EVOLUTION Mrs. Knopke Fullerton Union High School.
-
Upload
willis-owen -
Category
Documents
-
view
217 -
download
0
Transcript of EVOLUTION Mrs. Knopke Fullerton Union High School.
EVOLUTIONEVOLUTION
Mrs. Knopke
Fullerton Union High School
California State StandardCalifornia State Standard
3.3. Biological evolution accounts for the Biological evolution accounts for the diversity of species developed through diversity of species developed through gradual processes over many gradual processes over many generations. generations.
c.c. Independent lines of evidence from Independent lines of evidence from geology, fossils, and comparative geology, fossils, and comparative anatomy provide the bases for the anatomy provide the bases for the theory of evolution. theory of evolution.
EvolutionEvolution
What is it?What is it?
EvolutionEvolution
Simply stated, evolution is a Simply stated, evolution is a change in a lineage of change in a lineage of
organisms through time.organisms through time.
Root Word - EvolutRoot Word - Evolut
An unrollingAn unrolling
Types of EvidenceTypes of Evidencefor Evolutionfor Evolution
FossilsFossilsComparative AnatomyComparative AnatomyEmbryologyEmbryologyBiochemistryBiochemistry
What is a Fossil?What is a Fossil?
Any trace of an Any trace of an organism that organism that lived long ago.lived long ago.
Paleontologists also study fossils to gain Paleontologists also study fossils to gain knowledge about ancient climate and knowledge about ancient climate and geography.geography.
Paleontologists-Detectives to the pastPaleontologists-Detectives to the past
By studying the condition, position, and By studying the condition, position, and location of rocks and fossils, geologists and location of rocks and fossils, geologists and paleontologists can make deductions about paleontologists can make deductions about the geography of past environments.the geography of past environments.
For fossils to form, For fossils to form, organisms usually have to organisms usually have to be buried in mud, sand, be buried in mud, sand, or clay soon after they or clay soon after they die.die.
Fossil formationFossil formation
Most fossils are found in sedimentary rocks. Most fossils are found in sedimentary rocks. These rocks form at relatively low temperatures These rocks form at relatively low temperatures and pressures that may prevent damage to the and pressures that may prevent damage to the organism.organism.
Fossils are not usually found in other types of Fossils are not usually found in other types of rock because of the ways those rocks form. rock because of the ways those rocks form. For example, the conditions under which For example, the conditions under which metamorphic rocks form often destroy any metamorphic rocks form often destroy any fossils that were in the original sedimentary fossils that were in the original sedimentary rock.rock.
Fossil formationFossil formation
Few organisms become fossilized because, Few organisms become fossilized because, without burial, bacteria and fungi immediately without burial, bacteria and fungi immediately decompose their dead bodies. Occasionally, decompose their dead bodies. Occasionally, however, organisms do become fossils in a however, organisms do become fossils in a process that usually takes many years.process that usually takes many years.
The Fossilization ProcessThe Fossilization Process
The Fossilization ProcessThe Fossilization Process• A Protoceratops drinking at a river falls into the water and drowns• Sediments from upstream
rapidly cover the body, slowing its decomposition. Minerals from the sediments seep into the body.
• Over time, additional layers of sediment compress the sediments around the body, forming rock. Minerals eventually replace all the body’s bone material.
• Earth movements or erosion may expose the fossil millions of years after it formed.
Scientists use a variety of methods to determine Scientists use a variety of methods to determine the age of fossils. One method is a technique the age of fossils. One method is a technique called relative dating.called relative dating.
Relative datingRelative dating
If the rock layers If the rock layers have not been have not been disturbed, the disturbed, the layers at the layers at the surface must be surface must be younger than the younger than the deeper layers.deeper layers.
