 5D), which were not different from preimplant values. The corticosterone-treated group took longer to regain 24-hour periodicity and when they did, SBP was raised during sleep compared with baseline values in all mice (Figure 5A and 5C). Corticosterone treatment increased DBP both in the active and in the inactive phases (Figure 5D). Changes to the day:night variation in SBP did not reflect changes in either locomotor activity or heart rate, as assessed by telemetry (Figure S11).
Cosinor analysis was performed on 5-day bins of steady-state SBP (indicated by the blue boxes on Figure 4A). Corticosterone treatment significantly (P<0.001) increased
mesor and significantly decreased both the amplitude and robustness (P<0.001) of the underlying rhythm (Table).
Chronic Thiazide Therapy Restores a Dipping BP ProfileIn the next phase of the experiment, the mice were given hydrochlorothiazide in drinking water, achieving a plasma concentration of ≈15 μmol/L in both the groups. This did not alter BP in the control group but had a significant antihyper-tensive effect in the corticosterone-treated mice (Figure 5B). Thiazide reduced SBP during the inactive phase without affecting SBP during the active phase (Figure 5C). A similar profile was observed for DBP, being reduced by hydrochlo-rothiazide treatment when mice were asleep but remaining elevated during the active phase (Figure 5D). Cosinor analysis showed that hydrochlorothiazide restored a robust day:night rhythm for SBP in corticosterone-treated mice, reducing mesor and increasing amplitude to levels not significantly dif-ferent from controls (Table).
Figure 1. Day:night variation of gene expression (A), total NaCl cotransporter (NCC) protein (B), phosphorylated NCC (pT53-NCC; C), and exosomal NCC (D) in C57BL6 mice. Kidneys were harvested at Zeitgeber time (ZT) 6 (day) and ZT18 (night) for immunoblots and quantitative polymerase chain reaction using whole kidney homogenate. A–C, Exosomal NCC was measured by Nano-tracking gated for 20- to 100-nm particles labeled with Q-dot conjugated NCC antibody in 12-hour urine samples collected between ZT0–12 (day/sleep) and ZT12–0 (night/active). Two-way ANOVA with post hoc Sidak correction was carried out on gene expression data (n=15). Day:night total (n=6) and phosphorylated NCC (n=6) normalized densities in arbitrary units were compared by unpaired t tests. Exosomal NCC was corrected for urinary volume and analyzed by paired t tests. *P<0.0001, †P<0.001, ‡P<0.01, nonsignificant (ns) P>0.05. All data are mean±95% confidence interval.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 5: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/5.jpg)
Ivy et al NCC Activity and the Daily Rhythm of BP 1033
DiscussionWe find that NCC has a day:night variation of activity determined by phosphorylation of existing protein rather than by gene transcription. This variation is influenced by the rhythm of circulating glucocorticoid. If this hormonal profile is flattened, NCC is inappropriately activated dur-ing the inactive phase, inducing a nondipping BP profile. Hydrochlorothiazide, which inhibits NCC, reduced BP during the inactive phase only in corticosterone-treated mice, restor-ing a robust day:night variation in BP.
Daily NCC Activity Is Determined by PhosphorylationAround 4000 genes in the DCT exhibit day:night variation at the transcriptional level, of which ≈10% fit a circadian profile with a period of 24 hours.19 Genes found with circadian rhyth-micity included clock transcription factors, such as per1/2, cry1/2, and bmal1.19,32 Glucocorticoid-induced genes, such as the kinase sgk1 and the transcriptional regulator tsc22d3, also displayed a circadian profile of transcription at whole-kidney level.32 Our data are consistent with this literature (day:night
Figure 2. Day:night variation of plasma corticosterone (A and B), total NaCl cotransporter (NCC; C), and phosphorylated NCC (pNCC) protein (D) in adrenalectomized (ADX) and adrenal intact C57BL6 mice. A pooled profile of 24-hour plasma corticosterone was generated from composite terminal and spot plasma collections taken from ADX and control mice (A, n=8–20). Matched 2-way ANOVA was only performed on Zeitgeber time (ZT) 0 and ZT12 spot plasma samples collected concomitantly (B). The bar at the top of A and B indicates periods of light and dark. Kidneys were harvested at during the day when mice were asleep (ZT6) or at night when mice were awake (ZT18). Signal densities for immunoblots were normalized to Coomassie signal densities and compared with 2-way ANOVAs followed by post hoc Sidak correction. *P<0.0001, †P<0.001, ‡P<0.01, §P<0.05, nonsignificant (ns) P>0.05. All data are mean±95% confidence interval.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 6: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/6.jpg)
1034 Hypertension May 2016
transcriptional changes were found in per2, cry1, bmal1, sgk1, and tsc22d3); however, a limitation of our work is that it lacked the temporal resolution to detect rhythmic changes that have been reported for per1,19,32 cry2,19,32 mo25α,32 cul3,32 and WNK132 expression. It is also important to note that we assessed transcription at the whole-kidney level and can-not, therefore, discriminate between glucocorticoid-sensitive regions of the kidney and those with minimal glucocorti-coid sensitivity (ie, the aldosterone-sensitive distal nephron) because of expression of 11βHSD2. In such regions sgk1 and tsc22d3 might be regulated by aldosterone.
Slc12a3, which encodes NCC, had no day:night rhythm of transcription,19,32 as we have confirmed here. Our data at the whole-kidney level underscore the concept that day:night vari-ation in NCC activity is regulated by post-transcriptional mod-ification of existing protein.19 Of the 3 important residues thus far defined, our data show day:night control of phosphoryla-tion of Thr53, but not Ser71. We do not present data for Thr58 phosphorylation, as we found significant cross-reactivity of this antibody with NKCC2, which is present in our samples.
pNCC abundance is often used as a surrogate marker for NCC activity as it correlates with thiazide-sensitive transport in cells34,32 and in the intact kidney.29 We chose not to assess thiazide-sensitive sodium transport directly because the req-uisite approaches either increase corticosterone35 or abolish day:night rhythms of renal function.36 We instead used the excretion of NCC in urine exosomes to provide a noninvasive
snap-shot of transporter abundance in the apical membrane of the DCT.37,38 Exosomal NCC excretion was higher when mice were active, as recently described in healthy humans.39 In combination, these complementary experimental strategies indicate that thiazide-sensitive sodium transport is normally reduced during the inactive phase, correlating with the fall in BP and the lower ambient glucocorticoid level.
