Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

Contents lists available at ScienceDirect

Best Practice & Research ClinicalGastroenterology

6

Familial adenomatous polyposis

Finlay Macrae, MBBS (Hons1), MD, FRACP, FRCP (UK), AGAF, Professor a,*,D. du Sart b, S. Nasioulas b

a Department of Colorectal Medicine and Genetics and Familial Cancer Clinic, PO Box 2010, The Royal Melbourne Hospital,Melbourne, Victoria 3050, Australiab Victorian Clinical Genetic Services, Murdoch Childrens Research Institute, Parkville, Melbourne, Australia

Keywords:familial adenomatous polyposisAPC geneMYH genemutational analysisgenetic counselling

* Corresponding author. Tel.: þ61 3 9347 0788;E-mail address: finlay.macrae@mh.org.au (F. M

1521-6918/$ – see front matter � 2009 Elsevier Ltdoi:10.1016/j.bpg.2009.02.010

A multimodal approach of complementary techniques targetingprimarily truncating, deletion and rearrangement mutationsprovides a robust screening protocol that identifies the vastmajority of pathogenic germline APC gene mutations in FAPpatients. Patients in whom no mutation is identified through thismutation protocol, may be sub-cohorts representing a differentFAP pathogenesis including MYH associated polyposis and somaticcell mosaicism for APC gene mutations.

� 2009 Elsevier Ltd. All rights reserved.

Introduction

Familial adenomatous polyposis (FAP) is an autosomal dominant disorder characterised byadenomatous polyposis in the colon and rectum, and frequently involves extracolonic manifestations.In classical FAP, adenomas occur in their hundreds to thousands in the adolescence or early adulthood,with cancers developing nearly invariably by the fifth decade and often a lot earlier. An attenuated formof the disease also exists, where adenomas are less numerous and presentation with adenomas andcancer is later. Because of the very high cancer risk, at present colectomy is advised in both the classicaland attenuated forms of the disease once adenomas develop beyond mid teenage years. Duodenaladenomas are common, though cancer at this site is much less common. Other characteristics arepigmented ocular lesions, osteomas especially of the jaw, epidermoid cysts, adrenal adenomas andcarcinomas, thyroid tumours, desmoid tumours, and dentition abnormalities. The populationfrequency is w1 in 8000 with w100% penetrance.

FAP is thus a characteristic clinical syndrome for which the revolution in molecular diagnosticsprovided one of its earliest benefits. It was in the 1980s that the locus for what was then known as

Fax: þ61 3 9348 2004.acrae).

d. All rights reserved.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207198

familial polyposis coli was identified on the 5th chromosome, through cytogenetic and molecularstudies in a family in which mental retardation and polyposis tracked – implying a large genetic defect[1–3]. Subsequent molecular cloning traced the defect to a genetic locus named as the adenomatouspolyposis coli (APC) gene [4], and uncovered its biology – a tumour suppressor gene, which, whenmutated and therefore functionally deficient, was unable to sequester (ubiquitise) the proto-oncogenebeta-catenin in its cytoplasmic traverse to the nucleus [5]. APC gene mutational analyses in series ofFAP patients followed quickly [6].

The genetic basis of FAP indeed lies in the presence of a germline mutation of the APC gene, locatedwithin chromosome region 5q21–22. The APC gene consists of 15 exons with a combined open readingframe of 8532 base pairs and encodes a protein of 2843 amino acids. Approximately 95% of thegermline mutations in the APC gene lead to the synthesis of a truncated protein and they are spreadthroughout the gene (Fig. 1).

Major pathogenic mechanism of FAP

The APC gene protein has tumour suppressor functions and is part of the Wnt pathway. APC formsa complex with the cytoplasmic proteins beta-catenin, axin and glycogen synthase kinase-3b and thiscomplex induces beta-catenin degradation. Truncating mutations in the APC gene cause an aberrantaccumulation of beta-catenin because the resultant protein lacks the c-terminal, beta-catenin bindingdomain. The APC protein is the mediator of beta-catenin degradation, and thereby down-regulatestranscription exerted by the nuclear beta-catenin -Tcf complex. Unbridled without its suppression bythe APC complex, the beta-catenin -Tcf complex leads to transcriptional activation of several genes andoncogenes like c-myc, a transcription factor for several genes controlling cell growth and division. Thiscascade of events ultimately leads morphologically to adenomatous polyp formation, which, by defi-nition, have dysplasia, and are the precursor of the many colorectal cancers defined by the chromo-somal instability pathway. This pathway generally results in microsatellite stable cancers.