The Fossil RecordThe Fossil Record
Darwin’s views were influenced by Darwin’s views were influenced by fossilsfossils, , the relics or impressions of organisms from the relics or impressions of organisms from the past, mineralized in the past, mineralized in sedimentary sedimentary rocksrocks.. Sedimentary rocks form when mud and sand settle to Sedimentary rocks form when mud and sand settle to
the bottom of seas, lakes, and marshes.the bottom of seas, lakes, and marshes. New layers of sediment cover older ones, creating New layers of sediment cover older ones, creating
layers of rock called strata.layers of rock called strata. Fossils within layers show that a succession of Fossils within layers show that a succession of
organisms have populated Earth throughout time.organisms have populated Earth throughout time.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 22.2 Fig. 22.4
Fossils are the preserved remnants or Fossils are the preserved remnants or impressions left by organisms that lived in impressions left by organisms that lived in the past.the past. In essence, they are the historical documents In essence, they are the historical documents
of biology.of biology. The The fossil recordfossil record is the ordered array in which is the ordered array in which
fossils appear within sedimentary rocks.fossils appear within sedimentary rocks. These rocks record the passing of geological time.These rocks record the passing of geological time.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
The organic material in a dead organism The organic material in a dead organism usually decays rapidly, but hard parts that usually decays rapidly, but hard parts that are rich in minerals (such as bones, teeth, are rich in minerals (such as bones, teeth, shells) may remain as fossils.shells) may remain as fossils.
Under the right conditions minerals Under the right conditions minerals dissolved in groundwater seep into the dissolved in groundwater seep into the tissues of dead organisms, replace its tissues of dead organisms, replace its organic material, and organic material, and create a cast in the create a cast in the shape of the organism.shape of the organism.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 25.1c
Trace fossils consist of footprints, Trace fossils consist of footprints, burrows, or other impressions left in burrows, or other impressions left in sediments by the activities of animals.sediments by the activities of animals.
These rocks are in These rocks are in essence fossilized essence fossilized behavior.behavior. These dinosaur tracksThese dinosaur tracks
provide informationprovide informationabout its gait.about its gait.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 25.1f
Rarer than mineralized fossils are those Rarer than mineralized fossils are those that retain organic material.that retain organic material.
These are sometimes discovered as thin These are sometimes discovered as thin films between layers of sandstone or films between layers of sandstone or shale.shale. As an example, plant leaves millions of As an example, plant leaves millions of
years old have been discovered that are still years old have been discovered that are still green with chlorophyll.green with chlorophyll.
The most commonThe most commonfossilized material isfossilized material ispollen, which has apollen, which has ahard organic casehard organic casethat resiststhat resistsdegradation.degradation.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Comparative AnatomyComparative AnatomyHomoHomologous Structureslogous Structures
homo-homo-
SAMESAME
Comparative AnatomyComparative AnatomyHomoHomologous Structureslogous Structures
Comparative AnatomyComparative Anatomy Not all similarity is homology…Not all similarity is homology…
Remember: homologous = Remember: homologous = common ancestorcommon ancestor
Comparative AnatomyComparative Anatomy
AnaAnalogous Structureslogous Structures
ana- NOTana- NOT
Comparative AnatomyComparative Anatomy
AnaAnalogous Structureslogous Structures
Mammals
Distant rat-like common ancestor
Comparative AnatomyComparative Anatomy
AnaAnalogous Structureslogous Structures
Comparative AnatomyComparative Anatomy
Vestigial StructuresVestigial Structures
TOP 10 Useless Limbs TOP 10 Useless Limbs (and other Vestigial Organs)(and other Vestigial Organs)
