City University of New York (CUNY)CUNY Academic Works

Dissertations and Theses City College of New York

2019

Effect of hypoxia on spontaneous neural activity inthe cortex of neonate mouse pupsKrithikka Ravi Ms

How does access to this work benefit you? Let us know!Follow this and additional works at: https://academicworks.cuny.edu/cc_etds_theses

Effect of hypoxia on spontaneous neural activity in the cortex of neonate mouse pups

Thesis

Submitted in partial fulfillment of the requirement for the degree

Master of Science (Biomedical Engineering)

at

The City College of the City University of New York

By

Krithikka Ravi

May 2019

Approved by:

Professor Adrian Rodriguez-Contreras, Thesis Advisor

(Department of Biology, Center for Discovery and Innovation)

Professor Mitchell Schaffler, Chairman

Department of Biomedical Engineering

Effect of hypoxia on spontaneous neural activity in the cortex of neonate mouse pups

Krithikka Ravi

Department of Biomedical Engineering

Dr. Adrian Rodriguez-Contreras

(Department of Biology, Center for Discovery and Innovation)

ABSTRACT

Hypoxia caused by inadequate oxygenation has profound effects on the normal functioning of the

brain in mammals. Acute or chronic hypoxic insults occur in the brain depending on the duration

of hypoxic exposure. Hypoxia is known to occur in the human womb and exerts adverse effects

on the developing fetus. Most of the ongoing research on hypoxia is performed on rodent brain

slice taken from various brain regions using intracellular recording. Extensive work has been

carried out to understand the effects of chronic hypoxia on the developing nervous system,

specifically during intrauterine development. However, effects of acute hypoxia occurring

perinatally, on neuronal activity remain less studied. Spontaneous neural activity occurring during

the first weeks of development is important for priming the nervous system to function efficiently

when encountering sensory-evoked inputs. This calls for the need to understand the effects of acute

hypoxia on spontaneously arising neural activity in-vivo in awake and unanesthetized animals at

an age corresponding to the perinatal period in human fetus (36 – 40 weeks). This study utilized

wide-field epifluorescence imaging to indirectly record neural activity in the form of fluorescence

signals arising from a large volume of brain (from lambda suture to bregma) under normal air and

hypoxic air in SNAP-25-2A-GCaMP-6s transgenic mice at postnatal day 7. Results of this study

demonstrated a statistically significant reduction in frequency and increase in amplitude of

neuronal activity in the entire cortex under hypoxic air when compared to normal air. Bilateral

synchrony in neuronal activity was observed during normal and hypoxic conditions.

TABLE OF CONTENTS

1. Introduction………………………………………………………………………………..1

Hypoxia and its classification……………………………………………………………...1

Hypoxia as a risk factor for newborn infants……………………………………………....2

Developmental spontaneous activity in sensory systems………………………………….4

Significance of the current study…………………………………………………………..5

2. Hypothesis………………………………………………………………………………....6

3. Materials and Methods…………………………………………………………………….7

Animals…………………………………………………………………………………....7

Genotyping………………………………………………………………………………...7

Anchoring cranial windows………………………………………………………………..8

Transcranial wide field epifluorescence imaging………………………………………….9

Immunohistochemistry…………………………………………………………………..10

Image Processing………………………………………………………………………...11

Paired Sample t-test……………………………………………………………………....12

Wilcoxon Signed rank test………………………………………………………………..12

4. Results……………………………………………………………………………………13

Genotyping identified GcaMP-6s positive animals……………………………………....13

Wide-field epifluorescence imaging recorded fluorescence

peaks in GCaMP-6s positive animals and not in GCaMP-6s

negative animals………………………………………………………………………….13

Presence of bilateral synchrony in neuronal activity……………………………………...16

Hypoxia causes a reduction in frequency and increase in

amplitude of spontaneously neural activity……………………………………………....17

Immunohistochemistry………………………………………………………………….. 18

5. Discussion………………………………………………………………………………..20

6. Conclusion……………………………………………………………………………….22

7. References………………………………………………………………………………..23

LIST OF TABLES

Table 1: Effects of hypoxia on neuronal activity…………………………………………………..3

Table 2: List of reagents and oligonucleotide sequences used in PCR reaction…………………....8

LIST OF FIGURES

Figure 1: Wide-field epifluorescence imaging of spontaneous

activity in the cortex………………………………..………………………………….10

Figure 2: Results of PCR reaction………………………………………………………………...13

Figure 3: Time series of changes in GCaMP-6s fluorescence signal……………………………. 14

Figure 4: Overlap of GCaMP-6s fluorescence from left and right

cortex from SNAP-25-2A-GCaMP-6s positive animal...……………………………...15

Figure 5: Overlap of GCaMP-6s fluorescence from left and right

cortex from SNAP-25-2A-GCaMP-6s positive animal...……………………………...16

Figure 6: Bilateral cortical synchrony of intensity peaks…………………………………………16

Figure 7: Frequency distribution of fluorescence peaks………………………………………….17

Figure 8: Amplitude distribution of amplitude peaks…………………………………………….18

Figure 9: Immunohistochemistry………………………………………………………………...19

ACKNOWLEDGEMENT

It is with a deep sense of gratitude that I place on record my sincere thanks to all those who have

encouraged and supported me during the course of my research work.

This thesis work has been completed under the guidance of Dr Adrian Rodriguez–Contreras,

Associate Professor, who had tirelessly kept on motivating and encouraging me to put in my best

effort. I express my heartfelt gratitude to him for the valuable guidance, advice and encouragement

that I received from him throughout the course of the research study.

I also express my sincere gratitude to Dr. Bingmei Fu and Dr. Steven Nicoll for their valuable

inputs.

My special thanks are due to my friends Zeinab Esmaeilpour, Hash Sherif, Mahima Sharma, Erina

Hara, Lukas Hirsch, Aakriti Mittal, Pooja Kumar, Janak A Jain, Durga Shankar and Abhishek

Sanghani for their unconditional support and encouragement throughout the course of my research

study.

I would also like to thank Dr. Lucas Parra, whose class inspired me and gave me the confidence

on the usage of programming language for this project.

Finally, I would like to thank my family for their constant support and motivation.

ABBREVIATIONS

AMPA - α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid

NMDA- N-methyl-D-aspartate

kPa - Kilo pascal

PCR - Polymerase Chain Reaction

HIF - Hypoxia Inducible Factor

EDTA - Ethylenediaminetetraacetic acid

TBE - Tris-Borate-EDTA

BBB - Blood Brain Barrier

1

INTRODUCTION

Adequate oxygen concentration in atmospheric air is quintessential for normal functioning of the

human body. Normal atmospheric gas composition of oxygen is 21% of dry air and inspired

oxygen pressure is considered to be 19.6 kPa at sea level (atmospheric pressure is partial pressure

of constituent gases along with partial pressure of water vapor, 6.3kPa at 37℃). Normoxia is a

condition of normal oxygen composition of 21% along with other gases in the atmosphere.

Increase in altitude causes a fall in atmospheric pressure and partial pressure of oxygen. This fall

in partial pressure of oxygen leads to reduction in volume of inspired oxygen caused by reduced

driving pressure for gas exchange in the lungs (Peacock, 1998).

