Environmental Science & Engineering Magazine July-August 2014
-
Upload
environmental-science-and-engineering-magazine -
Category
Documents
-
view
226 -
download
0
description
Transcript of Environmental Science & Engineering Magazine July-August 2014
-
Advanced wastewater treatment helps stretch water supplies
Solving iron and manganese issues
Industrial wastewater treatment
Can coral reefs be saved?
ES&EsAnnual Guide to Government, Associations and Academic Institutions
AdvancedAdvancenced
www.esemag.comJuly/August 2014
-
And we couldnt have done it without you. Thats why we say were serving the best. Whatever the reason, were glad youre choosing us.
Again. And again.
Try our new easy pump selection tool at prominentpumps.ca.
SERV
ING
THE
BEST
.
1-888-709-9933www.prominentpumps.ca
SANSOMEQUIPMENT LIMITED
Industrial Pump SystemsIndustrial Pump Sy
Available from
-
Process Equipment for Wastewater, Biosolids & Biogas
Providing treatment solutions for more than 25 years.
Pro Aqua, Inc. carries a complete range of market leading and innovative products. Let us show you
what we can offer on your next project
Archimedes Screw Pumps
Screens Multi-Rake, Perf Plate, Drum, Travelling Band, Step, Climber, Vertical Pump Station Screens, Screenings Washer /Compactors
Grit Separation, Washing & Dewatering
Conveyors Shafted & Shaftless Screw, Belt
Blowers Rotary Screw, Rotary Lobe, Single Stage and Multistage Centrifugal, Turbo, Advanced Control, Rebuilds
Aeration Surface, Membrane & Ceram-ic, Fine & Coarse Bubble, Gas & Liquid Cleaning, DO Control, AlphaMeter
Mixers Anoxic & Swing Zones, Sludge Holding, Digester; Mechanical and Hydraulic
Tank Components Covers, Fabric Baf-fles, Troughs, Weirs, Scum Baffles, Skim-mers, Decanters, Swivel Joints, Telescoping Valves, Stamford Baffles, Launder Covers
Clarifiers Primary & Secondary, Circu-lar, Chain & Flight, Inclined Plate Settlers, Weir Washing
Biological SBR, MBR, RBC, MBBR, Oxidation Ditch, BioMag, CoMag
Polymer Liquid and Dry
Rotary Lobe Pumps & Grinders
Disinfection UV, Chlorine Scrubbers, Chlorine Gas Containment
Tertiary Filters Travelling Bridge, Disk, Membrane
Sludge Thickening & Dewatering Disk Thickener, Gravity Thickener, Filter Press, Screw Press
Anaerobic Digesters Sludge Condi-tioning, In-line Screening, Degritting, Membrane Gas Holders, Liquid Mixing, Nutrient Recovery
Sludge Drying Belt, Fluid Bed and Solar
Septage Receiving Screens, Dump Stations, Truck Access & ID, data gather-ing & equipment control
Sludge Treatment, Transport & Stor-age Cake Pumps, Silos, Sliding Frames, Live Bottom Hoppers, Push Floors, Truck Loading, Alkaline Stabilization
Odour Control Tank Covers, Chemical & Biological Treatment
CSO, Stormwater & Pump Stations Tipping Buckets, Bending Weirs, Flushing Gates, Flow Regulating, Vortex Valves, Storm Screens
Digester Gas Gas Holders, Gas Condi-tioning: chilling; compressing; and remov-al of moisture, sulphur, carbon dioxide and siloxane, complete Co-Generation facilities
T: (905) 864-9311 F: (905) 864-8469 www.proaquasales.com 7-264 Bronte St., S., Milton, ON L9T 5A3
We Are The Exclusive Suppliers For:
-
Publication Name Created By
Booked By Send Files To
Material Deadline RRU Contact
Size
Colour
PublicPuublicblicccaaPPubluubb caaPPuuubbliccaatiotiioon Nan NaNn Nattittiioonn N mmmeemmee BusiBuuusininneeessBBuuusineeessBBuuussiinneeessss inn VVVaass innn VVVaass innn VVVaannccooouuvvverrnnccooouuvveer CCrreatedreeaaatteeddCCrCrreeaaatteeddCrreeaaatteeddd BByyyByBy BByyyy RRRRU BrRUUU BraaaUU BBrBraaaRRRRUUU Braand Crenddd Cnd Crearreeaannd Creareeandd CCreaaativtivvvee //t vvee //ttivvvee / AATTTATTAAT
BooBooookkeeeddBBoooBookeeeddookkeeedd BByyBBByyBBByy CCooosssseteettttCCooosssseetttttCCooosssse teeee SeSeenend Findd FFFSend FindSeennd nd FFFilleesss TTes Tooles Tlesss Tol s TTToo Sarah.mSaaararahSarah.mmmSaaarrah.mh.mmSSaaarah.ra orris@coorrris@cs@@corroorrris@@ccss@@coossettessetteseetssetttossetteosssetssessetossettttteeo te ccomom..ccoomm
MaaatterriaaaMMMaaatteriaaaMMateriaMaatterr aal DDDeeeaadddldll DDeeeaaddlll DDDeeeaadddlliinneineeiinneeeineee 00707//00444//22077//0444//220077//00444//220011444001144444 RRRU ConU CoConnU ConRRRU CononRRRRU C ttataacctttacacctttaactt Brad TrBraBrad Traad TTrTrBrad Trd TTrB ibibbecbeckkbbbbeeckibbbeckec
