Expression and complex formation of simian virus 40 large T antigen ...

JOURNAL OF VIROLOGY, Sept. 1988, p. 3109-31190022-538X/88/093109-11$02.00/0Copyright © 1988, American Society for Microbiology

Expression and Complex Formation of Simian Virus 40 Large TAntigen and Mouse p53 in Insect Cells

DAVID, R. O'REILLY AND LOIS K. MILLER*Departments ofEntomology and Genetics, University of Georgia, Athens, Georgia 30602

Received 1 March 1988/Accepted 16 May 1988

Recombinant baculoviruses were constructed which express simian virus 40 large T antigen (SVT-Ag) or

murine p53 to high levels in infected insect cells. Characterization of the expressed proteins revealed that theydisplay many properties of the corresponding mammalian-derived proteins. Both proteins are of wild-type size,localize to the nucleus, are recognized by several SVT-Ag- or p53-specific monoclonal antibodies, and are

phosphorylated in this system. Complexes are formed between baculovirus-derived SVT-Ag and p53 aftercoinfection of insect cells with both recombinant viruses. After infection of insect cells with either virusindividually, each protein can self-associate to form a variety of oligomeric species. Pulse-chase experimentsindicated that both SVT-Ag and p53 are highly stable in insect cells, even in the absence of complex formation.

A variety of gene expression systems have been devel-oped recently with a view to achieving enhanced expressionof eucaryotic proteins normally present at extremely lowlevels (44). A recently developed vector system with consid-erable potential employs the baculovirus Autographa cali-fornica nuclear polyhedrosis virus (AcMNPV) to mediateexpression of the cloned gene in insect cell cultures (25, 31,32). In this system, the gene is inserted in place of theAcMNPV polyhedrin gene, which is nonessential for viralreplication in cell culture. Expression of the cloned gene isthen under the control of the polyhedrin promoter, resultingin high levels of expression late in infection.To date, a wide range of genes has been expressed by

using the baculovirus system and in many cases, biologicallyactivp proteins have been obtained (32a; reviewed in refer-ence 25). Characterization of the expressed proteins hasshown that insect cells can carry out at least some of theposttranslational modifications which occur in mammaliancells. Signal sequence cleavage has been demonstrated forhuman alpha- and beta-interferon and interleukin-2 and -3(27, 33, 54, 55), while the appropriate proteolytic cleavage ofhuman immunodeficiency virus env and gag proteins andinfluenza virus hemagglutinin is observed (16, 22, 26, 40).Polyomavirus large T antigen and the Drosophila Kruppelprotein display DNA-binding activity after synthesis in in-sect cells (36, 42). Oligomerization, complex formation, orboth has been observed for baculovirus-expressed rotavirusmajor capsid antigen (7) and two influenza virus polymerasecomplex proteins (56).

It is not yet clear whether all posttranslational modifica-tions will be comparable in mammalian and insect cells.Glycosylation is one modification which appears to differbetween mammalian and insect cells, but the significance ofthis difference is not yet known and several biologicallyactive glycoproteins have already been produced by usingthe baculovirus system. One of the posttranslational modi-fications of key importance is phosphorylation, because thismodification has been found to play a critical role in theregulation of protein function in a variety of systems. It isknown that the Drosophila Kruppel protein, c-myc, andhuman T-cell leukemia virus type I p40" are phosphorylatedafter expression in insect cells, but no information is avail-

* Corresponding author.

able concerning the nature or site(s) of the phosphorylationevents involved (17, 34, 36). Baculovirus-derived humanepidermal growth factor receptor displays an autophos-phorylation activity like that of the wild-type protein (12).We chose to study the expression of simian virus 40

(SV40) large T antigen (SVT-Ag) and murine p53, becauseprior characterization of the numerous functions and post-translational modifications associated with these proteinshas been extensive. SVT-Ag displays ATPase activity,DNA-binding activity, and helicase activity (4, 5, 43, 57).The protein is essential for viral DNA replication (59) andmay associate with the host cell DNA polymerase alpha (53).It can immortalize and transform primary and establishedcell lines, and these properties may be related to its ability tobind and stabilize the host cell protein p53 (30, 38, reviewedin reference 37). p53 itself is an immortalizing oncogene (6,20, 39) and is implicated in the passage of cells from Go to G1(21). Both SVT-Ag and p53 are phosphoproteins, and thenature and sites of phosphorylation are largely determined(29, 45-49, 60). SVT-Ag is a particularly good model to studyphosphorylation since there is much recent evidence linkingphosphorylation to the regulation of a number of its biolog-ical activities, especially viral DNA replication and DNAbinding (11, 35, 48).

In this study, we describe the expression of SVT-Ag andp53 by using the baculovirus expression system. The abun-dantly expressed proteins are localized in the insect cellnucleus and adopt a structural conformation similar to thatof their mammalian counterparts. Both proteins are phos-phorylated and retain the ability to associate together afterexpression in insect cells.

MATERIALS AND METHODS

Cells and viruses. Spodoptera frugiperda (fall armyworm)IPLB-SF21 cells (SF21 cells) (61) were maintained in TC-100medium (GIBCO Laboratories) supplemented with 10% fetalcalf serum and 0.25% tryptose broth. Stocks of wild-type(wt) virus, AcMNPV L-1 (24), were prepared and assayed asdescribed previously (31). Extracts of clone 6 rat cells (30),which express elevated levels of mouse p53, and AdSSVR111-infected human 293 cells (10) containing SVT-Agwere provided by C. Prives.

Construction of recombinant viruses. To generate recom-binant AcMNPVs expressing SVT-Ag and mouse p53,

3109

Vol. 62, No. 9

3110 O'REILLY AND MILLER

ABam HI Eco RI

1781 CIan B

3 ~~Kpn I

ST-Ag

5190 pEV55SVT(BgIU/StuI) 9.9kb

p

Polyhedrin 5' leoder SVT-Ag 5 leader* (Bgl /StuD) I0

AAACCTATAAATAGATC CCTAG GCTTTT

1t

(BgIll/Kpn

Pst I

Eco RI

Xho I pEV55p53 to

BgIll3 7.8kb

-'p~~~~~~~~~~~~~~~~~~~~~

Polyhedrin 5' leoder p53 5 leader-0 BgIll Eco RI -

AAACCTATAAATAGATCTCGAGAATTCCATCCTGG

XhoI_-29y -105

FIG. 1. Structure of the transplacement plasmids pEV55SVT and pEV55p53 (not to scale). (A) In pEV55SVT, SV40 sequences frompSVT#5, including the cDNA copy of the SVT-Ag gene, are indicated by the hatched box. The arrow indicates the expected SVT-Agtranscript. SV40 nucleotide numbers are given. (B) For pEV55p53, the stippled box represents the p53 cDNA from pSV53c. Again, the p53transcript is indicated. In both plasmids, AcMNPV sequences which flank the polyhedrin gene are presented as open boxes (P5' and P3'). ThepUC8 sequences are indicated by a thin line. Selected restriction endonuclease sites are shown. Sites in parentheses are those present in theoriginal fragments which were destroyed during the construction. The sequence of the pEV55-cDNA junction is given below each plasmid.In each case, the position of the fusion site relative to the AUG of the cloned gene is indicated.