The key point of understanding here is that the same gene (APC) when mutated in the germline, isresponsible for the autosomal dominant condition familial adenomatous polyposis, and when mutatedsomatically (e.g. in the colon), is also a key molecular event in sporadic colorectal cancer. In the case ofthe latter, each allele of the gene has been mutated, lost (‘loss of heterozygosity’, implying the deletionof all or a large component of this chromosome 5 in the tumour) or silenced (through methylation of its

Exon 151493 111

Microtubulebinding

β-catenin, GSK3 β,axin binding sites

β-cateninbinding site

Armadillo repeats

Dimerizationdomain

AAPC

codons78-157

AAPC

codons312-412

AAPC

codons1595-2843

CHRPE

codons 463-1387Desmoid tumours

codons 1444-1578

Profuse polyposis

codons 1250-1464

Spectrumof

mutationsin APC gene

Functionaldomains ofAPC gene

APC genestructure

Genotype-phenotypecorrelations

for APC geneand FAP

Fig. 1. The APC gene and FAP.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207 199

promoter). With only two copies, each of us has but two chances to maintain the integrity of APCsuppression process. Although one copy is enough for function of the APC gene, interference to thesecond allele has serious consequences, enabling beta-catenin to function unchecked, and drive mycassociated proliferation and therefore (with a number of other key mutational events) neoplasticdevelopment.

Families with FAP almost always harbour a germline mutation in the APC gene. Given its pivotalplace in the Wnt pathway (see Fig. 2), it is no surprise that when the APC gene is inactivated bymutation and/or deletion or silencing, adenomas and then cancers develop. In a sense, APC mutationcarriers are ‘primed’ for cancer development through the Wnt pathway, by harbouring a mutation inone of the APC alleles from birth.

Minor pathogenic mechanisms of FAP

A second mechanism involving the base-excision repair gene, MYH, has been shown to affect theAPC gene, resulting in a milder variant of FAP. Patients who carry two germline mutations in the MYHgene have an increased rate of somatic APC gene mutations, which predisposes to polyp formation andcancer progression as a consequence of non-functional APC protein. For more detail on MYH associatedpolyposis, please see accompanying chapter on MYH.

Somatic cell mosaicism for APC gene mutations is a third mechanism that could lead to FAP and isthought to occur in w20% of sporadic FAP cases [7]. Somatic cell mosaicism arises when a newmutation occurs in the APC gene post fertilisation and is present in only a subset of cell types or tissues.The timing of when the mutation occurs in embryogenesis, dictates the extent to which the mutation ispresent in different tissue types. In this situation, the cell type screened for mutation identification willhave a critical impact on the result. For example, screening of blood may not reveal the presence of theAPC gene mutation but screening of gut tissue may do so. Approximately 10–25% of FAP patientspresent as sporadic cases. Aretz S et al (2007) reported that 11% of the sporadic cases in their cohortindicated the presence of somatic cell mosaicism [8]; Hes FJ et al reported 21% in their sporadic FAPpatients showed mosaicism [9].

APC

protein

APC, β-catenin,

Axin and GSK3

complex

β-catenin

degradation

APC

protein

Non-functionalprotein

Increased cell division

and inhibition of apoptosis

Polyp formation *

Cancer

progression

cytoplasm nucleus

Binds to other proteins

inducesLeads to

β-catenin

β-catenin

TCF-4

complex

Activatestranscriptionof severalgenes and oncogenes

C-myc

increasedconcentration of

free β-cateninin nucleus

Binds to otherproteins

germline

mutations

in MYH gene

Increasessomatic

mutationsin APC

Wnt-pathway

* including other tumours like: osteomas, periampullary carcinomas, hypertrophy ofretinal pigment epithelium (CHRPE), and desmoids.

Fig. 2. APC protein functional pathway.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207200

Benefits of APC mutational analysis

FAP generally has such a characteristic phenotype that one could question the need for a genotypicdiagnosis.

So why undertake genotyping? The advantages relate to the understanding of genotype–phenotypecorrelations, and the opportunities for predictive DNA testing of young family members at genetic risk,who can then be offered surveillance informed by their mutation status, or may be no surveillance at all –if they are identified as not carrying the family specific mutation. This essentially halves the number offamily members that otherwise would need continuing annual or even bi-annual screening, and thusis quickly a cost effective strategy. Furthermore, the children of non-carriers do not need to beconcerned about FAP risk, as the mutation cannot ‘skip’ generations. In addition, in some families witha very severe disease spectrum and early age onset of polyposis and tumours in childhood, parentshave chosen prenatal testing for FAP or pre-implantation genetic diagnosis (PGD) for selection ofunaffected embryos as part of their family planning options when the family pathogenic mutation isknown. Consequently, genotyping makes an enormous impact on clinical management of thesefamilies.

Phenotype genotype correlations

There are certain sites on the APC gene which pre-dispose to specific phenotypic features. Thiscorrelation between the site of the APC gene mutation and the FAP phenotype is evident with a mildattenuated adenomatous polyposis (AAPC) usually observed when the mutation is at the 50 and 30 ends(between codons 78 and 157, 312 and 412, and 1595 and 2843) whereas severe classic FAP is seen whenthe mutation is in the middle of the APC gene, especially the well known 1309 codon (see Fig. 1).