SSiizzeeizizeSSizzee 88 112258.1258.125.112258..125125 25 x 1010 7755xx 1x 100.77757510.775 2250.39150.3910.39250.3913399.391250.39122 0.39 .2600.26000600 e00 e0 e266 0 eext.xt. 478xt. 4478xt 8. 78888888
ColCoColooloourouroulouurr 44c4cc4 brad.trbrad.trad tbrad.trrad.trribbeck@beck@eck@ckbbeck@ibbeec @b ec royalroyalroroyalrooyalroads.caads..ccaas.ads.ca
Explore the applied nature of the environment and sustainability professions through hands-on research examining environmental management, practice, communication and education, policy, and science.
Complete your bachelors or masters degree on campus, online, or choose a blend of online learning with on-campus residencies. Discover how the Royal Roads University experience is anything but ordinary.
Were ready when you are: 1.877.778.6227
Sustainable solutions start here.
life.changing
Environment & Sustainability
royalroads.ca/environment
-
| 19 www.esemag.com
Stormwater Management
For example, residents receiving stormwater management services are owed a duty. They may become more vulnerable, particularly if avoidable potential impacts of climate change are reasonably foreseeable. A valid policy decision, as op-SRVHGWRDQRSHUDWLRQDOGHFLVLRQFDQQHJDWHDQGLQJWKDWDGXW\RIFDUHH[LVWVDQGSUHYHQWDQGLQJRIQHJOLJHQFH
Standard of care constantly evolvingA negligent act, or omission, is one that breaches the re-
quired standard of care. The standard of care applicable to the design of infrastructure is likely to be the standard of care at the time of the design. That said, it is possible and perhaps more likely, that actions other than the design of infrastruc-ture will be subject to a claim of negligence. ,QRQHFDVHZKHUHWKHGHFLHQFLHVRIWKHVWRUPZDWHUV\V-
tem were well documented, the defendant-municipality chose to avoid major infrastructure upgrades. It did, however, im-plement a bylaw requiring that downspouts be disconnect-ed from the municipal sewer system. The municipality then IDLOHGWRHQIRUFHWKHE\ODZDQGZDVIRXQGOLDEOHIRURRGLQJdue to a failure of the municipal system. In that case, the fail-ure to enforce the bylaw was found to be the inaction that determined negligence.
Since inspections, maintenance, repairs and other process decisions may be ongoing, they can be judged against a more recent standard of care. This may include considerations of changing information and climate change. Relying on out-
dated standards or processes can be negligent, if new infor-mation suggests that they should be reconsidered. This is the case even if the standards and processes were not negligent before the new information came to light.
This does not mean that decision makers need to change all possible standards and processes and upgrade their entire infrastructure in light of climate change information. After
continued overleaf...
Cole Engineering Welcomes Mohsen Mortada to the Leadership TeamMohsen Mortada has a wealth of business experience in Canada as well as on the world stage. He will contribute global consulting strategies complementing Cole Engineerings vast engineering experience to bring clients unsurpassed services and solutions.
905.940.6161 | 416.987.6161 | www.ColeEngineering.ca
ENVIRONMENTAL SCIENCES AND ENGINEERING | TRANSPORTATION | URBAN DEVELOPMENT
Toronto received more than 4,700 basement flood complaints during and after the July storm.
-
Environmental Science & Engineering Magazine
Utilities
With a history that dates back over a century in Ontario, it would be easy to assume that the state of science and knowledge in waterpow-er development reached its apex some time ago. While it is certainly true that the sector is mature in its approach to the consideration and incorporation of social, environmental and economic values, there is always new information to be brought to future projects.
The Ontario Waterpower Associa-tion (OWA) is undergoing collaborative efforts to develop Best Management Practices (BMPs). Building on the cre-ation and implementation of the 2008 Class Environmental Assessment for Waterpower, the OWA has sought to continuously improve the advice pro-vided to proponents, regulators and oth-er interests.