How Do Glucocorticoids Influence Daily Variation in NCC Activity?The circadian rhythm of circulating glucocorticoids can entrain renal clock gene transcription.22 One hypothesis is that circa-dian transcription factors are the link between circulating cor-ticosterone and phosphorylation/activation of NCC. Per1 does regulate NCC activity, binding the promotor of slc12a3 and wnk4 to positively regulate transcription in a DCT cell line.20 In our study, adrenalectomy abolished the daily variation of pNCC abundance but did not uniformly affect the variation in clock gene expression. A clearer relationship was observed in mice chronically infused with glucocorticoid. In this scenario, increased pNCC levels during the inactive phase were associ-ated with increased transcription of per1, cry1, and bmal1. A clearer relationship to pNCC abundance across all experi-mental paradigms was with sgk1 and tsc22d3 expression. An alternative hypothesis is that the circadian variation in gluco-corticoids directly controls NCC activity by engaging a net-work of regulatory kinases downstream of a corticosteroid
Figure 3. Day:night variation of plasma corticosterone (A), urinary aldosterone (B), total NaCl cotransporter (NCC; C), phosphorylated NCC (pNCC) protein (D), urinary sodium (E), and food intake (F) in chronic corticosterone (Cort)- and vehicle-treated C57BL6 mice. Plasma was sampled in Cort- and vehicle-treated mice at Zeitgeber time (ZT) 0 and ZT12. Urinary aldosterone and sodium were measured in samples collected during the 12 hours of subjective day, when mice were asleep (ZT0–12) and over subjective night when mice were awake (ZT12–0). Food intake was measured during this time. These urine and food intake data are the average for each mouse during 2 consecutive days’ measurements. Kidneys were harvested at ZT6 (day/sleep) and ZT18 (night/active) for immunoblots using whole kidney homogenate. Plasma corticosterone, urinary aldosterone and sodium excretion, and food intake data were compared with matched 2-way ANOVA with post hoc Sidak correction. Normalized signal densities for immunoblots were analyzed using 2-way ANOVA with post hoc Sidak correction. *P<0.0001, †P<0.001, ‡P<0.01, §P<0.05, nonsignificant (ns) P>0.05. All data are mean±95% confidence interval.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 7: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/7.jpg)
Ivy et al NCC Activity and the Daily Rhythm of BP 1035
receptor and upstream of the WNK/SPAK/OSR1 kinase cas-cade. Indeed, synthetic glucocorticoids increase the expres-sion/activity of NCC,40,41 and recent studies show that sgk1 enhances NCC activity indirectly by suppressing degradation of WNK1 kinase.42 Because we found that most DCT cells do not express 11βHSD2, corticosterone could induce sgk1 expression through either MR or glucocorticoid receptor activation43: MR is the most plausible route because MR antagonists abolish the endogenous rhythm of the WNK1/SPAK/OSR1 phosphoryla-tion cascade.19 Nevertheless, an important limitation to our study is that gene expression and protein phosphorylation were assessed at only 2 time points. This lack of temporal resolution precludes cosinor analysis of these data sets and limits our abil-ity to assess the relationship between glucocorticoid-activated transcriptional pathways and NCC activation.
How Do Glucocorticoids Induce a Nondipping BP Profile?We chronically infused corticosterone such that plasma lev-els were held midway between the physiological peak and trough. This rapidly induced nondipping BP, reflecting a sig-nificant rise in BP during the inactive phase. Our approach models the loss of nocturnal BP observed in patients receiving chronic glucocorticoid therapy.25 Glucocorticoid insufficiency in humans and adrenalectomy in mice also achieve a flat daily cortisol/corticosterone profile. In this setting, the reduced day:night BP variation reflects a low-peak BP during waking hours.26,35 Overall, these data indicate that an intact glucocor-ticoid rhythm is essential for the normal daily variation in BP:
loss of this dynamic glucocorticoid control may contribute to increased cardiovascular mortality in patients on chronic glu-cocorticoid therapy.36
What accounts for the loss of dip in our study? It is unlikely to reflect increased sympathetic drive in the inactive period,37 since the daily variation in heart rate was not affected by corti-costerone treatment. We also discount a major role for reduced arterial compliance38 because DBP increased (throughout the 24-hour cycle), rather than fell, during corticosterone treatment. The most plausible explanation of our data are that corticoste-rone activates the WNK/SPAK/OSR1 cascade and clamps NCC on throughout the 24-hour cycle. This impairs the normal modu-lation of BP by pressure natriuresis, and in consequence BP does not fall during sleep to facilitate sodium excretion and maintain balance.39 Indeed, corticosterone infusion did not affect overall sodium balance but reduced sodium excretion during the active phase. This is consistent with data from normotensive humans: those excreting a greater proportion of the daily sodium load during sleep have a reduced dip during sleep.12 This concept is reinforced by data in adrenalectomized mice. These animals do not activate NCC during periods of activity and cannot main-tain sodium balance by modulating renal excretion: BP lacks day:night variation because peak BP is significantly reduced.
PerspectivesHydrochlorothiazide monotherapy was previously shown to reduce night-time BP in essential hypertensive patients, but only those with a nondipping BP profile.15 Night-time dos-ing of hydrochlorothiazide (in combination with valsartan)
Figure 4. Systolic blood pressure (SBP; A) and diastolic blood pressure (DBP; B) in C57BL6 mice after treatment with corticosterone or vehicle followed by chronic hydrochlorothiazide (HCTZ). Moving averages (during 5 hours) throughout the duration of the experiment are displayed here. After baseline recordings (11 days), all mice were anesthetized under isoflurane and received either vehicle or corticosterone slow-release silastic pellets (subcutaneously). After 11 days, all mice were treated with chronic HCTZ (80 mg/kg) in their drinking water. The blue rectangles indicate 5-day bins that were taken forward for further analysis. All data are mean±95% confidence interval (CI), n=6 (vehicle, black line) n=5 (corticosterone, red line), where thick lines are the mean, and thin-dotted lines are 95% CI.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 8: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/8.jpg)
1036 Hypertension May 2016
is more effective than daytime dosing at reducing BP dur-ing sleep.17 Our study provides mechanistic insight into these outcomes and suggests that thiazides, or thiazide-like diuret-ics with a longer half-life could improve BP control over the 24-hour cycle in certain patients. Measuring urinary exo-somal NCC in morning urine samples would be an effective and noninvasive means of patient stratification. We predict benefit in nondipping patients on glucocorticoid therapy or those with abnormal peripheral glucocorticoid metabolism. Restoring dipping BP profile through thiazide diuretics would be a cost-effective way of reducing cardiovascular risk in these patients.