10. The wings on flightless birds.10. The wings on flightless birds.
http://www.livescience.com/animalworld/top10_vestigial_organs.html
1. The human appendix.1. The human appendix.
2. Male breast tissue and nipples.2. Male breast tissue and nipples.
3. Mating behavior of virgin whiptail lizards.3. Mating behavior of virgin whiptail lizards.
4. Sexual organs of dandelions.4. Sexual organs of dandelions.
5. Wisdom teeth in humans.5. Wisdom teeth in humans.
6. The blind fish 6. The blind fish Astyanax mexicanusAstyanax mexicanus..
7. The human tailbone (coccyx).7. The human tailbone (coccyx).
8. Erector pili and body hair.8. Erector pili and body hair.
9. Hind leg bones in whales and snakes.9. Hind leg bones in whales and snakes.
Evidence from EmbryologyEvidence from Embryology
58 days old 166 days old
4 mm long 6 cm long
An Elephant Embryo
Comparative Embryology
EmbryosEmbryos
A fish
B bird
C pig
D human
Comparative EmbryologyComparative Embryology
Can you guess which embryo belongs to…
The human?
The fish?
The pig?
The bird?
Biochemical Evidence Biochemical Evidence
Looking at an organism Looking at an organism and the relationship and the relationship with other organisms at with other organisms at the DNA level.the DNA level.
Evidence from BiochemistryEvidence from BiochemistryAmino acids and enzymes Amino acids and enzymes
(proteins)(proteins)Ex: Cytochrome cEx: Cytochrome c
Biochemical Similarities of Organisms
Comparison of Organisms
Percent Substitutions of Amino Acids in
Cytochrome c Residues
Two orders of mammals
Birds vs. mammals
Amphibians vs. birds
Fish vs. land vertebrates
Insects vs. vertebrates
Algae vs. animals
5 and 10
8-12
14-18
18-22
27-34
57
Molecular EvidenceMolecular Evidence
Molecular EvidenceMolecular Evidence
Evidence from BiochemistryEvidence from Biochemistry
Factoid: Roundworms share 25% of their genes with humans!
On a molecular level, the On a molecular level, the DNA code links living DNA code links living organisms to common organisms to common ancestors.ancestors.
Evidence for EvolutionEvidence for Evolution
Today, scientists combine data fromToday, scientists combine data from fossils, comparative anatomy, fossils, comparative anatomy, embryology, embryology, and and biochemistry biochemistry in in order to interpret the order to interpret the evolutionary evolutionary relationshipsrelationships among species. among species.
Relative Age of FossilsRelative Age of Fossils
Radioactive DatingRadioactive Dating How to date a fossil (without spending a
fortune for dinner and flowers) Have you wondered how the age of fossils are determined? There are several different methods scientists use to determine age of fossils. Sometimes, it is possible to determine age directly from the fossil. Many times however, fossils are to old to have their age directly measured. Instead, age can be determined from radioactive elements occuring within rock found in association with the fossils.
Over time, radioactive “parent” isotopes Over time, radioactive “parent” isotopes are converted at a steady decay rate to are converted at a steady decay rate to “daughter” isotopes.“daughter” isotopes.
The rate ofThe rate ofconversion isconversion isindicated as theindicated as thehalf-life, thehalf-life, thetime it takestime it takesfor 50% offor 50% ofthe isotopethe isotopeto decayto decay..
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin CummingsFig. 25.2
MimicryMimicry How Does Mimicry Help Animals?How Does Mimicry Help Animals?
Usually, an animal will MIMIC another Usually, an animal will MIMIC another to avoid predators. If it can to avoid predators. If it can trick its enemy into thinking it is trick its enemy into thinking it is something less tasty or more something less tasty or more dangerous, it will survive dangerous, it will survive
This tropical saturniid moth displays eyespots on This tropical saturniid moth displays eyespots on its hindwings when threatened. This is a its hindwings when threatened. This is a "dishonest" signal, in contrast to the "honest" "dishonest" signal, in contrast to the "honest" signal of the Io moth in the preceding image.signal of the Io moth in the preceding image.
MimicryMimicry A Lonomia moth A Lonomia moth
resembles a dead resembles a dead leaf on the forest leaf on the forest floor of the floor of the Monteverde Cloud Monteverde Cloud Forest in Costa Forest in Costa Rica, her head at Rica, her head at the left and a the left and a simulated leaf vein simulated leaf vein running from wingtip running from wingtip to wingtip.to wingtip.
