i

An-Najah National University

Faculty of Graduate Studies

Genetic Diversity within Ancient Olives (Olea europaea L.)

in Palestine

By

Mohammad Yousef Jaber

Supervisor

Dr. Hassan Abu Qaoud

Co- Supervisor

Dr. Rami Arafeh

This Thesis is Submitted in Partial Fulfillment of the Requirements for

the Degree of Master of Plant Production, Faculty of Graduate

Studies, An-Najah National University, Nablus, Palestine.

2013

iii

Dedication

This work is dedicated to my father, mother, wife, brother, sisters and

my friends; the completion of this work was not possible without their

support and help.

iv

Acknowledgments

I would like to express my deepest respect and most sincere

gratitude to my supervisor Dr. Hassan Abu Qaoud and Dr. Rami

Arafeh Co- Supervisor for his guidance and encouragement at all

stages of my work.

In addition I would like to thank my committee members, Dr.Aziz

Salameh and Dr.Heba El-fares.

Another word of special thanks goes for all members of the

Department of Plant Production at the Faculty of Agriculture at

An-Najah National University.

Last but not least my thanks and gratitude to my family, friends

and colleagues in my work for their help and support.

v

اإلقرار

:وقع أدناه مقدم الرسالة التي تحمل عنوان أنا الم

Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine

Declaration

The work provided in this thesis, unless otherwise referenced, is the

researcher’s own work, and has not been submitted elsewhere for any other

degree or qualification.

Student’s Name: إسم الطالب :

Signature: التوقيع :

Date: التاريخ :

vi

Table of Contents

Content Page

Dedication iii

Acknowledgment iv

Table of contents vi

List of figures vii

List of tables viii

List of abbreviations ix

Abstract x

Chapter One: Introduction 1

Introduction 1

Chapter Two: Literature review 7

The biology of olive 7

Studies on molecular markers in olive 8

Chapter Three: Materials and methods 15

Plant material 15

Isolation and quality measures of the total DNA 19

Microsatellite (SSR) analysis 19

Polymerase chain reaction (PCR) reagents and procedure 21

Visualization of PCR product 22

Microsatellite gel scoring, data collection and data analysis 23

Chapter Four: Results and discussion 25

Description of SSR data 25

SSR data analysis 27

Chapter Five: Conclusions and recommendations 34

References 36

Appendix 53

ب الملخص

vii

List of Figures

No. Figure Page

Figure (1)

A,B

Tow samples of ancient olive trees with

diameter more than 1.0 m. selected from ( A)

Assera elshamaliah and (B) bait leed.

16

Figure(2) Al-Badawi olive tree in the village Al-Walaja. 16

Figure(3) West Bank map and sample localities. 17

Figure(4)

(A) +(B) photos of gel electrophoresis for

microsatellite markers with( new England bio

laps DNA ladder Catalog #N3032S.

25

Figure(5) Two dimensional PCA plot of 101 individuals

and six SSR markers. Numbers represent the

proportion of variation represented on each axis.

28

Figure(6) Three dimensional PCA plot of 101 individuals

and six SSR markers. Numbers represent the

proportion of variation represented on each axis.

Numbers in the plot refer to groups; 1) core

ancient, 2) close to ancient, 3) Walaja and wild

individuals, 4) cultivated Nabali Mohassan, 5)

Souri cultivar.

28

Figure(7) A circle NJ tree of all individuals included

according to Saitou and Nei, 1987. Numbers

indicate bootstrap values after 500 replicates

29

Figure(8) PCA analysis of assigned populations based on

square root distance in FAMD software.

32

Figure (9) UPGMA dendogram Based on Nei’s (1978)

Genetic distance of ancient, cultivated and wild

olives

33

viii

List of Tables

No. Table Page

Table

(1)

Countries of olive production according to FAOSTAT

(2010).

2

Table

(2)

main genetic markers used in olive studies and their

use in this crop

11

Table

(3)

Localities, geographical coordinates and sample size

that were included in the study

18

Table

(4)

List of SSR tailed primers along with forward and

reverse sequences used in this study and the reference

of each pair

20

Table

(5)

The PCR program used for the amplification of SSR

primers

22

Table

(6)

Summary of Heterozygosity statistics for the six SSR

markers analyzed

27

ix

List of Abbreviations

Abbreviation Full Name

2D PCA plots Tow dimention plots

3D PCA plots Three dimention plots

AFLP Amplified fragment length polymorphism

cv. Cultivar

dATP deoxyadenosine triphosphate

dCTP deoxycytidine triphosphate

dGTP deoxyguanosine triphosphate

DNA Deoxyribonucleic Acid

DNTPS Deoxynucleotide Triphosphates

dTTP deoxythymidine triphosphate

FAO Food and Agriculture Organization of the United Nations

GDP Gross domiestic product

Ha Hectare

ISSR Inter-simple sequence repeat

Ng Nanogram

NJ Neighbor Joining

PCA Principal component analysis

PCBS Palestinian central bureau of statistics

PCR Polymerase chain reaction

pMol Picomoles

(q/ha) Quantity per hectares (Ton/hectares)

RAPD Random amplification of polymorphic DNA

RFLP Restriction fragment length polymorphism

SE Standard error

SSR Simple Sequence Repeat

UPGMA

Unweighted pair group method with arithmetic mean

(capital letter)

UV Ultra violet

W Width

x

Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine

By

Mohammad Yousef Jaber

Supervised

Dr. Hassan Abu Qaoud

Co- Supervised

Dr. Rami Arafeh

Abstract

This study is conducted to explore the genetic variation using simple

sequence repeat (SSR) microsatellite marker within ancient olive “Roumi”

and some selected common cultivars across olive cultivation areas in

Palestine. Ninety two ancient olive samples in addition to four Nabali

Baladi, three Nabali Mohassan, one Souri, and one wild olive samples were

included in the study. The famous olive tree of Al-Walaja village that is

dated to 4500-5000 years was also included in the study (6 samples from

the tree drip line). In six SSR loci screened (23) polymorphic alleles were

observed. Cluster analyses by neighbour joining (NJ) and Principal

Coordinate Analysis (PCA) in 2D and 3D plots reflected high genetic

similarity within the group of ancient olive in addition to the “Nabali”. The

Nabali Mohassan and Souri were clustered in two separated groups. The

“Al-Walaja” and the wild samples clustered closely in one group. Both

individual and Population based analysis showed absence of geographical

pattern within the ancient populations in addition to a clear separation from

Nabali Mohassan and Souri from the remaining populations. The High

similarity between Roumi and Nabali Baladi, and also between the wild

and Al-Walaja tree was observed indicating common ancestral genetic

xi

pool. In conclusion, the Roumi ancient olives in Palestine have very narrow

genetic background suggesting that it was propagated from very similar

genetic material.

1

CHAPTER 1

Introduction:

Olive, Olea europaea L. is the most cultivated plant in the world (FAO,

2004). and its one of the oldest known cultivated plant for human

civilization in the region. Olive has shaped both the culture and the

landscape of the Mediterranean for thousands of years. (Green, 2002;

Bartolini et al., 2002).

In 2010 more than 9.4 million hectares were planted with olive trees,

which is more than twice the amount of devoted land of apples, bananas or

mangoes. Only coconut trees and oil palms command more space. (FAO,

2012). Cultivation area tripled from 2,600,000 to 7,950,000 hectares

(6,400,000 to 19,600,000 acres) between 1960 and 1998 and reached the

peak in 2008 with 10 million ha. The ten largest producing countries,

according to the Food and Agriculture Organization, are all located in the

Mediterranean region and produce 95% of the world's olives and olive oil

(Table 1).

2

Table 1. The Production, Area, and Yield of olive in the largest

Producing Countries in The World.

Rank Country\Region Production

(in tons)

Cultivated area

(in hectares)

Yield

(q/ha)

01 Spain 6,940,230 2,330,400 2.9781

02 Italy 3,182,200 1,144,420 2.7806

03 Greece 2,000,000 850,000 2.3529

04 Turkey 1,750,000 798,493 2.1916

05 Morocco 1,364,690 597,513 2.2839

06 Syria 1,095,040 684,490 1.5997

07 Tunisia 863,000 1,779,950 0.4848

08 Egypt 459,650 52,668 8.7273

09 Portugal 443,800 343,200 1.2931

10 Algeria 420,000 295,000 1.4237

11 Argentina 170,000 62,498 2.72

12 Peru 160,914 12,962 12.4142

13 Libya 139,091 216,013 0.6439

14 Jordan 131,847 62,088 2.1235

15 Palestine 115,551 109,213 1.058

16 Australia 91,067 30,407 2.9949

— World 19,845,300 9,634,576 2.0598

FAOSTAT (2011).

In palestine, olive is the most important economic crop value. Olive

occupied about 45% of cultivated area in Palestine and in a good years can

contribute as much as 15-19% of agriculture output (PCBS,2004). Given

3

that agriculture accounts for nearly 25 percent of GDP, Olive sector is an

important element of the Palestinian economy and estimates suggest that

about 100,000 families depend to some extent upon the olive harvest for

their livelihoods (The World Bank, 2012). In Palestine, about 90- 95% of

the harvested olive fruits are used to produce olive oil, and the average of

olive oil production ranged between 20,000-25,000 tons in the last decade

,According to PCBS(2012) the production of olive oil exceed 22,951

tons.

They are several olive cultivars in Palestine but the most common are

Nabali Baladi, Nabali Mohassan and Souri. Ancient olive trees are with

centennial or even millennial ages that have being dated back to the

crusade time are known with the cultivar name “Roumi”. The Roumi

cultivar can be found in many olive orchards among Palestinians areas as

well as other eastern Mediterranean countries like Syria, Lebanon and

Jordan.

Until recent times, the discrimination between the olive cultivars is

difficult because of the high similarities in morphological characters. There

are more than 1250 cultivars that have been described for Olea europaea L

using morphologic analyses (Bartolini, 2008), Differences within and

between olive cultivars was determined by assessing differences in olive

tree, namely leaf shape and colour, and other morphological characters

regarding fruit shape. These measures based on phenotypic characters

revealed to be problematic, especially in early stages of tree

4

development, but they are readily available and does not require

sophisticated equipment and is the most direct measure of phenotypes.