With the attenuated phenotype, adenomas are fewer and cancer often develops later. Though notgenerally accepted, a case can be made to simply observe (e.g. with annual colonoscopy removingpolyps by snare polypectomy) these patients over several years before surgery. However, theseobservations on phenotype–genotype correlation are not invariable, and kindred are described wherethere are classic and attenuated phenotypes all with the same mutation. Kindred with mutationsbetween codons 1250 and 1464 are associated with a dense rectal adenomatous phenotype, lendingextra support to definitive excisional surgery (e.g. a proctocolectomy with ileal–anal anastomosis) toablate any risk of large bowel cancer. So, these mid gene mutations could direct a surgical approachbased on its prediction, rather than contemporary appearance, of dense rectal polyposis.

Kindred with a mutation between codons 1444 and 1578 are associated with desmoid disease,accounting for some families where desmoid disease appears unusually frequently. Care should betaken in surgical decision making even for colectomy in these families, as the development of desmoiddisease may be more hazardous than the risk of cancer from the polyposis.

Clinical approach to gene testing in FAP

Like many familial cancer syndromes, the approach to gene testing in a family involves:

1. Consultation with the proband in the family, to explain the benefits of gene testing for the patientand his/her family.

2. Pedigree assessment to decide whether the likely gene involved will be the APC or MYH gene.3. Engaging a clearly affected family member in offering a DNA sample for mutational analysis of the

APC or MYH gene4. Once the family specific mutation has been identified, then offering other at risk family members

the opportunity for predictive DNA testing for the family specific mutation. This usually meanscascade testing of first degree relatives of carriers. Sometimes second degree relatives can beoffered when a family member declines the offer of screening, or has died.

The decision to test is based on the phenotype, and in particular, the number of adenomatous polypsthe index case has had diagnosed. This means that a careful count of polyps is essential, either by the

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207 201

endoscopist over one or several procedures, or by the pathologist from a colectomy specimen. Endo-scopic assessment is best done with dye spray enhancement of the colon using dilute indigo carmine ormethylene blue (5 ml in 20 ml of normal saline), allowing 2 min between application and mucosalobservation (‘dye beats the eye’). In our clinical practice, we accept a total count of 10 adenomas asenough to offer mutational analysis. If the pedigree indicates dominant (vertical) transmission, wewould start with the APC gene, whereas if the pedigree indicates a recessive (horizontal) pedigree withno parents of children affected, then the MYH gene will be tested first. The vast majority of MYHfamilies carry the G382D or Y165C mutations, so many services will test only for these mutations,reserving full sequencing for those found to have one of these mutations only, or for those who havehigher numbers of adenomas and without the common MYH or APC mutations.

Predictive DNA testing carries counselling responsibilities, as not all family members want to knowthe result of a gene test. This is especially the case where health care systems are not community rated,and health insurance is loaded where risk has been identified, for example, through gene testing. In theUnited States, private health insurance until recently could be difficult to access where genetic testinghas uncovered a serious risk pre-disposition. In most other countries, health care is equally availableregardless of genetic risk determination. On the other hand, life and income protection, and some otherforms of insurance are affected in most countries by genetic testing results. Counselling needs to takethese consequences of genetic testing into account. Family members contemplating predictive DNAtesting are well advised to attend to matters of insurance, according to the circumstances in theircountry, and policies of their own insurer.

Gene testing strategies

Methods to identify mutations in the APC gene are under continuing evolution. A range ofdifferent mutation screening methods can be used in genetic testing of the APC gene. Full genesequencing, considered as the gold standard, allows detection of point mutations and small intragenicdeletions/duplications which lead to protein truncating changes and missense changes in the geneprotein product. However, as this testing strategy is costly and sequence analyses are labour intensive,due to the large size of the gene (open reading frame of APC is 8529 bp), many laboratories use initialscreening assays to reduce the total amount of sequencing required. Screening assays like highresolution melt analysis (HRM), denaturing high pressure liquid chromatography (dHPLC), singlestrand conformation polymorphism analysis (SSCP) Denaturing gradient gel electrophoresis (DGGE)and protein truncation test (PTT) are techniques which allow scanning of the gene exons for changeswhich is then followed by targeted sequencing of regions indicated. The PTT assay will detect onlychanges which lead to truncation of the gene protein. All other methods including full genesequencing, will detect all sequence changes including non-pathogenic changes like polymorphicvariants and missense mutations with uncertain clinical significance. These changes with unknownclinical significance result in a huge dilemma concerning the clinical management of family membersof affected patients. There is no clear indication whether surveillance and further screening needs tocontinue. Mutation screening methods which target only pathogenic mutations translate into thehighest clinical impact and the most cost effective genetic testing. It is known that most of themutations in the APC gene leading to FAP are truncating mutations. However, recent reports haveindicated that intragenic deletions and genomic rearrangements also account for a further percent ofpathogenic mutations.

Previous reports indicate identifiable pathogenic APC mutations account for between 50 and 82% ofFAP [6,10–17]. Factors that influence the rate of mutation detection are primarily the limitations of thetechniques used in the analyses and perhaps an inexact diagnosis of FAP. All the methods listed abovewould fail to identify pathogenic changes such as intragenic deletions as well as rearrangements,because they all require an initial amplification of both normal and mutated sequences to enablea successful mutation detection outcome. The preliminary amplification of the APC DNA needed inorder to have enough to perform the testing, can be confounded by mutations which affect, evendelete, the primer sites for the polymerase chain reactions (PCR), in which case the allele carrying themutation will not amplify. Only the good allele will amplify, so the mutation is entirely missed as

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207202

a consequence. This is a problem common to all analytic methodologies that rely on amplification ofthe patients DNA before testing.