Hypoxia and its classification

Inadequate oxygenation leads to depletion in the required supply of oxygen concentration to the

tissues causing a condition known as hypoxia. Hypoxia can occur throughout the human body

affecting all cell types. Therefore, it is crucial for the cells and tissues to be able to detect reduction

in the partial pressure of oxygen and respond appropriately for effective survival (Shimoda, 2010).

Hypoxia is classified into two types on basis of duration of hypoxic insult, acute hypoxia and

chronic hypoxia (Bayer, 2011). Duration of acute hypoxia ranges from a few minutes to few hours

whereas chronic hypoxia extends from days to months (Hutter, 2010).

The brain is the largest oxidative organ and consumes a disproportionately large percentage of

oxygen in comparison to its total body mass. Adult human brain is approximated to take up only

2% of the total body weight, its energy consumption is 10 times more than the entire body’s energy

consumption (Erecińska, 2001). This is due to its constituent cells, neurons, that are extremely

sensitive to changes in the partial pressure of oxygen. Because of a neuron’s high sensitivity to

reduction in the partial pressure of oxygen, any reduction in oxygen saturation (or hypoxia) leads

to increased production of reactive oxygen species (ROS) in the brain (Maiti, 2006).

Condition of reduced partial pressure of oxygen manifests in the human womb during fetal

development (Hutter, 2010). Hypoxia can occur to the fetus during the conception of embryo,

gestational developmental period and delivery. Hypoxia exerts a supportive effect during

embryogenesis (until the first 10 weeks of pregnancy) by protecting the developing embryo against

oxygen-mediated damage, antioxidant enzyme catalase, peroxidase and mitochondrial superoxide

dismutase arising within placental tissue (Watson, 1998). This protective role of hypoxia changes

after the 13th week of gestation when oxygen saturation gradually increases attains a level of 60%

during the second trimester. Any decrease in partial pressure of oxygenation after the second

trimester has an adverse effect of the fetus causing a condition known as intrauterine hypoxia

(Hutter, 2010).

Chronic hypoxia in the uterus occurs from several days up to months. On the contrary, acute

hypoxia occurs for a few minutes to hours in fetal life. This is caused during maternal labor,

umbilical cord compression, placental abruption and abnormal uterine contractions, posing a major

challenge to fetal life (De Haan, 2006).

2

Hypoxia as a risk factor for newborn infants

Acute hypoxia occurring during birth, also termed as asphyxia affects 1-6 infants in every 1000

live full-term births. Brain injury caused by asphyxia perinatally, stands as one of the common

causes of morbidity and death of preterm and term fetuses, contributing to 23% of neonate’s death

across the globe (Lawn, 2005). In addition, perinatal hypoxia is also associated with increasing

the risk factor of the fetus to develop neurological disorders in the future. For example, it was

concluded from a pilot study and review of literature case study that patients affected with

schizophrenia had a history of obstetric complication in comparison with other psychiatric and

normal patients (Lewis, 1987). A perinatal asphyxia rat model study on Wistar rat pups showed

exaggerated age-related long-term memory impairment in rats that experienced perinatal

asphyxia during birth (Berg, 2000). A 2018 study (Lima, 2018) using perinatal asphyxia rat model

revealed abnormal permeabilization of the blood-brain barrier, increased mitochondrial

respiration rate, cyanosis and hypertonia in pups that were exposed to acute hypoxia (15 minutes)

around the time of their birth. The study concluded that perinatal asphyxia, causes mitochondrial

damage and alteration of brain development at a subcellular level without exhibiting any visible

changes in the morphological features of neurons.

General fetal response to hypoxia at the cellular level includes changes in the expression patterns

of hypoxia- inducible factor (HIF), a transcription factor that regulates several genes belonging

to the glycolytic pathway (Zimna, 2015). Such changes occurring at a genetic level in addition to

providing protective effects, persist throughout postnatal life and increase susceptibility to

develop neurodegenerative disorders (Nalivaeva, 2018). Changes occur in expression levels of

certain specific genes in the cortex during fetal and early postnatal development and these

changes play a direct role in postnatal and adult cognitive functioning. One such genes that plays

a significant role in early brain development is RE1- silencing transcription factor (REST) which

is also shown to play a dominant role in shaping the changes occurring during adult neurogenesis

(Lunyak, 2016). Changes in the expression levels of REST factor have shown to correspond to

mild cognitive disorders, Huntington disease, down syndrome and Alzheimer’s disease occurring

postnatally (Nho, 2015). REST factor helps in protecting integrity during normal embryogenesis

and during hypoxia REST accumulates in nucleus of hypoxia exposed cells, functioning as major

repressor of 20% of hypoxia- repressed genes, acting counter-regulatory to HIF-dependent gene

expression (Nalivaeva, 2018).

Notable change induced by hypoxia in the brain is rapid failure of synaptic transmission and

considerable membrane depolarization acting as a signal for further neuronal hyperexcitability,

irreversible neuronal dysfunction and neuronal death (Balestrino, 1995). Two hypotheses attempt

at explaining the reason for suppressed neuronal activity. The first hypothesis talks about the

central role of glutamate and excessive opening of ionotropic glutamate receptor channels in

creating a hypoxic brain damage (Choi, 1990). The second hypothesis postulates that an excessive

accumulation of calcium ions in the cytosol, caused by loss of calcium homeostasis, over

stimulates calcium dependent proteases, phospholipases and endonucleases (Lipton, 1994).

3

Most of the original work focusing on understanding the effects of hypoxia on neuronal activity

have utilized brain slices and intracellular recording technique. The reason stated by most of the

brain slice studies is that different brain regions exhibit different responses to hypoxic insult and

in order to understand how hypoxia is directly related to irreversible neuronal damage in a

particular brain region, recording using brain slices is the most straightforward approach (Nieber,

1999). Effects of hypoxia in brain slices taken from different regions of the brain are described in

Table 1.

Brain region Age and strain

of the animal

used in the

study

Technique

used in the

study

Observation

made

(Hypoxic

condition)

Normoxic

condition References

Hippocampus Sprague-

Dawley rats

(Postnatal day

14- postnatal

day 23)

Intracellular

recording of

resting

membrane

potential from

CA1 region in

hippocampal

slices (300 µm)

under hypoxic

condition (95%

N2- 5% O2) for

15-20 minutes

at 30℃ - 31℃

Initial response to

hypoxia was

membrane

hyperpolarization

along with

increase in resting

conductance

Reoxygenation of

the slices led to

post-hypoxic

hyperpolarization

followed by

normalization of

resting potential

(Hyllienmark,

1999)

Brain stem Sprague-

Dawley rats

(Postnatal day

5- postnatal

day 15)

Intracellular

recording from

transverse

brainstem slices

(400 µm) under

hypoxic

condition (95%

N2-5% CO2)

for less than 1

minute

Hypoxia induced

spreading like

depression found

in the brainstem

slices

Recovery from

hypoxia observed

during

reoxygenation

(Funke, 2009)

Retinal and

superficial

superior

colliculus

neuronal culture

Male and

female Wistar

rats (Postnatal

day 1)