cDNA copies of these genes were cloned first into thetransplacement plasmid pEV55. The structure of this vectorhas been described previously (31, 32). The cDNA encodingSVT-Ag was excised from the plasmid pSVT#5 (constructedby Y. Gluzman) by digestion with StuI (nucleotide 5191) andEcoRI (nucleotide 1780), yielding a fragment which extendsfrom 29 base pairs upstream of the ATG of SVT-Ag toapproximately a kilobase downstream of the translationaltermination codon. This fragment was cloned into pEV55which had been previously digested with BglII (filled in withT4 DNA polymerase) and EcoRI. The recombinant plasmidobtained, pEV55SVT, is illustrated in Fig. 1A.To construct pEV55p53, a cDNA encoding murine p53

was excised from the plasmid pSV53c (19) by digestion withEcoRI and BglII (filled in with T4 DNA polymerase). Theresultant 1.33-kilobase fragment includes 105 base pairs of 5'flanking sequence and extends 20 base pairs beyond thetermination codon. It was inserted into pEV55 that had beenpreviously digested with KpnI (blunt ended within T4 DNApolymerase) and EcoRI. The structure of the resultantplasmid, pEV55p53, is depicted in Fig. 1B.To confirm the structure of the pEV55-cDNA junction in

both pEV55SVT and pEV55p53, the DNA sequence span-ning the junction was determined by double-stranded se-quencing of plasmid DNA, essentially as described by Chenand Seeburg (3). The primer used was a 17-mer correspond-ing to residues -26 to -42 in the polyhedrin leader se-quence. The plasmids pEV55SVT and pEV55p53 contain theSVT-AG and p53 genes downstream from the AcMNPVpolyhedrin promoter and flanked by polyhedrin 5' and 3'flanking sequences (Fig. 1).Recombinant viruses expressing these genes were gener-

ated by replacement of the wt polyhedrin gene in AcMNPVL-1 with the promoter-gene fusions from pEV55SVT andpEV55p53. To this end, 2 x 106 SF21 cells were cotrans-fected with 2 ,ug of viral DNA (isolated as described inreference 31) and 18 ,ug of either pEVS5SVT or pEV55p53,according to the procedure of Potter and Miller (41). At 5days later, progeny virus were harvested and then re-plaqued. Plaques generated by recombinant virus were iden-tified by visual screening for an occlusion-negative pheno-

type (31). The recombinant viruses were subjected to threerounds of plaque purification before large-scale virus stockswere prepared. Viral DNA was isolated, and the structuresof the resultant viruses, vEV55SVT and vEV55p53, wereverified by restriction enzyme analysis and Southern blot-ting.

Analysis of proteins synthesized in infected cells. SF21 cells(106/35-mm Petri dish) were infected with wt or recombinantviruses at a multiplicity of infection (MOI) of from 10 to 50(see figure legends). At the appropriate times postinfection(p.i.), the medium was removed and replaced with TC-100lacking either methionine or phosphate. The cells werelabeled 1 h later with 50 ,uCi of [35S]methionine or 100 ,uCi of32p; (New England Nuclear) in 0.5 ml of methionine- orphosphate-deficient medium. The lengths of the labelingperiods are indicated in the individual figure legends. Incertain experiments, the [35S]methionine pulse labeling waschased by incubation of the cells in TC-100 containing anexcess of unlabeled methionine. The cells were rinsed threetimes in cold phosphate-buffered saline (PBS; 8 mMNa2HPO4, 137 mM NaCl, 0.5 mM MgCl2, 1.6 mM KH2PO4,2.7 mM KCl [pH 8.0]) and incubated in 50 ,ul of lysis buffer(1% Nonidet P-40, 150 mM NaCl, 50 mM Tris hydrochloride[pH 8.0]) containing 1 mM phenylmethylsulfonyl fluoride(Fluka), 40 ,uM pepstatin (Fluka), and 20 ,uM leupeptin(Fluka) for 30 min at 4°C. Lysates were stored at -80°C.Total proteins present were visualized by electrophoresis ofportions of the lysates through 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE; 23). Alternatively, sam-ples were immunoprecipitated with various antibodies (intissue culture fluid) directed against SVT-Ag or p53 (detailedin the text). Trial immunoprecipitation experiments wereconducted to ensure the presence of excess antibody. Im-munoprecipitation experiments were carried out in NETbuffer (140 mM NaCl, 5 mM EDTA, 0.05% Nonidet P-40, 50mM Tris hydrochloride [pH 8.0]) containing 1 mg of bovineserum albumin per ml, at 4°C for 3 to 4 h. Antigen-antibodycomplexes were collected by adsorption to fixed Staphylo-coccus aureus (Sigma Chemical Co.) for 1 h at 4°C. Immu-noprecipitates were washed three times in NET buffer,

J. VIROL.

BACULOVIRUS-DERIVED SVT-Ag AND p53 3111

eluted by being boiled for 5 min in the gel-loading buffer (23),and analyzed by SDS-PAGE.Immunofluorescence studies. SF21 cells (105) were seeded

onto glass coverslips (22 by 22 mm) and infected with therecombinant viruses at an MOI of 10. At the selected timesp.i., the cells were washed three times in cold PBS and fixedin 70% acetone-30% methanol at -20°C for 10 min. Thefixative was removed, and the coverslips were air dried andstored at -20°C. Before being stained, coverslips wereincubated in PBS at room temperature for 15 min. The PBSwas removed by aspiration, and 50 ,ul of the appropriatedilution (determined empirically) of monoclonal antibodywas placed on the coverslip. After incubation at 37°C for 1 hin a moist environment, the coverslips were washed twicefor 15 min each in PBS at room temperature. The secondantibody used was a fluorescein isothiocyanate-conjugatedrabbit anti-mouse immunoglobulin antiserum (Sigma), andincubation conditions were as described above. After twofurther washes with PBS, the coverslips were mounted ontomicroscope slides and examined by using Nomarski or UVoptics.

Sucrose gradient centrifugation. SF21 cells were infectedwith the recombinant viruses individually or together andlysed as described above. Lysates (2 x 106 infected cells pergradient) were loaded onto 5-ml linear gradients of 5 to 20%sucrose in PBS and centrifuged at 55,000 x g for 16 h at 4°C.Equal volume fractions (250 ,ul) were collected and immu-noprecipitated with PAb 419 or PAb 421.