Given that intragenic deletions and gene rearrangements are also gene changes that impact on thegene protein structure and function, and may also impact on the level of protein expression, these typesof changes must also be included in any mutation screening protocol. Thus, PCR-independent tech-niques, like southern blotting or chromosome fluorescence in situ hybridisation (FISH) analysis orquantitative PCR assays like multiplex ligation-dependent probe amplification (MLPA) [18], or real timePCR should be included in the screening protocol.

There have been a number of reports associating deletion and rearrangement mutations in the APCgene with FAP [19–23]. There are also reports on the presence of blocks of Alu repeat sequences withinthe intronic regions of the APC gene that may predispose to deletions and rearrangement changes[24,25]. Therefore, techniques used in the second stage screening should be aimed at overcoming thetrap of conventional hi-resolution mutation scanning assays which do not detect large deletion orrearrangement mutations. The number of reported genomic deletions and rearrangements hasincreased as laboratories use techniques directed towards the detection of these types of genealterations.

Methods used for mutation screening

The protein truncation test (PTT) assay starts with the coding sequence of the APC gene and thentranscribes it into mRNA, which is then translated into the APC gene protein. In this assay, the size of thegenerated protein is compared to the size of the normal protein, to detect the presence of mutationsleading to truncation of the protein. For exons 1–14, high quality RNA is required for testing and forexon 15, DNA is used. The RNA-PTT analysis of exons 1–14 identifies more mutations than other non-RNA-based detection methods. The study of Powel et al (1993) [14] identified 47% of their mutationswithin exons 1–14 by using RNA PTT, which is consistent with our experience (47% – unpublished).Non-RNA based methods identify between 4 and 26% mutations in exons 1–14 [10–12,15,16,20,26–29].High quality RNA is best achieved through the use of transformed lymphoblast cell lines treated witha protein-synthesis-inhibitor to stop mutant RNA decay. The addition of a protein synthesis inhibitor(e.g. cyclohexamide) to reduce mutant RNA decay before RNA extraction, preserves the mutant mRNAand enhances the intensity of truncated fragments in the PTT. This enables clearer identification oftruncated proteins above the constant background bands, decreasing the false negative rate andincreasing the detection rate of the PTT [30]. However, it is thought that nonsense-mediated mRNAdecay is not a major problem in detecting APC gene mutations [31], and therefore RNA-based PTTanalysis without the use of cyclohexamide still gives good detection rates.

The high resolution melt assay is a two step technique that first incorporates saturating DNA-binding fluorescent dye into the PCR product during amplification, then, during a melt reaction, detectsthe DNA becoming single stranded as the fluorescence is released. This melt process generatesa specific trace pattern that shows a difference when there is a sequence difference in the DNA product.The assay will then indicate which region or gene exon may have a sequence change, and thereforerequires assessment with sequencing. Other mutation scanning techniques operate on similar prin-ciples. SSCP exploits the tertiary structure of DNA single strands in specific physical conditions, e.g.temperature and ionic environment, to detect sequence differences. DGGE separates fragments withdifferent sequences by detecting differences in the partially melted fragments in denaturing condi-tions. All these above assays will indicate specific regions for sequencing, where changes, variants ormutations, are identified.

FISH is a good tool for detecting deletions and rearrangements in genes. The use of high resolutionFISH can detect smaller changes within a few kilobases. The resolution of the FISH analysis can beincreased by using smaller probes, or by using target DNA like stretched chromosomes or chromatinfibres. This is useful in detecting rearrangements like inversions of a few kb in size. In addition, a singleFISH experiment can identify translocations between different chromosomes that may not be observedcytogenetically or identified with other molecular methods. Chromosome translocations can affect thelevel of gene expression, or prevent gene expression altogether due to position effect variegation orchanges in translation direction, even though the whole genome is present and balanced.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207 203

Quantitative real time PCR and MLPA can detect mutations when amplification has occurred fromonly one allele. Consequently, any type of mutation that prevents PCR amplification of the mutant allelewill be detected. Quantitative real time PCR is a technique that determines the amount of productamplified at each PCR cycle by quantitation of fluorescence generated at end of each cycle. The amountof product amplified is directly proportional to the amount of starting template alleles. MLPA is a twostage assay that first hybridises and ligates probes to the specific gene regions, and these ligated probesare then amplified by PCR in a quantitative manner [18]. Both the above assays require comparativeanalysis with control samples and normalisation of data to generate values that indicate whether generegions are deleted, or duplicated or normal. Though Southern blot analysis is labour intensive, notconducive to high-throughput screening and requires a large amount of DNA, it allows detection ofgene rearrangements not detected by standard FISH or quantitative PCR analysis.

Suggested testing protocol

Stage I: Screening for mutations and/or high throughput sequencingStage II: Screening for deletion mutationsStage III: Screening for DNA/chromosomal rearrangements

Somatic mosaicismOther genes – MYH?