AcknowledgmentsT.S. Peltz was awarded a scholarship by The Physiological Society. We thank the British Heart Foundation Centre of Research Excellence Award for supporting the telemetry studies.
Sources of FundingJ.R. Ivy and A.R. Howarth were funded by PhD studentships from The British Heart Foundation (FS/11/78/29328 and FS/13/52/30637).
DisclosuresNone.
References 1. Millar-Craig MW, Bishop CN, Raftery EB. Circadian variation of blood-
pressure. Lancet. 1978;1:795–797. 2. Muller JE, Tofler GH, Stone PH. Circadian variation and triggers of onset
of acute cardiovascular disease. Circulation. 1989;79:733–743. 3. Lurbe E, Redon J, Kesani A, Pascual JM, Tacons J, Alvarez V, Batlle D.
Increase in nocturnal blood pressure and progression to microalbuminuria
in type 1 diabetes. N Engl J Med. 2002;347:797–805. doi: 10.1056/NEJMoa013410.
4. Timio M, Venanzi S, Lolli S, Lippi G, Verdura C, Monarca C, Guerrini E. “Non-dipper” hypertensive patients and progressive renal insufficiency: a 3-year longitudinal study. Clin Nephrol. 1995;43:382–387.
5. Davidson MB, Hix JK, Vidt DG, Brotman DJ. Association of impaired diurnal blood pressure variation with a subsequent decline in glomeru-lar filtration rate. Arch Intern Med. 2006;166:846–852. doi: 10.1001/archinte.166.8.846.
6. Ohkubo T, Hozawa A, Yamaguchi J, Kikuya M, Ohmori K, Michimata M, Matsubara M, Hashimoto J, Hoshi H, Araki T, Tsuji I, Satoh H, Hisamichi S, Imai Y. Prognostic significance of the nocturnal decline in blood pressure in individuals with and without high 24-h blood pressure: the Ohasama study. J Hypertens. 2002;20:2183–2189.
7. Peixoto AJ, White WB. Circadian blood pressure: clinical implications based on the pathophysiology of its variability. Kidney Int. 2007;71:855–860. doi: 10.1038/sj.ki.5002130.
8. Hermida RC, Ayala DE, Mojón A, Fernández JR. Decreasing sleep-time blood pressure determined by ambulatory monitoring reduces cardiovascular risk. J Am Coll Cardiol. 2011;58:1165–1173. doi: 10.1016/j.jacc.2011.04.043.
9. Centonza L, Castoldi G, Chianca R, Busca G, Golin R, Zanchetti A, Stella A. Short-term analysis of the relationship between blood pressure and urinary sodium excretion in normotensive subjects. Clin Sci (Lond). 2000;98:495–500.
10. Ivy JR, Bailey MA. Pressure natriuresis and the renal control of arterial blood pressure. J Physiol. 2014;592(pt 18):3955–3967. doi: 10.1113/jphysiol.2014.271676.
11. Uzu T, Takeji M, Yamauchi A, Kimura G. Circadian rhythm and postural change in natriuresis in non-dipper type of essential hypertension. J Hum Hypertens. 2001;15:323–327. doi: 10.1038/sj.jhh.1001185.
12. Bankir L, Bochud M, Maillard M, Bovet P, Gabriel A, Burnier M. Nighttime blood pressure and nocturnal dipping are associated with daytime urinary sodium excretion in African subjects. Hypertension. 2008;51:891–898. doi: 10.1161/HYPERTENSIONAHA.107.105510.
13. Dyer AR, Stamler R, Grimm R, Stamler J, Berman R, Gosch FC, Emidy LA, Elmer P, Fishman J, Van Heel N. Do hypertensive patients have a different diurnal pattern of electrolyte excretion? Hypertension. 1987;10:417–424.
Figure 5. A, Corticosterone (gray lines) increased systolic blood pressure (SBP) when mice were asleep but not during the active period. B, Chronic hydrochlorothiazide (HCTZ) treatment lowered sleep-time SBP in corticosterone-treated mice (gray line) but not in controls (black line). The bar at the top of A and B indicates periods of subjective day (when mice were asleep) and night (when mice were awake). The analysis was performed on 5-day bins of raw SBP data (blue box in Figure 4) and a group average calculated every 30 minutes in the 24-hour cycle. The average SBP (C) and diastolic blood pressure (DBP; D) were also calculated during subjective day (Zeitgeber time [ZT] 3–8) when mice were asleep and night (ZT15–20), when mice were awake. Data were analyzed by matched 2-way ANOVA with post hoc Sidak correction. *P<0.0001, †P<0.001, ‡P<0.01, §P<0.05, nonsignificant (ns) P>0.05, n=6 (vehicle), n=5 (corticosterone). Data are mean±95% confidence interval (CI), where thick lines are mean and thin-dotted lines are 95% CI.
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 9: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/9.jpg)
Ivy et al NCC Activity and the Daily Rhythm of BP 1037
14. Uzu T, Ishikawa K, Fujii T, Nakamura S, Inenaga T, Kimura G. Sodium restriction shifts circadian rhythm of blood pressure from nondipper to dipper in essential hypertension. Circulation. 1997;96:1859–1862.
15. Uzu T, Kimura G. Diuretics shift circadian rhythm of blood pres-sure from nondipper to dipper in essential hypertension. Circulation. 1999;100:1635–1638.
16. Zeng J, Jia M, Ran H, Tang H, Zhang Y, Zhang J, Wang X, Wang H, Yang C, Zeng C. Fixed-combination of amlodipine and diuretic chronotherapy in the treatment of essential hypertension: improved blood pressure con-trol with bedtime dosing-a multicenter, open-label randomized study. Hypertens Res. 2011;34:767–772. doi: 10.1038/hr.2011.36.
17. Hermida RC, Ayala DE, Mojón A, Fontao MJ, Fernández JR. Chronotherapy with valsartan/hydrochlorothiazide combination in essential hyperten-sion: improved sleep-time blood pressure control with bedtime dosing. Chronobiol Int. 2011;28:601–610. doi: 10.3109/07420528.2011.589935.