RESULTS

Construction of recombinant viruses and analysis of SVT-Ag and mouse p53 expression. cDNAs encoding SVT-Ag andmurine p53 were cloned into the transplacement plasmidpEV55 as described in Materials and Methods. The resultantplasmids are depicted in Fig. 1. In pEV55SVT (Fig. 1A), thejunction of polyhedrin and SVT-Ag leader sequences occursat position -29 relative to the SVT-Ag ATG, while inpEVSSpS3 (Fig. 1B), the polyhedrin-p53 fusion is at position-105 relative to the p53 ATG. The transplacement plasmidpEV55 provides the entire polyhedrin promoter-leader re-gion to drive gene expression. The A of the BglII site inpEV55 corresponds to the A of the polyhedrin ATG in wtAcMNPV. pEV55 is therefore expected to provide higherlevels of expression than vectors such as pAc373 or pEV51which lack portions of the leader region (31, 54). Therecombinant viruses vEVSSSVT and vEVSSpS3 were con-structed by cotransfection of wt AcMNPV DNA withpEVSSSVT and pEVSSpS3 respectively, to allow allelicreplacement of the wt polyhedrin sequences with the clonedgene. Recombinant viruses were selected by screening for anocclusion-negative phenotype since the polyhedrin gene isno longer present.The expression of SVT-Ag and p53 by these viruses was

examined by SDS-PAGE analysis of extracts derived fromSF21 cells infected with wt or recombinant viruses forvarious times. The extensive accumulation of polyhedrinafter infection with wt virus can be clearly seen in theCoomassie blue-stained gel presented in Fig. 2A. Afterinfection with vEV55pS3, high levels of a 53-kilodalton (kDa)protein accumulate by 36 and 48 h p.i. This protein is notpresent in wt-infected or in mock-infected cells. Similarly, anovel 94-kDa protein accumulates by 36 and 48 h afterinfection with vEVSSSVT, although the steady-state levelsof this protein are somewhat lower than those of the 53-kDaprotein.

The kinetics of synthesis of these proteins were examinedby SDS-PAGE of [35S]methionine pulse-labeled proteins ofinfected cells (Fig. 2B). Synthesis of both the 94- and 53-kDaproteins is detectable at 24 h p.i. and increases through 48 hafter infection. In both cases, the kinetics of synthesis arelike those of polyhedrin, and a similar inhibition of host cellprotein synthesis is observed at late times p.i.To confirm that the 94- and 53-kDa proteins correspond to

SVT-Ag and p53, respectively, immunoprecipitation exper-iments were performed with monoclonal antibodies specificfor these proteins. It can be seen in Fig. 2C and D that themonoclonal antibody PAb 419, which is specific for SVT-Ag(15), recognizes the 94-kDa polypeptide expressed invEVSSSVT-infected SF21 cells. Similarly, PAb 421, ananti-p53 antibody (15), specifically immunoprecipitates the53-kDa protein from vEV55-infected cells (Fig. 2C and D).Again, no such proteins are immunoprecipitated from wt- ormock-infected lysates. Note that polyhedrin precipitatesspontaneously in these experiments because it is quiteinsoluble in the lysis buffer used. As before, synthesis ofboth proteins is detectable from 24 h after infection andlower levels of SVT-Ag are observed than of p53. In theseand certain subsequent experiments, the amount of sampleused from vEVSSpS3-infected cells was reduced because ofthe more efficient expression of this vector (see figurelegends). Trial titration experiments were previously carriedout to ensure the presence of excess antibody in all immu-noprecipitations.We next carried out immunoprecipitations of human cells

infected with Ad5SVR111, a recombinant adenovirus whichexpresses SVT-Ag, or clone 6 rat cells, which expresselevated levels of mouse p53, in order to compare themammalian-derived proteins with the same proteins synthe-sized in infected insect cells. Figure 2E demonstrates thatSVT-Ag synthesized in insect cells is precisely the same sizeas SVT-Ag produced in AdSSVR111 infected human cells.Similarly, the insect-derived p53 displays an identical mobil-ity to murine p53 made in the cloned 6 cells. Note that incertain experiments the insect-derived SVT-Ag is observedas a doublet. This is also seen with Ad5SVR111-infectedhuman cells and may reflect postlysis degradation which hasbeen frequently observed for various SVT-Ag preparations(58). From the Coomassie blue-stained gel of the samplesshown in Fig. 2E, we estimated that the recombinant bacu-loviruses produced from 2- to 10-fold more SVT-Ag and p53per cell than their mammalian counterparts. On the basis ofa comparison with Coomassie blue-stained protein stan-dards, we estimate that SVT-Ag accumulated to approxi-mately 25 to 50 ,ug/107 cells, whereas p53 levels of 60 to 150,ug/107 cells are obtained (data not shown).

Subcellular localization of SVT-Ag and p53 in insect cells. Aseries of immunofluorescence experiments were carried outto examine the subcellular localization of SVT-Ag or p53 ininsect cells at various times after infection with vEV55SVTor vEV55p53, respectively. In the data presented in Fig. 3,SVT-Ag expression is initially observed at 24 h p.i., whereaslow levels of p53 are detectable at 12 h after infection. Themore extensive accumulation of p53 is in agreement with theexpression studies described above. At 12 h p.i. whenexpression levels are lower, both proteins are predominantlyfound in the nucleus. Later in infection, due to the high levelexpression of these proteins and to the fact that the nucleusswells considerably after baculovirus infection, it is difficultto establish whether there are significant amounts of theseproteins in the cytoplasm as well. The patterns of accumu-

VOL. 62, 1988


I:4b 4e'?S- 3EfI.-RIC .QUI i4

t-,j.J , ......

Ir-,w- .,

%,:

*1_, ,, i i_ W. : 8!- s. t h ;'& ,; $z. .,." . .. ... _ .. . . : .... ..

i #. " t., ,. | u._ 1 ""_ "_ *. Z_S - _ S#s _ _

XF- _

F * F4 ' F-

*:: * !S -E 1t*-

i.;.* : :* g g .: .g .... g<: .:::* .: ;0 p. .: :

st ^w F :

> .,i.. > wd s.. ^ < -. b .....

.. :." "l

.. E..... %, E

Z .:...... S .F.... ,=\

Xsffi|Sii

.. > o}

.-- £.i.

.,s: ,.,.. ...

*....::

_W,*WS ..,. -.

