Germplasm collection and characterization in tomatillo (Physalis

philadelphica Lam.)

Todd VisionDepartment of Biology

University of North Carolina at Chapel Hill, USA

Solanaceae in North Carolina

Tomatillo (Physalis philadelphica

Lam.)

from Hernández Bermejo and León 1994

• Annual • Self-incompatible• Fruit enclosed by

a papery calyx• Native to Mexico• Diploid (n=12)

Ethnobotany of tomatillo

• Culinary uses• Salsa verde (usually

with Capsicum)• Infusion of calyx to

make tamale dough

• Medicinal uses• Leaves and fruits for

headaches and stomachaches

• Juice for sore throats• Cooked calyx for

diabetes

Economic importance• Cultivation mostly in

Mexico and Guatemala• In Mexico

• Fifth most important vegetable

• > 25,000 Ha cultivated/yr

• Elsewhere• Equal importance in

Guatemala• Used by growing Mexican

population in U.S.A. (esp. California)

• Used internationally in haute cuisine

Phylogeny of SolanaceaePetunia, Brunfelsia

Nicotianeae (Nicotiana)

Jaboroseae

Hyoscyameae

From Olmstead et al. 1999 Solanaceae IV

Anthocercideae

Nolanea

Nicandreae

Solaneae (Solanum)

Datureae

Capsiceae (Capsicum)

Physaleae (Physalis)

Mandragoreae

Solandreae

Lycieae

M. Whitson (2002) Two-gene phylogeny of the Physalinae

rbcL and ITSLeucophysalis viscosaBrachistus spp., Witheringia spp.Tzetalia spp

P. alkekengi (Chinese lantern)

Ocryctes spp, Leucophysalis nana, L. grandiflora

P. microphysa

P. arborescensQuincula lobataChamaesaracha spp.

P. crassifolia, P. acutifoliaMargaranthus

New World clade P. philadelphica (tomatillo)

P. microcarpa, P. ignota, P. cordata, P. lagascae, P. pruinosa, P. angulata, P. pubescens

P. nicandroides, P. peruviana (uchua), P. chenopodifolia, P. coztomatl, P. sordida, P. hederifolia, P. glutinosa, P. longifolia, P. greenmanii, P. caudella

P. minima, P. lanceolata, P. hetrophylla, P. virginina, P. arenicola, P. pumila, P. mollis, P. viscosa, P. cinerascens, P. angustoflia, P. walteriU.S. perennials

Nomenclature

• Physalis philadelphica Lam. (= P. ixocarpa Brot.) • tomate from Nahuatl ayacach tomatl meaning

berry• Local names:

• miltomate (Oaxaca)• tomate verde (Jalisco) • tomatillo (Jalisco, Oaxaca, Puebla)• tomate de cascara (Jalisco, Puebla, Oaxaca, Chiapas)• tomate de hoja (Jalisco, Puebla)

• tomate de milpa, or miltomate, from its association with maize fields

Domestication• Cultivation is ancient

• Remains in the Valley of Tehuacán in Puebla

• Gradient of cultivation still visible

• But few modern cultivars• Primitive features of

landraces• Self-incompatibility• Indeterminate growth• Nonsynchronous ripening• Fruit drop

• Lack of clear wild relative

Fruit size variation

Classification of varieties

• Work of Santaguillo Hernández and Peña Lomelí (Universidad Autónoma Chapingo)

• Mostly morphological• Some molecular (AFLP) evidence

• Three most important varieties• Rendidora (central and southern Mexico)• Salamanca (Guatemala)• Tamazula (in western Mexico)

variety habit fruiting

yield fruit fruit color calyx color

Rendidora crawling early high medium lemon green

green

Salamanca erect late medium

large deep green clear green

Tamazula erect early medium

medium purple green to purple

Puebla verde

crawling to semierect

early medium

large green green with purple veins

Manzano crawling to semierect

late medium

large orange green

Arandas erect early low small to medium

green to purple

green to purple

Milpero cultivado

crawling to erect

late very low

very small

green to purple

green purple

Milpero no cultivatado

crawling to erect

late very low

very small

green, yellow, purple

green to purple

SF1 Chapingo

crawling to semierect

very early

very high

medium lemon green

green

Summary of Hudson work

• Self-incompatibility and crossability

• Model of domestication

Germplasm conservation

2002 Collecting ExpeditionSponsored by USDA Plant Exchange

Office

Maria Chacon and Todd Vision University of North Carolina

Ofelia Vargas Ponce

Universidad de GuadalajaraLarry Robertson

USDA-ARSAureliano Peña Lomelí

Universidad Autónoma ChapingoAndrew Jarvis

CIAT

Existing collections

MEXICO

Jalisco

Guerrero

OaxacaChiapas

PueblaMichoacan

Jalisco

seedbank herbarium both

Predicted priorities from FloraMap

Sources of collection

• Undisturbed vegetation (none)• Disturbed vegetation• Tomatillo fields• Other fields (maize)• Traditional markets• Farmer’s seed stock