Whole cell-

patch clamp

technique in

presynaptic and

postsynaptic

cells under

hypoxic

solution for a

duration of 20

minutes

Hypoxia induced

suppression of

retinocollicular

neurotransmission

in pre-synaptic

and postsynaptic

coupled neurons

Rapid recovery of

neurotransmission

for reoxygenation

in synaptically

coupled neurons

(Dumanska,

2019)

Table 1: Effects of hypoxia on neuronal activity

4

Developmental spontaneous activity in sensory systems

Electrical activity originating intrinsically during early stages of development in sensory systems,

even before the onset of sensory experience is known as spontaneous activity. This spontaneous

activity in the developing nervous system is required for refinement of synaptic connections,

formation of neuronal maps and establishment of neural circuitry before the onset of stimulus-

induced neural activity (Yin, 2018). Babola et al., in their 2018 study, used wide-field imaging on

P6-P15, SNAP-25-2A-GCaMP-6s positive mice. They showed that in the developing auditory

system, spontaneous activity arose in the cochlea before the period of hearing onset and that such

activity had the potential to influence maturation of sound-processing circuits by propagating to

the central auditory centers. Ackman et al., in their 2012 study demonstrated the presence of

spontaneous neural activity originating in retinal ganglion cells (RGC) in mouse pups of P3-P9

age group using calcium-dye labelling and two-photon imaging. Results of the study showed that

spontaneous waves were present for a week during development and were responsible for

conveying retinal organization information to circuits in the entire visual system through a specific

pattern of activity (Ackman, 2012). It is evident from these studies that the first week of postnatal

development in rodents forms an important period for spontaneously arising neural activity to

refine and prime the sensory circuitry in order to efficiently propagate evoked activity from sensory

organs to the appropriate processing centers in the brain.

Studies aiming to replicate human perinatal hypoxic-ischemic brain damage in rodents require an

appropriate postnatal period that faithfully recapitulates the developmental landmarks. The 7-day

postnatal rodent (P7) is an appropriate model for perinatal hypoxia studies. During this age,

histological similarities between the rodent brain and that of 36 to 40-week gestation human

fetus/newborn infant were observed (Semple, 2013). These similarities included axonal pruning

and apoptosis of overabundant cells (Bockhorst, 2008), heightened rate of birth of glial cells

(Kriegstein, 2009) and completion of layering of neurons in the cerebral region (Weitzdoerfer,

2004).

Although several studies are conducted on brain slices with the aim of understanding the effects

of hypoxia on neuronal activity and comparing them to control conditions, there are no studies

exploring the effects of hypoxia on spontaneous neural activity arising in vivo in unanesthetized

animals at an age corresponding to the perinatal period in human infants (36-40 weeks). Most of

the studies available, have been able to demonstrate different phase changes in a neuron’s response

to hypoxia, hypoxia induced depolarization, heightened excitability and hyperpolarization. Most

of the brain slice studies have employed techniques related to intracellular recording. These

techniques focus mainly on recording electrical activity from single cells, neurons. These studies

also report variations in response to oxygen deprivation among different brain regions, and the

difficulty involved with recording such different responses, under the same field of view

(Hyllienmark, 1999).

In live animals, neural activity occurring in brain tissue is a much-complicated interplay involving

glial cells, local blood flow (forming the basis of neurovascular coupling) and concentration of

5

glucose available in the surrounding extracellular space. Studies have elaborated the roles of

astrocytes and microglial cells as primary responders to neuronal hypoxic insult, by changing their

phenotype and active functions in order to turn them to reactive cells (Mucci, 2017). In 2018,

Karunasinghe et al., in their patch-clamp study demonstrated the response of astrocytes, present in

different brain regions, to acute hypoxic environment. Results of this study concluded that

astrocytes depending on their location in the brain, can either enhance effects of acute hypoxic to

a profound anoxic (complete loss of oxygen) depolarization causing irreversible death of neurons,

or return to normal conditions following reperfusion. Luo et al., in 2019 performed a systematic

review on bibliographic articles to determine if there were changes in the levels of S100B protein

in serum samples taken from neonates with perinatal asphyxia 24 hours after birth. S100B is a

cytosolic calcium-binding protein found concentrated mainly in glial cells. The results of this

literature review concluded that increased serum S100B levels as found in neonates after 24 hours

of birth, can serve as an indicator of brain damage caused by rupture of the blood brain barrier. It

can be inferred from this review that glial cells in live subjects play a role in helping the neurons

combat hypoxic insult.

Significance of the current study

The current study aims to understand the changes in the activity of cortical neurons during

exposure to an acute hypoxic insult for a duration of 10 minutes, using an indirect optical imaging

technique in live and awake animals at postnatal day 7. In this study, neuronal activity is recorded

under baseline conditions (normal air) for a duration of 10 minutes. Under the same experimental

conditions, the study investigates how acute hypoxic insult alters neuronal activity.

This study utilizes in-vivo wide-field epifluorescence imaging in unanesthetized transgenic

(SNAP-25-2A-GCaMP-6s) mice, a calcium-indicator tool strain containing a genetically encoded

calcium indicator (GCaMP-6s). These animals have widespread expression of the slow variant of

GCaMP-6s in neurons. GCaMP-6s has the property of ultrasensitive detection of single neuron

action potentials coupled with slow decay and response kinetics (Chen, 2013). Global cortical

response, in vivo, to hypoxic exposure was optically recorded, overcoming the previously

mentioned limitations as encountered in brain slice studies. Furthermore, this study utilizes

transgenic mouse model at postnatal day 7 (P7) for hypoxic exposure and imaging. P7-P10

corresponds to a period of peak brain growth spurt, peak in gliogenesis, increasing axonal and

dendritic density, oligodendrocyte maturation state changes and consolidation of the immune

system. This period in addition to providing an efficient model to study the impact of hypoxia on

major neurodevelopmental changes also corresponds to human gestation (term infant) of 36-40

weeks (Semple, 2013). This period is known as a perinatal sensitive period, a stage when the

human fetus is highly prone to acute hypoxic insult (Hutter, 2010).

6

HYPOTHESIS

If spontaneous activity in the cortex is affected by hypoxia, then there should exist a quantifiable

difference in neural activity recorded under normal air and hypoxic air.

7

MATERIALS AND METHODS

Animals

Experimental protocol used in this study was approved by the Institutional Animal Care and Use

Committee of the City College of New York. Animals used in this study were housed in a cage

under conditions of 12-hour light/dark cycle and were provided with food and water ad libitum.

Animal cages were kept in an aseptic environment in the City College animal house facility.

SNAP25-2A-GCaMP-6s (Synaptosomal Associated Protein 25kDa) heterozygote females were

purchased from Jackson Laboratory (JAX 025111). One female was paired with a male C57BL6.

The animals were separated after 5 days to a week of pairing. Females were checked for birth after

21 days of gestation every day. The day of birth was recorded as P0. Newborn pups were housed

in the same cage along with their mothers until imaging experiments.

Genotyping

At postnatal day 6 (P6), 2mm of toe tissue was clipped aseptically and immersed in 100 µl of lysis

buffer (200µM EDTA at pH 8.0) taken in a 1.5 ml eppendorf. The tissue along with the lysis buffer

was heated to 97℃ on a hot plate (Thermo Scientific) for 1 hour. Tubes were removed from the

hot plate after 1 hour and vortexed thoroughly. 100 µl of buffer containing 40 mM Tris-HCl at pH

8.0 was added to the tubes and centrifuged at 12,000 rpm for 3 minutes at 4℃. After centrifugation

the tubes were stored at room temperature and DNA template from the solution was used for the

following PCR reaction.