9 , ti-

FIG. 2. Protein synthesis in recombinant and wt AcMNPV-infected insect cells. SF21 cells were infected with vEV55SVT, vEV55p53, orwt AcMNPV at an MOI of 20. At 12, 24, 36, and 48 h p.i., cells were pulse labeled with [35S]methionine for 1 h and then lysed (50 ,ul/35-mmdish). (A and B) A 20- and 3-,ul sample, respectively, of each lysate was analyzed directly by SDS-PAGE. A Coomassie blue-stained gel isshown in panel A, and an autoradiograph is shown in panel B. (C) A 20-,ul sample of each vEV55SVT lysate and 7 RI1 of each vEV55p53 lysatewere immunoprecipitated with PAb 419 and PAb 421, respectively, before SDS-PAGE. The same respective volumes of wt-infected andmock-infected (mi) cells were analyzed as controls. The Coomassie blue-stained gel is shown. (D) The same as panel C except that 10 ,u1 ofthe vEV55SVT lysates and 3 ,u1 of each vEV55p53 lysate were used for the immunoprecipitation experiments. The gel was visualized byautoradiography. (E) Immunoprecipitates of vEV55SVT- or vEV55p53-infected lysates (48 h p.i.) were analyzed in parallel withimmunoprecipitates of lysates of Ad5SVR111-infected 293 cells or clone 6 rat cells. In each case, the volume of lysate used for the mammaliansamples represents three times more cells than the quantity used for the insect cell samples. Mock-infected (mi) insect cells were includedas negative controls. An autoradiograph is shown. The molecular size markers (M) are given in kilodaltons, and the positions of SVT-Ag (T),p53, and polyhedrin (PH) are indicated.

lation observed were unchanged after coinfection of SF21cells with both viruses (data not shown).

Epitope analysis of insect-derived SVT-Ag and p53. Thedata obtained in the experiments described above indicatethat the insect-derived SVT-Ag and p53 each display at leastone epitope known to be found on the corresponding wtproteins. To investigate further the similarity of these recom-binant proteins to their mammalian counterparts, we exam-ined the ability of several other monoclonal antibodies to

recognize them. In this experiment, infected SF21 cells werepulse labeled with [35S]methionine 48 h p.i. and lysed eitherimmediately or after a 3-h chase. The lysates were thenimmunoprecipitated with the appropriate antibodies andanalyzed by SDS-PAGE. The antibodies tested for SVT-Agwere PAb 416 and PAb 419, which recognize distinct epi-topes toward the N terminus of SVT-Ag (15), and PAb 100,which recognizes a determinant present in the center of asubset of SVT-Ag molecules (13, 14, 50). The latter epitope,

J. VIROL.


vEV55SVT vEV55p53

I

419 421FIG. 3. Immunofluorescence localization of SVT-Ag and p53 in insect cells. SF21 cells on glass coverslips were infected with vEV55SVT

or vEV55p53 at an MOI of 10. Infections were allowed to proceed for 12, 24, or 36 h before the cells were fixed and processed forimmunofluorescence analysis. The primary antibodies used were PAb 419 or PAb 421. Mock-infected cells (mi) were processed in parallel ascontrols. The fixed and stained cells were visualized by either UV (columns 1 and 3) or Nomarski (columns 2 and 4) illumination.

which has been associated with the DNA-binding propertiesof SVT-Ag, is dependent on the molecule assuming anappropriate tertiary structure, because antibody recognitionis destroyed by denaturation. The baculovirus-derived SVT-Ag displays all three epitopes, as shown in Fig. 4A.

The antibodies used to analyze p53 were PAb 242, PAb246, PAb 248, and PAb 421 (15, 63). The former three are

apparently specific for mouse p53 while the PAb 421 epitopeis more highly conserved and is found on p53 molecules ofseveral species (62). The PAb 242, PAb 246, and PAb 248

mi

12

24

36

VOL. 62, 1988


A4}6 479 1QO--Ps.: .: :.Y ...... . .i .. ...............

*: ::: ::::: ... : .... .

..... .:.:.: .... : .. ... .:

....* .:: .: : ::.::. ::

...... ....................... ...... : :

.. ::: .. :.:: :.

*...;0..B!iS.:S-''............ . Si .. ..:::

B242 246 248 421

__ __b _ __ - p53

mS P C MiC m Dr mi PC mi C mi P mi P CFIG. 4. Epitope analysis of insect-derived SVT-Ag (T) and p53. SF21 cells were infected with vEVSSSVT (A) or vEVSSpS3 (B) at an MOI

of 20. At 36 h p.i., the cells were labeled with [35S]methionine for 1 h. The cells were either lysed immediately (lanes P) or incubated incomplete TC-100 containing an excess of cold methionine for 3 h before lysis (lanes C). Then, 10 Il of each lysate was immunoprecipitatedwith PAb 416, PAb 419, or PAb 100 (panel A) or with PAb 242, PAb 246, PAb 248, or PAb 421 (panel B). Mock-infected (mi) cell lysates wereimmunoprecipitated with each antibody as a control (lanes mi). Immunoprecipitated proteins were analyzed by SDS-PAGE, and theautoradiographs obtained are shown.

epitopes are localized toward the N terminus of the molecule(exons 1, 3, and 4, respectively), whereas the PAb 421epitope is at the extreme C terminus of p53 (62). PAb 246 isof further interest since it has been reported that the deter-minant recognized by this antibody is stabilized by complexformation with SVT-Ag. However, it can be seen from Fig.4B that the baculovirus-produced p53 displays all four epi-topes, regardless of the presence of SVT-Ag. For bothSVT-Ag and p53, no significant difference was observed inthe ability of any antibody to recognize these proteins aftereither a pulse or a pulse-chase labeling (compare lanes P andC). This result indicates that all epitopes examined arepresent on both recently synthesized and older molecules.Complex formation between insect-derived SVT-Ag and

p53. One of the most characteristic properties of SVT-Agand p53 in mammalian systems is the ability to associatetogether to form a tight complex (reviewed in reference 37).To determine whether this association takes place in insectcells, we examined the sedimentation profiles of SVT-Agand p53 through linear sucrose gradients. 35S-labeled lysateswere prepared 48 h after infection of SF21 cells withvEV55SVT and vEV55p53 either individually or together,and the lysates were centrifuged through sucrose gradients.After centrifugation, the gradients were fractionated andimmunoprecipitated with PAb 419 (anti-SVT-Ag) or PAb 421(anti-p53). Figure 5A shows the sedimentation profile ofSVT-Ag extracted from SF21 cells infected with vEVSSSVTalone. While the protein sediments rather heterogeneously,two major species can be distinguished (fractions 3 to 5 andfractions 8 to 10). This is similar to the sedimentation profileobserved for SVT-Ag extracted from SV40-infected monkeycells in which it has been proposed that the slower-sedi-menting form represents monomers and dimers, while thefaster-sedimenting form corresponds to tetramers and higheroligomeric forms (8). Thus, these data suggest that SVT-Agsynthesized in insect cells is also capable of forming avariety of oligomeric forms.The sedimentation profile of p53 extracted from SF21 cells

infected with vEV55p53 alone indicates that this protein alsoexists in a variety of oligomeric forms (Fig. 5B). Again, two

species can be discerned (fractions 4 to 6 and fractions 14 to17), although p53 appears to sediment even more heteroge-neously than SVT-Ag.

After coinfection of SF21 cells with vEV55SVT andvEV55p53, immunoprecipitation of the gradient fractionswith the anti-SVT-Ag antibody shows that much of theSVT-Ag now exists as heavy oligomeric forms which sedi-ment to the bottom of the gradient (Fig. 5C, fractions 13 to17). p53 is now found to be coprecipitated by the anti-SVT-Ag antibody from the heavier fractions. These data indicatethat complex formation has taken place between SVT-Agand p53, and that the complexed forms of these proteinscosediment through the sucrose gradients, as seen in SV40-infected rodent cells (28).