However, these morphological and phonological markers have the

disadvantage of the small number of polymorphism detected and of being

environmentally dependent (Mohan et al., 1997; Tanksley & Orton, 1983).

Besides that, some of the morphological characteristics are available for

short period (e.g., olive fruits) or when the olive tree achieves a mature

stage, which may delay the correct identification. Due to the high genetic

diversity observed in olive germplasm and the presence of homonyms and

synonyms cases, efficient and rapid discriminatory methods are described

to identify cultivars and to determine the relationships between them.

(Fabbri et al. 2009).

The olive tree (Olea europaea var. europaea) is thought to have been

domesticated from the wild oleaster species Olea europaea var. sylvestris

at a minimum of nine different times. The earliest probably dates to the

Neolithic migration into the Mediterranean basin, about 6000 years ago.

Propagating olive trees is a vegetative process; that is to say, successful

trees are not grown from seeds, but rather from cut roots or branches buried

in the soil and allowed to root, or grafted onto other trees. Regular pruning

helps the grower keep access to the olives in the lower branches, and olive

trees are known to survive for centuries, some reportedly for as much as

2,000 years or more. The first domesticated olives are likely from the

eastern end of the Mediterranean Sea, although some debate persists about

5

its origins and spread. Archaeological evidence suggests that the

domestication of olive trees spread into the western Mediterranean and

North Africa by the Early Bronze Age, 4500 years ago. (Hirst, 2013).

A lot of ancient olive trees are found in Palestine and they have similar

morphological characteristics implying that cultivar identity based on

morphology is inefficient. but the characterization and conservation of the

ancient olive germplasm is a priority task because these trees are

progressively cut and used for their ornamental value, and to the

progressive transformation of traditional olive groves into new commercial

orchards or other crops (Muñoz-Diez, 2008; Rallo and Muñoz-Díez, 2010).

Additionally, the outstanding performance of ancient olives may also be

helpful in understanding history of olive domestication.

With the help of moluclar markers, the classification and characterization

of this large number of ancient olives in Palestine is possible and also

efficient method to identifiying possible unknown morphotypes in this

group.

The general objective of this study is to provide an insight into the genetic

diversity of olives in Palestine with high focus on ancient olives by using

microsatellite marker.

The specific objectives are:

1- to explore the genetic variation and relationships within and among

different ancient olive growing areas in Palestine.

6

2- To use microsatellite marker (SSR) for highlighting the relationship

between ancient, wild and some common cultivated olive cultivars in

Palestine.

7

CHAPTER 2

Literature review:

1- The biology of olive

Olive belongs to the Oleaceae family that includes 30 genera and 600

species (Cronquist 1981), olive is a diploid species having 46 chromosomes

(2n = 46) (Reale et al., 2006). within the genus Olea, there are 30 species

exist throughout the Mediterranean basin (Reale et al., 2006; Taamalli et

al., 2006) in which Olea europaea is only cultivated species. Wild olive or

oleaster (Olea europaea subsp. europaea var. sylvestris) and the cultivated

olive (Olea europaea subsp. europaea var. europaea) are the two forms of

the subspecies europaea exist (Green 2002).

The cultivated olive is an evergreen, out-crossing, vegetatively propagated

tree with a very wide genetic patrimony that is the result of both plant

longevity and the scarcity of genotype turnover through centuries of

cultivation (Bracci et al., 2011).

In another side The large number of cultivars, added to the many cases of

synonymous and homonymous name, makes the description and

classification of olive varieties is extremely difficult (Fabbri et al.

2009),The size of cultivated olive germplasm based on about 1,250

varieties, cultivated in 54 countries, conserved in over 100 collections,

were included in the FAO olive germplasm database. (Bartolini, 2008), but

8

the fact is certainly much more because the lack of information on many

local cultivars (Cantini et al., 1999).

Due to this richness of the germplasm, olive is an unusual case among

horticultural crops and its biodiversity can represent a rich source of

variability for the genetic improvement of this plant (Baldoni and Belaj,

2009).

2- Studies on molecular markers in olive:

Exploring the variation between olive cultivars has long history. Several

methods were implemented in the early studies questioned the genetic

variation indirectly such as isozyme analysis by Trujillo et al., (1995),

they studied the isozyme variation in 155 olive cultivars by analysing

pollen samples there results showed discrimination between 85% of the

studied cultivars. The remainder were separated into groups of two or three

cultivars that could be identified using morphological characteristics. No

intracultivar polymorphisms were observed.

DNA-based markers revealing polymorphisms at the DNA level are very

useful tools in genetic studies and in the improvement of crop plants, and

present numerous advantages over conventional phenotype based methods,

they can be applied to a variety of purposes including DNA fingerprinting,

genetic screening and chromosomal mapping (Bracci et al., 2011).

9

Molecular markers according to Kahl (2004) are any specific DNA

segment whose base sequence is polymorphic in different organisms. Such

markers can be visualized by hybridization-based techniques such as

restriction fragment length polymorphism (RFLP) or by polymerase chain

reaction (PCR)-based methods.

Several molecular markers have been recently used to characterize and

discriminate the olive cultivars such as chloroplast DNA RFLP (Besnard et

al., 2011), chloroplast DNA SSR (Baali-Cherif and Besnard, 2005), AFLP

(Hagidimitriou et al., 2005; Owen et al., 2005; Grati-Kamoun et al., 2006;

Ercisli et al., 2009), RAPD (Belaj et al., 2004; Soleimani et al., 2006; La

Mantia et al., 2006; Sesli and Yegenoglu, 2009; Durgac et al., 2010),

mitochondrial DNA RFLP (Besnard and Berville, 2000), mitochondrial

DNA AFLP and RAPD (de Caraffa et al., 2002), ISSR markers

(Terzopoulos et al., 2005; Essadki et al., 2006), chloroplast DNA SSR

(Mariotti et al., 2010), ISSR and SSR (Gomes et al., 2009), SSR and RAPD

(La Mantia, 2006), SSR (Díaz et al., 2006; Ganino et al., 2007; Muzzalupo

et al., 2009; Baldoni et al., 2009; Alba, et al., 2009; Roubos et al., 2010;

Mariotti et al., 2010).

A Two inter-simple sequence repeat (ISSR) markers were effeciently used

for the differentiation among 31 Olea europaea L. cultivars grown in

Greece (Terzopoulos et al., 2005). A wide intra-varietal genetic variability

among 120 clones of the Portuguese olive ‘Cobrançosa’ cultivar was

observed using RAPD and ISSR techniques (Martins-Lopes et al., 2009).

10

Using AFLP analysis, significant genetic diversity was revealed among the

main Italian olive cultivars (Sensi et al., 2003). RAPD analysis of

Eighty-four olive accessions in Tunisia indicated coefficient of smiliraty

ranges between 0.98 and 0.40 estimated by simple matching algorithm

(Zitoun et al., 2008 ). Belaj et al. (2003) compared the usefulness of

RAPD, AFLP, and SSR markers for identification and genetic

differentiation of 32 Spanish and Italian olive cultivars. They concluded

that SSR markers, due to their co-dominant nature, high levels of

polymorphism and reproducibility, have a higher discriminating power for

cultivar identification, and are ideal for olive genome mapping and genetic

studies. A description of the main genetic markers used in olive studies and

their use in this crop is presented below and summarized in table 2.

The choice and selection of an adequate molecular marker systems depends

upon the type of study to be undertaken and whether it will fulfil at least a

few of the mentioned criteria like: (a) highly polymorphic between two

organisms, inherited co-dominantly, (b) evenly distributed throughout the

genome and easily visualized, (c) occurs frequently in the genomes, (d)

stable over generations, (e) simple, quick and inexpensive technique, (f)

small amounts of DNA samples required, and(g) no prior information about

the sample’s genome is required (Agarwal et al., 2008; Hatzopoulos et al.,

2002).

11

Table (2) - main genetic markers used in olive studies and their use in this crop. RFLP RAPD SSR AFLP ISSR

Developers Botstein et al.

(1980)

Williams et al.

(1990)

Morgante and

Olivieri (1993)

Vos et al. (1995) Zietkiewicz et al.

(1994)

Application in Olea

europea L.

-Phylogenetic studies.

(Baldoni et al. 2009)

-Male sterility analysis.

(Besnard et al. 2000)

-DNA fingerprinting of cultivars

(Fabbri et al. 1995),

-Genetic correspondence of plant

material from nursery(Belaj et al. 1999)

-Detection of intra-cultivar variability

(Belaj et al. 2004)

-Construction of linkage map

(De la Rosa et al. 2004)

-Cultivar traceability in olive oil

(Martins-Lopes et al. 2008)

-Phylogenetic studies (Hess et al. 2000),

-DNA fingerprinting

of cultivars.

(Baldoni et al. 2009)

-Construction of linkage map.

(De la Rosa et al. 2003)

-Paternity analysis.

( De la Rosa et al. 2004)

-DNA fingerprinting of

cultivars.

( Angiolillo et al. 1999)

-Detection of intra-cultivar

variability.

(Belaj et al. 2004)

-Phylogenetic studies.

(Baldoni et al. 2006)

-Cultivar traceability in olive

oil.

(Busconi et al. 2003)

-Construction of linkage map.

( De la Rosa et al. 2003)

-Phylogenetic studies.

(Hess et al. 2000),

-Detection of intra-

cultivar variability.

(Gemas et al. 2004)

-Cultivar traceability in

olive oil.

(Martins-Lopes et al.