8

Oligonucleotide sequences Concentration

& volume

Source

Primer (Forward): CCCAGTTGAGATTGGAAAGTG

(SNAP25-2A-GCaMP6s-D-Wildtype)

0.5 µl of (10

µM

concentration)

IDT

Primer (Reverse): CTGGTTTTGTTGGAATCAGC

(SNAP25-2A-GCaMP6s-D-Wildtype)

0.5 µl of (10

µM

concentration)

IDT

Primer (Forward, 5’-3’): CCCAGTTGAGATTGGAAAGTG

(SNAP25-2A-GCaMP6s-D-Mutant)

0.5 µl of (10

µM

concentration)

IDT

Primer (Reverse): ACTTCGCACAGGATCCAAGA

(SNAP25-2A-GCaMP6s-D-Mutant)

0.5 µl of (10

µM

concentration)

IDT

Master Mix 10 µl Thermo

Scientific

PCR- grade water 7 µl Thermo

Scientific

Total reaction mixture 20 µl

Table 2: List of reagents and oligonucleotide sequences used in PCR reaction

PCR protocol used in the study was adopted from Jackson Laboratory site (www.jax.org).

Following PCR, samples were run on a 1.5% agarose gel prepared in 1X TBE buffer prepared

from 10X TBE Electrophoresis buffer (89 mM Tris, 89mM boric acid, 2mM EDTA, Thermo

Scientific) in distilled water and ethidium bromide (10 mg/ml, Thermo Scientific). The gel was

allowed to solidify at room temperature. Following gel solidification, 15 µl of the PCR product

was added to each well. A no-template control (water control) was used as a negative control.

Equal volume of 100 bp DNA ladder (50 µg/ml, New England BioLabs) was added to a separate

well. The gel was run at 125 volts for 1 hour or until the DNA bands migrated half the distance

from the starting well position. The gel was viewed under UV light with an exposure duration of

15 seconds.

Anchoring cranial windows

Male and female pups at postnatal day 7 (P7) were separated from their mother and acclimatized

to the surgical room temperature at 25℃ for 15 minutes. Following acclimatization, inhalation

anesthesia was induced using vaporized isoflurane at an initial dose of (4% -5% with pure oxygen)

until the animal became unresponsive to toe pinch. An incision was made starting midline to the

9

ears (lambda suture) and ending at posterior to the eyes (bregma suture). Dorsal surface of the

scalp was removed following subsequent cuts (Babola et al., 2018). The exposed area was cleared

of underlying membranes and other contaminating particles using gelatin sponge soaked in sterile

artificial cerebrospinal fluid (ACSF) and dry sterile gelatin sponge (Gelfoam). Care was taken such

that the imaging field remained free of blood clots that would interrupt capturing reflected

fluorescence signals arising intrinsically. 5mm round glass cover slip (Bellco Glass) was placed

on the exposed skull using super glue (Krazy Glue). Super glue was placed along the edges of the

metal head plate and the plate was anchored such that it surrounded the cover slip. The animal was

weaned from isoflurane supply and placed on a heating pad and allowed to recover from surgery

for an hour (Babola et al., 2018).

Transcranial wide field epifluorescence imaging

Following an hour of post-surgery recovery, the animals were transported to the imaging unit

(Figure 1). The animals were placed on a heating pad to avoid any loss of body temperature

throughout the imaging experiment. Image frames were captured on a digital camera (Thor Labs)

at 8 Hz with an exposure duration of 124 milliseconds at a maximum gain of 24x. Halogen lamp

(HAL 100) was used as the source of white light. The exposed region of the skull was illuminated

with blue light of wavelength (470 nm -490 nm) obtained after filtering through an excitation filter.

The filtered blue light was then directed to a dichroic mirror and after getting reflected from the

mirror, the resulting light was focused on the specimen using a macro lens (SMC Pentax f1.2).

Reflected light from the skull was captured after passing through an emission filter. Image frames

were recorded on Thor camera software as 10-bit monochrome images and saved in 8-bit tiff

format without annotations at a resolution of 968x608 pixels after horizontal 2x and vertical 2x

sub-sampling for an uninterrupted duration of 20 minutes.

10

Figure 1: Wide-field epifluorescence imaging of spontaneous activity in the cortex from lambda to bregma in awake

SNAP-25-2A-GCaMP-6s positive mouse pups at P7.

Imaging session consisted recording GCaMP-6s activity in response to two different conditions

(normal air and hypoxic air). Images were captured from the exposed cortical region starting from

lambda suture until bregma for SNAP25-2A-GCaMP6s- positive and SNAP25-2A-GCaMP6s

negative pups at P7. 20 minutes uninterrupted imaging session started with recording neuronal

activity in response to normal air delivered at a flow rate of 1L/min at a pressure of 1 bar for a

duration of 10 minutes (4800 image frames) followed by hypoxic air (8% O2 and 92% N2) for the

next 10 minutes (4800 image frames) delivered at a pressure of 1 bar.

Immunohistochemistry

One SNAP25-2A-GCaMP-6s positive and one negative animal taken from the imaging experiment

were decapitated to isolate whole brain. As the negative animal lack GFP insertion and do not

exhibit fluorescence on excitation, they were taken as the negative control. Isolated whole brains

were immersed in 4% paraformaldehyde prepared in 0.1M phosphate buffer (pH 7.2). The brains

were subjected to gradient dehydration in 10%, 20% and 30% sucrose solution (prepared in 0.1M

phosphate buffer) until the brains sunk in each of the sucrose solutions. 80µm sections were cut

using a vibratome and the brain slices (from positive and negative animal) were transferred to 24

well dishes for staining.

11

Sliced brain sections were double stained for neuronal nuclei (NeuN, Millipore) and for

fluorescence in neuronal cell bodies. Sections were initially blocked using 0.4% normal goat serum

for 30-45 minutes. This was followed by incubation in primary antibody solutions containing 1%

normal goat serum and permeabilization agent (0.3% Triton-X100). The primary antibody for

staining GFP (present in the neuronal cell body) was raised in chicken and was used at a dilution

of 1:4000 (Stock solution concentration- 10 mg/ml, Abcam, Lot no: 13970). Primary antibody for

staining neuronal nuclei (NeuN) was raised in guinea pig and was used at a dilution of 1:500 (Stock

solution concentration-1 mg/ml). Sections were incubated in primary antibodies overnight at 4℃.

The following day, sections were rinsed twice in washing solution composed of 0.02% Triton-

X100. Secondary antibodies used were Alexa Fluor 647 Goat anti-guinea pig antibody and Alexa

Fluor 594 Goat anti-chicken antibody. Working concentration of secondary antibody was 2 µg/ml

and was prepared in a solution containing 0.02% Triton-X100. Brain sections were incubated in

secondary antibody solution for 2 hours at room temperature. Following secondary antibody

incubation, the sections were washed four times in the washing solution (solution used during the

first wash). Sections were then mounted on a glass slide and covered using a coverslip. The

coverslips and brain sections were sealed to the glass slide using mounting medium (Thermo

Scientific). Images were captured on a confocal microscope (Leiss LSM 800) using a 40X oil-

immersion objective.