Conversely, when the same gradient fractions are immu-noprecipitated with the anti-p53 antibody (Fig. 5D), p53 isfound to sediment throughout the gradient and complexedSVT-Ag, which is coprecipitated with pS3 by the anti-p53antibody, cosediments toward the bottom of the gradient.

Stability of baculovirus-produced SVT-Ag and p53. Theresults described above demonstrate that baculovirus-pro-duced SVT-Ag and pS3 are capable of associating together toform a high-molecular-weight complex in insect cells. One ofthe consequences attributed to complex formation in mam-malian cells is the stabilization of p53, which is otherwiseturned over very rapidly (38). We undertook a series ofpulse-chase experiments to determine the stability of SVT-Ag and p53 in SF21 cells both with and without complexformation. SF21 cells were infected with vEVSSSVT andvEVSSpS3 either separately or together. At 36 h p.i., thecells were pulse labeled with [35S]methionine for 30 min andthen chased with an excess of cold methionine for selectedtimes. The autoradiograph presented in Fig. 6 shows thatboth SVT-Ag and pS3 are highly stable in insect cells, withno significant turnover observed even after a 25-h chase. Nosignificant differences were observed when the SF21 cellswere coinfected with both viruses. The fact that coprecipi-tation of SVT-Ag and p53 was observed even after the30-min pulse suggests that complex formation takes placerapidly in this system.

J. VIROL.


AvEV55SVT

U 171615 14 1312 1110 9 8 7 6 5 4 3 2 l

BvEV55p53

U 17161514131211 10 9 8 7 6 5 4 3 2 1

*lo - W -,A -..w.ww..MPM--o

ES~nhlIPsE-W'.

419

- p53

421

vEV55SVT + vEV55p53U 171615141312 1 109 8 7 6 5 4 3 2 1

UINI--KIMUe'M-1--ShAmkm-

DvEV55SVT + vEV55p53

U 17 16 15 1453 1241 10 9 8 7 6 5 4 3 2 1

p53- _ .:::::C .-w

419

-p53

421FIG. 5. Sucrose gradient analysis of insect-derived SVT-Ag (T) and p53. SF21 cells were infected with vEV55SVT (MOI, 50) (A),

vEV55p53 (MOI, 10) (B), or coinfected with both viruses (MOIs, 50 and 10, respectively) (C and D) for 36 h. They were then pulse labeledwith [35S]methionine for 1 h before lysis. Lysates were centrifuged through linear 5 to 20% sucrose gradients, and the fractions wereimmunoprecipitated with PAb 419 or PAb 421. Immunoprecipitates were analyzed by SDS-PAGE and autoradiographed as described in thelegend to Fig. 4. Fractions are numbered 1 through 17 from the top of the gradient. Lane U, An aliquot of the lysate not subjected to gradientcentrifugation and then immunoprecipitated in parallel.

vEV55SVT

P 1 2.5 5 10 25

vEV55SVT

vEV55p53

P 1 2.5 5 10 25

vEV55p53

P 1 2.5 5 10 25

vEV55SVT

vEV55p53

P 1 2.5 5 10 25

xb

-T

_ -p53

.,1\.. /

419 421FIG. 6. Stability of SVT-Ag (T) and p53 in insect cells. SF21 cells were pulse labeled with [35S]methionine for 30 min after infection for

36 h with vEV55SVT, vEVSSpS3, or both (MOIs as in the legend to Fig. 5). Labeled cells were either lysed immediately after the pulse (lanesP) or incubated in TC-100 with excess cold methionine for 1, 2.5, 5, 10, or 25 h. Lysates were then immunoprecipitated and analyzed as before.

C

4mwwdw..l---- .Am.

VOL. 62, 1988


A BvEV55SVT vEV55p53 wt12 24 36 48 12 24 36 48 12 24 3648 mi

-T

vEV55SVT vEV55p53 wt12 6r4- 2

M 12 24 36i4812 2436 48}2 243648

205-

116-97.4-

66)-

45-

29-

97.4-

66-

-p53

e sete: t; i . iP1 ....' Z7ii3IF

CVEVS5SVT vEV55p53 vEV55SVTt vEV55p53

ml 12 24 36 48 mi 12 24 36 48 12 24 36 48 12 24 36 48

45-

29-

DvEV55SVT

12 24 3648

i

l.-

--

-

_L.

--

:

-T

-p53

vEV55p53 vEV55SVT vEV55p53

12 24 36 48 12 24 36 48 12 24 36 48

116-

97.4-: . . . ..... . : S

: :: ::

:#.F.:7..w:**@.."a ..K.'.-''... '= '" - Ti. : . . .66-

45-

-p53

205-

97.4-

66-

45-

29-29-_."........._... --::o

419 421 419 421 419 421 419 421FIG. 7. Phosphorylation of SVT-Ag and p53 in insect cells. SF21 cells were infected with vEV55SVT (MOI, 20), vEV55p53 (MOI, 20),

or wt virus (MOI, 20), or coinfected with vEV55SVT and vEV55p53 (MOIs, 50 and 10, respectively). At 12, 24, 36, or 48 h p.i., the cells werelabeled with 32p, for 1 h before lysis. Samples of the lysates were either analyzed directly by SDS-PAGE (panels A and B) or wereimmunoprecipitated with PAb 419 or PAb 421 as described in Materials and Methods (panels C and D). (A and C) Coomassie blue-stainedgels; (B and D) Autoradiographs. The sizes of the molecular markers are given in kilodaltons (lane M), and the positions of SVT-Ag (T), p53,and polyhedrin (PH) are indicated. mi, Mock infected.

-T

-p53

Phosphorylation of SVT-Ag and p53 in insect cells. Anothernotable characteristic of SVT-Ag and p53 is that they areboth phosphorylated in mammalian cells. We investigatedwhether the proteins produced by our expression systemwere phosphorylated by labeling SF21 cells with 32Pi atselected times after infection with vEV55SVT, vEV55p53,orwt virus. The labeled lysates were then analyzed by SDS-PAGE; autoradiography (Fig. 7B) shows clearly that both

SVT-Ag and p53 are phosphorylated in this system. InvEV55p53-infected cells, the major phosphoprotein presentin the infected cell late in infection is p53. Immunoprecipi-tation before SDS-PAGE confirmed the identities of thephosphoproteins (Fig. 7D). Comparison of the autoradio-graphs (Fig. 7B and D) with the Coomassie blue-stained gels(Fig. 7A and C) suggests that the degree of phosphorylationis maximal at 24 h p.i., dropping two- to fivefold by 48 h after

J. VIROL.


infection. Analysis of SVT-Ag and p53 extracted from SF21cells coinfected with both vEV55SVT and vEV55p53 revealsno major differences in the degree of phosphorylation ofeither of these proteins after complex formation (Fig. 7C andD).