Classification of collections• Uncultivated

• From undisturbed or disturbed habitat, or a weed in a field occupied by other crops (maize)

• Incipient domesticate• Casually but intentionally cultivated in fields devoted

to other crops (maize)

• Landrace• Cultivated for self-consumption or sale at a local

market

• Escape• Resembling a landrace but not found in a cultivated

field

2002 collections

Jalisco

Michoacán

Guerrero

Oaxaca Chiapas

Puebla

uncultivatedincipient domesticateescapelandrace

2002 collections

State Uncult. Incip. Escape Landrace Collection sitesChiapas - - - 22 6Guerrero 6 - 1 6 12Hidalgo - - - 2 1Jalisco 8 1 3 4 12Michoacán 3 - - 1 3Oaxaca 4 9 - 25 12Puebla - - - 16 8

Total 21 10 4 76 54

Comparison of Mexican collections

BANGEV USDA New CollectionsState No. of

accessionsNo. of

collectionsites

No. ofaccessions

No. ofcollection

sites

No. ofaccessions

No. ofcollection

sitesBajaCalifornia

3 1 - - - -

Chiapas 1 1 - - 22 18Chihuahua - - 8 5 - -Colima 1 1 - - - -Guanajuato 7 6 - - - -Guerrero 7 4 - - 13 11Hidalgo 4 3 - - 2 1Jalisco 74 45 - - 13 13México 26 10 4 4 - -Michoacán 21 14 - - 3 2Morelos 9 6 - - - -Nayarit 9 7 - - - -Oaxaca 100 1 - - 39 37Puebla 125 16 - - 11 8San LuisPotosí

1 1 - - - -

Sonora 1 1 - - - -Zacatecas 2 2 - - - -Total 391 119 12 9 105 90

P. angulata

P. ampla

Local preferences

• Jalisco: purple fruit

• Puebla: large, green

• Guerrero: yellow• Chiapas: small

and purple

Field trials

• Larry Robertson at USDA Plant Genetic Resources Unit (Geneva, New York)

• Tested 99 accessions from 2002 collection

• 4 plants per accession, one in a pollinator-exclusion cage

• Measured a suite of agronomic and domestication traits

Results of field trials

• Domestication characters• Agronomic characters• BRIX• Selfing• Yield• Interest from organic farmers

Uses of microsatellite markers

• Genetic diversity• Phylogeography and the origin of

domestication• Paternity analysis and varietal

fingerprinting• Genetic mapping• Marker-assisted breeding

Mono (A)11 AAAAAAAAAAADi (AT)8 ATATATATATATATATTri (ATC)7 ATCATCATCATCATCATCATCTetra (CTAG)6 CTAGCTAGCTAGCTAGCTAGCTAG

Imperfect GTGTGTGTATGTGTGTInterrupted GTGTGTGTCCCGTGTGTGTCompound GTGTGTGTCTCTCTCTCTCT

Simple Sequence Repeats (SSR), Short Tandem Repeats (STR)

Microsatellites

Microsatellites: advantages

• Abundant • Codominant• Highly

polymorphic• Highly repeatable• PCR-based• Can be

multiplexed for amplification or scoring

Development of SSR markers

• Two strategies• From enriched SSR libraries• From tomato SSRs

Enrichment of SSRs

Digest genomic DNA & ligate adapters

Hybridize to biotin-labeled SSR probes

Sequence inserts and design primers

Screen primers for polymorphism (in 8 genotypes)

Clone captured fragments

Capture with magnetic streptavidin beads

Enriched library results• 11 libraries generated • 1620 positive clones isolated• 659 clones sequenced (w/ inserts 500-1500

bp). • 205 (31%) clones contained one or more SSR• SSRs represented 40 unique loci • Primers designed for 24 loci• Eight were easily scorable and highly

polymorphic

Enriched library results

motif clones isolated clones with inserts 500-1500 bp

clones with SSR

ACT 43 25 3AAT 117 60 4AAG/ATC 67 28 23ATG/TTC 0 0 0TTG 248 32 21AGT 126 69 31TTA 89 20 2AAC 50 11 10AC 609 249 52AG 0 0 0AT 271 165 59TOTAL 1620 659 (41%) 205 (31%)