Image Processing

Regions of interest in the cortex from GCaMP-6s positive animals were corrected for bleaching

(using bleach correction function on ImageJ) and imported to MATLAB environment. Raw images

were imported on ImageJ platform and each individual collection of image frames were

concatenated on the ImageJ platform. Following this, the images were corrected for

photobleaching using the Bleach Correction function, exponential fit on ImageJ. Region of interest

(ROI) was selected using ROI manager tool on ImageJ manually for every imaging session.

Fluorescence intensity measurements for the selected ROIs were measured and the data was

recorded on an excel sheet.

Data was imported into MATLAB (Mathworks) and fluorescence intensities were normalized

using equation (1)

Normalized fluorescence intensity = ΔF (1)

Fo

ΔF= F – Fo (2)

Where,

F = Amplitude of the recorded fluorescence signals from SNAP-25-2A-GCaMP-6s positive and

negative animals

12

Fo = Minimum computed value of the recorded fluorescence intensity using the min function in

MATLAB.

Following normalization of fluorescence intensities, fluorescence peaks from the signals were

detected using an in-built function on MATLAB (findpeaks) using a fixed value threshold criterion

for all recording sessions. Threshold value was set at 20% by analyzing ΔF/Fo values of SNAP-

25-2A-GCaMP-6s negative animals. Number of peaks computed using findpeaks function was

recorded for baseline condition and for the hypoxic condition. The resulting data was plotted

graphically on MATLAB using the plot function.

Peaks above the set 20% threshold was computed for both conditions (normal air and hypoxic air).

The resulting data was tested for normality using Shaipro-Wilk’s test (using SPSS Software).

Frequency and amplitude distribution of the fluorescence peaks above 20% ΔF/Fo was mapped

using GraphPad Prism software for data obtained from left and right cortex.

Paired Sample t-test

Data collected from five SNAP25-2A-GCaMP6s positive animals under two test conditions

(normal air and hypoxic air) was analyzed using paired t-test function on MATLAB. The null

hypothesis under consideration was that the mean of the differences in intensities between normal

condition and hypoxic condition was zero. The significance level was set at 5% and p-value was

calculated under paired t-test.

MATLAB function: [h,p]= ttest(normal air intensity peaks, hypoxic air intensity peaks)

h value of 1 would be returned if the null hypothesis was rejected and h value of 0 would be

returned if the null hypothesis was failed to be rejected at a significance level of 0.05. p-value

returned by the program was used for computing statistical significance of the data.

Wilcoxon Signed Rank test

Amplitude data collected from all five SNAP25-2A-GCaMP6s positive animals under two test

conditions (normal air and hypoxic air) was analyzed using Wilcoxon Signed-rank test (SPSS

Software). The null hypothesis under consideration was that the median of the differences in

amplitude intensity between normal condition and hypoxic condition was zero. The significance

level was set at 5% and p-value was calculated under Wilcoxon Signed-rank test.

Kurtosis of the amplitude data was measured individually for all five animals (under normoxia and

hypoxia) using MATLAB ‘kurtosis’ function.

13

RESULTS

Genotyping identified GCaMP-6s positive animals

Postnatal day 6 (P6) SNAP-25-2A-GCaMP-6s pups were genotyped to identify GCaMP-6s

positive heterozygous animals. Bands of very low intensity were observed in SNAP-25-2A-

GCaMP-6s negative pups as seen in lane marked pup3 and pup4 in SNAP-25 mutant section. An

exemplar image showing the results of genotyping is given in figure 2.

Figure 2: PCR performed to amplify 498 base pair SNAP-25 wild-type fragments and 230 base pair SNAP-25 mutant

fragments. PCR products were run on a 1.5% TBE agarose gel. L- 100 bp DNA ladder, WC- water control without

template DNA.

As shown in figure 2, DNA bands can found in lanes close to 500 base pair (498 bp) in SNAP-25

wild type primer section, corresponding to DNA ladder and close to 200 base pair (230 bp) in

SNAP-25 mutant primer section, corresponding to DNA ladder for pup 1 and pup 2. Pup 1 and

pup 2 are heterozygous positive for GCaMP-6s as they contain one copy of the calcium indicator

containing the GFP sequence. Heterozygous negative animals will not contain a sequence for GFP

as it is not a knockin line containing calcium indicator. This feature is exhibited by pup 3 and pup

4 with no bright DNA bands in lanes corresponding to 230 bp. Heterozygous positive and negative

male and female pups were selected following genotyping for surgery and imaging.

Wide-field epifluorescence imaging recorded fluorescence peaks in GCaMP-6s positive animals

and not in GCaMP-6s negative animals

Spontaneous activity as indicated by increase in GCaMP-6s fluorescence signals were consistently

present in the cortical region of SNAP-25-2A-GCaMP-6s positive animals at P7 (Figure 3).

Bilaterally spreading spontaneous neural activity as represented by fluorescence signals was found

in all five positive animals that were imaged. The SNAP-25-2A-GCaMP-6s negative animals

14

lacked this fluorescence activity. Image frames were acquired from SNAP-25-2A-GCaMP-6s

positive animals and from one negative animal from every litter. Image frames acquired from a

SNAP-25-2A-GCaMP-6s positive and SNAP-25-2A-GCaMP-6s negative mice pups during

imaging are shown in figure 4 and figure 5.

Figure 3: Representative image of time series of changes in GCaMP-6s fluorescence signal. (A) Changes in GCaMP-

6s signal in a SNAP-25-2A-GCaMP-6s positive animal (B) Changes in signal in SNAP-25-2A-GCaMP-6s negative

animal.

Exemplar traces of fluorescence (indirectly reporting neuronal activity) recorded in GCaMP-6s

positive and negative animals are displayed in figure 4 and figure 5. A decrease in activity can be

observed when the animals were inhaling hypoxic gas (92% N2 & 8% O2) as compared to animals

inhaling normal air at a pressure of 1 bar.

15

Figure 4: Representative image of overlap of GCaMP-6s fluorescence recorded from left and right cortex from SNAP-

25-GCaMP-6s negative animal. (A) GCaMP-6s fluorescence over entire imaging duration (1200 seconds) (B) Zoomed

in image of overlap of left and right cortical fluorescence intensity peaks. ‘o’ represents fluorescence peaks above

.F/Fo under hypoxic conditionߡ F/Fo under normoxic condition. ‘x’ represents fluorescence peaks above 20%ߡ 20%

16

Figure 5: Representative image of overlap of GCaMP-6s fluorescence recorded from left and right cortex from SNAP-

25-GCaMP-6s positive animal. (C) GCaMP-6s fluorescence over entire imaging duration (1200 seconds) (D) Zoomed

in image of overlap of left and right cortical fluorescence intensity peaks. ‘o’ represents fluorescence peaks above

.F/Fo under hypoxic conditionߡ F/Fo under normoxic condition. ‘x’ represents fluorescence peaks above 20%ߡ 20%

Results of the optical recording were categorized as bilateral cortical synchrony of neuronal

activity, frequency and amplitude distribution of fluorescence intensity peaks under normal and

hypoxic conditions.