2008)

Principle Southern blotting of

restricted fragments

PCR of random mprimers PCR of Microsatellite Detection of DNA

Restriction fragments by

PCR

PCR of inter simple

Sequence repeats

Level of polymorphism Medium Medium Very high Medium Medium

Codominance

of alleles

Codominant Dominant Codominant Dominant Dominant

Number of loci

analyzed per assay

1-2 3-15 1 04-150 3-12

DNA required per

assay

2-10 µg 10-20 ng 20-50 ng 20-500ng 10-20ng

12

Prior

sequence

information

Yes No Yes No No

Developmental cost High Low High Medium Low

Running costs per

assay

Medium Low Medium Medium Low

Repeatability Very high Fair Very high Very high Medium-high

Ease of use Labour intensive Easy Easy Difficult initially Low

13

Microsatellites (Simple Sequence Repeats -SSRs), consists of short, (1-6

base pairs long), with tandem repeated sequences mono-,di-,tri-,tetra-or

penta-nucleotide units occurring in the genomes of many higher organisms

(Rafalski &Tingey,1993; Wu & Tanksley, 1993), SSR is co-dominant and

hyperallelic. The number of repetitions of these nucleotide units generates a

polymorphism among genotypes, and they are widely used in plant genetic

research for diversity studies; namely in olive tree because of their high

polymorphism, reproducibility, and ideal for genetic map development,

linkage analysis, marker-assisted selection and fingerprinting studies

(Bracci et al., 2009; Cipriani et al., 2002; De la Rosa el al., 2004; Gomes et

al., 2009; Karp et al., 1996; Muzzalupo et al., 2009; Rallo et al., 2002; Sefc

et al., 2000).

When compared with RAPD or AFLP markers, the SSR have the

advantage of their co-dominant nature, as two alleles may be identified at

each locus. The main constrain of SSR markers is the development requires

previous DNA sequencing for primer designing. Many authors have

reported on SSR development in olive and several of them are currently

available for DNA analysis (Sefc et al. 2000; Cipriani et al. 2002; De la

Rosa et al. 2002; Sabino Gil et al. 2006; Sefc et al., 2000; Bandelj et al.,

2004).

These markers have been used for different applications such as cultivar

discrimination (Sarri et al. 2006; Fendri et al., 2010), study of relationships

between wild and cultivated olive tree (Belaj et al., 2007), construction of

14

association maps (De la Rosa et al., 2003), paternity analysis (Mookerjee et

al., 2005) and identification of olive oil varietal composition (Alba et al.

2009;Ayed et al. 2009). Doveri et al. (2008) and Baldoni et al. (2009) have

listed SSR markers and protocols for olive genotyping aimed at developing

a robust method for accurate and precise olive genotyping.

15

CHAPTER 3

Materials and methods

1- Plant material:

Ninety six olive trees were selected from different geographical regions of

the West Bank area from north to south. Geographical coordinated and

sample size of each locality is presented in Table (3).

Since this study is focusing more on the genetic construction of ancient

olives, the size age relationship appears to be the most suitable methods to

identify the age of trees and only trees with diameter more than 1.0 m

(circumference about 3.0 m) were selected (figure 1) for taking leaf

samples (Rozas, 2003; 2004).

The diameter of 96 ancient olives was measured at 1.0 m height from the

ground surface. Trees with seriously damaged trunks were excluded from

this analysis. The diameter of the ancient olives ranged between 1m to 6 m.

long.

16

Figure 1. A photograph of tow ancient olive trees with diameter more than 1.0 m

sampled from (left) Assera Al-Shamaliah and (right) Bait Leed.

An olive tree in the village of “Al-Walaja” between Jerusalem and

Bethlehem, called “Al-Badawi” tree, figure (2) was given a special

attention in this study. It is a mass of trunks with a total diameter around

6.0 meters. The tree was aged between 4000-5000 years old. (ARIJ, 2010).

Six DNA samples from this tree were included in the study collected from

the circumference of the tree’s drip line.

Figure (2). Al-Badawi olive tree in Al-Walaja village. The tree is about 6.0 meters

diameter with many trunks. From (ARIJ,. 2010).

17

In total, 101 sample of fresh leaf material were collected then dried with

silica gel beads to use for DNA extraction. Within the samples, eight olive

trees were also included from cultivated Nabali Baladi(4 trees), Nabali

muhassan(3 trees) and souri(1 tree). A map for all localities sampled is

shown in figure (3).

Figure (3) localities were the leaves samples of ancient olive trees where collected.

18

Table (3). Localities, geographical coordinates and sample size that

were included in the study.

# of

samples

# of

Trees

E N District Location No.

6 6 35 23 33 43 32 20 32 82 Tubas Tayaser-

Tobas 1

6 6 35 15 06 60 32 27 55 85 Jenin Berqeen 2

3 3 35 24 09 30 32 29 36 49 Jenin Faqouaa 3

6 6 35 10 35 64 32 30 21 03 jenin Anin 4

6 6 35 01 34 29 32 07 50 41 Qalqilia Bait Amin 5

6 6 35 08 28 87 32 12 53 85 Qalqilia Kufrqadom 1 6

6 6 35 21 51 86 32 08 40 90 Nablus Aqraba Yanon 7

6 6 35 15 55 12 32 15 06 81 Nablus Assera

elshamaliah 8

6 6 35 10 17 03 32 04 43 84 Salfeet Salfeet 9

6 6 35 04 09 83 32 06 35 86 Salfeet Bedya 10

6 6 35 08 40 84 32 14 55 36 Tulkarem Bait leed 11

6 6 35 14 11 11 31 46 42 31 Jerusalem Jerusalem 12

6 1 35 09 04 66 31 44 03 43 Baitlahem Walajah 13

12 12 35 05 47 86 31 31 40 52 Hebron Hebron 14

5 5 35 02 47 67 31 32 12 51 Hebron Tafouh 15

8 8 (0) Nabali Baladi ,(3)

Nabali Mohassan, (1) Souri

Qalqilia Kufrqadom 16

1 1 wild olive trees Nablus Al-Junaidi

nursery 17

101 96 Total

19

2- Isolation and quality measures of the total DNA:

Leaves samples were grinded into a powder using mortar and pestle with

sterile sea sand. DNA extraction and purification was carried out with

Qiagen, DNeasy total genomic extraction kit following manufacturer’s

instructions.

DNA quality and concentration were measured with DNA

spectrophotometer (Eppendorf A.G., Hamburg, Germany). Another test for

DNA quality and concentration was conducted with agarose gel

electrophoresis. Samples with poor quality DNA were excluded and the

extraction was repeated. Concentration and quality of the used DNA are

listed in table 1. in the appendix. For each SSR reaction, DNA

concentration was adjusted at around 50.0 ng/µl.

3- Microsatellite (SSR) analysis

A set of six microsatellite (SSR) primer pairs were used to explore the

polymorphism in 101 ancient and some cultivated olive samples (Table 0).

20

Table (4). List of (SSR) primers along with forward and reverse

sequences used in this study and the reference of each pair.

No Marker Forward and reverse primer pair Reference

1 U99-35 5’ AATTTAATGGTCACACACAC 3’

3’ ATTGCGAAATAGATCTACGA 5’

(Cipriani et al., 2002)

2 U99-28 5’ CTGCAGCTTCTGCCCATAC 3’

3’ GCAGCTCATCATTTGGCACT 5’

Capriani et al (2002)

3 GAPu-

103

5’ TGAATTTAACTTTAAACCCACACA 3’

3’ GCATCGCTCGATTTTATCC 5’

(Cipriani et al., 2002)

4 DCA9 5’ AATCAAAGTCTTCCTTCTCATTTCG 3’

3’ GATCCTTCCAAAAGTATAACCTCTC 5’

Sefc et al., 2000;

Bandelj et al., (2004)

5 DCA16 5’TTAGGTGGGATTCTGTAGATGGTTG 3’

3’ TTTTAGGTGAGTTCATAGAATTAGC 5’

Sefc et al., 2000;

Bandelj et al.,( 2004)

6 DCA3 5’ CCCAAGCGGAGGTGTATATTGTTAC 3’

3’ TGCTTTTGTCGTGTTTGAGATGTTG 5’

Sefc et al., 2000;

Bandelj et al., (2004)

21

4- Polymerase chain reaction (PCR) reagents and procedure:

Amplifications were performed in polymerase chain reactions (PCRs) tubes

with total volume of 25.0 μl containing 1.0 μl of genomic DNA template

(30-60 ng), 22.0 μl of master mix containing (H2O; 15.0 μl, 10X buffer; 2.5

μl; MgCl2 (25 mM) 2.5 μl; dNTPS (5mM)1.0 μl; and 1.0 μl of Taq

polymerase enzyme produces in Biotechnology Research Center BRC at

Palestine Polytechnic University. PCR-PPU master mix contained 1.25 unit

of Thermoprime Plus DNA Polymerase, 75 mM Tris-HCl, 20 mM

(NH4)2SO4, 3.0 mM MgCl2, 0.01% (V/V) Tween® 20 and 0.2 mM each of

dATP, dCTP, dGTP and dTTP respectively. PCR PPU- Master mix also

contains dye to facilitate the electrophoresis. Forward and reverse primers

were added at 1.0 μl of each (15 pmol/μl). The PCR reactions were setup in

0.2 ml PCR tubes. The PCR was carried out in the thermal cycler from

Applied Biosystems.

Thermocycler details used for SSR amplifications are listed in table (5).

22

Table (5). The PCR program used for the amplification of SSR

primers.

PCR profile for SSR analysis Process

Step -1 94oC for 5 minutes Initial Denaturation

Step -2 94oC for 1 minute Denaturation

Step -3 55oC for 1 minute Annealing

Step -4 72oC for 2 minutes Extension

Step -5 35 times repeated 35 Cycles

Step -6 72oC for 7 minutes Final extension

Step -7 4oC for ever End

5- Visualization of PCR product:

The PCR product (25.0 μl) of each sample was loaded in 2.0% w/v agarose

gel dissolved in 1X TBE buffer. Ten microliters of ethedium bromide at a

concentration of 10.0 μg/μl was mixed with the gel solution after being

dissolved. The samples were loaded into gel pockets for electrophoresis at

(100-110) volt for about 1.5 hours. A hundred basepair ladder was added in

every gel to facilitate the scoring procedure. After electrophoresis, the gels

were photographed with a digital camera provided with UV filter.

23

6- Microsatellite gel scoring, data collection and data analysis:

Microsatellite amplicons were scored as a co-dominant marker on the

number of alleles (11, 22,… NN for homozygous and 12 for

heterozygous..etc) and according to the amplicon’s size in base pairs as

viewed on agarose gel. Furthermore, allelic data was transformed into a

binary (0/1) matrix to carry out other dominant marker based analysis

including Neighbour Joining (NJ) clustering and population PCA analysis.