18. Bazúa-Valenti S, Gamba G. Revisiting the NaCl cotransporter regulation by with-no-lysine kinases. Am J Physiol Cell Physiol. 2015;308:C779–C791. doi: 10.1152/ajpcell.00065.2015.
19. Zuber AM, Centeno G, Pradervand S, Nikolaeva S, Maquelin L, Cardinaux L, Bonny O, Firsov D. Molecular clock is involved in predictive circadian adjustment of renal function. Proc Natl Acad Sci U S A. 2009;106:16523–16528. doi: 10.1073/pnas.0904890106.
20. Richards J, Ko B, All S, Cheng KY, Hoover RS, Gumz ML. A role for the circadian clock protein Per1 in the regulation of the NaCl co-transporter (NCC) and the with-no-lysine kinase (WNK) cascade in mouse distal con-voluted tubule cells. J Biol Chem. 2014;289:11791–11806. doi: 10.1074/jbc.M113.531095.
21. Richards J, Gumz ML. Advances in understanding the peripheral circa-dian clocks. FASEB J. 2012;26:3602–3613. doi: 10.1096/fj.12-203554.
22. Sujino M, Furukawa K, Koinuma S, Fujioka A, Nagano M, Iigo M, Shigeyoshi Y. Differential entrainment of peripheral clocks in the rat by glucocorticoid and feeding. Endocrinology. 2012;153:2277–2286. doi: 10.1210/en.2011-1794.
23. Hunter RW, Bailey MA. Glucocorticoids and 11β-hydroxysteroid dehy-drogenases: mechanisms for hypertension. Curr Opin Pharmacol. 2015;21:105–114. doi: 10.1016/j.coph.2015.01.005.
24. Hunter RW, Ivy JR, Bailey MA. Glucocorticoids and renal Na+ transport: implications for hypertension and salt sensitivity. J Physiol. 2014;592(pt 8):1731–1744. doi: 10.1113/jphysiol.2013.267609.
25. Imai Y, Abe K, Sasaki S, Minami N, Munakata M, Nihei M, Sekino H, Yoshinaga K. Exogenous glucocorticoid eliminates or reverses circadian blood pressure variations. J Hypertens. 1989;7:113–120.
26. Imai Y, Abe K, Sasaki S, Minami N, Nihei M, Munakata M, Murakami O, Matsue K, Sekino H, Miura Y. Altered circadian blood pressure rhythm in patients with Cushing’s syndrome. Hypertension. 1988;12:11–19.
27. Al-Dujaili EA, Mullins LJ, Bailey MA, Andrew R, Kenyon CJ. Physiological and pathophysiological applications of sensitive ELISA methods for urinary deoxycorticosterone and corticosterone in rodents. Steroids. 2009;74:938–944. doi: 10.1016/j.steroids.2009.06.009.
28. Oosthuyzen W, Sime NE, Ivy JR, Turtle EJ, Street JM, Pound J, Bath LE, Webb DJ, Gregory CD, Bailey MA, Dear JW. Quantification of human urinary exosomes by nanoparticle tracking analysis. J Physiol. 2013;591(pt 23):5833–5842. doi: 10.1113/jphysiol.2013.264069.
29. Hunter RW, Ivy JR, Flatman PW, Kenyon CJ, Craigie E, Mullins LJ, Bailey MA, Mullins JJ. Hypertrophy in the Distal Convoluted Tubule of
an 11β-Hydroxysteroid Dehydrogenase Type 2 Knockout Model. J Am Soc Nephrol. 2015;26:1537–1548. doi: 10.1681/ASN.2013060634.
30. McDonough AA, Veiras LC, Minas JN, Ralph DL. Considerations when quantitating protein abundance by immunoblot. Am J Physiol Cell Physiol. 2015;308:C426–C433. doi: 10.1152/ajpcell.00400.2014.
31. Refinetti R, Lissen GC, Halberg F. Procedures for numerical analy-sis of circadian rhythms. Biol Rhythm Res. 2007;38:275–325. doi: 10.1080/09291010600903692.
32. Zhang R, Lahens NF, Ballance HI, Hughes ME, Hogenesch JB. A circa-dian gene expression atlas in mammals: implications for biology and med-icine. Proc Natl Acad Sci U S A. 2014;111:16219–16224. doi: 10.1073/pnas.1408886111.
33. Rosenbaek LL, Kortenoeven ML, Aroankins TS, Fenton RA. Phosphorylation decreases ubiquitylation of the thiazide-sensitive cotransporter NCC and subsequent clathrin-mediated endocytosis. J Biol Chem. 2014;289:13347–13361. doi: 10.1074/jbc.M113.543710.
34. Richardson C, Rafiqi FH, Karlsson HK, Moleleki N, Vandewalle A, Campbell DG, Morrice NA, Alessi DR. Activation of the thiazide-sen-sitive Na+-Cl- cotransporter by the WNK-regulated kinases SPAK and OSR1. J Cell Sci. 2008;121(pt 5):675–684. doi: 10.1242/jcs.025312.
35. Sei H, Oishi K, Chikahisa S, Kitaoka K, Takeda E, Ishida N. Diurnal ampli-tudes of arterial pressure and heart rate are dampened in Clock mutant mice and adrenalectomized mice. Endocrinology. 2008;149:3576–3580. doi: 10.1210/en.2007-1714.
36. Bergthorsdottir R, Leonsson-Zachrisson M, Odén A, Johannsson G. Premature mortality in patients with Addison’s disease: a population-based study. J Clin Endocrinol Metab. 2006;91:4849–4853. doi: 10.1210/jc.2006-0076.
37. Furlan R, Guzzetti S, Crivellaro W, Dassi S, Tinelli M, Baselli G, Cerutti S, Lombardi F, Pagani M, Malliani A. Continuous 24-hour assessment of the neural regulation of systemic arterial pressure and RR variabilities in ambulant subjects. Circulation. 1990;81:537–547.
38. Dhaun N, Moorhouse R, MacIntyre IM, Melville V, Oosthuyzen W, Kimmitt RA, Brown KE, Kennedy ED, Goddard J, Webb DJ. Diurnal variation in blood pressure and arterial stiffness in chronic kidney disease: the role of endothelin-1. Hypertension. 2014;64:296–304. doi: 10.1161/HYPERTENSIONAHA.114.03533.
39. Sachdeva A, Weder AB. Nocturnal sodium excretion, blood pressure dipping, and sodium sensitivity. Hypertension. 2006;48:527–533. doi: 10.1161/01.HYP.0000240268.37379.7c.