In the lowland rain forest of the Peruvian In the lowland rain forest of the Peruvian Amazon, a "bird dropping" on a leaf Amazon, a "bird dropping" on a leaf turns out to be a caterpillar.turns out to be a caterpillar.
Munching on a plant Munching on a plant stem in Costa Rica's stem in Costa Rica's Monteverde Cloud Monteverde Cloud Forest Reserve, this Forest Reserve, this Xylophanes Xylophanes caterpillar has such caterpillar has such tiny eyes that you tiny eyes that you would need a hand would need a hand lens to see them. lens to see them. The red "eyes" and The red "eyes" and pointed "stinger" are pointed "stinger" are both fakeboth fake..
CamouflageCamouflage A masked A masked
treefrog seems to treefrog seems to be strumming a be strumming a stem as we watch stem as we watch him on the slopes him on the slopes of Costa Rica's of Costa Rica's Penas Blancas Penas Blancas cloud forestcloud forest
CamouflageCamouflage An animal uses An animal uses camouflagecamouflage to blend in to blend in
with its environment. Camouflage is the with its environment. Camouflage is the use of color, pattern, and shape to look use of color, pattern, and shape to look like the things around you like the things around you
A gravid female A gravid female katydid blends with katydid blends with the tropical the tropical vegetation in the vegetation in the lowland Amazon lowland Amazon rain forest of Peru. rain forest of Peru. Her wings mimic Her wings mimic the mottling of the the mottling of the surrounding leaves, surrounding leaves, and she holds even and she holds even her long antennae her long antennae still as we take this still as we take this available-light photo available-light photo
Physiological EvidencePhysiological Evidence
A change in the organisms metabolic A change in the organisms metabolic processes:processes:
Weeds ability to become resistant to Weeds ability to become resistant to herbicides.herbicides.
Bacteria’s ability to become resistant to Bacteria’s ability to become resistant to antibiotics.antibiotics.
Venom of a snakeVenom of a snake
Structural AdaptationsStructural Adaptations
Take many different forms –Take many different forms – ThornsThorns teethteeth hairhair beaksbeaks colorcolor TailsTails
Possible AncestralLasan finch
Amakihi Extinct mamo
Crestedhoneycreeper
Akialoa
Akepa
Akiapolaau LiwiMaui parrotbill
Apapane
Ou
Grosbeak finch
PalilaAkikiki
Niihau
Kauai
Oahu
Lanai
Molokai
Maui
KahoolaweHawaii
Diversity in new environmentsDiversity in new environments
Charles Darwin – Father of Charles Darwin – Father of Modern Scientific ThoughtModern Scientific Thought
Raised on a farm Raised on a farm Was an avid Was an avid
outdoorsman (fished outdoorsman (fished and hunted), collected and hunted), collected bugs, taxidermistbugs, taxidermist
Influenced greatly buy Influenced greatly buy his grandfather his grandfather Erasmus DarwinErasmus Darwin Was a Physician, Was a Physician,
Poet and early Poet and early EvolutionistEvolutionist
Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Family plans were to Family plans were to
have him become a have him become a doctor like his doctor like his grandfather and father grandfather and father
After 2 years of After 2 years of Medical School he Medical School he dropped outdropped out Operations were Operations were
bloody and had bloody and had problems with faintingproblems with fainting
Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Parents sent him to Parents sent him to
Divinity School for 3 Divinity School for 3 years to become a years to become a clergy in the Church of clergy in the Church of England England Left because he Left because he
preferred to be preferred to be outdoorsoutdoors
As any parent would As any parent would do, they worried about do, they worried about what they were going what they were going to do with their sonto do with their son
Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d
Darwin’s Botany Darwin’s Botany professor at Cambridge professor at Cambridge (John Stevens Henslow) (John Stevens Henslow) was contacted about a job was contacted about a job as a naturalist for a shipas a naturalist for a ship
He thought of Darwin for He thought of Darwin for the positionthe position
Because of Henslow’s Because of Henslow’s recommendation, Darwin recommendation, Darwin was hired as the was hired as the Naturalist aboard the Naturalist aboard the H.M.S. Beagle and as a H.M.S. Beagle and as a companion for Captain companion for Captain FitzroyFitzroy
Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Darwin had one major Darwin had one major problem on the voyageproblem on the voyage He was seasick for almost He was seasick for almost