Principal Component Analysis (PCA) was carried out to explore the

individual genetic grouping in 2D and 3D PCA plots. Genetix v 4.05

software (Belkhir et al. 2004) was used to generate 2D and 3D plots for

individuals. A population based PCA analysis was also carried out with

FAMD software (Schlueter and Harris, 2006) according to the Square root

distance method between populations. The PCA analyzes a data table

representing observations described by several dependent variables, which

are, in general, inter-correlated. Its goal is to extract the important

information from the data table and to express this information as a set of

new orthogonal variables called principal components (Abdi and Williams

2010).

The SSR data were analyzed using several genetic parameters such as

number of alleles per locus; observed heterozygosity (Ho, calculated as the

number of heterozygotes per locus divided by the number of individual

typed). Expected heterozygosity (He) or gene diversity (Nei 1987).

24

Neighbor Joining (NJ) phenogram (Saitou and Nei, 1987) was generated

using the software MEGA v.5.1 in order to examine the clustering of

individuals. Bootstrap statistical support was calculated from 500

replicates. Heterozygosity measures were carried out with Popgene v.1.32

software (He and Genetic diversity). Samples from each location were

treated as one populations and a population dendogram was generated in

TFPGA software according to Nei and Li (1979) population distance.

In other approach, the banding pattern was read as dominant marker in a

(0) absent to (1) present to generate the similarity matric according to

standard Jaccard Coefficient with FAMD.

Jaccard’s similarity coefficient for a pair of individuals i and j is defined as

Sij= p / p+q+r

where:

S: similarity.

p: is the number of variables that are positive for both ith and jth.

q: is the number of variables that are positive for the i and negative for the jth object.

r: is the number of variables that is negative for the ith and positive for the jth.

So the Jaccard’s distance (d=1-Sij).

25

CHAPTER 4

Results and discussion:

1- Description of SSR data:

The six SSR primers used in this study produced in total 23 polymorphic

SSR loci. The sizes of amplicons ranged from 120 base pair in the primer

pair SSR-DC16 and the largest amplicon was 620 base pair in the primer

SSR-DCA3.

Figure (4) A: GAPu-103 microsatellite markers with( new England bio laps DNA

ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the

study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali

Muhassan,RA8= souri).

26

Figure (4) B: SSR-UA99-28 microsatellite markers with( new England bio laps DNA

ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the

study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali

Muhassan,RA8= souri, BD= bidya,WA= walajah).

Heterozygosity statistics are presented in table (6). The average observed

heterozygosity equals to 0.63± 0.49 St. Dev.

27

Table (6). Summary of Heterozygosity statistics for the six SSR

markers analyzed.

2- SSR data analysis

The PCA analyses of the 101 individuals with the 6 SSR markers are

presented in 2D and 3D plots (figure 5, 6). In the 3D plot, the first three

principal coordinates accounted for 27.44%, 16.68% and 14.30% of the

total variation respectively. Most (81 accession) of the ancient olives in

addition to the Nabali Baladi were found in one close group (number 1). It

is noted that ancient accessions group show no geographical structure. The

genetic distance among the ancient individuals ranges from 0.0 – 0.1. Few

individuals positioned close to the large ancient group (2) include samples

JE3, JE4, HE6, HE11, TU5. Another group (3) consisted of the wild

individual and the Al-Walaja samples (6 samples) in addition to KQ3,

KQ4, KQ5, and BD6. Accessions, RA5, RA6 and RA7 (group 4) which

represent the Nabali Mohassan variety are grouped together. Interestingly,

the cultivar Souri (group 5) is located distantly from all the groups

described.

28

Figure 5. Two dimensional PCA plot of 101 individuals and six SSR markers. Numbers

represent the proportion of variation represented on each axis. Numbers in the plot refer

to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals, 4)

cultivated Nabali Mohassan, 5) Souri cultivar.

Figure 6. Three dimensional PCA plot of 101 individuals and six SSR markers.

Numbers represent the proportion of variation represented on each axis. Numbers in the

plot refer to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals,

4) cultivated Nabali Mohassan, 5) Souri cultivar.

29

The two dimensional (2D) PCA plot confirms the same finding revealed by

the 3D PCA plot. The main principle coordinates in the 2D plot accounted

for 27.44% and 16.7% from the total variation respectively (figure 5).

Neighbor joining (NJ) analysis of the 101 accessions is shown in figure (7).

The pattern shows a clear large cluster of individuals of ancient and Nabali

Baladi accessions, the other clear clusters of individuals of Nabali

Mohassan ,

souri , walaja and wild , some of closed individuals to Nabali Baladi and

ancient group was clustered also.

Figure 7. A NJ phenogram of all included individuals according to Saitou and Nei,

(1987). Numbers above the branches indicate bootstrap values after 500 replicates.

30

There is a huge mass of literature addressed the genetic diversity in olives

and because of the wide distribution of this crop and the huge number of

cultivars studied, part of the studies focused on exploring the genetic

relationships in accessions within a restricted area. Perhaps the study that is

very similar to this one was conducted by (Wiesman et al.,1998) focused

on molecular characterization of the traditional and introduced olive

cultivars in Israel and three locations in the West Bank area planted with

Nabali cultivar. They also included accessions from Souri cultivar in the

study. A high similarity among Souri accessions was , and to lesser extent

among Nabali. On the other hand, the Jaccard’s similarity coefficient was

calculated between Nabali and Souri ranged from 0.635 to 0.738. These

results are in agreement with the findings in this study despite using

different marker system. A clear discrimination between Souri and Nabali

Mohassan acessions was observed in the 2D, 3D and NJ analysis. Genetic

distance between Souri and Nabali Mohassan accessions ranged from 0.538

to 0.824 (table 2, Appendix).

Olive trees have been grown either for oil or table olive production in the

Mediterranean basin since ancient time. There is enormous number of olive

cultivars distributed in its cultivation range. The genetic diversity of them

is also abundant and characterized by a huge number of locally cultivated

and propagated germplasm by farmers. In a large scale study conducted by

(Bartolini et al., 1993), more than 1,208 cultivars from 52 countries,

conserved in 94 collections were addressed. However, the number of

31

cultivars is probably much higher bearing in mind the lack of information

on minor cultivars in different olive growing regions.

Cultivar surveys have been initiated in many olive growing countries in

order to describe existing cultivars, thus obtaining information for

germplasm preservation, description of cultivars of specific growing

regions and for breeding purposes. For the description and management of

the existing genetic diversity in olives, molecular markers have been found

to be particularly valuable because of such characteristics as high genetic

informativeness, environmental independence, relatively easy use and the

possibility of accumulating large amount of data.

Olive cultivars were further genotyped for identification purposes or for

assessment of genetic diversity on international (world germplasm

collections), national (Spain, Italy, Tunis, Morocco, Turkey, Greece,

Croatia, Slovenia, Portugal, Lebanon, Alger) and regional scales (olive

growing region with characteristic variety structure). There have been

numerous publications from these studies and we present here only a few

examples. Sarri et al. (2006) genotyped 118 olive cultivars from several

Mediterranean countries by use of twelve SSR markers showing high

discrimination power among the included samples.

The present study provided insight into the genetic variation in the ancient

“Roumi”olive that is cultivated in Palestine with centennial or even

millennial age. Microsatellites analysis indicated high genetic similarity

32

within ancient olives regardless of their geographic location from where

they collected (Jaccard coofeccient 0.0 – 0.1). As revealed by the

population based PCA, population from distant locations like Hebron in the

South and Faquo’a in the North, Tubas in the East and Salfeet in the West

grouped close to each other, figure (8).

Figure 8. PCA analysis of assigned populations based on square root distance in FAMD

software.

The same result can be visualized in the UPGMA dendogram regarding

these populations in figure 9. The tree has three clusters of ancient olives in

addition to another cluster of wild and Al-Walaja tree and the last cluster

with the Souri and Nabali Mohassan. Interestingly, the common cultivated

varieties the Nabali Mohassan and Souri fell in the same cluster apart from

the ancient and wild material. Wild olive and Al-walaja olive share similar

subcluster.

33

Figure 9. UPGMA dendogram based on Nei's (1978) genetic distance of ancient,

cultivated and wild olives treated as populations.

This study also provides vital information about similarity between the

wild olive Olea oleaster and Al-Walaja tree (0.200 -0.455 Jaccard

distance). Being clustered close to each other and distant from common

cultivated and ancient cultivars indicates common ancestry and relatedness

to the same genetic pool.

34

CHAPTER 5

Conclusions:

Molecular characterization of native germplasm followed by clear cultivar

identification in olives is important to confirm true-to-type denominated

cultivars and solve problems relating to synonyms, homonyms and

mislabelled planting material. This is, to the best of my knowledge, the first

study that addressed, in a comprehensive sampling approach, ancient olives

across their geographical distribution in Palestine as a part of the eastern

Mediterranean region.

One of the main concluding remarks in this study is the high genetic

similarity within the “Roumi” or ancient olives that are grown in Palestine

since centuries and the newly cultivated Nabali Baladi cultivar. Being one

close group implies formulating easier conservation strategy as well as

easier treatment for future breeding programs.

The high similarity between wild olive and Al-Walaja tree is noteworthy. It

was always believed that the ancient tree of Al-Walaja belongs to the

ancient Roumi cultivar. This study showed clearly the close relationship

between the wild and Al-Walaja tree. A closer look into the botanical and

horticultural characteristics of this tree in needed.

Relationships could also be established regarding common cultivated

varieties, Nabali, Nabali Mohassan and Souri.

35

Finally, SSR marker is a useful molecular tool for screening genetic

polymorphism and highlighting relationships within the olive material in

Palestine. Adopting variable SSRs that can be visualized and scored easily

would help to identify other cultivars which are propagated in Palestine.

36

References

Abdi H, Williams LJ. Jackknife. In: Salkind NJ, ed. Encyclopedia of

Research Design. Thousand Oaks: Sage Publications; 2010.