Presence of bilateral synchrony in neuronal activity

Bilateral synchrony in neuronal activity was found under both normal air conditions and hypoxic

air conditions with the peak intensity being bigger or smaller on one side in comparison with the

contralateral side (Figure 6).

Figure 6: Representative image of bilateral cortical synchrony of intensity peaks under normal air conditions and

hypoxic air conditions for a recording duration of 10 minutes each.

17

Hypoxia causes a reduction in frequency and increase in amplitude of spontaneous neural activity

Analysis of frequency and amplitude distribution of fluorescence peaks revealed the effects of

hypoxia on spontaneous neural activity. A reduction in frequency of fluorescence peaks (above

threshold) is found under the conditions of hypoxia (Figure 7). In five animals imaged under

hypoxic conditions, frequency of fluorescence peaks (above threshold) clearly decreased by an

average of 31± 15.64 as compared to normoxic conditions of 61.3 ± 16.8. Difference in frequency

of fluorescence peaks between control and hypoxia were statistically significant (p<0.01, Paired t-

test).

Figure 7: Plot of frequency distribution of fluorescence peaks (representing neuronal activity) under normoxic and

hypoxic conditions. Results are expressed as the number of peaks above threshold (20% ߡF/Fo) (mean±SEM, n= 10).

**p<0.001.

Amplitude of fluorescence peaks did not follow a normal distribution (n=5 animals) (Figure 8). In

contrast to the reduced frequency of peaks, amplitude of fluorescence peaks under hypoxic

condition had a higher median value of 0.3045±0.1601 as compared to normoxic conditions

0.288±0.0873. Difference in amplitude of fluorescence peaks between control and hypoxia were

statistically significant (p < 0.05, Wilcoxon signed-rank test).

Analysis of kurtosis was performed to understand the distribution of amplitude data. Results of

kurtosis analysis for individual GCaMP-6s positive animals under normoxia and hypoxic is

represented in Figure 8A. Out of five animals recorded, two animals displayed increased kurtosis

value during hypoxic condition as compared to normoxic condition. Two animals displayed

decreased kurtosis value during hypoxic condition as compared to normoxic condition. One animal

did not exhibit any change in kurtosis under normoxic and hypoxic condition.

18

A B

Figure 8: Analysis of amplitude distribution of fluorescence peaks (representing neuronal activity) under normal air

conditions and hypoxic air conditions. (A) Plot of kurtosis of amplitude data (recorded under normoxia and hypoxia)

from five SNAP-25-2A-GCaMP-6s positive animals. (B) Box plot summarizing amplitude distribution recorded under

normoxia and hypoxia from five SNAP-25-2A-GCaMP-6s positive animals. In each box plot, horizontal line crossing

the box is the median, top and bottom of the box are the upper and lower quartiles, whiskers extending up and down

from the periphery of the box are minimum and maximum values. Represents outlier amplitude data points recorded

under normoxia. Represents outlier data points recorded under hypoxia. (Tukey comparison of medians, *p<0.05)

Immunohistochemistry

Coronal slices of the cortex were imaged. Staining was found to be positive for GFP expression in

both SNAP-25-2A-GCaMP-6s positive and negative animals and are represented in red color

(Figure 9). Staining was found to be positive for neuronal nuclei in both SNAP-25-2A-GCaMP-

6s positive and negative animals.

19

Figure 9: GCaMP-6s expression in GCaMP-6s positive and negative animal at P7 on 80 µm thick coronal sections

(A) labeling for neurons expressing green fluorescent protein (GFP) in red (B) labeling for neuronal nuclei (NeuN)

in green color (C) Merge of neuronal cells expressing green fluorescent protein (red) and nucleus present in neurons

(green).

20

DISCUSSION

In the current study, changes in the levels of neuronal calcium were recorded indirectly in

unanesthetized animals using wide-field epifluorescence imaging, facilitating visualization of

neuronal activity under normal and hypoxic conditions on a spatial (over the entire cortical region)

and temporal scale (over time duration of 20 minutes). This study was conducted on animals at

postnatal day 7, an age when the optical properties of the skull are suitable for transcranial imaging

in the presence of an imaging window (Soleimanzad, 2017). At this young age, the animal’s skull

is translucent and therefore, transmits most of the fluorescence signal originating in the brain,

through the skull to reach the sensor (camera) present in the imaging set up. In addition, use of

GCaMP-6s in recording spontaneous resting state activity reveals neuronal activity with a high

spatial accuracy (Vanni, 2014; Mohajerani, 2013). GCaMP-6s rather than any other variant was

suitable for this study as it detects small changes in intracellular calcium concentrations, displays

slower decay kinetics, exhibits higher sensitivity and exhibits lower photobleaching enabling long

term imaging (Garcia, 2017). Long term imaging with low photobleaching is essential to study the

response of neurons to hypoxia over the entire ten minutes of imaging duration.

This study utilized wide-field fluorescence imaging where signal was recorded from neuronal

population over a large surface area (mesoscopic level) rather than recording signals representing

the activity of individual neurons (Homma, 2009). This technique was well suited for this study as

compared to two-photon microscopy as a larger field of view was imaged to understand neuronal

interactions over a large scale without the need for scanning small regions in the cortex. This

facilitated in understanding how various cortical regions (left and right cortex) responded to

hypoxic insult under one imaging field of view.

Bilateral presence of fluorescence activity in the entire cortical area was observed (Figures 4,5 and

7). This activity originated at no defined region in the cortex and spread in the form of short waves

in no specified direction. As shown in figure 7, fluorescence activity in the left and the right cortex

occurred in a pattern where they appear as mirror images of each other in a GCaMP-6s positive

animal at P7. This observation is similar to the results obtained by Babola et al. (2018) where they

recorded spontaneous activity during the pre-hearing phase in SNAP-25-2A-GCaMP-6s positive

animal at P7. In their study, spontaneous activity in two lobes of the inferior colliculus overlapped

on each other and exhibited bilateral synchrony.

Analysis of frequency distribution of fluorescence peaks above the set amplitude threshold

criterion (20% ߡF/Fo) in SNAP-25-2A-GCaMP-6s positive animals revealed an overall reduction

in frequency of intensity peaks under hypoxic condition as compared to normal air conditions.

This reduction in frequency occurred bilaterally under hypoxic condition and it was observed in

all five GCaMP-6s positive animals used in the study (Figure 6). Statistical analysis performed

using paired t-test strengthens the obtained results with a p-value of 0.000572 for data obtained

from both left and right cortex together at a significance level of 0.05. A possible cause for this

21

observed reduction in the fluorescence can be attributed to suppression of neural activity caused

by brief exposure to hypoxic environment. A similar result was observed in a study that

demonstrated pre pathological retinocollicular plasticity facilitated by short-term/acute hypoxia.

Study results demonstrated suppression of AMPA synaptic transmission associated with acute

hypoxia (Dumanska, 2019).