the entire voyage the entire voyage
Because of this, every time Because of this, every time he had a chance to go he had a chance to go ashore, he didashore, he did
While away from the ship, While away from the ship, he collected plants and he collected plants and animals to send back to animals to send back to England and made England and made meticulous drawings of meticulous drawings of those he didn’t collectthose he didn’t collect
Cape Verde Islands
Galapagos Islands
Lamarckism:Lamarckism: Inheritance Inheritance of Acquired Traitsof Acquired Traits
““Organisms by striving to adapt to their Organisms by striving to adapt to their environment acquire adaptations during environment acquire adaptations during their lives that are passed on to its their lives that are passed on to its offspring”offspring” New parts from no parts and use disuseNew parts from no parts and use disuse
Pangenetic view of developmentPangenetic view of development ““Gemules” modify the preformed embryo in Gemules” modify the preformed embryo in
the males spermthe males sperm
Inheritance of Acquired Inheritance of Acquired TraitsTraits
Observation #1: All Observation #1: All species have such great species have such great potential fertility that their potential fertility that their population size would population size would increase exponentially if all increase exponentially if all individuals that are born individuals that are born reproduced successfully.reproduced successfully.
Observation #2: Observation #2: Populations tend to remain Populations tend to remain stable in size,stable in size,except for seasonal except for seasonal fluctuations.fluctuations.
Observation #3: Environmental resources are Observation #3: Environmental resources are limited.limited.
Fig. 22.8
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Observation #4: Individuals of a population Observation #4: Individuals of a population vary extensively in their characteristics; no vary extensively in their characteristics; no two individuals are exactly alike.two individuals are exactly alike.
Observation #5: Much of this variation is Observation #5: Much of this variation is heritable.heritable.
Fig. 22.9
•Inference #1: Production of more individuals than the environment can support leads to a struggle for existence among the individuals of a population, with only a fraction of the offspring surviving each generation.
Inference #2Inference #2: Survival in the struggle for : Survival in the struggle for existence is not random, but depends in existence is not random, but depends in part on the hereditary constitution of the part on the hereditary constitution of the individuals. individuals. Those individuals whose inherited Those individuals whose inherited
characteristics best fit them to their characteristics best fit them to their environment are likely to leave more offspring environment are likely to leave more offspring than less fit individuals.than less fit individuals.
Inference #3Inference #3: This unequal ability of : This unequal ability of individuals to survive and reproduce will individuals to survive and reproduce will lead to a gradual change in a population, lead to a gradual change in a population, with favorable characteristics accumulating with favorable characteristics accumulating over the generations.over the generations.
Causes of Genetic Causes of Genetic Variation in a PopulationVariation in a Population
RecombinationRecombination
Gene Flow - MigrationGene Flow - Migration
Genetic DriftGenetic Drift
MutationsMutations
Causes of Genetic Causes of Genetic Variation in a PopulationVariation in a Population
RecombinationRecombination
Gene Flow – MigrationGene Flow – Migration
Genetic DriftGenetic Drift
MutationsMutations
Gene FlowGene Flow
The loss or gain of alleles in a population The loss or gain of alleles in a population due to the migration of fertile individuals due to the migration of fertile individuals or gametes between populations. or gametes between populations. If too much gene flow, populations become If too much gene flow, populations become
homogeneoushomogeneous
Gene FlowGene Flow
10 Red : 0 White6 Red : 4 White6 Red : 4 White
Gene FlowGene Flow
10 Red : 2 White10 Red : 0 White10 Red : 0 White
Causes of Genetic Causes of Genetic Variation in a PopulationVariation in a Population
RecombinationRecombination
Gene Flow - MigrationGene Flow - Migration
Genetic DriftGenetic Drift
MutationsMutations
Genetic DriftGenetic Drift
Changes in the gene pool of a small Changes in the gene pool of a small population due to chance. population due to chance.