40. Chen Z, Vaughn DA, Blakely P, Fanestil DD. Adrenocortical steroids increase renal thiazide diuretic receptor density and response. J Am Soc Nephrol. 1994;5:1361–1368.
41. Velazquez H, Bartiss A, Bernstein P, Ellison DH. Adrenal steroids stim-ulate thiazide-sensitive NaCl transport by rat renal distal tubules. Am J Physiol. 1996;270:F211–F219.
42. Roy A, Al-Qusairi L, Donnelly BF, Ronzaud C, Marciszyn AL, Gong F, Chang YP, Butterworth MB, Pastor-Soler NM, Hallows KR, Staub O, Subramanya AR. Alternatively spliced proline-rich cassettes link WNK1 to aldosterone action. J Clin Invest. 2015;125:3433–3448. doi: 10.1172/JCI75245.
43. Ueda K, Fujiki K, Shirahige K, Gomez-Sanchez CE, Fujita T, Nangaku M, Nagase M. Genome-wide analysis of murine renal distal convo-luted tubular cells for the target genes of mineralocorticoid receptor. Biochem Biophys Res Commun. 2014;445:132–137. doi: 10.1016/j.bbrc.2014.01.125.
What Is New?•Persistent elevation of circulating glucocorticoids induced a nondipping
blood pressure (BP) profile.•This nondipping BP was associated with persistent activation of the renal
sodium chloride cotransporter.•Treatment with a thiazide diuretic reduced BP and restored the normal
dipping rhythm.
What Is Relevant?•BP normally dips during sleep and loss of the nocturnal dip (nocturnal
hypertension) increases the risk of cardiovascular and renal disease.•Elevated glucocorticoid levels may promote the nocturnal hypertension
common in chronic stress, obesity, and type 2 diabetes mellitus.
• Long-lasting thiazide diuretics may improve BP control throughout the 24-hour cycle.
Summary
This study suggests that thiazide diuretics may lower nocturnal blood pressure in conditions associated with abnormal glucocor-ticoid metabolism, reducing long-term cardiovascular risk in such patients.
Novelty and Significance
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 10: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/10.jpg)
Matthew A. BaileyNeeraj Dhaun, Emad A.S. Al-Dujaili, David J. Webb, James W. Dear, Peter W. Flatman and Jessica R. Ivy, Wilna Oosthuyzen, Theresa S. Peltz, Amelia R. Howarth, Robert W. Hunter,
CotransporterGlucocorticoids Induce Nondipping Blood Pressure by Activating the Thiazide-Sensitive
Print ISSN: 0194-911X. Online ISSN: 1524-4563 Copyright © 2016 American Heart Association, Inc. All rights reserved.
is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Hypertension doi: 10.1161/HYPERTENSIONAHA.115.069772016;67:1029-1037; originally published online March 7, 2016;Hypertension.
Free via Open Access http://hyper.ahajournals.org/content/67/5/1029
World Wide Web at: The online version of this article, along with updated information and services, is located on the
/content/68/1/e5.full.pdfAn erratum has been published regarding this article. Please see the attached page for:
http://hyper.ahajournals.org/content/suppl/2016/03/07/HYPERTENSIONAHA.115.06977.DC1.htmlData Supplement (unedited) at:
http://hyper.ahajournals.org//subscriptions/
is online at: Hypertension Information about subscribing to Subscriptions:
http://www.lww.com/reprints Information about reprints can be found online at: Reprints:
document. Permissions and Rights Question and Answer this process is available in the
click Request Permissions in the middle column of the Web page under Services. Further information aboutOffice. Once the online version of the published article for which permission is being requested is located,
can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialHypertensionin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:
by guest on January 23, 2017http://hyper.ahajournals.org/
Dow
nloaded from
![Page 11: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/11.jpg)
e5
In the article by Ivy et al (Ivy JR, Oosthuyzen W, Peltz TS, Howarth AR, Hunter RW, Dhaun N, Al-Dujaili EAS, Webb DJ, Dear JW, Flatman PW, Bailey MA. Glucocorticoids induce nondipping blood pressure by activating the thiazide-sensitive cotransporter. Hypertension. 2016;67:1029–1037. doi: 10.1161/HYPERTENSIONAHA.115.06977), which published online ahead of print March 7, 2016, and appeared in the May 2016 issue of the journal, a correction was needed.
The incorrect Creative Commons Attribution license was applied in the article. The Creative Commons Attribution Non-Commercial License (CC-BY-NC 4.0) should have been the Creative Commons License (CC-BY 3.0). An Open Access indicator has been added in the article and the license text has been changed to read, “© 2016 The Authors. Hypertension is published on behalf of the American Heart Association, Inc., by Wolters Kluwer. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution, and repro-duction in any medium, provided that the original work is properly cited.”
We regret the error.
These corrections have been made to the current online version of the article, which is available at http://hyper.ahajournals.org/content/67/5/1029.full.
Correction
(Hypertension. 2016;68:255. DOI: 10.1161/HYP.0000000000000048.)© 2016 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYP.0000000000000048
![Page 12: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/12.jpg)
1
SUPPLEMENTARY MATERIAL
Glucocorticoids induce non-dipping blood pressure by activating the thiazide-sensitive co-
transporter
Jessica R. Ivy1, Wilna Oosthuyzen
1, Theresa Peltz
1, Amelia R. Howarth
1, Robert W. Hunter
1,
Neeraj Dhaun1, Emad A.S. Al-Dujaili
2, David J. Webb
1, James, W. Dear
1, Peter W. Flatman
3,
Matthew A. Bailey1
1The British Heart Foundation Centre for Cardiovascular Science The University of Edinburgh;
2Dietetics, Nutrition and Biological Sciences Department, Queen Margaret University and
3The
Centre for Integrative Physiology, The University of Edinburgh, United Kingdom
Correspondence to: Matthew A. Bailey, PhD
University/BHF Centre for Cardiovascular Science,
The Queen’s Medical Research Centre,
The University of Edinburgh,
47 Little France Crescent,
Edinburgh, EH16 4TJ United Kingdom
Email [email protected]
![Page 13: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/13.jpg)
2
Supplementary Methods:
Measurement of NCC in urinary exosomes: The number of exosomes in urine samples was
measured by Nanoparticle Tracking Analysis (NTA, NanoSight Ltd, Amesbury, UK), as described1.