Agarwal, M.; Shrivastava, N. & Padh H. (2008). Advances in

molecular marker techniques and their applications in plant sciences.

Plant Cell Reports, Vol.27, pp. 617–631.

Alba, V., Montemurro, C., Sabetta, W., Pasqualone, A. & Blanco, A.

(2009a). SSR-based identification key of cultivars of Olea europaea L.

diffused in Southern-Italy. Scientia Horticulturae, No. 123, pp. 11–16.

ARIJ. 2010. Al Walaja Village Profile. Palestinian Localities Study.

Bethlehem governorate. http://proxy.arij.org/vprofile

Angiolillo A, Mencuccini M, Baldoni L. Olive genetic diversity

assessed using amplified fragment length polymorphisms. Theoretical

and Applied Genetics. 1999;98:411–421.

Ayed, R.B.; Grati-Kamoun, N.; Moreau, F. & Rebaï, A. (2009).

Comparative study of microsatellite proWles of DNA from oil and

leaves of two Tunisian olive cultivars, Eur Food Res Technol. Vol. 229,

pp. 757–762.

Baali-Cherif, D. and G. Besnard. 2005. High genetic diversity and

clonal growth in relict populations of Olea europaea sub sp. laperrinei

(Oleaceae) from Hoggae, Algeria. Annals of Botany, 96: 823-830.

37

Baldoni, L. & Belaj, A. (2009). Olive, In: Vollmann J, Rajean I (eds) Oil

crops. Handbook of plant breeding, vol 4. Springer Science Business

Media, New York, pp. 397–421. doi 10.1007/978-0-387-77594-4_13

Baldoni, L.; Nicolò, G.C.; Mariotti, R.; Ricciolini, C.; Arcioni, S.;

Vendramin, G.V.; Buonamici, A.; Porceddu, A.; Sarri, V.; Ojeda, M.A.;

Trujillo, I.; Rallo, L.; Belaj, A.; Perri, E.; Salimonti, A.; Muzzalupo, I.;

Casagrande, A.; Lain, O.; Messina, R. & Testolin, R. (2009). A consensus

list of microsatellite markers for olive genotyping. Molecular Breeding,

Vol.24, pp. 213–231.

Bandelj, D., Jakse, J., Javornik, B. 2004. Assessment of genetic

variability of olive varieties by microsatellite and AFLP markers.

Euphytica, 136: 93–102. Olive germplasm (Olea europaea L.) 2008.

Available at: http://www.oleadb.it/olivodb.html.

Bartolini, G. and Petruccelli, R. (2002) Classification, Origin,

Diffusion and History of the Olive. Food and Agriculture Organization of

the United Nations, Rome.

Bartolini, G., Messeri, C. and Prevost, G. 1993. Acta Horticulturae, 356:

116-118.

Belaj, A., Satovic, Z., Cipriani, G., Baldoni, L., Testolin, R. and Rallo,

L. 2003. Comparative study of the discriminating capacity of RAPD,

AFLP and SSR markers and of their effectiveness in establishing

38

genetic relationships in olive. Theoretical and Applied Genetics, 107:

736–744.

Belaj A, Muñoz-Díez C, Baldoni L, Porceddu A, Barranco D, SatovicZ.

Genetic diversity and population structure of wild olives from the

north-western Mediterranean assessed by SSR markers. Annals of

Botany 2007;100:449-458.

Belaj A, Rallo L, Trujillo I, Baldoni L. Using RAPD and AFLP

markers to distinguish individuals obtained by clonal selection of

‘Arbequina’ and ‘Manzanilla de Sevilla’ olive. Hortscience.

2004;39:1566–1570.

Belaj A, Trujillo I, De la Rosa R. and Rallo L.1999. Marcadores de

ADN para identificacion de variedades de olivo. Agricultura 799:166–

167.

Belkhir, K.; V. Castric and F. Bonhomme. 2002. IDENTIX, a software

to test for relatedness in a population using permutation methods.

Molecular Ecology Notes 2(4): 611-614

Bronzini de Caraffa, V., Maury, J., Gambotti, C., Breton, C., Berville´,

A.,Giannettini, J., 2002. Mitochondrial DNA variation and RAPD mark

oleasters, olive and feral olive from Western and Eastern

Mediterranean.Theor. Appl. Genet. 104, 1209–1216.

39

Besnard, G.; Khadari, B.; Villemur, P. & Bervillé, A. .2000. A

cytoplasmic male sterility in olive cultivars (Olea europaea L.):

phenotypic, genetic and molecular approaches.Theoretical and Applied

Genetics, Vol.100, pp.1018–1024.

Besnard, G., & Berville, A. (2000). Multiple origins for

Mediterranean olive (Olea europaea L. ssp europaea) based upon

mitochondrial DNA polymorphisms. CR Acad Sci Paris Sci de la Vie,

323, 173-181.

Besnard G, Hernandez P, Khadari B, Dorado G, Savolainen V (2011)

Genomic profiling of plastid DNA variation in the Mediterranean olive

tree. BMC Plant Biol. 2011 May 10;11:80. doi: 10.1186/1471-2229-11-80.

Botstein, D., R.L. White, M. Skolnick, and R.W. Davis. 1980.

Construction of genetic linkage map in man using restriction fragment

length polymorphism. Amer. J. Hum. Genet. 32:314–331.

Bracci, T.; Sebastiani, L.; Busconi, M.; Fogher, C.; Belaj, A. & Trujillo,

I. (2009). SSR markers reveal the uniqueness of olive cultivars from the

Italian region of Liguria. Scientia Horticulturae, Vol.122, pp. 209-215.

Burley AL, Phillips S, Ooi MKJ . Can age be predicted from diameter

for the obligate seeder Allocasuarina littoralis (Casuarinaceae) by

using dendrochronological techniques? Australian Journal of Botany

2007;55:433-438.

40

Busconi M, Foroni C, Corradi M, Bongiorni C, Cattapan F, Fogher C

(2003) DNA extraction from olive oil and its use in the identification of

the production cultivar. Food Chem 83:127–134

Cantini, C., Cimato, A. and Sani, G. 1999. Morphological evaluation

of olive germplasm present in Tuscany region. Euphytica, 109: 173–181.

Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., Testolin, R.

2002. Microsatellite markers isolated in olive (Olea europaea L.) are

suitable for individual fingerprinting and reveal polymorphism within

ancient cultivars. Theoretical and Applied Genetics,104: 223-228.

Corpas, F. J., Ferna´ndez-Ocan˜a, A., Carreras, A., Valderrama, R.,

Luque, F., Esteban, F. J.,Rodrı´guez-Serrano, M., Chaki, M., Pedrajas, J.

R., Sandalio, L. M., del Rı´o, L. A., and Barroso, J. B. (2006). The

expression of different superoxide dismutase forms is cell-type

dependent in olive (Olea europaea L.) leaves. Plant Cell Physiol. 47,

984–994.

Cronquist,A., 1981. An integrated system of classification of

flowering plants.Columbia Univ. press.New York, USA.

De la Rosa R, Angiolillo A, Guerrero M, Pellegrini M, Rallo L, Besnard

G, Berville´ A, Martin A, Baldoni L (2003) A first linkage map of olive

(Olea europaea L.) cultivars using RAPD, AFLP, RFLP and SSR

markers. Theor Appl Genet 106:1273–1282

41

De la Rosa R, James CM, Tobutt KH (2004) Using microsatellites for

paternity testing in olive progenies. HortScience 39:351–354

De la Rosa R, James CM, Tobutt KR (2002) Isolation and

characterisation of polymorphic microsatellites in olive (Olea europaea

L.) and their transferability to other genera in the Oleaceae. Mol Ecol

2:265–267.

Díaz, A., Martín, A., Rallo, P., Barranco, D., De la Rosa, R. (2006) Self-

incompatibility of ‘Arbequina’ and ‘Picual’ olive assessed by SSR markers.

J. Amer. Soc. Hort. Sci. 131:250–255.

Durgac, C., Kiyga, Y., Ulas, M., 2010: Comparative molecular

analysisof old olive (Olea europaea L.) genotypes from Eastern

Mediterranean region of Turkey. Afr. J. Biotechnol. 9, 428-433.

Doveri S, Sabino Gil F, Diaz A, Reale S, Busconi M, da Camara

Machado A, Martin A, Fogher C, Donini P, Lee D (2008).

Standardization of a set of microsatellite markers for use in cultivar

identification studies in olive (Olea europaea L.). Sci. Hortic.

(Amsterdam) 116: 367-373.

Essadki M, Ouazzani N, Lumaret R, Moumni M (2006). ISSR variation

in olive-tree cultivars from Morocco and other western countries of the

Mediterranean Basin. Genet. Resour. Crop. Evol. 53(3): 475-482.

42

Ercisli S and Barut EA (2009). Molecular characterization of olive

cultivars using amplified fragment length polymorphism markers.

Genet. Mol. Res., 8(2): 414-419.

Fabbri A, Lambardi M, Ozden-Tokatli Y. (2009). Olive Breeding.

In:Breeding Plantation Tree Crops: Tropical Species, Springer

Science+Business Media, LLC. Cp.12, p.423-465.

Fabbri, A., Hormaza, J.I. and V.S. Polito. 1995. Random amplified

polymorphic DNA analysis of olive (Olea europaea L.) cultivars.

J. Am. Soc. Hortic. Sci., 120: 538-542

Fendri M, Trujillo I, Trigui A and Rodriguez-Garcia IM (2010). Simple

sequence repeat identification and endocarp characterization of olive

tree accessions in a Tusinian germplasm collection. HortScience 45:

1429-1436.

Food and Agriculture Organization of the United Nations

,Faostat.fao.org (2012-02-23). Retrieved on 2012-07-08

Food and Agriculture Organization of the United Nations ,Seed and

Plant Genetic Resources Service – AGPS,OLIVE GERMPLASM

cultivars and world-wide collections,Edition 2005.

http://apps3.fao.org/wiews/olive/intro.jsp.

43

Ganino, T., Beghe` , D., Valenti, S., Nisi, R., Fabbri, A., 2007. RAPD

and SSR markers for characterization and identification of ancient

cultivars of Olea europaea L. in the Emilia region, Northern Italy.