The Human Variome Project

Sequencing will identify changes in the gene which may be clearly pathogenic. Mutations thatintroduce a stop codon into the transcription process through a frame shift in transcription, can becalled pathogenic. Other changes are clearly normal variants, or polymorphisms, with no conse-quences for disruptive alteration to the APC protein. There is a third class of variant, unclassified,where the consequences in vivo are uncertain. These changes represent a serious challenge ininterpretation for clinical predictive purposes, and are the reason for attention to the Human VariomeProject (HVP).

The HVP (http://www.humanvariomeproject.org) is an initiative of the Human Genetic VariationSociety (HGVS) [32]. The HGVS aims to catalogue all variation across all genes in the human genomeand annotate those variations with all known information that relates to the consequences of thevariation. This will include phenotypes associated with the changes. For the APC gene, this task isbeing undertaken by the International Society for Gastrointestinal Hereditary Tumours (InSiGHT)through its Locus Specific Databases (LSDBs) housed on its website http://www.insight-group.org. TheHVP is a critically important process required to facilitate the tasks of interpretation of unclassifiedvariants as they are progressively uncovered through the increasing practices of gene sequencing indiagnostic and research laboratories world-wide. Unless we have a common ‘clearing house’ of suchinformation publicly available, there will be intolerable delays in realising the full benefit of therevolution in diagnostic molecular genetics in which we are in the midst. InSiGHT and its membershipare acutely aware of the need for the Human Variome Project and actively supporting it through itsown LSDBs.

Appendix

An effective strategy for APC gene mutational analysis

Sample preparationDNA is isolated from 10 ml of EDTA blood with the nucleon extraction kit (Amersham). RNA is

extracted from transformed lymphoblast cell lines after a pre-incubation in cyclohexamide (1 mg/ml)at 37 �C for 2 h using the RNeasy minikit (Qiagen). cDNA synthesis is performed as per kit method(Roche).

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207204

PTT assayThe PTT assay is performed using a T7 reticulocyte lysate kit (Promega) which involves incorpo-

ration of 35S methionine to detect the protein products. The assay has been modified from previouslypublished methods [14,33–37] by the addition of cyclohexamide before RNA isolation. Lymphoblastsare incubated for 2 h at 37 �C at a final concentration of 0.1 mg/mL [30]. There are six overlapping PTTfragments (see Table 1). Sequencing of implicated regions to further characterise mutations followsidentification of truncated protein.

SequencingSequencing of individual exons from exons 1 to 14, including about 10 bases of intronic sequence on

each end [5] and exons 15-1 to 15-7 [6] is performed using published methods.

FISH analysisProbe isolation is performed by screening the RPCI-1 PAC library [38] with PCR primers specific for

the APC gene (brain specific promoter, exons 6, 9 and 15-6). Two clones containing the brain specificpromoter and exons 1–5 (163M2 and 319I6) and three clones containing exons 6–15 (257A10, 257D9,74G23) are isolated. A previously published BAC clone, which contains the entire APC gene (6e10), isalso used to screen the metaphase spreads [39]. PAC 72M20 maps on the short-arm of chromosome-5and is used as a chromosome-5 tag on the metaphase spreads.

The PAC and BAC clones were labelled with DIG or Biotin by nick translation according to themanufacture’s instructions (Roche). For each slide, 100 ng labelled DNA, 10 mg COT-1 DNA and 10 mgherring sperm DNA is suspended in 15 ml hybridisation mix (50% deionised formamide/10% dextransulphate/5� SSCC). This is pre-annealed for 1 h at 37 �C, before adding to chromosome slides andhybridising overnight at 37 �C. Chromosome preparations are made from transformed lymphocytecells as per standard cytogenetic protocols. Slide washing is performed at 60 �C 0.1� SSC. Dual colourFISH is produced by first incubating in avidin-FITC, then with biotinylated goat anti-avidin and anti-digoxygenin and finally with avidin-FITC and anti-mouse Texas Red, all for 30 min each. The slides arevisualised with a fluorescent microscope equipped with a CCD camera using Photometrics V forwindows imaging software. A minimum of 20 cells is analysed for each probe.

Quantitative real time PCRReal time quantitative PCR with the TaqMan fluorescent probes is based on the 50 exonuclease

activity of Taq polymerase to cleave the fluorescent labelled hybridisation probe during the extensionphase of the PCR [40] and the fluorescence is captured by an optical system. The cycle at which thefluorescence rises above background is called the threshold cycle (Ct). There is a linear relationship

Table 1PTT fragments and conditions for analysis of the APC gene.