DISCUSSION

In this study, we describe the construction and analysis ofrecombinant baculovirus vectors expressing SVT-Ag andmouse p53. The vectors produce levels of these proteinsranging from 50 to 150 ,ug/107 cells. These levels are excel-lent compared with those of the presently available mamma-lian gene expression systems.

Recently, Jeang et al. (18) described the construction of arecombinant baculovirus containing the coding sequencesfor SV40 large T and small t antigens. However, this vectorincluded SV40 early-gene splice sites, and the authors reportthat only small t antigen is synthesized in significantamounts. There is little or no detectable accumulation oflarge T antigen. The fact that we have readily obtained theexpression of large T antigen from a cDNA clone furtherdemonstrates the importance of using intronless genes withthe baculovirus expression system, as discussed previously(32).

Several lines of evidence indicate that the baculovirus-derived proteins are similar to their mammalian counter-parts. The proteins are of normal size (Fig. 2E) and aretransported to the nucleus (Fig. 3), indicating that thenuclear transport signals of both SVT-Ag and p53 arerecognized in insect cells. Both proteins also appear to adopta native conformation since they both display several epi-topes characteristic of the wt proteins (Fig. 4). Interestingly,the baculovirus-derived p53 is clearly recognized by themonoclonal antibody PAb 246, even in the absence ofSVT-Ag (Fig. 4B). Yewdell et al. (63) reported that thisepitope is generally unstable in the absence of SVT-Ag.However, those authors do report that the PAb 246 epitopeis present on p53 from at least one spontaneously trans-formed mouse cell line in the absence of SVT-Ag. The basisof this phenomenon is not known.

Sucrose gradient centrifugation analyses indicated thatbaculovirus-derived SVT-Ag and p53 are capable of self-associating to form a variety of oligomeric forms (Fig. 5). Atleast for SVT-Ag, this property is important because there ismuch evidence showing that different oligomeric forms ofthe protein display different posttranslational modificationsand biological functions in mammalian cells (reviewed inreference 43).Our experiments also show that baculovirus-produced

SVT-Ag and p53 can associate together in insect cells toform a rapidly sedimenting high-molecular-weight complex.The precise role played by complex formation in mammaliancells is not yet clear but it may have profound effects on theability of SVT-Ag to support viral DNA replication andimmortalize or transform cells (1, 9, 30; for a review, seereference 37). It is therefore of interest to observe that thisproperty is retained by the proteins in insect cells. Ourresults suggest that some SVT-Ag and p53 remain uncom-plexed in this system since the total amount of SVT-Agimmunoprecipitated from these cells (Fig. SC) is greater thanthe amount coprecipitated with p53 (Fig. SD). The converseis also true. Since p53 appears to be in excess of SVT-Ag incoinfected cells, there is likely to be a certain amount of freep53 in this system. In addition, there is evidence to suggestthat only a subpopulation of SVT-Ag is capable of binding

p53 (63). However, it is also difficult to rule out the possi-bility that there is some dissociation of the complexpostlysis.We notice that the sedimentation profile of p53 does not

change significantly in the presence or absence of SVT-Ag.Since the sedimentation profile of uncomplexed p53 inmammalian cells has not been reported, we do not knowwhether this is a general phenomenon.Another interesting observation concerning complex for-

mation in insect cells is that a pulse-chase analysis (Fig. 6)revealed that complex formation is very rapid in these cellsand that association is complete in less than 30 min. This isin contrast to the situation in mammalian cells in whichCarroll and Gurney (2) reported that although p53 is rapidlyincorporated into the complex, SVT-Ag enters the complexmore slowly, requiring from 3 to 6 h for maximum incorpo-ration. Those authors proposed that this phenomenon indi-cates that newly made SVT-Ag requires some posttransla-tional modification before it can complex p53. Morerecently, Schmeig and Simmons (51) have postulated thatthe kinetics of complex formation depends on the ratio ofSVT-Ag to p53 in the cell line studied and that competitionbetween newly synthesized and complexed SVT-Ag is themajor determinant of the rate of entry of SVT-Ag into thecomplex. The rapid rate of complex formation observed herewould tend to support the latter hypothesis; in our systemthere is ample p53 which should allow prompt entry of newlysynthesized SVT-Ag into the complex.The pulse-chase experiments also revealed that both SVT-

Ag and p53 are highly stable in insect cells. This is in strikingcontrast to what is observed in mammalian cells in which, inthe absence of SVT-Ag, p53 is highly unstable (38). Althoughwe are unsure of the basis for this enhanced stability of p53in insect cells, it should be noted that in this system, p53expression takes place late in infection, when the virus hasalready largely shut down host cell protein synthesis anddisrupted host cell metabolism.

Further evidence that the baculovirus system can expressauthentic mammalian proteins was provided by the observa-tion that both SVT-Ag and p53 are phosphorylated in thissystem. The data presented in Fig. 7 suggest that phosphor-ylation is maximal at 24 h p.i. and declines thereafter. It willnow be important to determine the type(s) and site(s) of thephosphorylation events involved, since both the nature anddegree of phosphorylation appear to be critical for thecorrect functioning of SVT-Ag and p53. Recent evidencesuggests that phosphorylation of serine residues down regu-lates the ability of SVT-Ag to support viral replication (11,35). This may or may not be mediated by decreased origin-binding activity (11, 35, 52). It seems also that the appear-ance of higher oligomeric forms of SVT-Ag is coincidentwith greater phosphorylation of the protein as it ages (8).Furthermore, Samad et al. (45) report that at least a compo-nent of p53 phosphorylation is dependent on SVT-Ag. Webelieve that these proteins therefore provide a valuablemodel system to establish whether insect cells can phosphor-ylation proteins in a manner qualitatively and quantitativelysimilar to mammalian cells.

In summary, we have successfully used the baculovirusexpression system to direct the efficient synthesis of SVT-Agand murine p53 in insect cells. These proteins are identical tothe corresponding mammalian products by all criteria exam-ined, and the levels of expression obtained compare favor-ably with those of mammalian expression systems presentlyavailable. Recently obtained evidence indicates that baculo-virus-derived SVT-Ag is functional in an in vitro SV40-

VOL. 62, 1988


origin-dependent replication system (C. Prives, personalcommunication). These facts, coupled with the ease of useand inherent safety of the baculovirus system (32), shouldmake these vectors a convenient source of SVT-Ag and p53for in vitro biochemical studies. We anticipate that thefurther analysis of these recombinant proteins and in partic-ular a more detailed characterization of their state of phos-phorylation will allow us to better evaluate the potential andlimitations of the baculovirus expression system.

ACKNOWLEDGMENTS

We thank Carol Prives for critical reading of the manuscript, forproviding lysates of clone 6- and Ad5SVR111-infected cells, and forpSVT#5 and monoclonal antibodies PAb 416, PAb 419, PAb 421,and PAb 100. We are grateful to Marcus Fechheimer for help withthe immunofluorescence experiments. We also thank Evelyne Mayand Jean-Claude Erhart for providing pSV53c and monoclonalantibodies PAb 242, PAb 246, and PAb 248.