Analysis of amplitude distribution of fluorescence peaks in SNAP-25-2A-GCaMP-6s positive

animals revealed a significant increase in fluorescence peak amplitude under hypoxic condition as

compared to normoxic conditions as revealed by p-value (Figure 8). Kurtosis data revealed two

out of the five animals exhibiting an increased kurtosis during hypoxic condition as compared to

normoxic conditions. Under hypoxia the amplitude distribution did not follow a normal

distribution and fell towards the heavy tailed region. Two animals exhibited decrease in kurtosis

and their amplitude distribution fell towards the lighter tailed region. One animal did not exhibit

change in kurtosis between hypoxia and normoxia and hence the amplitude distribution was not

different between hypoxia and normoxia. The use of SNAP-25-2A-GCaMP-6s positive animals in

this study facilitated an ultrasensitive imaging of calcium ions during neuronal firing. A likely

reason for the increase in amplitude of fluorescence peaks can be attributed to accumulation of

calcium ions near the vesicle and modulating the amount of neurotransmitter released from the

vesicles (Dodge, 1967). However, the difference in mechanisms of calcium influx into the cytosol

of neurons under normoxic conditions and hypoxic conditions remains unknown. As mitochondria

is highly sensitive to hypoxic insult (Lima, 2018) and mitochondrial function and calcium ion

accumulation in the neurons is tightly coupled, it can be hypothesized that calcium ion homeostasis

is imbalanced leading to excessive accumulation of calcium in the cytosol causing an increase

intensity of fluorescence peaks during hypoxia (Duchen, 2012).

Intracellular recordings performed on brain slices obtained from different brain regions indicate

different patterns of response on exposure to hypoxia (Dumanska, 2019; Hyllienmark, 1999).

Mechanisms of response to hypoxia in cortical regions are determined by the type of neurons

present in cortical layers. Such a heterogeneous neuronal population makes the response of

neurons differ widely due to differences in membrane properties. The current study did not identify

any consistent pattern in global cortical response to hypoxia such as, neuronal depolarization

followed by hyperpolarization. Studies conducted in neocortical pyramidal neurons exhibited

hypoxia induced hyperpolarization followed by post-hypoxic hyperpolarization (Nieber, 1999).

Pyramidal cells in the prefrontal cortex showed a membrane depolarization along with decreased

input resistance following hypoxia (Brand, 1998).

Immunohistochemistry staining results in the current study, showed a positive staining for both

SNAP-25-2A-GCaMP-6s positive and negative animals. As GCaMP-6s negative animals lacked

the genes for fluorescence activity, they were used as negative control. Such a negative control is

advantageous as the entire tissue from the negative animal was prepared in the same manner as the

positive sample, minimizing experimental variability arising between positive and negative

experimental samples (Burry, 2011). The most likely reason for observing a positive staining result

22

in GCaMP-6s negative animal can be attributed to the reason that immunohistochemistry protocol

did not work properly leading to false positive result for GCaMP-6s negative animal.

Few limitations of this study are as follows: (1) using the current imaging set up, fluorescence

intensity is measured entirely from the cortical surface of the brain. It is unknown if sub-cortical

neurons also contribute to the recorded fluorescence signal. This is essential as the transgenic

mouse model used in this study has a pan-neuronal GCaMP-6s expression (2) spatial and temporal

information about the point of origin of fluorescence (in the right and left cortex) was not measured

in the study. It is unknown if the region of origin for this fluorescence activity is fixed or variable

among animals (3) owing to the ultrasensitive nature of GCaMP-6s, in addition to detecting rapid

changes in intracellular free calcium caused by neuronal activity, intracellular reserves of calcium

may also be detected by GCaMP-6s in this study. This could overestimate neuronal activity as

recorded by fluorescence signals.

Directions for future research aligned with this study: (1) introducing normoxia (normal air)

following hypoxic air exposure and investigating whether reduction associated with frequency of

neuronal firing under hypoxia is a reversible or an irreversible manifestation; (2) investigating the

effects of acute hypoxia on the ability to perform behavioral tasks on adult animals, that were

exposed to acute hypoxic exposure during their first week of postnatal development; (3)

investigating suppressive effect of hypoxia on neuronal activity with increasing age (from P8-

P15); (4) experiment to quantitatively determine the concentration of calcium present in the

neuron’s cytosol, during the firing of an action potential can be performed. Using this experiment,

a comparison between the concentration of calcium ions during neuronal firing under normoxic

and hypoxic conditions can be performed. Such an analysis of concentration would clarify the

theory of accumulated calcium ions causing greater amplitude fluorescence peaks under hypoxic

conditions. Pivovarova et al., in their 2010 review paper list the various techniques that are

available for estimating the concentration of intracellular calcium ions; (5) analysis to trace the

spread of fluorescence activity (representing neuronal activity) over the cortical area, indicating

origin and direction of spread of fluorescence signals.

CONCLUSION

In the current study, a reduction in the number of intensity peaks immediately following exposure

to a hypoxic environment of 10 minutes as compared to baseline (normal air) was observed. To

the best of knowledge this study is the first of its kind to perform an in-vivo recording of response

of an unanesthetized and awake animal to an acute-hypoxic environment at P7. An observed

reduction in the frequency and increase in amplitude of neuronal activity under hypoxic conditions

was observed. Synchrony in neuronal firing between the left and right cortex was observed. The

results of this study are in alignment with the previous studies performed using brain slices-

presence of suppression of neural activity in response to exposure to hypoxic air.

23

REFERENCES

Ackman, J. B., Burbridge, T. J., & Crair, M. C. (2012). Retinal waves coordinate patterned

activity throughout the developing visual system. Nature, 490(7419), 219–225.

https://doi.org/10.1038/nature11529

Babola, T. A., Li, S., Gribizis, A., Lee, B. J., Issa, J. B., Wang, H. C., … Bergles, D. E. (2018).

Homeostatic Control of Spontaneous Activity in the Developing Auditory System. Neuron,

99(3), 511-524.e5. https://doi.org/10.1016/j.neuron.2018.07.004

Balestrino, M. (1995). Pathophysiology of anoxic depolarization: new findings and a working

hypothesis. Journal of Neuroscience Methods, 59(1), 99–103. https://doi.org/10.1016/0165-

0270(94)00199-Q

Bayer, C., Shi, K., Astner, S. T., Maftei, C. A., & Vaupel, P. (2011). Acute Versus Chronic

Hypoxia: Why a Simplified Classification is Simply Not Enough. International Journal of

Radiation Oncology, 80(4), 965–968. https://doi.org/10.1016/j.ijrobp.2011.02.049

Bockhorst, K. H., Narayana, P. A., Liu, R., Ahobila-Vijjula, P., Ramu, J., Kamel, M., … Perez-

Polo, J. R. (2008). Early postnatal development of rat brain: In vivo diffusion tensor

imaging. Journal of Neuroscience Research, 86(7), 1520–1528.

https://doi.org/10.1002/jnr.21607

Burry, R. W. (2011). Controls for immunocytochemistry: An update. Journal of Histochemistry

and Cytochemistry, 59(1), 6–12. https://doi.org/10.1369/jhc.2010.956920

Chen, T.W., Wardill, T. J., Sun, Y., Pulver, S. R., Renninger, S. L., Baohan, A., … Kim, D. S.

(2013). Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature, 499, 295-

300. https://doi.org/10.1038/nature12354

Choi, D. W. (1990). Cerebral hypoxia: some new approaches and unanswered questions. The

Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 10(8),

2493–2501.

De Haan, M., Wyatt, J. S., Roth, S., Vargha-Khadem, F., Gadian, D., & Mishkin, M. (2006).