PCR fragment Size bp PCR conditions Oligo name Oligo sequence

Segment 1A (codons 1–431) 1293 60 �C, 3.5 mM MgCl2, Seg.1 Int.50 T7GCTGCAGCTTCATATGATCQiagen HOT Star Taq Exon 9R CATGCCTGGTTCATGAGC

Segment 1B (codons 251–832) 1780 60 �C, 3.5 mM MgCl2, Exon 7F T7GAAACCGGCTCACATGATGQiagen HOT Star Taq 15B3b GGGTAACACTGTAGTATTCAAAT

Segment 1 (codons 1–811) 2468 66 �C, 3.5 mM MgCl2,wax bead, AmpliTaq

Seg. 1 Int.50 T7GCTGCAGCTTCATATGATCSeg. 1 Int.30 CTGACCTATTATCATCATGTGG

Fragment 2 (codons 654–1263) 1869 59 �C, 3.5 mM MgCl2,AmpliTaq

15AT7 T7CAAATCCTAAGAGAGAACAACTGTC15F3b CAC AAT AAG TCT GTA TTG TTT CTT

Fragment 3 (codons 1029–1701) 2058 59 �C, 1.5 mM MgCl2,wax bead, AmpliTaq

15ET7 T7CTTAAATATTCAGATGAGCAGTTGAA15J3 GAG CCT CAT CTG TAC TTC TGC

Fragment 4 (codons 1596–2338) 2266 59 �C, 3.5 mM MgCl2,wax bead, AmpliTaq

15JT7 T7GCCCAGACTGCTTCAAAATTA15Q3b CTTATTCCATTTCTACCAGGGGAA

Segment internal 50 and exon 7F T7 sequence: GGATCCTAATACGACTCACTATAGGGAGACCACCATG. Fragments 2, 3, 4 and 5 T7sequence: GGATCCTAATACGACTCACTATAGGAACAGACCACCATG (Powell, 1998; Powell et al., 1993; van der Luijt et al., 1994; vander Luijt et al., 1996).

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207 205

within the exponential growth phase between the template copy number and the Ct value. Duplexingwith an internal control gene (labelled with a different reporter dye) allows relative quantitation. Thiseliminates the need for all DNA samples to have the same amount of template DNA added at thebeginning of the PCR reaction. The Ct value of the test probe and internal control probe are comparedand normalised by calculating the 2^�(2DCt) value. DCt is the Ct difference between the test exon and thecontrol exon. 2DCt is the difference between the DCt value and an average DCt of the negative controlsincluded in assay. The 2^�(2DCt) value calculated shows that non-deleted samples have a value of 1 anddeleted samples have a value of zero. In other words, a value below 0.5 has one copy of the APC geneexon being tested and a value above 0.5 has two copies of the APC gene exon.

The quantitative real time PCR is carried out as a duplex PCR for the test exon, labelled with FAM andCFTR exon 24 as an internal control labelled with HEX, in a reaction volume of 25 ml using the BrilliantQPCR kit (Stratagene, Integrated Sciences). The TaqMan fluorescent probes are synthesised accordingto the Applied Biosystems primer-express software program, allowing a standard amplificationthermal cycling conditions (denaturation 95 �C for 10 min, and subsequent cycles of 95 �C for 15 s and60 �C for 1 min for 40 cycles). Each exon specific PCR reaction mixture consists of 200 nM exon specificforward and reverse primers, 100 nM exon specific probe to a final concentration of 5.0 mM MgCl2 and200 ng DNA sample. The CFTR forward and reverse primers are at a concentration of 200 nM each andthe HEX labelled CFTR exon 24 probe was at a concentration of 400 nM. Amplifications are carried outin the iCycler detection system (Bio–Rad) and analyses are performed in triplicate using the iCycler iQreal time detection system software version 2.3 for windows.

Southern blot analysisTen mg DNA is digested with a minimum of seven restriction enzymes (EcoRI, BglI, NsiI, XbaI, DraI,

HindIII, BamHI) and separated on 0.8% agarose gels. Denaturation and then transferred under alkalineconditions (0.1 M NaOH) with a charged nylon membrane (Hybond Nþ, Amersham). Cloned PCRfragments (from PTT analysis) are labelled with a32P dCTP by random priming. 150–200 ng denaturedlabelled probe is pre-annealed with 30 mg placental DNA and 2 mg herring sperm DNA in Churchbuffer for a minimum 30 min at 65 �C to remove repeat sequences and hybridised overnight at 65 �C.The final wash is at 0.1� SSC at 65 �C. Filters are exposed to auto-radiographic film for 3–10 days.

Multiplex ligation dependent probe amplificationMLPA analysis is performed using kits from MRC-Holland (Amsterdam, The Netherlands). The kits

include probes for each exon of the APC gene, control regions across the genome and further controlsto check for adequate quality of DNA and efficient ligation. A total of 1 ml of DNA is used per MLPAreaction. MLPA PCR products are separated on an ABI3100 genetic analyser and interpreted usingGenotyper version 2.0. Peak heights are exported to an Excel spreadsheet designed to assess theratios or each test peak relative to all other peaks for that individual. Ratios of test peaks to controlpeaks and control peaks top other control peaks in each patient sample are compared to the sameratios obtained from two normal individuals which are included in each run. For normal sequences,a dosage quotient of 1.0 is expected.; if a deletion or duplication is present, the dosage quotientshould be 0.5 and 1.5 respectively. Results ware deemed acceptable if the dosage quotient for controlpeaks fall within the range 0.8 to 1.2. A deletion is scored if the mean dosage quotient of the test tointernal control peaks is less than 0.7, and a duplication is scored if the mean dosage quotient is 1.3or greater.