NCC-containing exosomes were identified by fluorescence after conjugation of a rabbit anti-NCC
antibody (AB3553; EMD Millipore) to a quantum dot (Qdot 605 Anti- body Conjugation Kit;
Invitrogen, UK). For fluorescent NTA analysis, a 532nm (green) laser diode excited the Qdots with
a long-pass filter (430nm) so that only fluorescent particles were tracked and labeled-particle
concentration determined by NTA software.
Immunoblotting: Western blots were performed as we have described2. Briefly, kidneys were
homogenized in a sucrose buffer containing phosphatase, kinase, and protease inhibitors, and
protein samples were resolved by SDS-PAGE (NuPAGE Novex 3%–8% Tris-acetate gels;
Invitrogen, UK) and transferred to PDVF membrane (Amersham Hybond-P GE Healthcare).
Primary antibodies used were: rabbit anti-NCC (AB3553; EMD Millipore, 1:1000); sheep anti-
pThr53-NCC, anti-pThr58-NCC, anti-pSer71-NCC (each at 1:500), and anti-NKCC2 (1:10,000, all
from Division of Signal Transduction Therapy, Dundee University, UK). Secondary antibodies
were: goat anti-rabbit IgG-HRP (sc-2030; Santa-Cruz Biotechnology, 1:2000), and donkey anti-
sheep IgG-HRP (A3415; Sigma-Aldrich, 1:20,000). Images were developed by
electrochemiluminescence and quantified by densitometry using ImageJ. The bottom <50kDa of the
gel was coomassie stained and used as a loading control, as described3. The cross-reactivity of NCC
phospho-antibodies was determined by immunoprecipitation experiments. NCC and NKCC2 were
separately pulled-down from whole kidney homogenates and the products probed using pThr53-
NCC, pThr58-NCC and pSer71-NCC antibodies. Anti-pThr53-NCC and anti-pSer71-NCC were
selective for NCC but anti-pThr58-NCC showed significant cross-reactivity with NKCC2 (See
Supplemental Material, Figure S1).
Quantitative-PCR: RNA was extracted from frozen kidneys (RNeasy Mini Kit, Qiagen) and treated
on-column with DNase I. cDNA was transcribed from 500 ng of total RNA and used for qPCR
reactions with the Roche Universal ProbeLibrary (See Supplemental Material, Table 1). TBP,
HPRT and 18S rRNAs were used as endogenous control genes. Their expression did not differ
across any of the experimental groups. CT values were approximately 25-33, 22-28, 7-15 for TBP,
HPRT and 18S, respectively. Test gene CT values ranged from 22 to 37. The level of endogenous
control genes was normalized such that day/vehicle/sham was equal to 1.
Immunofluorescence: Kidneys were fixed by aortic perfusion of 4% paraformaldehyde and then
embedded in paraffin, sectioned at 5m and mounted onto glass slides. Sections were double-
immunostained to co-localise NCC expression with GR, MR or 11HSD2; all sections were
counterstained with DAPI (Immunodetection and Imaging Facility; The University of Edinburgh).
Images were acquired using a Zeiss LSM 510 Meta Confocal Laser Scanning Microscope. DAPI,
Cy3 and Cy5 were excited using a blue diode 405nm laser and HeNe 546nm and 633nm lasers
respectively. Tiled images (~7x7) were captured through a 20X objective lens.
BP measurement: Radiotelemetry devices (Model TA-11PAC-10, Data Systems International, UK)
were inserted into male C57BL/6 mice under isoflurane anesthesia. After a week of post-operative
recovery, data were collected over a 1-minute period every 30 minutes at an acquisition rate of
1kHz. Basal measurements were obtained over 7 days before corticosterone (n=5) or blank (n=6)
elastomer pellets were implanted subcutaneously. In order to verify that the plasma corticosterone
clamping was sustained throughout the experiment, blood was sampled at ZT0 and ZT12 in vehicle
and corticosterone treated mice on the last day of the telemetry experiment i.e. four weeks after
implantation. After 11 days, hydrochlorothiazide (HCTZ; 80mg/kg/day) was administered in
drinking water. The mice did not change their intake of water following HCTZ dosing. HCTZ
concentration in plasma samples taken on the final experimental day was measured by LC/MS.
![Page 14: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/14.jpg)
3
REFERENCES
1. Oosthuyzen W, Sime NE, Ivy JR, Turtle EJ, Street JM, Pound J, Bath LE, Webb DJ,
Gregory CD, Bailey MA, Dear JW. Quantification of human urinary exosomes by nanoparticle
tracking analysis. J Physiol. 2013;591:5833-5842.
2. Hunter RW, Ivy JR, Flatman PW, Kenyon CJ, Craigie E, Mullins LJ, Bailey MA, Mullins
JJ. Hypertrophy in the Distal Convoluted Tubule of an 11beta-Hydroxysteroid Dehydrogenase Type
2 Knockout Model. J Am Soc Nephrol. 2015;26:1537-1548.
3. McDonough AA, Veiras LC, Minas JN, Ralph DL. Considerations when quantitating
protein abundance by immunoblot. Am J Physiol Cell Physiol. 2015; 308:C426-C433.
![Page 15: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/15.jpg)
4
Table S1: Table of qRT-PCR assays.