Genet. Resour. Crop Evol. 54, 1531–1540.

Gemas VJ, Almadanim MC, Tenreiro R, Martins A, Fevereiro P (2004)

Genetic diversity in the Olive tree (Olea europaea L. subsp. europaea)

cultivated in Portugal revealed by RAPD and ISSR markers. Genet

Resour Crop Evol 51:501–511

Gomes, S.; Martins-Lopes, P.; Lopes, L. & Guedes-Pinto, H. (2009).

Assessing genetic diversity in Olea europaea L. using ISSR and SSR

markers. Plant Molecular Biology Reports, Vol.123, pp. 82-89.

Grati-Kamoun, N., Mahmoud, F., Rebaï, A. and Gargouri, A. 2006.

Genetic diversity of Tunisian Olive Tree (Olea europaea L.) cultivars

assessed by AFLP markers. Genet. Resour. Crop Evol., 53: 265-275.

Green, P.S. (2002) A revision of Olea L. (Oleaceae). Kew Bulletin,

57(1): 91-140.

Hagidimitriou M, Katsiotis A, Menexes G, Pontikis C, Loukas M

(2005). Genetic diversity of major Greek olive cultivars using

molecular (AFLPs and RAPDs) markers and morphological traits. J.

Am. Soc. Hort. Sci. 130: 211-217.

44

Hatzopoulos, P.; Banilas, G.; Giannoulia, K.; Gazis, F.; Nikoloudakis,

N.; Milioni, D. & Haralampidis, K. (2002). Breeding molecular markers

and molecular biology of the olive tree. European Journal of Lipid

Science and Technology, Vol.104, pp. 574-586.

Hess J, Kadereit W, Vargas P (2000) The colonization history of Olea

europea L. in Macaronesia based on internal transcribed spacer 1

(ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD)

and intersimple sequence repeats (ISSR). Mol Ecol 9:857–868

Hirst, K K.. 2013. Olive history: domistication of Olea europea L.

http://archaeology.about.com/od/oterms/qt/Olive-History.htm

Kahl, G. (2004). The dictionary of gene technologies. Genomics,

transcriptomics, proteomics.3rd Edition. Volume 1 and 2 Wiley – VCH

Verlag, Gmb H &Co. KGaA, Weinheim.

Karp, A.; Seberg, O. & Buiatti, M. (1996). Molecular techniques in the

assessment of botanical diversity. Annals of Botany, Vol.78, pp. 143-149.

La Mantia M, Lain O, Caruso T, Testolin R (2005) SSR-based DNA

fingerprints reveal the genetic diversity of Sicilian olive (Olea europaea

L.) germplasm. J Hortic Sci Biotech 80:628–632.

M. Morgante, A. M. Olivieri, Plant J. 3 (1993) 175– 182.

45

Martins-Lopes P, Gomes S, Santos E, Guedes-Pinto H (2008). DNA

markers for Portuguese olive oil fingerprinting. J Agric Food Chem

56:11786–11791.

Mariotti R, Cultrera NG, Díez CM, Baldoni L and Rubini A.(2010).

Identification of new polymorphic regions and differentiation of

cultivated olives (Olea europaea L.) through plastome sequence

comparison. BMC Plant Biol. 2010 Sep 24;10:211. doi: 10.1186/1471-

2229-10-211.

Mohan, M.; Nair, S.; Bhagwat, A.; Krishna, T.G.; Yano, M.; Bhatia,

C.R. & Sasaki, T. (1997). Genome mapping, molecular markers and

markers-assisted selection in crop plants. Molecular Breeding, Vol.3, pp.

87-103.

Mookerjee, S., Guerin, J., Collins, G., Ford, C., Sedgley, M. (2005).

Paternity analysis using microsatellite markers to identify pollen

donors in an olive grove. Theor. Appl. Genet. 111:1174–1182.

Muñoz-Díez C. Spain; 2008. Prospección, diversidad genética y

conservación de ejemplares monumentales y poblaciones silvestres de

olivo (Olea europaea L.). PhD Thesis, University of Cordoba.

Muzzalupo, I., Stefanizzi, F., Salimonti, A., Falabella, R. and Perri, E.

2009. Microsatellite markers for identification of a group of Italian

olive accessions. Sci Agric (Piracicaba, Braz), 66: 685- 690.

46

Nei M. (1978) Estimation of average heterozygosity and genetic

distance from a small number of individuals. Genetics 89:583-590

Nei M. (1987) Molecular Evolutionary Genetics. Columbia University

Press, New York, NY, USA.

Owen CA, Bita EC, Banilas G, Hajjar SE, Sellianakis V, Aksoy U, et al..

2005. AFLP reveals structural details of genetic diversity within

cultivated olive germplasm from the Eastern Mediterranean. Theor.

Appl. Genet. 110: 1169-1176.

Ozkaya, M.T., Cakir, E., Gokbayrak, Z., Ercan, H. and Taskin, N. 2006.

Morphological and molecular characterization of Derik Halhali olive

(Olea europaea L.) accessions grown in Derik–Mardin province of

Turkey. Scientia Horticulturae, 108: 205–209.

Palestinian Central Bureau of Statistics (PCBS), The Statistical Report

about the Olive Presses Survey 2012.

Pelestinian Central Bureau of Statistics, (2004) Agricultural statisitical

data. Palestine.

Pontikis, C.A., M. Loukas, and G. Kousounis. 1980. The use of

biochemical markers to distinguish olive cultivars. J. Hort. Sci.

55(4):333-343.

47

Rafalski, J.A. & Tingey, S.V. (1993). Genetic diagnostics in plant

breeding: RAPD, microsatellites and machines. Trends in Genetics,

Vol.9, pp. 275-279.

Rallo L, Muñoz-Díez C. Olive growing in a time of change. In:

Verheye H, editor. Soils, plant growth and crop production. 2010. In:

Encyclopedia of life support systems (EOLSS), developed under the

auspices of the UNESCO. Oxford: Eolss Publishers. http://www.eolss.net.

(accessed 8 February 2011

Rallo, P.; Dorado, G. & Martin, A. (2002). Application of

Microsatellite Markers in olive Breeding. Acta Horticulturae, Vol.586,

pp. 69-71.

Reale, S., S. Doveri, A. Dı´az, A. Angiolillo, L. Lucentini, F. Pilla, A.

Martı´n, P. Donini, and D. Lee. 2006. SNP-based markers for

discriminating olive (Olea europaea L.) cultivars. Genome 49:1193–

1205.

Roubos, K., Moustakas, M., Aravanopoulos, F.A., 2010: Molecular

identifi cation of Greek olive (Olea europaea) cultivars based on

microsatellite loci. Genet. Mol. Res. 9, 1865-1876.

Rozas V. A dendroecological reconstruction of age structure and

past management in an old-growth pollarded parkland in northern

Spain. Forest Ecology and Management 2004;195:205-219.

48

Rozas V. Tree age estimates in Fagus sylvatica and Quercus robur:

testing previous and improved methods. Plant Ecology 2003;167:193-

212.

Rugini, E. & Lavee, S. (1992). Olive. In: F.A. Hammerschlag and R.E.

Litz (eds.).Biotechnology of perennial fruit crops. CAB Intl., Wallingford,

U.K. pp. 371-382.

Sabino Gil, F., Busconi, M., Da Camara Machado, A., Fogher, C., 2006.

Development and characterization of microsatellite loci from Olea

europaea. Mol. Ecol. Notes 6, 1275–1277.

Saitou N and Nei M (1987). The neighbor-joining method: a new

method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-

425.

Sarri, V., Baldoni, L., Porceddu, A. and Cultrera, N.G. 2006 .

Microsatellite markers are powerful tools for discriminating among

olive cultivars and assigning them to geographically defined

populations. Genome 49: 1606-1615.

Sarri, V., Baldoni, L., Porceddu, A., Cultrera, N.G.M., Contento, A.,

Frediani, M., Belaj, A., Trujillo, I., Cionini, P.G., 2006. Microsatellite

markers are powerful tools for discriminating among olive cultivars

and assigning them to geographically defined populations. Genome 49,

1606–1615.

49

Schlüter, P. M. & Harris, S. A., 2006. Analysis of multilocus

fingerprinting data sets containing missing data. Mol. Ecol. Notes: 6:

569-572.

Sensi, E., Vignani R, Scali, M. and Masi, E. 2003. DNA fingerprinting

and genetic relatedness among cultivated varieties of Olea europaea L.

estimated by AFLP analysis. Sci. Hort., 97: 379-388.

Sefc, K.M., Lopes, M.S., Mendonc¸ D., Rodrigues, D., Santos, M.,

Laimer, M. and Machado, A. 2000. Identification of microsatellite loci in

olive (Olea europaea) and their characterization in Italian and Iberian

olive trees. Molecular Ecology, 9: 1171–1173.

Soleimani, A., Zamani, Z., Talaei, A. R. and Naghavi, M. R. 2006.

Molecular Characterization of Unknown Potentially Salt Tolerant

Olive Genotypes Using RAPDMarkers. J. Sci. Islamic Rep. Iran, 17:

107-112.

Taamalli, W., Geuna, F., Bassi, D., Daoud, D. and Zarrouk, M. 2008.

SSR marker based DNA fingerprinting of Tunisian olive (Olea

europaea L.) varieties. Journal of agronomy, 7: 176-181.

Tanksley, S.D. & Orton, T.J. (1983). Isozymes in plant genetics and

breeding. Elsevier, Amsterdam.

50

Terzopoulos, P.J., Kolano, B., Bebeli, P.J. and Kaltsikes, P.J. 2005.

Identification of (Olea europaea L.) cultivars using inter simple

sequence repeat markers. Scientia Hortic., 105: 45-51.

Trujillo, I, L. Rallo And Arús, Pere (1995). Identifying Olive Cultivars

by Isozyme Analysis. J. AM ER. SOC. HO RT. SCI. 120(2):318–324.

Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; van de Lee, T.; Hornes,

M.; Friters, A.; Pot, J.; Paleman, J.; Kuiper, M. & Zabeau, M. (1995).