This work was supported in part by Public Health Service grantA123719 from the National Institute of Allergy and InfectiousDiseases.

LITERATURE CITED1. Braithwaite, A. W., H.-W. Sturzbecher, C. Addison, C. Palmer,

K. Rudge, and J. R. Jenkins. 1987. Mouse p53 inhibits SV40origin-dependent DNA replication. Nature (London) 329:458-460.

2. Carroll, R., and E. G. Gurney. 1982. Time-dependent matura-tion of the simian virus 40 large T antigen-p53 complex studiedby using monoclonal antibodies. J. Virol. 44:565-573.

3. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: afast and simple method for sequencing plasmid DNA. DNA 4:165-170.

4. Clark, R., M. Tevethia, and R. Tjian. 1984. The ATPase activityof SV40 large T antigen, p. 363-368. In G. Vande Woude, A.Levine, W. Topp, and J. Watson (ed.), Cancer cells, vol. 2.Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

5. Dean, F. B., P. Bullock, Y. Murakami, C. R. Wobbe, L.Weissbach, and J. Hurwitz. 1987. Simian virus 40 DNA replica-tion: SV40 large T antigen unwinds DNA containing the SV40origin of replication. Proc. Natl. Acad. Sci. USA 84:16-20.

6. Eliyahu, D., A. Raz, P. Gruss, D. Givol, and M. Oren. 1984.Participation of p53 cellular tumor antigen in transformation ofnormal embryonic cells. Nature (London) 312:646-649.

7. Estes, M. K., S. E. Crawford, M. E. Penaranda, B. L. Petrie,J. W. Burns, W.-K. Chan, B. Ericson, G. E. Smith, and M. D.Summers. 1987. Synthesis and immunogenicity of the rotavirusmajor capsid antigen using a baculovirus expression system. J.Virol. 61:1488-1494.

8. Fanning, E., B. Nowak, and C. Burger. 1981. Detection andcharacterization of multiple forms of simian virus 40 large Tantigen. J. Virol. 37:92-102.

9. Gannon, J. V., and D. P. Lane. 1987. p53 and DNA polymerasealpha compete for binding to SV40 T antigen. Nature (London)329:456-458.

10. Gluzman, Y., H. Reichl, and D. Solnick. 1982. Helper-freeadenovirus type 5 vectors, p. 187-192. In Y. Gluzman, (ed.),Eucaryotic viral vectors. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.

11. Grasser, F. A., K. Mann, and G. Walter. 1987. Removal ofserine phosphates from simian virus 40 large T antigen increasesits ability to stimulate DNA replication in vitro but has no effecton ATPase or DNA binding. J. Virol. 61:3373-3380.

12. Greenfield, C., G. Patel, S. Clark, N. Jones, and M. D. Water-field. 1988. Expression of the human EGF receptor with ligandstimulatable kinase activity in insect cells using a baculovirusvector. EMBO J. 7:139-146.

13. Gurney, E. G., R. Harrison, and J. Fenno. 1980. Monoclonalantibodies against simian virus 40 T antigens: evidence fordistinct subclasses of large T antigen and for similarities amongnon-viral T antigens. J. Virol. 34:752-763.

14. Gurney, E. G., S. Tamowski, and W. Deppert. 1986. Antigenicbinding sites of monoclonal antibodies specific for simian virus40 large T antigen. J. Virol. 57:1168-1172.

15. Harlow, E., L. V. Crawford, D. C. Pim, and N. M. Williamson.1981. Monoclonal antibodies specific for simian virus 40 tumorantigens. J. Virol. 39:861-869.

16. Hu, S.-L., S. G. Kosowski, and K. F. Schaaf. 1987. Expressionof envelope glycoproteins of human immunodeficiency virus byan insect virus vector. J. Virol. 61:3617-3620.

17. Jeang, K.-T., C.-Z. Giam, M. Nerenberg, and G. Khoury. 1987.Abundant synthesis of functional human T-cell leukemia virustype I p40x protein in eucaryotic cells by using a baculovirusexpression vector. J. Virol. 61:708-713.

18. Jeang, K.-T., M. Holmgren-Konig, and G. Khoury. 1987. Abaculovirus vector can express intron-containing genes. J. Vi-rol. 61:1761-1764.

19. Jenkins, J., K. Rudge, P. Chumakov, and G. Currie. 1985. Thecellular oncogene p53 can be activated by mutagenesis. Nature(London) 317:816-818.

20. Jenkins, J., K. Rudge, and G. Currie. 1984. Cellular immortal-ization by a cDNA clone encoding the transformation-associ-ated phosphoprotein p53. Nature (London) 312:651-654.

21. Kaczmarek, L., M. Oren, and R. Baserga. 1986. Cooperationbetween the p53 protein tumor antigen and platelet-poor plasmain the induction of cellular DNA synthesis. Exp. Cell Res. 162:268-272.

22. Kuroda, K., C. Hauser, R. Rott, H.-D. Klenk, and W. Doerfler.1986. Expression of the influenza virus haemagglutinin in insectcells by a baculovirus vectors. EMBO J. 5:1359-1365.

23. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

24. Lee, H. H., and L. K. Miller. 1978. Isolation of genotypicvariants of Autographa californica nuclear polyhedrosis virus.J. Virol. 27:754-767.

25. Lucknow, V. A., and M. D. Summers. 1988. Trends in thedevelopment of baculovirus expression vectors. Bio-Tech-nology 6:47-55.

26. Madisen, L., B. Travis, S.-L. Hu, and A. F. Purchio. 1987.Expression of the human immunodeficiency virus gag gene ininsect cells. Virology 158:248-250.

27. Maeda, S., T. Kawai, M. Obinata, H. Fujiwara, T. Horiuchi, Y.Saeki, Y. Sato, and M. Furusawa. 1985. Production of humanalpha-interferon in silkworm using a baculovirus vector. Nature(London) 315:592-594.

28. McCormick, F., and E. Harlow. 1980. Association of a murine53,000-dalton phosphoprotein with simian virus 40 large Tantigen in transformed cells. J. Virol. 34:213-224.

29. Meek, D. W., and W. Eckhart. 1988. Phosphorylation of p53 innormal and simian virus 40-transformed NIH 3T3 cells. Mol.Cell. Biol. 8:461-465.

30. Michalovitz, D., D. Eliyahu, and M. Oren. 1986. Overproductionof protein p53 contributes to simian virus 40-mediated transfor-mation. Mol. Cell. Biol. 6:3531-3536.

31. Miller, D. W., P. Safer, and L. K. Miller. 1986. An insectbaculovirus host-vector system for high level expression offoreign genes, p. 277-298. In J. K. Setlow and A. Hollander,(ed.), Genetic engineering, vol. 8. Plenum Publishing Corp.,New York.