Species at risk The OWAs BMPs initially focused
on species at risk, including lake stur-geon, American eel and channel darter. 6SHFLHVDW ULVN%03VVSHFLFDOO\DG-
dress the relationship between waterpow-er projects and a particular species and offer practical advice using science-based information. A common theme in these documents is the pathways of effects DSSURDFKWRWKHLGHQWLFDWLRQRISRWHQWLDOimpacts and appropriate mitigation strate-gies. In all cases, the BMPs are designed to inform decision making and act to sup-plement professional judgement.
The OWA has subsequently expand-ed its efforts to develop a series of 38 BMPs associated with facility construc-tion. These provide practical and cur-rent best practices that assist proponents and contractors in determining how to construct, rehabilitate or repair a wa-terpower facility in an environmentally responsible manner.
Facility construction The BMPs have also been designed
so that an entire BMP or portions of it
can be easily incorporated into project tender documents. Professionals work-ing on waterpower construction sites, including contractors, inspectors and FRQWUDFW DGPLQLVWUDWRUV ZLOO DOVR QGthis compendium useful as a reference document. Agency personnel involved in waterpower project design, review and permitting can also use them to help in the execution of their mandates.
Once again in partnership with key organizations, the Association has add-ed three new products to the series in 2014, with a focus on wetlands, migra-tory birds and water quality.
Wetlands and migratory birds This project explores the connection
between waterpower facility develop-ment and key considerations with re-spect to wetlands and migratory birds. The BMPs are structured both as stand-alone documents and also incorporated into the series on construction. Impor-tantly, the initiative brought together subject matter experts from Ducks Un-limited Canada (Ontario), the Canadi-an Wildlife Service and the Ministry
Best management practices for waterpower projects
The OWAs Best Management Practices explore the connection between waterpower facility development with respect to wetlands and migratory birds.
Photo by Rick Robb Ducks Unlimited Canada.
Specializing in the science of corrosion prevention, ICCC
has been providing high quality products and engineering services
for the Cathodic Protection/Corrosion Control industry for over
50 years.
Magnesium & Zinc Anodes Impressed Current Anodes Rectifiers/Junction Boxes Pipeline Cleaning Swabs Cadweld/Thermoweld Products Monolithic Isolating Joints Pipeline Coatings
Contact ICCC for competitive pricing and on-time delivery.
E-mail: [email protected] Central Fax: 905-333-4313
www.Rustrol.com
INTERNATIONAL CORROSION CONTROL INC.
INTERPROVINCIAL CORROSION CONTROL COMPANY LTD.Industry Leaders since 1957
-
#!,,
6)3)43MITHAND,OVELESSCOM
3EEFORYOURSELF2EQUESTAVIEWATYOURFACILITYWITHAVISITFROMONEOFOURTRAVELINGDEMO0UMP3TATIONSAT3MITH!ND,OVELESSCOM
(AVEYOUUEVER LR LOOKOOKOKEDE ATTAT THTHEH TTTRUECOSTOFOWNEN RSHIPFORRYOURLIFTSSTATIONSNS 77HE7HENYYOOUSEE BEBB YONDINITTIALPURCHRCHASEAS PRICETOOOTHERLIFIFECECCYCLYCLC ECOSTTSTSLSS IKEINSTALLAL TIONN PUMPUMPPEFlCIENCCYANDPPOWEOWER DRDR DRARAWW OOPERATIONANDA MAMAINTENAENANCENCEASSOCIATTEDLABOABOR TRTIMEIMEIMEANAN DEQQUIQ PMENTANDPPARTRTSS YOUYOUWIWILLLLAPPRECIAATETHEE3MI3M TH,, OVEOVEVELLESSAPPRP ROACCH/URROPOPERAERATORTOR
SAFEABBOVEVEGRAGRADEDEE7ET7E7 LL-OUNTED0UMPMP3T3 ATITIONSNSWIWITHTHLONGLAASTINGNGHIGHGHLYLYLYEFlEFlFlCIEIECIENTNT 3,33 .O. N#LOG 0U0UMPSMPS DEDELIVLIVERERTHELOWWESTLT LIFTSTSTSTATIATATIONONO OPEERARATTINGCOC STSnINCINCLUDUDINGINGSAVINGGSVVSSUBSUBMERMERMERSISIBSIBLESES
-
50 | July/August 2014
Trenchless Technology
and 57% have a population less than 50,000. While staff training was noted by about 50% of the respondents to be very important, 40% of the respondents reported a training budget of less than $5,000. Respondents noted that open-cut construction methods are still the dominant method for water and waste-water pipeline renewal and construc-tion. &ULWLFDO LVVXHV LGHQWLHGE\ WKHVXU-
vey included:
Improving water quality and flows, ensuring pipe integrity, and reducing watermain leaks and breaks.