AFLP: a new technique for DNA fingerprinting. Nucleic Acids

Research, Vol.21, pp. 4407-4414.

Wiesman, Z., N. Avidan, S. Lavee, and B. Quebedeaux. 1998.

Molecular characterization of common olive cultivars in Israel and the

West Bank using randomly amplified polymorphic DNA (RAPD)

markers. J.Amer. Soc. Hort. Sci. 123:837–841.

Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, and S.V.

Tingey. 1990. DNA polymorphism amplified by arbitrary primers are

useful as genetic markers. Nucleic Acids Res. 18:6531–6535.

World bank, Brief Overview of the Olive and the Olive Oil Sector in

the Palestinian Territories.2012.http://go.worldbank.org/MBK9GU1TD0

Wu, K.S. & Tanksley, S.D. (1993). Abundance, polymorphism and

genetic mapping of microsatellites in rice. Molecular General Genetics,

Vol. 241, pp. 225-235.

52

Zitoun B, Bronzini de Caraffa V, Giannettini J, Breton C. 2008. Genetic

diversity in Tunisian olive accessions and their relatedness with other

Mediterranean olive genotypes. Sci. Hortic. 115: 416-419.

Zohary, D. (1994). The wild genetic resources of the cultivated olive.

Acta Horticulturae,Vol.356, pp. 62-65.

Zohary, D., and Spiegel-Roy, P. (1975). Beginning of fruit growing in

the world. Science 187, 319–327.

53

Appendix

Table (1): Concentration and quality of the used DNA:

# Sample

Concentration

ng/µl Purity

V. DNA Stock

(µl)

V. TE buffer

(µl)

1 FQ3 77.8 1.93 64.26735219 35.73264781

2 FQ2 78 2.21 64.1025641 35.8974359

3 FQ1 84 2.4 59.52380952 40.47619048

4 TF1 77.9 1.94 64.18485237 35.81514763

5 TF2 58.8 1.67 85.03401361 14.96598639

6 TF3 180.9 1.73 27.63957988 72.36042012

7 TF4 131.3 2.2 38.08073115 61.91926885

8 TF5 35 3.46 142.8571429 -42.85714286

9 RA1 73.4 1.83 68.11989101 31.88010899

10 RA2 45 2.23 111.1111111 -11.11111111

11 RA3 149.5 1.8 33.44481605 66.55518395

12 RA4 83.1 1.84 60.16847172 39.83152828

13 RA5 74 1.64 67.56756757 32.43243243

14 RA6 71.1 2.82 70.32348805 29.67651195

15 RA7 72.7 1.81 68.77579092 31.22420908

16 RA8 58.3 1.93 85.76329331 14.23670669

17 HE11 141.5 1.42 35.33568905 64.66431095

18 HE10 165.3 1.51 30.24803388 69.75196612

19 HE9 166.3 1.73 30.06614552 69.93385448

20 HE8 83.9 1.54 59.59475566 40.40524434

21 HE1 59.5 2.95 84.03361345 15.96638655

22 HE12 80.3 2.28 62.26650062 37.73349938

23 HE7 326.6 1.91 15.30924679 84.69075321

24 HE6 167.5 1.88 29.85074627 70.14925373

25 HE2 58.7 3.86 85.17887564 14.82112436

26 HE4 76.5 1.69 65.35947712 34.64052288

27 HE5 142.7 1.49 35.0385424 64.9614576

28 HE3 71.1 1.77 70.32348805 29.67651195

29 WD2 108 1.33 46.2962963 53.7037037

30 BD1 94.4 1.26 52.96610169 47.03389831

31 WA1 175.7 1.36 28.45759818 71.54240182

32 BD2 74.6 1.65 67.02412869 32.97587131

33 WA6 104.3 1.62 47.93863854 52.06136146

34 WA5 92 1.65 54.34782609 45.65217391

35 BD6 99.1 2.46 50.45408678 49.54591322

36 WA4 75 1.87 66.66666667 33.33333333

37 WA2 69.9 2.31 71.53075823 28.46924177

38 BD4 56.2 1.86 88.96797153 11.03202847

39 WA4 190 1.75 26.31578947 73.68421053

40 BD3 35 1.99 142.8571429 -42.85714286

41 BD5 75.8 2.15 65.96306069 34.03693931

42 KQ6 53.5 1.77 93.45794393 6.542056075

54

43 KQ5 61.2 1.52 81.69934641 18.30065359

44 KQ4 207.7 1.54 24.07318247 75.92681753

45 KQ3 196.9 1.69 25.39360081 74.60639919

46 KQ2 87.1 1.51 57.40528129 42.59471871

47 KQ1 227 1.59 22.02643172 77.97356828

48 YA6 134 1.17 37.31343284 62.68656716

49 YA5 45 1.12 111.1111111 -11.11111111

50 YA4 81.3 1.15 61.50061501 38.49938499

51 YA3 70.2 2.45 71.22507123 28.77492877

52 YA2 73.4 1.25 68.11989101 31.88010899

53 YA1 94.2 1.31 53.07855626 46.92144374

54 BL6 151.1 1.31 33.09066843 66.90933157

55 BL5 89.4 1.18 55.92841163 44.07158837

56 BL4 87.5 1.66 57.14285714 42.85714286

57 BL3 35 2.3 142.8571429 -42.85714286

58 BL2 63.9 1.23 78.24726135 21.75273865

59 BL1 52.9 1 94.51795841 5.482041588

60 BR1 66.5 1.89 75.18796992 24.81203008

61 BR2 51.7 1.71 96.71179884 3.288201161

62 TU6 45.9 1.7 108.9324619 -8.932461874

63 TU2 69.7 2.31 71.73601148 28.26398852

64 BR3 74 1.4 67.56756757 32.43243243

65 TU4 10 0 500 -400

66 BR6 67.7 1.5 73.85524372 26.14475628

67 TU3 10 0 500 -400

68 TU5 10 0.4 500 -400

69 AS6 68 0 73.52941176 26.47058824

70 BR5 69.6 2.3 71.83908046 28.16091954

71 SA3 86.3 1.91 57.93742758 42.06257242

72 AN5 40 3.95 125 -25

73 AN2 30 2.3 166.6666667 -66.66666667

74 AS4 40 2.49 125 -25

75 AS5 30 1.73 166.6666667 -66.66666667

76 SA4 89 1.7 56.17977528 43.82022472

77 BA3 40 1.29 125 -25

78 BA2 145.4 2.08 34.38789546 65.61210454

79 SA6 64.1 4.21 78.00312012 21.99687988

80 JE2 25 0.7 200 -100

81 JE4 30 0 166.6666667 -66.66666667

82 JE1 20 1.9 250 -150

83 JE5 65.8 1.5 75.98784195 24.01215805

84 JE6 51 1.45 98.03921569 1.960784314

85 AS2 64.4 1.64 77.63975155 22.36024845

86 BA5 35 1.79 142.8571429 -42.85714286

87 BA4 38 1.59 131.5789474 -31.57894737

88 AS1 60 1.32 83.33333333 16.66666667

89 SA1 68 1.34 73.52941176 26.47058824

90 TU1 20 1.49 250 -150

91 AN4 40 2.01 125 -25

92 AS3 20 1.99 250 -150

55

93 SA2 100.3 1.57 49.85044865 50.14955135

94 BA6 20 1.66 250 -150

95 AN6 40 1.59 125 -25

96 JE3 75.4 1.52 66.31299735 33.68700265

97 SA5 72.4 1.8 69.06077348 30.93922652

98 AN1 10 0 500 -400

99 BA1 81.7 2.54 61.1995104 38.8004896

100 BR4 40 1.99 125 -25

101 AN3 40 2.9 125 -25

56

Table (2): similarity matrix.

FQ3 FQ2 FQ1 TF1 TF2 TF3 TF4 TF5 RA1 RA2 RA3 RA4 RA5 RA6 RA7 RA8 HE11 HE10 HE9 HE8 HE1 HE12 HE7 HE6 HE2 HE4 HE5 HE3 WD2 BD1 WA1 BD2 WA6 WA5 BD6 WA4 WA2 BD4 WA3 BD3 BD5 KQ6 KQ5 KQ4 KQ3 KQ2 KQ1 YA6 YA5 YA4 YA3 YA2 YA1 BL6 BL5 BL4 BL3 BL2 BL1 BR1 BR2 TU6 TU2 BR3 TU4 BR6 TU3 TU5 AS6 BR5 SA3 AN5 AN2 AS4 AS5 SA4 BA3 BA2 SA6 JE2 JE4 JE1 JE5 JE6 AS2 BA5 BA4 AS1 SA1 TU1 AN4 AS3 SA2 BA6

FQ3 0.000

FQ2 0.000 0.000

FQ1 0.000 0.000 0.000

TF1 0.000 0.000 0.000 0.000

TF2 0.200 0.200 0.200 0.200 0.000

TF3 0.300 0.300 0.300 0.300 0.125 0.000

TF4 0.000 0.000 0.000 0.000 0.200 0.300 0.000

TF5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000

RA1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000

RA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000

RA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000

RA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000

RA5 0.571 0.571 0.571 0.571 0.615 0.692 0.571 0.571 0.571 0.571 0.571 0.571 0.000

RA6 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000

RA7 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000 0.000

RA8 0.824 0.824 0.824 0.824 0.800 0.867 0.824 0.824 0.824 0.824 0.824 0.824 0.571 0.538 0.538 0.000

HE11 0.250 0.250 0.250 0.250 0.417 0.500 0.250 0.250 0.250 0.250 0.250 0.250 0.500 0.571 0.571 0.765 0.000

HE10 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000

HE9 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000

HE8 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000

HE1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000

HE12 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000

HE7 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000

HE6 0.333 0.333 0.333 0.333 0.200 0.300 0.333 0.333 0.333 0.333 0.333 0.333 0.571 0.643 0.643 0.750 0.385 0.333 0.333 0.333 0.333 0.333 0.333 0.000

HE2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000

HE4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000

HE5 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000

HE3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000

WD2 0.462 0.462 0.462 0.462 0.500 0.583 0.462 0.462 0.462 0.462 0.462 0.462 0.333 0.417 0.417 0.667 0.500 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.538 0.538 0.462 0.000