Important to small populations.Important to small populations. The Founder EffectThe Founder Effect
New colony being populated by a few New colony being populated by a few individualsindividuals Important on islandsImportant on islands
The BottleneckThe Bottleneck Diseases or other catastrophes cause the Diseases or other catastrophes cause the
population to dramatically decrease in numberspopulation to dramatically decrease in numbers
Genetic DriftGenetic Drift
A change in a population’s allele A change in a population’s allele frequency due to chance. Important to frequency due to chance. Important to small populations.small populations. The Founder EffectThe Founder Effect
New colony being populated by a few New colony being populated by a few individualsindividuals Important on islandsImportant on islands
The BottleneckThe Bottleneck Natural catastrophes cause the population to Natural catastrophes cause the population to
dramatically decrease in numbersdramatically decrease in numbers
The BottleneckThe Bottleneck
The BottleneckThe Bottleneck
Flood kills Flood kills most of most of the the individualsindividuals
The BottleneckThe Bottleneck
Causes of Genetic Causes of Genetic Variation in a PopulationVariation in a Population
RecombinationRecombination
Gene Flow - MigrationGene Flow - Migration
Genetic DriftGenetic Drift
MutationsMutations
MutationsMutations
Mutations:Mutations: Any change in the genetic Any change in the genetic sequence of DNAsequence of DNA
Most Mutations are NeutralMost Mutations are Neutral Replicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic code Intron/Exon formation in mRNAIntron/Exon formation in mRNA Masked by dominant geneMasked by dominant gene
On average, mutations occur 1 out of a On average, mutations occur 1 out of a billion base pairs; thus we carry 3 mutations billion base pairs; thus we carry 3 mutations in our genetic codein our genetic code
Mutations:Mutations: Any change in the genetic Any change in the genetic sequence of DNAsequence of DNA
Most Mutations are NeutralMost Mutations are Neutral Replicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic code Intron/Exon formation in mRNAIntron/Exon formation in mRNA Masked by dominant geneMasked by dominant gene
Genetic RedundancyGenetic Redundancy
Genetic RedundancyGenetic Redundancy
MetSerValStopMetSerValStop
AUGUCAGUUUAGAUGUCAGUUUAG
MutationsMutations
AUGUCAGUAUGUCAGUAAUAUAAA
MetSerValStopMetSerValStop
Mutations:Mutations: Any change in the genetic Any change in the genetic sequence of DNAsequence of DNA
Most Mutations are NeutralMost Mutations are Neutral Replicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic code Intron/Exon formation in mRNAIntron/Exon formation in mRNA Masked by dominant geneMasked by dominant gene
Introns/ExonsIntrons/Exons
Mutations:Mutations: Any change in the genetic Any change in the genetic sequence of DNAsequence of DNA
Most Mutations are NeutralMost Mutations are Neutral Replicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic code Intron/Exon formation in mRNAIntron/Exon formation in mRNA Masked by dominant geneMasked by dominant gene
Sickle-cell AnemiaSickle-cell Anemia First described by a Chicago First described by a Chicago
MD in the early 1900’s.MD in the early 1900’s. Caused by a SINGLE mutation Caused by a SINGLE mutation
(change second base of the (change second base of the codon from uracil to adenine – codon from uracil to adenine – from valine to glutamate) at from valine to glutamate) at the sixth position of the beta the sixth position of the beta chain.chain.
Causes the hemoglobin Causes the hemoglobin molecule to lose their molecule to lose their flexibility and become rigid.flexibility and become rigid.