gene accession number forward primer reverse primer UPL
Rn18s NR_003278.1 ctcaacacgggaaacctcac cgctccaccaactaagaacg 77
Tbp NM_013684 gggagaatcatggaccagaa gatgggaattccaggagtca 97
HPRT NM_013556.2 cctcctcagaccgcttttt aacctggttcatcatcgctaa 95
per1 NM_001159367.1 gcttcgtggacttgacacct tgctttagatcggcagtggt 71
per2 NM_011066 gcttcgtggacttgacacct tgctttagatcggcagtggt 5
clock-201 NM_007715.5 ccagtcagttggtccatcatt tggctcctaactgagctgaaa 76
cry1 NM_007771.3 ggcagagcagtaactgatacga tgactttcccaccaacttca 52
cry2 NM_009963.4 ggagcatcagcaacacagg ccgcttggtcagttcttcac 11
arnt1 var1 NM_001243048 gaatacattgtctcaaccaacactg ttagctgcgggaaggttg 97
arnt1 var2 ENSMUST00000106637.1 agtacgcctccccctgat tgtctggagtccctccattt 79
Sgk1 NM_001161845 gattgccagcaacacctatg ttgatttgttgagagggacttg 91
TSC22d3 v2 NM_010286.3 tccgttaaactggataacagtgc tggttcttcacgaggtccat 49
MR NM_001083906 caaaagagccgtggaagg tttctccgaatcttatcaataatgc 11
GR NM_008173 tgacgtgtggaagctgtaaagt catttcttccagcacaaaggt 56
Hsd11b2 NM_008289.2 cactcgaggggacgtattgt gcaggggtatggcatgtct 26
Slc12a3 NM_019415 cctccatcaccaactcacct ccgcccacttgctgtagta 12
Oxsr1 NM_133985 tgccttcaaaaggatccaga tggaaaaatttgtgcctcaac 84
Stk39 ENSMUST00000102715 gtacgagctccaggaggttatc tcttgcctgggtttgcat 27
Stk39 JN368425 ttaccgtcattcctaactttactgc gaatgcgcttactccaaaatct 18
Wnk1 AY309076 cttttgccaagagtgtgataggt caacggattcatcatatttctcc 92
Wnk1 AY311934 / AY309076 tgctgctgttctcaaaagga acttcaggaattgctactttgtca 20
Wnk4 NM_175638 tccgatttgatctggatgg gggcaggatgaactcattgta 26
Nedd4 NM_010890 acgtgctgttcactgctgat tcacaactcgtgtgtcatcg 1
Cab39 NM_133781 tgagaaggagcctcagacaga aaaatttgagccacgtcttttt 17
Cul3 NM_016716.4 agaagggaagaatcctgttgact gccggtcattattgaaggatt 69
![Page 16: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/16.jpg)
5
Table S2: Parameters obtained from cosinor analysis of C57BL6 mice telemetry data. Data are
mean± 95% CI. (n=4)
Variable SBP DBP HR Activity
Period (hours) 23h09
±0h22 23h09 ±0h18
23h48 ±
0h12 23.48 ±0h12
Acrophase (ZT) 18h10±0h47 18h09±0h49 17h06±0h05 17h06±0h05
Amplitude (mmHg/bpm/counts) 10.0 ± 1.8 9.8 ± 1.5 57.0 ± 22 6.24 ± 1.2
MESOR (mmHg/bpm/counts) 125 ± 2 95 ± 5 507 ± 7 7± 2
Robustness (%) 26.3±4.3 23.9±3.3 12.5±5.0 28.5±1.9
![Page 17: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/17.jpg)
6
Immunoprecipitation (IP) for specificity of NCC phospho-antibodies: The NCC phospho-motifs are conserved in other related transporters, particularly NKCC2.
Threonine 53 and 58 on NCC shares homology with Threonine 96 and 101 on NKCC2. Therefore
IP was performed to test the specificity of the NCC phospho-antibodies. Superparamagnetic beads
(DynabeadsTM
Protein G, Life Technologies) were washed and conjugated to NCC and NKCC2
antibodies according to the manufacturer’s instructions. 2500mg kidney homogenate was added to
the bead-antibody mixture and placed on a magnet to “pull-down” proteins bound to the antibodies.
The antigens were eluted and resuspended (in 20L DynabeadsTM
elution buffer, Life
Technologies, 3L DTT and 7.5L LDS) and, along with a standard kidney homogenate, were
Western blotted.
Figure S1: Cross-reactivity of anti-NCC antibodies
Immunoprecipitation was used to “pull down” NCC or NKCC2 from 2500 g of total kidney
homogenate. These immunoprecipitation products (+) were then separated on 3-8% Tris Acetate
gel, transferred to Hybond P membrane and immunoblotted for the NCC phospho-antibodies and
NKCC2. 12 g of total kidney homogenate (-) was run alongside the IP products and probed
directly as a positive control.
![Page 18: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/18.jpg)
7
Figure S2: 24-hour systolic blood pressure (A), diastolic blood pressure (B), heart rate (C) and
activity (D) in C57BL6 mice. Data were collected using radiotelemetry and are shown as hourly
mean over 5-day batches (thick line) ±95% CI (thin dotted line) (n=4). The white bar indicates
subjective day, when mice were inactive; the black bar indicates the subjective night, when mice
were active. Lights were turned on at 7am local time (ZT0).
120 246 18
110
120
130
140
ZT (hours)
Systo
lic B
P (m
mH
g)
Systolic Blood Pressure
120 246 18
400
500
600
ZT (hours)
Heart
rate
(b
pm
)
Heart Rate
120 246 18
80
100
120
ZT (hours)D
iasto
lic B
P (m
mH
g)
Diastolic Blood Pressure
120 246 18
0
5
10
15
20
25
ZT (hours)
Activity (A
U)
Activity
(A) (B)
(C) (D)
![Page 19: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/19.jpg)
8
Figure S3: Urinary aldosterone (A), corticosterone (B), sodium (C) and potassium (D) excretion
and food intake (E). Urine samples were collected over subjective day (black circle; ZT0-12), when
mice were inactive and over the night (red square; ZT12-0), when mice were active. These data are
the average for each mouse over two consecutive days’ measurements. Data are mean ±95% CI.
Statistical comparisons were made using paired Student’s t tests, ****P<0.0001 ***P<0.001.
**P<0.01 (n=10).
(B) Urinary Corticosterone
Day Night
0
50
100
150
200
250
nm
ol/12h
ou
r
****
(A) Urinary Aldosterone
Day Night
0.0
0.5
1.0
1.5
nm
ol/12h
ou
r
**
Day Night
0
100
200
300
µm
ol / 1
2 h
ou
r
****
Day Night
3
6
9
12
gra
ms
/ 1
2 h
ou
r
**
Day Night
0
100
200
300
400
µm
ol /
12
ho
ur
***
(C) Urinary Sodium (D) Urinary Potassium
(E) Food intake
![Page 20: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/20.jpg)
9
Figure S4: Representative images of immunofluorescent staining of (A) NCC (green) and MR (red)
and (B) NCC (green) and GR (red) in male C57BL6 mice. High-powered views of yellow-boxed
regions are displayed. Bar, 100m in large top/bottom panels; 10m in high-powered middle
panels.
![Page 21: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/21.jpg)
10
Figure S5: Immunofluorescent staining for NCC (green) and 11HSD2 (red) in 3 (A-C) male
C57BL6 mice. High-powered views of yellow-boxed regions are given on the right where blue
arrows indicate regions in which 11HSD2 and NCC staining are within the same cell/tubule. Bar,
100m (left-hand panels); 10m (right hand panels).