Clinical key points

� Familial adenomatous polyposis (FAP) is a highly penetrant inherited condition predisposingalmost inevitably to colorectal cancer, which can be prevented by timely diagnosis andintervention with colectomy.

� Attenuated forms exist which present at a later age with a smaller number of adenomatouspolyps; these include families with recessively inherited MYH mutations.� Genotype phenotype correlation has some utility in surgical decision making, and estab-

lishing risk of desmoid disease.� Germline Mutations in the APC gene are responsible for FAP; one of a large number of

mutations in the APC gene is usually identified through one of a variety of mutational analytictechniques.� Sequencing of the gene often is insufficient alone to detect all APC mutations due to cryptic

changes such as large deletions or rearrangements, somatic mosaicism to identify the familyspecific mutation.� Identifying the family specific APC gene mutation through a clearly affected proband allows

predictive testing to be offered to other family members, which has major cost efficiencies infamily management and surveillance, and enhances opportunities for early diagnosis andprophylactic surgery.� Mutations in the APC gene are not only responsible for FAP when inherited, but also are a key

molecular oncogenic event in colorectal cancer when occurring somatically.

Research key points

� Families that do not harbour an APC or MYH mutation are likely to provide important newinsights into the pathogenesis of colorectal cancer and are worthy of research focus.� Modifier genes and environmental influences affecting penetrance and expression of

multiple adenomas need to be studied. This may inform common colorectal cancer aetiologyas well.� Clinical management of families with attenuated APC using endoscopic ablation or poly-

pectomy needs further research as to the level of confidence with which colorectal neoplasiacan be controlled.� FAP is an ideal population for trials of chemoprevention against colorectal neoplasia.� APC and MYH mutational and phenotypic databases should form part of the Human Variome

Project through the International Society for Gastrointestinal Hereditary Tumours.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207206

References

[1] Herrara L, Kakati S, Gibas L, et al. Brief clinical report: Gasrdner Syndrome in a man with interstitial deletion of 5q. Am JMed Genet 1986;25:473–6.

[2] Bodmer WF, Bailey C, Bodmer J, et al. Localization of the gene for familial adenonmatous polyposis on chromosome 5.Nature 1987;328:614–6.

[3] Hockey KA, Mulcahy MT, Montgomery P, Levitt S. Deletion of chromosome 5q and familial adenomatous polyposis. J MedGenet 1989;26:61–82.

[4] Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP locus genes from chromosome 5q21. Science 1991;253:661–5.[5] Groden J, Thliveris A, Samowitz W, et al. Identification and characterization of the familial adenomatous polyposis coli

gene. Cell 1991;66:589–600.[6] Miyoshi Y, Ando H, Nagase H, et al. Germ-line mutations of the APC gene in 53 familial adenomatous polyposis patients.

Proc Natl Acad Sci U S A 1992;89:4452–6.[7] Tuohy TM, Burt RW. Somatic mosaicism: a cause for unexplained cases of familial adenomatous polyposis? Gut 2008;57:

10–2.[8] Aretz S, Stienen D, Friedrichs N, et al. Somatic mosaicism: a frequent cause of FAP. Hum Mutat 2007;28:985–92.[9] Hes FJ, Nielsen M, Bik WM, et al. Somatic APC mosaicism: an underestimated cause of polyposis coli. Gut 2008;57:71–6.

[10] Armstrong JG, Davies DR, Guy SP, Frayling IM, Evans DG. APC mutations in familial adenomatous polyposis families in theNorthwest of England. Hum Mutat 1997;10:376–80.

[11] Dobbie Z, Spycher M, Mary JL, et al. Correlation between the development of extracolonic manifestations in FAP patientsand mutations beyond codon 1403 in the APC gene. J Med Genet 1996;33:274–80.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207 207

[12] Giarola M, Stagi L, Presciuttini S, et al. Screening for mutations of the APC gene in 66 Italian familial adenomatous pol-yposis patients: evidence for phenotypic differences in cases with and without identified mutation. Hum Mutat 1999;13:116–23.

[13] Nagase H, Miyoshi Y, Horii A, et al. Screening for germ-line mutations in familial adenomatous polyposis patients: 61 newpatients and a summary of 150 unrelated patients. Hum Mutat 1992;1:467–73.

[14] Powell SM, Petersen GM, Krush AJ, et al. Molecular diagnosis of familial adenomatous polyposis [see comments].Comment in: SS N Engl J Med SS 1993 Dec 30;329(27): 2028–9. N Engl J Med 1993;329:1982-7.

[15] van der Luijt RB, Khan PM, Vasen HF, et al. Molecular analysis of the APC gene in 105 Dutch kindreds with familialadenomatous polyposis: 67 germline mutations identified by DGGE, PTT, and southern analysis. Hum Mutat 1997;9:7–16.