32. Miller, L. K. 1987. Baculoviruses for foreign gene expression ininsect cells, p. 457-465. In R. Rodriguez, and D. Denhardt (ed.),Vectors: a survey of molecular cloning vectors and their uses.Butterworth's, Stoneham, Mass.

32a.Miller, L. K. 1988. Baculoviruses as gene expression vectors.Annu. Rev. Microbiol. 42:177-179.

33. Miyajima, A., J. Schreurs, K. Otsu, A. Kondo, K.-I. Arai, and S.Maeda. 1987. Use of the silkworm, Bombyx mori, and an insectbaculovirus vector for high-level expression and secretion ofbiologically active mouse interleukin-3. Gene 58:273-281.

34. Miyamoto, C., G. E. Smith, J. Farrell-Towt, R. Chizzonite,M. D. Summers, and G. Ju. 1985. Production of human c-mycprotein in insect cells infected with a baculovirus expressionvector. Mol. Cell. Biol. 5:2860-2865.

J. VIROL.


35. Mohr, I. J., B. Stillman, and Y. Gluzman. 1987. Regulation ofSV40 DNA replication by phosphorylation of T antigen. EMBOJ. 6:153-160.

36. Ollo, R., and T. Maniatis. 1987. Drosophila Kruppel geneproduct produced in a baculovirus expression system is anuclear phosphoprotein that binds DNA. Proc. Natl. Acad. Sci.USA 84:5700-5704.

37. O'Reilly, D. R. 1986. p53 and transformation by SV40. Biol. Cell57:187-196.

38. Oren, M., W. Maltzman, and A. J. Levine. 1981. Post-transla-tional regulation of the 54K cellular tumor antigen in normal andtransformed cells. Mol. Cell. Biol. 1:101-110.

39. Parada, L., H. Land, R. Weinberg, D. Wolf, and V. Rotter. 1984.Cooperation between gene encoding p53 tumour antigen and rasin cellular transformation. Nature (London) 312:649-651.

40. Possee, R. D. 1986. Cell-surface expression of influenza virushaemagglutinin in insect cells using a baculovirus vector. VirusRes. 5:43-59.

41. Potter, K. N., and L. K. Miller. 1980. Transfection of twoinverterbrate cell lines with DNA of Autographa californicanuclear polyhedrosis virus. J. Invertebr. Pathol. 36:431-432.

42. Rice, W. C., H. E. Lorimer, C. Prives, and L. K. Miller. 1987.Expression of polyomavirus large T antigen by using a baculo-virus vector. J. Virol. 61:1712-1716.

43. Rigby, P., and D. Lane. 1983. The structure and function ofsimian virus 40 large T antigen. Adv. Viral Oncol. 3:31-57.

44. Rodriguez, R., and D. Denhardt (ed.). 1987. Vectors: a survey ofmolecular cloning vectors and their uses. Butterworth's, Stone-ham, Mass.

45. Samad, A., C. Anderson, and R. Carroll. 1986. Mapping ofphosphomonoester and apparent phosphodiester bonds of theoncogene product p53 from simian virus 40-transformed 3T3cells. Proc. Natl. Acad. Sci. USA 83:897-901.

46. Scheidtmann, K. H. 1986. Phosphorylation of SV40 large Tantigen: cytoplasmic and nuclear phosphorylation sites differ intheir metabolic stability. Virology 150:85-95.

47. Scheidtmann, K. H., B. Echle, and G. Walter. 1982. Simian virus40 large T antigen is phosphorylated at multiple sites clusteredin two separate regions. J. Virol. 44:116-133.

48. Scheidtmann, K. H., M. Hardung, B. Echle, and G. Walter.1984. DNA-binding activity of simian virus 40 large T antigencorrelates with a distinct phosphorylation state. J. Virol. 50:1-12.

49. Scheidtmann, K. H., A. Kaiser, A. Carbone, and G. Walter.1981. Phosphorylation of threonine in the proline-rich carboxy-

terminal region of simian virus 40 T antigen. J. Virol. 38:59-69.50. Scheller, A., L. Covey, B. Barnet, and C. Prives. 1982. A small

subclass of SV40 T antigen binds to the origin of replication.Cell 29:375-383.

51. Schmeig, F., and D. T. Simmons. 1984. Intracellular location andkinetics of complex formation between simian virus 40 T antigenand cellular protein p53. J. Virol. 52:350-355.

52. Simmons, D. T., W. Chou, and K. Rodgers. 1986. Phosphoryla-tion down regulates the DNA-binding activity of simian virus 40T antigen. J. Virol. 60:888-894.

53. Smale, S. T., and R. Tjian. 1986. T-antigen-DNA polymerasealpha complex implicated in simian virus 40 DNA replication.Mol. Cell. Biol. 6:4077-4087

54. Smith, G. E., G. Ju, B. L. Ericson, J. Moschera, H.-W. Lahm,R. Chizzonite, and M. D. Summers. 1985. Modification andsecretion of human interleukin-2 produced in insect cells by abaculovirus expression vector. Proc. Natl. Acad. Sci. USA 82:8404-8408.

55. Smith, G. E., M. D. Summers, and M. J. Fraser. 1983. Produc-tion of human beta-interferon in insect cells infected with abaculovirus expression vector. Mol. Cell. Biol. 3:2156-2165.

56. St. Angelo, C., G. E. Smith, M. D. Summers, and R. M. Krug.1987. Two of the three influenza viral polymerase proteinsexpressed using baculovirus vectors form a complex in insectcells. J. Virol. 61:361-365.

57. Stahl, H., P. Droge, and R. Knippers. 1986. DNA helicaseactivity of SV40 large tumor antigen. EMBO J. 5:1939-1944.

58. Tegtmeyer, P., K. Rundell, and J. K. Collins. 1977. Modificationof simian virus 40 protein A. J. Virol. 21:647-657.

59. Tooze, J. 1981. DNA tumor viruses, p. 125-296. In J. Tooze(ed.), Molecular biology of tumor viruses, 2nd ed. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

60. Van Roy, F., L. Fransen, and W. Fiers. 1981. Phosphorylationpatterns of tumor antigens in cells lytically infected or trans-formed by simian virus 40. J. Virol. 40:28 44.

61. Vaughn, J. L., R. H. Goodwin, G. L. Thompkins, and P.McCawley. 1977. The establishment of two cell lines from theinsect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vi-tro 13:213-217.

62. Wade-Evans, A., and J. Jenkins. 1985. Precise epitope mappingof the murine transformation associated protein p53. EMBO J.4:699-706.

63. Yewdell, J. W., J. V. Gannon, and D. P. Lane. 1986. Monoclonalantibody analysis of p53 expression in normal and transformedcells. J. Virol. 59:444 452.

VOL. 62, 1988

Expression and complex formation of simian virus 40 large T antigen ...

Documents

Transcript of Expression and complex formation of simian virus 40 large T antigen ...