![Page 22: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/22.jpg)
11
Figure S6: Day:night variation of NCC phosphorylation at Thr53 in female C57BL6 mice. Kidneys
were harvested at ZT6 (day/inactive phase) and ZT18 (night/active phase) for immunoblots. No
attempt was made to synchronize the oestrus cycles of these mice. Signal densities for immunoblots
were normalised to Coomassie signal density and compared by unpaired t-tests, **P<0.01, All data
are mean ± 95% CI.
Figure S7: Day:night variation of NCC phosphorylation at Ser71 in male C57BL6 mice. Kidneys
were harvested at ZT6 (day/inactive phase) and ZT18 (night/active phase) for immunoblots. Signal
densities for immunoblots were normalised to Coomassie signal density and compared by unpaired
t-tests. ns, P>0.05. All data are mean ± 95% CI
![Page 23: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/23.jpg)
12
Figure S8: Gene expression in kidneys of adrenalectomised (ADX) and adrenal intact C57BL6
mice. Control and ADX mice were single housed and culled at day 9 post surgery during the
subjective day when inactive (black circle; ZT6) or night (red square; ZT18), when active. The
encoding gene is given with name of the resulting protein in brackets. Gene expression of each gene
was normalised to the average expression of 18S, TBP and HPRT. Data are mean ± 95% CI. Data
were analysed with two-way ANOVA followed by post hoc Sidak correction, where ***P<0.001,
**P<0.01 *P<0.05, ns P>0.05 (n=5-6).
Intact ADX
-1
0
1
Lo
g1
0(A
U)
slc12a3 (NCC)
Intact ADX
per2 (PER2)
*
*
Intact ADX
-1
0
1
Lo
g1
0(A
U)
sgk1 (SGK1)
Intact ADX
clock-201 (CLOCK)
Intact ADX
tsc22d3 (GILZ)
** nsDayNight
Intact ADX
-1
0
1
Lo
g1
0(A
U)
cry1 (CRY1)
*****
Intact ADX
per1 (PER1)
Intact ADX
arntl var1 (BMAL1)
**
Intact ADX
wnk4 (WNK4)
![Page 24: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/24.jpg)
13
Figure S9: Gene expression in kidneys of corticosterone (Cort) or vehicle treated C57BL6
mice. Mice were culled during the subjective day when inactive (black circle; ZT6) or night (red
square; ZT18), when active.
The encoded protein name is given in brackets. Gene expression of each test gene was normalised
to the average expression of 18S, TBP and HPRT. Data are mean ± 95% CI. Data were analysed
with two-way ANOVA followed by post hoc Sidak correction, where ****P<0.0001, ***P<0.001,
**P<0.01 *P<0.05, ns P>0.05 (n=9)
tsc22d3 (GILZ)
Vehicle Cort
DayNight***
slc12a3 (NCC)
Vehicle Cort
-1
0
1
2
Lo
g1
0(A
U)
sgk1 (SGK1)
Vehicle Cort
-1
0
1
2
Lo
g1
0(A
U) ***
wnk4 (WNK4)
Vehicle Cort
cry1 (CRY1)
Vehicle Cort
-1
0
1
2
Lo
g1
0(A
U)
*
per1 (PER1)
Vehicle Cort
**
*
per2 (PER2)
Vehicle Cort
**** **
clock-201 (CLOCK)
Vehicle Cort
arntl var1 (BMAL1)
Vehicle Cort
**
![Page 25: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/25.jpg)
14
Figure S10: Immunoblots for pT53 NCC (A) pS71 NCC (B) and total NCC (C) in vehicle and
corticosterone treated mice. Mice were culled in groups of 3 control and 3 experimental animals
during the subjective day when inactive (ZT6) or night (ZT18), when active. The experiment was
performed on three separate occasions and immunoblots were performed in these batches (1-3). “R”
is reference load, which was a pooled sample that was used to normalise across the three batches of
immunoblots.
![Page 26: Glucocorticoids Induce Nondipping Blood Pressure by ... · priate activation of the thiazide-sensitive NaCl cotransporter (NCC) is a strong determinant of nocturnal BP. NCC activity](https://reader034.fdocuments.us/reader034/viewer/2022050518/5fa229a9356f8b21bf0b5ba3/html5/thumbnails/26.jpg)
15
Figure S11: Heart rate and activity in C57BL6 mice. After 11 days of baseline recording, mice
received either corticosterone (red line) or control (black line) pellets. After a further 11 days, all
mice received HCTZ (80 mg/kg) in their drinking water. Data displayed here are the moving
average (over 5 hours) of heart rate (A) and activity (D) throughout the duration of the experiment.
The blue rectangles indicate 5-day bins that were taken forward for further analysis. Summary mean
daytime and nighttime heart rate (B, C) and activity (E, F) were obtained by taking the mean over
the 5-day bins for subjective day, when mice were inactive (ZT3-8) and night (ZT15-20), when
mice were active. Data are mean ± 95% CI, where thick lines are mean and feint lines are 95% CI.
Summary data were analysed by matched two-way ANOVA with post hoc Sidak correction.
****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 ns, not significant P>0.05, n=6 (vehicle) n=5
(corticosterone).
1 3 6 8 11 16 21 23 26 28 316
400
500
600
700
Day
He
art
ra
te (
bp
m)
Vehicle
Cort
Baseline
Chronic HCTZ
Cort/Vehicle Pellet
Baseline Pellet HCTZ
400
450
500
550
bp
m
Day Time Mean
VehicleCort*
Interaction nsTreatment **Group nsMatching *
*
1 3 6 8 11 16 21 23 26 28 316
0
10
20
30
Day
Ac
tiv
ity
(c
ou
nts
)
Vehicle
Cort
Baseline
Chronic HCTZ
Cort/Vehicle Pellet
Baseline Pellet HCTZ
0
2
4
6
8
co
un
ts
Day Time Mean
VehicleCort
Interaction nsTreatment nsGroup nsMatching ****
Baseline Pellet HCTZ
450
525
600
675
bp
m
Night Time Mean
VehicleCort
*Interaction nsTreatment ***Group nsMatching ****
**
**
Baseline Pellet HCTZ
0
5
10
15
20
co
un
ts
Night Time Mean
VehicleCort
Interaction nsTreatment nsGroup nsMatching ****
(A)
(B)
(E)
(C)
(D)
(F)
Heart Rate
Activity