[16] Wallis YL, Morton DG, McKeown CM, Macdonald F. Molecular analysis of the APC gene in 205 families: extended geno-type-phenotype correlations in FAP and evidence for the role of APC amino acid changes in colorectal cancer predispo-sition. J Med Genet 1999;36:14–20.

[17] Aretz S, Stienen D, Uhlhaas S, et al. Large submicroscopic genomic APC deletions are a common cause of typical familialadenomatous polyposis. J Med Genet 2005;42:185–92.

[18] Schouten JP, Mc Elgunn CJ, Waaijer R, et al. Relative quantification of 40 nucleic acid sequences by multiplex ligand-dependent amplification probe amplification. Nucleic acid Res 2002;30:e57.

[19] Gayther S, Wells D, Gulati K, et al. Germline rearrangement of MCC and APC detected by pulsed field gel electrophoresisand fluorescent in situ hybridization [published erratum appears in Ann Hum Genet 1993 Oct;57(Pt 4):311]. Ann HumGenet 1993;57:169–78.

[20] Mandl M, Caspari R, Jauch A, et al. Familial adenomatous polyposis: a submicroscopic deletion at the APC locus in a familywith mentally normal patients. Hum Genet 1996;97:204–8.

[21] Pilarski RT, Brothman AR, Benn P, Shulman Rosengren S. Attenuated familial adenomatous polyposis in a man with aninterstitial deletion of chromosome arm 5q. Am J Med Genet 1999;86:321–4.

[22] Prosser J, Condie A, Wright M, et al. APC mutation analysis by chemical cleavage of mismatch and a protein truncationassay in familial adenomatous polyposis. Br J Cancer 1994;70:841–6.

[23] van der Luijt RB, Tops CM, Khan PM, et al. Molecular, cytogenetic, and phenotypic studies of a constitutional reciprocaltranslocation t(5;10)(q22;q25) responsible for familial adenomatous polyposis in a Dutch pedigree. Genes ChromosomesCancer 1995;13:192–202.

[24] Cao X, Eu KW, Seow-Choen F, et al. Topoisomerase-I- and Alu-mediated genomic deletions of the APC gene in familialadenomatous polyposis. Hum Genet 2001;108:436–42.

[25] Su LK, Kohlmann W, Ward PA, Lynch PM. Different familial adenomatous polyposis phenotypes resulting from deletions ofthe entire APC exon 15. Hum Genet 2002;111:88–95.

[26] Giardiello FM, Petersen GM, Piantadosi S, et al. APC gene mutations and extraintestinal phenotype of familial adeno-matous polyposis. Gut 1997;40:521–5.

[27] Olschwang S, Laurent-Puig P, Groden J, et al. Germ-line mutations in the first 14 exons of the adenomatous polyposis coli(APC) gene. Am J Hum Genet 1993;52:273–9.

[28] Scott RJ, Meldrum C, Crooks R, et al. Hunter Family Cancer Service. Familial adenomatous polyposis: more evidence fordisease diversity and genetic heterogeneity. Gut 2001;48:508–14.

[29] Walon C, Kartheuser A, Michils G, et al. Novel germline mutations in the APC gene and their phenotypic spectrum in FAPkindreds. Hum Genet 1997;100:601–5.

[30] Bateman JF, Freddi S, Lamande SR, et al. Reliable and sensitive detection of premature termination mutations usinga protein truncation test designed to overcome problems of nonsense-mediated mRNA instability. Hum Mutat 1999;13:311–7.

[31] Su LK, Steinbach G, Sawyer JC, et al. Genomic rearrangements of the APC tumor-suppressor gene in familial adenomatouspolyposis. Hum Genet 2000;106:101–7.

[32] Cotton RG, Auerbach AD, Axton M, et al. Genetics: the Human Variome Project. Science 2008;322:861–2.[33] Powell SM. Direct analysis for familial adenomatous polyposis mutations. Methods Mol Biol 1998;92:251–66.[34] Powell SM. Direct analysis for familial adenomatous polyposis mutations. Mol Biotechnol 2002;20:197–207.[35] Roest PA, Roberts RG, Sugino S, et al. Protein truncation testing for rapid for rapid detection for translation-terminating

mutations. Hum Mol Genet 1993;2:17–21.[36] van der Luijt R, Khan PM, Vasen H, et al. Rapid detection of translation-terminating mutations at the adenomatous

polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1–4.[37] van der Luijt RB, Meera Khan P, Vasen HF, et al. Germline mutations in the 30 part of APC exon 15 do not result in truncated

proteins and are associated with attenuated adenomatous polyposis coli. Hum Genet 1996;98:727–34.[38] Ioannou PA, Amemiya CT, Garnes J, et al. A new bacteriophage P1-derived vector for the propagation of large human DNA

fragments. Nat Genet 1994;6:84–9.[39] Kenck C, Bugert P, Wilhelm M, Kovacs G. Duplication of an approximately 1.5 Mb DNA segment at chromosome 5q22

indicates the locus of a new tumour gene in nonpapillary renal cell carcinomas. Oncogene 1997;14:1093–8.[40] Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilising the

50–30 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 1991;88:7276–80.