SSR motif(repeat

number)

Unique contigs

Primer pairs

(AC)5-27 9 4

(AG)5-7 2 2

(AAC)4-25 17 8

(AAT)4 1 1

(ATC)5-7 2 2

(AAAC)4 1 1

Compound 7 5Imperfect 1 1Total 40 24

Transferring tomato SSRs• Primers developed for SSRs in tomato

expressed sequence tags (from SGN, http://sgn.cornell.edu)

• 24/87 (27.5%) primers amplified a product in tomatillo • ~25% of di- and tri-nucleotides• One out of nine among compound SSRs

• Six products were• Approximately the expected size• Yielded clean, bright bands

• Two were highly polymorphic

Tomatillo microsat markersTa

a Mg++ Primer Size Genotypic(°C) conc. conc. ranged distort.

(mM) (µM) (bp)F:CTAACTCATCCGCTGATTCATCR:AATAATTCTCTACCCCCTCCTF:CCTTTAGGAAAAAACAAGAACTCR:TACTACACCTCTATAGCCCGATAATCF:GTCAGCGACAGATTTAAGGTTCR:GCCAACGTAGTCATTTGTCAGTF:CCTTGTCGTGGACTTTATTATCCR:CACACCTGCCTCTGAAACGF:GTTGTAGGTTAGCATATTGGGGTAGTAR:TCTATAACAGATAGAGAGGCTGTTTCCF:ATACAACCCTGCCCAAAACCR:CTCATTCTGTGTCCAGCTTCCF:TATTTTTGTCTTGAGCCGAGGR:AGAGTGTTCATGAGAACAATATGCCF:CCATTGACTGTGAAATCGTGR:CTGTTCATTAGCAGTATCAGCTCF:GTAGAACCCTGTCTTCCATAAGTGR:GACAGAGAGAAACAAGATTCAGTAGF:CACAAGAGTTAGGTCCATTTACTTGR:CAGAAAGAGAGAGATAGAGAATTGGF:TTACTAGGTACCGTGAGATGCR:ACATTCTACCCTCCCCAGACF:AGTGAGTTATCTGGTAGTCATCCTGR:TGTAAGAAACACCACTCTATGTCTCF:CTCTTCATTAGACGTTGCTCTAR:GACGAGTCACATTATTCAGTTGF:CTCACCGTAGATACAAGTAGAATACR:AGGGTTTAAAATCCCCTACATCF:CTCCAAATTGGGCAATAACAR:TTAGGAAGTTGCATTAGGCCAF:GTTTCAGCAGCCTGTCCAATR:TGACAGCATTTGGGTTTGAG

Marker Motif No. allelesd HE b F c Allelic distort.

MIC3 (AAC)855 2.5 0.5 18 233-273 0.91 0.06 3.95 9.04

MIC5 (AAC)655 2.5 0.5 1d 118d

MIC48 (ATC)550 2.5 0.4 8 220-228 0.7 0.11 1.12 1.37

MIC89 (AAT)455 2.5 0.2 5 284-340 0.53 -0.08

MIC96 (AAAC)460 2.5 0.4 1e 210d

MIC98 (AAC)560 2.5 0.4 2 187, 189 0.06 0

MIC103 (AAC)755 2.5 0.5 1e 169d

MIC242 (ATC)760 2.5 0.4 2 104, 109 0.12 -0.08

MIC269 (AAC)455 2.5 0.2 7 230-258 0.72 0.19 2.97 14.69

MIC301 (AC)755 2.5 0.4 18 322-385 0.87 0.17 4.08 6.73

MIC303 (AAC)760 2.5 0.2 5 312-383 0.52 0.58

MIC341 (CA)9(GA)650.6 2.5 0.4 22 174-221 0.89 0.14 6.86 10.5

MIC350 (AC)860 3.5 0.6 12 251-326 0.73 0.48

MIC441 (AC)550 2.5 0.4 1e 240d

SSR43 (TAC)756.6 2.5 0.4 1e 195-216 0.87 0.43 0 0

SSR140 (CAG)755 2.5 0.07 8.56 15.22*0.2 10 120-144 0.45

Cross-amplification of primers

Species MIC3 MIC48 MIC89 MIC98 MIC242 MIC269 MIC301 MIC303 MIC341 MIC350 SSR43 SSR140P. acutifolia X X X X X X X XP. angulata X X X X X X X XP. ampla X X X X X X X X XP. pruinosa X X X X X XP. peruviana X X X X X X X XP. alkekengi X XSolanum lycopersicum