Under low oxygen condition, Under low oxygen condition, the RBC will become sickle in the RBC will become sickle in shape.shape.
These sickled RBC are then These sickled RBC are then destroyed.destroyed.
Sickle-cell AnemiaSickle-cell Anemia A recessive gene that A recessive gene that
follows “Mendelian follows “Mendelian Inheritance”.Inheritance”.
Homozygous recessive Homozygous recessive condition is “Sickle-cell condition is “Sickle-cell Anemia” with only a Anemia” with only a 20% chance of 20% chance of surviving to puberty.surviving to puberty.
Heterozygous condition Heterozygous condition is “Sicklemia” and is “Sicklemia” and individuals will only individuals will only become ill under become ill under extreme conditions, e.g. extreme conditions, e.g. high altitudes, exertion.high altitudes, exertion.
Three Forms of Natural Three Forms of Natural SelectionSelection
StabilizingStabilizing
DirectionalDirectional
DisruptiveDisruptive
Stabilizing SelectionStabilizing Selection
Directional SelectionDirectional Selection
Disruptive SelectionDisruptive Selection
Allopatric SpeciationAllopatric Speciation
From Ricklefs, R.E. 2001. The Economy of Nature. W.H. Freeman. New York.
Mammals
Distant rat-like common ancestor
What happens when 2 What happens when 2 “new” species come in “new” species come in contact again?contact again?
Post-zygotic BarriersPost-zygotic Barriers
Pre-zygotic BarriersPre-zygotic Barriers
Which ones happen are a function of timeWhich ones happen are a function of time
Once these types of barriers are in place, two Once these types of barriers are in place, two species can overlap in space, and remain true species can overlap in space, and remain true biological speciesbiological species
Post-zygotic barriersPost-zygotic barriers
Hybrid sterility - hybrids can't Hybrid sterility - hybrids can't produce functional gametes produce functional gametes
Hybrid Hybrid breakdownbreakdown - hybrids - hybrids never reach sexual maturity. never reach sexual maturity.
Hybrid Hybrid inviabilityinviability - offspring - offspring of hybrids are inviable.of hybrids are inviable.
Time Time IncreasingIncreasing
Pre-zygotic BarriersPre-zygotic Barriers
Gametic isolation - gametes fail Gametic isolation - gametes fail to uniteto unite
Structural isolation - mating is Structural isolation - mating is physically impossiblephysically impossible
Behavioral isolation - mates Behavioral isolation - mates recognize species specific sexual recognize species specific sexual signalssignals
Temporal isolation - mating Temporal isolation - mating occurs at different times. occurs at different times.
Habitat isolation - mating occurs Habitat isolation - mating occurs in different places in different places
Time IncreasingTime Increasing
Adaptive Radiation – Adaptive Radiation – Produces Homologous Produces Homologous structuresstructuresA Common AncestorA Common Ancestor
Convergent Radiation- Convergent Radiation- Species that are Species that are notnot closely related have closely related have similar traits in similar similar traits in similar environmentsenvironments
Homology or analogy?
You have probably noticed that dolphins and sharks both have a streamlined body shape with a triangular fin on the back and two side fins. However, the two animals also have many differences.
Sharks Dolphins
skeleton made of cartilageskeleton made of cartilage skeleton made of bone<> skeleton made of bone<>
use gills to get oxygen from the water in use gills to get oxygen from the water in which they swimwhich they swim
go to the surface and breathe go to the surface and breathe atmospheric air in through their blowholesatmospheric air in through their blowholes
don't nurse their youngdon't nurse their young do nurse their youngdo nurse their young
don't have hairdon't have hair do have hair — they are born with hair do have hair — they are born with hair around their "noses"around their "noses"
They may share the same basic They may share the same basic shape, but underneath their skins, shape, but underneath their skins, sharks and dolphins are very sharks and dolphins are very different! different!