BD1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.000

WA1 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000

BD2 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.938 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.222 0.636 0.000

WA6 0.667 0.667 0.667 0.667 0.727 0.818 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.750 0.750 0.857 0.692 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.636 0.636 0.667 0.400 0.636 0.250 0.556 0.000

WA5 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000

BD6 0.455 0.455 0.455 0.455 0.636 0.600 0.455 0.455 0.455 0.455 0.455 0.455 0.455 0.545 0.545 0.867 0.364 0.455 0.455 0.455 0.455 0.455 0.455 0.583 0.455 0.545 0.545 0.455 0.455 0.545 0.500 0.727 0.700 0.500 0.000

WA4 0.583 0.583 0.583 0.583 0.636 0.727 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.667 0.667 0.786 0.615 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.545 0.545 0.583 0.300 0.545 0.125 0.600 0.143 0.125 0.600 0.000

WA2 0.500 0.500 0.500 0.500 0.667 0.750 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.800 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.500 0.455 0.455 0.500 0.364 0.455 0.222 0.500 0.250 0.222 0.500 0.125 0.000

BD4 0.364 0.364 0.364 0.364 0.400 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.692 0.692 0.875 0.273 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.500 0.455 0.545 0.636 0.727 0.545 0.333 0.636 0.667 0.000

WA3 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000 0.500 0.125 0.222 0.545 0.000

BD3 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000

BD5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000

KQ6 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.938 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.400 0.750 0.250 0.700 0.750 0.600 0.727 0.636 0.500 0.750 0.222 0.300 0.000

KQ5 0.700 0.700 0.700 0.700 0.625 0.750 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.667 0.667 0.700 0.727 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.800 0.800 0.700 0.700 0.667 0.625 0.889 0.875 0.625 0.750 0.750 0.778 0.778 0.625 0.667 0.700 0.889 0.000

KQ4 0.400 0.400 0.400 0.400 0.600 0.700 0.400 0.400 0.400 0.400 0.400 0.400 0.545 0.500 0.500 0.857 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.400 0.500 0.500 0.400 0.545 0.500 0.600 0.556 0.667 0.600 0.375 0.700 0.600 0.600 0.600 0.333 0.400 0.375 0.714 0.000

KQ3 0.636 0.636 0.636 0.636 0.818 0.909 0.636 0.636 0.636 0.636 0.636 0.636 0.636 0.600 0.600 0.846 0.667 0.636 0.636 0.636 0.636 0.636 0.636 0.846 0.636 0.600 0.600 0.636 0.636 0.600 0.556 0.500 0.429 0.556 0.667 0.500 0.375 0.818 0.556 0.600 0.636 0.500 0.857 0.429 0.000

KQ2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.636 0.545 0.400 0.667 0.111 0.200 0.125 0.778 0.444 0.556 0.000

KQ1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000 0.100 0.222 0.667 0.333 0.600 0.111 0.000

YA6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000

YA5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000

YA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000

YA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000

YA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000

YA1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.545 0.455 0.455 0.583 0.200 0.100 0.222 0.800 0.500 0.600 0.111 0.200 0.100 0.100 0.100 0.100 0.100 0.000

BL6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000

BL5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000

BL4 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000

BL3 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000

BL2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000 0.000

BL1 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000

BR1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000

BR2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000

TU6 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000 0.200 0.200 0.000

TU2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000

BR3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000 0.000

TU4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.667 0.583 0.455 0.583 0.200 0.100 0.222 0.800 0.333 0.600 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.111 0.111 0.111 0.111 0.100 0.100 0.111 0.100 0.100 0.000

BR6 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000

TU3 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000

TU5 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.714 0.692 0.692 0.800 0.417 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.455 0.667 0.500 0.727 0.667 0.750 0.750 0.769 0.545 0.667 0.455 0.364 0.500 0.778 0.600 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.400 0.400 0.400 0.400 0.364 0.364 0.400 0.364 0.364 0.300 0.400 0.400 0.000

AS6 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000

BR5 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.786 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.222 0.500 0.444 0.700 0.500 0.727 0.600 0.636 0.500 0.500 0.400 0.300 0.600 0.571 0.700 0.800 0.500 0.400 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.500 0.300 0.300 0.500 0.300 0.300 0.400 0.333 0.333 0.500 0.222 0.000

SA3 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000

AN5 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000

AN2 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000

AS4 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.867 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.444 0.700 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.250 0.750 0.375 0.667 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.333 0.333 0.333 0.125 0.300 0.300 0.125 0.300 0.300 0.222 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.000

AS5 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000 0.400 0.111 0.333 0.111 0.111 0.111 0.125 0.000

SA4 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000 0.222 0.111 0.000

BA3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000

BA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000

SA6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000

JE2 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000

JE4 0.500 0.500 0.500 0.500 0.400 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.692 0.692 0.714 0.273 0.500 0.500 0.500 0.500 0.500 0.500 0.364 0.500 0.583 0.583 0.500 0.615 0.455 0.545 0.636 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.455 0.500 0.636 0.625 0.727 0.818 0.545 0.455 0.500 0.500 0.500 0.500 0.500 0.583 0.500 0.500 0.667 0.667 0.667 0.545 0.500 0.500 0.545 0.500 0.500 0.583 0.400 0.400 0.400 0.455 0.500 0.455 0.455 0.455 0.500 0.400 0.455 0.400 0.400 0.400 0.250 0.000

JE1 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.769 0.750 0.750 0.933 0.583 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.333 0.333 0.400 0.667 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.400 0.375 0.875 0.667 0.778 0.444 0.500 0.400 0.400 0.400 0.400 0.400 0.333 0.400 0.400 0.250 0.250 0.250 0.444 0.400 0.400 0.444 0.400 0.400 0.333 0.444 0.444 0.250 0.333 0.556 0.333 0.333 0.333 0.375 0.444 0.333 0.250 0.250 0.250 0.500 0.600 0.000

JE5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.846 0.833 0.833 0.929 0.667 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.444 0.700 0.286 0.625 0.700 0.909 0.667 0.700 0.700 0.700 0.600 0.500 0.500 0.857 0.778 0.750 0.556 0.600 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.556 0.500 0.500 0.556 0.500 0.500 0.444 0.556 0.556 0.375 0.444 0.500 0.444 0.444 0.444 0.500 0.556 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.000

JE6 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.583 0.583 0.714 0.538 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.300 0.545 0.500 0.727 0.545 0.750 0.636 0.667 0.545 0.545 0.455 0.364 0.636 0.625 0.727 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.545 0.545 0.545 0.545 0.364 0.364 0.545 0.364 0.364 0.455 0.400 0.400 0.400 0.300 0.333 0.300 0.300 0.300 0.500 0.400 0.300 0.222 0.222 0.222 0.250 0.400 0.444 0.375 0.000

AS2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000

BA5 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000

BA4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000

AS1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000

SA1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000

TU1 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000

AN4 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000

AS3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000

SA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000

BA6 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000 0.250 0.500 0.429 0.250 0.250 0.250 0.143 0.250 0.250 0.143 0.250 0.250 0.250 0.000

AN6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000 0.250

JE3 0.545 0.545 0.545 0.545 0.600 0.700 0.545 0.545 0.545 0.545 0.545 0.545 0.857 0.846 0.846 0.857 0.583 0.545 0.545 0.545 0.545 0.545 0.545 0.667 0.545 0.500 0.500 0.545 0.769 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.545 0.375 0.875 0.667 0.625 0.444 0.500 0.545 0.545 0.545 0.545 0.545 0.500 0.545 0.545 0.444 0.444 0.444 0.444 0.545 0.545 0.444 0.545 0.545 0.500 0.444 0.444 0.600 0.500 0.556 0.500 0.500 0.500 0.375 0.444 0.500 0.600 0.600 0.600 0.500 0.600 0.500 0.429 0.600 0.600 0.600 0.556 0.600 0.600 0.556 0.600 0.600 0.600 0.500

SA5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429

AN1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429

BA1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429

BR4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000 0.125 0.125 0.125 0.143

AN3 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429

57

FQ3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

FQ2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

FQ1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

TF1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

TF2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

TF3 1 1 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0

TF4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

TF5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

RA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

RA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

RA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

RA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

RA5 1 1 0 0 1 1 0 0 1 1 0 0 0 0 1 0 0 0 1

RA6 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1

RA7 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1

RA8 0 0 0 0 1 1 0 0 0 1 1 0 0 1 1 0 1 0 0

HE11 1 1 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 1 1

HE10 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE9 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE8 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE12 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE7 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE6 1 1 0 0 0 0 1 1 1 1 0 0 1 0 0 0 0 0 0

HE2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

HE3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

WD2 1 1 0 0 1 1 0 0 1 1 0 0 1 0 0 0 0 1 0

BD1 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

WA1 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0

BD2 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

WA6 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0

WA5 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0

BD6 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 1

WA4 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0

WA2 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 1

BD4 1 1 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 1 0

WA3 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0

BD3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

BD5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

KQ6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

KQ5 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0

KQ4 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1

KQ3 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 1

KQ2 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

KQ1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

YA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

YA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

YA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

YA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

YA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

YA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BL1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

BR1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BR2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

TU6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1

TU2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BR3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

TU4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1

BR6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0

TU3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0

TU5 1 1 0 0 0 0 1 1 0 1 0 0 1 1 0 0 0 0 0

AS6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

BR5 0 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

SA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

AN5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

AN2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

AS4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0

AS5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0

SA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0

BA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

BA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

SA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

JE2 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

JE4 1 0 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 0 0

JE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

JE5 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

JE6 1 0 0 0 0 0 1 1 0 1 0 0 1 0 1 0 0 0 0

AS2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

BA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

BA4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

AS1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

SA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

TU1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

AN4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

AS3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

SA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

BA6 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

AN6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0

JE3 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1 1 0

SA5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

AN1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

BA1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

BR4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

AN3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

Appendix(3):FAMD Format

58

أ

( Olea europea L

2113

ب

( Olea europea L

Microsatellite (SSR)29

03

6

936

04044

PCA

أ