X X X

Solanum melongena

X X X X

Capsicum annuum

X X X X

Nicotiana tabaccum

X X

Tests of Mendelian segregation

• Segregation tested using ~50 F2 progeny per marker

• All 12 markers showed nuclear segregation

• One (SSR140) showed significant distortion

• No linkage detected among markers• But not all marker combinations tested

Genetic diversity survey

• Is there evidence for a genetic bottleneck within cultivated genotypes?

• Is there evidence for restricted gene flow• Among geographic regions?• Between cultivated and uncultivated

genotypes?• What is the geographic origin of

cultivated genotypes?

Survey sample• Includes germplasm from

• USDA• BANGEV (Mexico)• CATIE (Costa Rica, samples from Guatemala)

• 69 genotypes• 39 different sites• 19 sites represented by 2 or 3 genotypes

• 6 Guatemalan states and 15 Mexican states• Cultivation status

• 21 uncultivated and 39 cultivated (all Mexican) • 9 unknown (all Guatemalan)

Diversity and cultivation status

Cultivated UncultivatedLocus A He A He

MIC3 16 0.89 13 0.89MIC48 7 0.65 5 0.68MIC89 4 0.54 4 0.45MIC98 2 0.03 2 0.13MIC242 2 0.12 2 0.13MIC269 6 0.70 7 0.61MIC301 15 0.86 13 0.82MIC303 4 0.56 5 0.54MIC341 19 0.89 13 0.86MIC350 9 0.65 7 0.76SSR43 13 0.87 10 0.84SSR140 9 0.47 4 0.47

Mean 8.8 0.6 7.1 0.6

Physiographic provinces

© 1975 Board of Regents, The University of Texas

Northern states

Trans-Mexican Volcanic Belt

Sierra Madre del Sur

Chiapas-Guatemala

Population structure

0.1

N: Northern states, T: Trans-Mexican Volcanic Belt, S: Sierra Madre del SurC: Chiapas-Guatemala

WeedyCultivated

Analysis of Molecular Variation

By geographic provincesource d.f. SumSq %Varamong groups 3 19.07 2.78within groups 132 437.72 97.22

total 135 456.79

By cultivation statussource d.f. SumSq %Varamong groups 1 8.14 2.5within groups 118 400.04 97.5total 119 408.18

Population structure analysis

• Bayesian statistical approach for detecting admixed populations (Pritchard et al. 2000)

• Assigns individuals fractionally to K subpopulations

• Optimal model is K=2 (with prob~0.98)

• Six pairs of markers show significant gametic disequilibrium

Diffuse domestication: a hypothesis

• Domestication in multiple regions?

• Extensive gene flow with uncultivated populations after domestication?

Future genetic work

• EST sequencing• Tod evelop molecular markers

• Crosses among self-compatible accessions• To map the genetic markers• Identify QTL for key domestication and

agronomic traits

• Association mapping of candidate genes• Shallow population structure• High levels of diversity and recombination

Prospects for improvement

• Traits of importance• Determinate

growth• Self-compatibility• Resistance to

lodging• Fruit retention• Loose calyx

Pests and diseases

• Viruses• Powdery mildew• Coleoptera• Heliothis subflexa

caterpillars

Conclusions• Much potential for crop improvement of

tomatillo• Germplasm resources are now available

• Variation for some traits (self-incompatibility) but not others (indeterminate growth)

• A panel of 12 microsatellites are now available

• Very little population structure• Possibly diffuse domestication• Extensive gene flow

• Excellent system for candidate gene association mapping

Many thanks to• María Chacon and Maria Tsompana (UNC-CH)

• Assistants Casey Kolb, Letycia Argote Nuñez, Leah Schinasi, Lindsey Swanson

• Larry Robertson (USDA)• Aureliano Peña Lomelí (Chapingo)• Ofélia Vargas de Ponce (Guadalajara)• Andrew Jarvis (CIAT)• Karen Williams (USDA Plant Exchange Office)• USDA, CATIE, and BANGEV seed banks• The many farmers who shared their seeds