Inflow/infiltration, flow capacity and root intrusion in wastewater pipelines.
Flow capacity, surcharging, pipe col-lapse and infiltration in stormwater pipelines.In order to address the critical issues,
respondents to the survey noted that: Rate increases are important. Access to government grants and long-
term financing is needed. Public education is considered import-
ant. Government regulatory requirements
are needed.The information provided by the Bur-
ied Infrastructure Survey is designed for use by municipal infrastructure manag-ers, contractors, consultants, manufac-turers and political decision makers, for market analysis and assessment.
This is an annual survey and the
The 2014 Trenchless Technology Roadshow in Niagara Falls featured over 60 exhibitors and 400 attendees.
Open-cut is the dominant method for pipeline construction and renewal.
HUBER Technology selects new president
Henk-Jan van Ettekoven has been appointed as the new President at HUBER Technology, Inc., headquar-tered in Huntersville, NC.
Van Ettekoven served as the companys Director of Manufacturing and Service since 2007. There, he was responsible for strategic growth opportunities, the development of new programs and products, along with directing aftermarket sales ac-tivities in North America.
HUBER Technology provides state-of-the-art equipment for munic-ipal and industrial water and waste-water treatment.
For more information, E-mail: [email protected]
-
PRIMARY TREATMENT Complete line of ne screening equipment Selfcleaning perforated plate screens FlexRake frontraked ne screens FlexRake frontraked bar screens FlexRake low ow Screenings washer/compactor Auger conveyor SelfCleaning trashracks Mufn Monster grinder for sludge, scum,
septage, screenings & wastewater Channel Monster grinder for pump staons
and sewage treatment plant headworks Honey Monster septage receiving staon Auger Monster ne screen system Monster ne screen & band screen perforated
plate ne screens with 2, 3 & 6mm perforaons Screenings washer/compactors Rotang drum screens down to 2mm perfs Raptor screenings washer pressSECONDARY TREATMENT AquaJet direct drive oang aerator Aqua DDM mechanical oang mixer Fine bubble aeraon systems using membrane or
ceramic diusers with gas cleaning systems Stainless steel coarse bubble aeraon systems Mul stage acvated biological process MSABP Two & three rotary lobe P/D blowers Centrifugal mulstage blowers Floang diversion curtains for aerated lagoons,
activated sludge systems & clear wells Subsurface jet aeraon/mixing systems
for high rate & low rate treatment systems Drop in jet aerators/mixers Spirao & Spiravac peripheral feed clariers Closed loop reactor oxidaon ditch systems Rotary brush aerators High eciency single stage integrally geared blowers Direct drive turbo type blowers Aeraon system controls & instrumentaon Chain & ight clarier systems & components
plasc, cast iron or stainless steel Half bridge, centre feed, circular clariers Spiral blade clariersTERTIARY TREATMENT AquaDisk cloth media tertiary lter AquaDiamond terary cloth media for traveling
bridge lters
CALL 905.856.1414 131 Whitmore Rd., Unit 13, Woodbridge, ON L4L 6E4
www.envirocan.ca
Ontario Pollution Control Equipment Association
Two Companies Many LinesOne Number To Call
and more
TANK COVERS & DOMES Aluminum and FRP geodesic domes Flat aluminum tank covers Aluminum channel and launder covers Aluminum hatch coversDISINFECTION UV disinfecon systems Package & custom ozone systemsBIOSOLIDS PROCESSING/HANDLING Sludge storage bins & live boom dischargers GBT & RDT for sludge thickening Belt filter presses & screw presses Centrifuges for thickening & dewateringODOUR CONTROL Biofilters Bioscrubbers Carbon adsorbers Chemical wet scrubbersBULK MATERIAL HANDLING Shaftless & shafted screw conveyors Screw pumps open & closed designsFLOWMETERS Open channel ow metering portable and
permanent; wireless data transmission Inseron mag ow meters with wireless
data transmission Data loggers with wireless data transmissionINDUSTRIAL WASTEWATER TREATMENT PCl Series DAF with corrugated plates PWl Series DAF low prole, from 20800 GPM Pipe occulators Industrial wastewater treatment systems Coalescing oil/water separators Inclined plate clariersPACKAGE TREATMENT PLANTS Package potable water treatment plants Package sanitary wastewater treatment plants Package industrial wastewater treatment plants Package industrial process water treatment plantsWATER TREATMENT Pressure ltraon systems removal of iron
and manganese, arsenic, fluoride, radium,uranium
www.acgtechnology.com