Brain and cognitive-behavioural development after asphyxia at term birth. In

Developmental Science, 9, 350-8.

Dodge, F. A., & Rahamimoff, R. (1967). Co‐operative action of calcium ions in transmitter

release at the neuromuscular junction. The Journal of Physiology, 193(2), 419-32.

https://doi.org/10.1113/jphysiol.1967.sp008367

Duchen, M. R. (2012). Mitochondria, calcium-dependent neuronal death and neurodegenerative

disease. Pflugers Archiv European Journal of Physiology, 464(1), 111-21.

https://doi.org/10.1007/s00424-012-1112-0

Dumanska, H., & Veselovsky, N. (2019). Short-term hypoxia induces bidirectional pathological

long-term plasticity of neurotransmission in visual retinocollicular pathway. Experimental

Eye Research, 179, 25–31. https://doi.org/10.1016/j.exer.2018.10.014

Erecińska, M., & Silver, I. A. (2001). Tissue oxygen tension and brain sensitivity to hypoxia.

Respiration Physiology, 128(3), 263–276. https://doi.org/10.1016/S0034-5687(01)00306-1

Funke, F., Kron, M., Dutschmann, M., & Müller, M. (2009). Infant Brain Stem Is Prone to the

Generation of Spreading Depression During Severe Hypoxia. Journal of Neurophysiology,

101(5), 2395–2410. https://doi.org/10.1152/jn.91260.2008

Garcia, M. I., Chen, J. J., & Boehning, D. (2017). Genetically encoded calcium indicators for

studying long-term calcium dynamics during apoptosis. Cell Calcium, 61, 44–49.

https://doi.org/10.1016/j.ceca.2016.12.010

24

Homma, R., Baker, B. J., Jin, L., Garaschuk, O., Konnerth, A., Cohen, L. B., … Zecevic, D.

(2009). Wide-field and two-photon imaging of brain activity with voltage- and calcium-

sensitive dyes. Methods in Molecular Biology, 489, 43-79. https://doi.org/10.1007/978-1-

59745-543-5_3

Hutter, D., Kingdom, J., & Jaeggi, E. (2010). Causes and Mechanisms of Intrauterine Hypoxia

and Its Impact on the Fetal Cardiovascular System: A Review. International Journal of

Pediatrics, 2010, 1–9. https://doi.org/10.1155/2010/401323

Hyllienmark, L., & Brismar, T. (1999). Effect of hypoxia on membrane potential and resting

conductance in rat hippocampal neurons. Neuroscience, 91(2), 511–517.

https://doi.org/10.1016/S0306-4522(98)00650-2

Karunasinghe, R. N., Dean, J. M., & Lipski, J. (2018). Acute sensitivity of astrocytes in the

Substantia Nigra to oxygen and glucose deprivation (OGD) compared with hippocampal

astrocytes in brain slices. Neuroscience Letters, 685, 137–143.

https://doi.org/10.1016/j.neulet.2018.08.033

Kriegstein, A., & Alvarez-Buylla, A. (2009). The Glial Nature of Embryonic and Adult Neural

Stem Cells. Annual Review of Neuroscience, 32(1), 149–184.

https://doi.org/10.1146/annurev.neuro.051508.135600

Lawn, E., Cousens, J. Z. (2005). MDGs and newborn babies. Lancet, 365, 891–900.

https://doi.org/10.1016/S0140-6736(05)71048-5

Lima, M. J. P., Rayee, D., Silva-Rodrigues Thaiaand Paes Pereira, P. R., Miranda Mendonca, A.

P., Rodrigues-Ferreira, C., Szczupak, D., … Uziel, D. (2018). Perinatal Asphyxia and Brain

Development: Mitochondrial Damage WithoutAnatomical or Cellular Losses. Molecular

Neurobiology, 55(11), 8668–8679. https://doi.org/10.1007/s12035-018-1019-7

Lewis, S. W., & Murray, R. M. (1987). Obstetric complications, neurodevelopmental deviance,

and risk of schizophrenia. Journal of Psychiatric Research, 21(4), 413-21.

https://doi.org/10.1016/0022-3956(87)90088-4

Lipton, S. A., & Rosenberg, P. A. (1994). Excitatory amino acids as a final common pathway for

neurologic disorders. The New England Journal of Medicine, 330(9), 613-22.

https://doi.org/10.1056/NEJM199403033300907

Lunyak, V. V. (2016). Corepressor-Dependent Silencing of Chromosomal Regions Encoding

Neuronal Genes. 298(5599), 1742-52.

Luo, Q., Pin, T., Dai, L., Chen, G., Chen, Y., Tian, F., & Zhang, M. (2019). The Role of S100B

Protein at 24 Hours of Postnatal Age as Early Indicator of Brain Damage and Prognostic

Parameter of Perinatal Asphyxia. Global Pediatric Health, 6, 2333794X1983372.

https://doi.org/10.1177/2333794x19833729

Maiti, P., Singh, S. B., Sharma, A. K., Muthuraju, S., Banerjee, P. K., & Ilavazhagan, G. (2006).

Hypobaric hypoxia induces oxidative stress in rat brain. Neurochemistry International,

49(8), 709–716. https://doi.org/10.1016/j.neuint.2006.06.002

Mucci, S., Herrera, M. I., Barreto, G. E., Kolliker-Frers, R., & Capani, F. (2017).

Neuroprotection in Hypoxic-Ischemic Brain Injury Targeting Glial Cells. Current

Pharmaceutical Design, 23(26), 3899-906.

https://doi.org/10.2174/1381612823666170727145422

Nalivaeva, N. N., Turner, A. J., & Zhuravin, I. A. (2018). Role of prenatal hypoxia in brain

development, cognitive functions, and neurodegeneration. Frontiers in Neuroscience, 12, 1–

21. https://doi.org/10.3389/fnins.2018.00825

Nieber, K. (1999). Hypoxia and neuronal function under in vitro conditions. Pharmacology and

25

Therapeutics, 82(1), 71–86. https://doi.org/10.1016/S0163-7258(98)00061-8

Nho, K., Kim, S., Risacher, S. L., Shen, L., Corneveaux, J. J., Swaminathan, S., … Saykin, A. J.

(2015). Protective variant for hippocampal atrophy identified by whole exome sequencing.

Annals of Neurology, 77(3), 547–552. https://doi.org/10.1002/ana.24349

Peacock, A. J. (1998). Oxygen at high altitude. Bmj, 317(7165), 1063.

https://doi.org/10.1136/bmj.317.7165.1063

Semple, B. D., Blomgren, K., Gimlin, K., Ferriero, D. M., & Noble-Haeusslein, L. J. (2013).

Brain development in rodents and humans: Identifying benchmarks of maturation and

vulnerability to injury across species. Progress in Neurobiology, 106–107, 1–16.

https://doi.org/10.1016/j.pneurobio.2013.04.001

Shimoda, L. A., & Polak, J. (2010). Hypoxia. 4. Hypoxia and ion channel function. American

Journal of Physiology-Cell Physiology, 300(5), C951–C967.

https://doi.org/10.1152/ajpcell.00512.2010

Soleimanzad, H., Gurden, H., & Pain, F. (2017). Errata: Optical properties of mice skull bone in

the 455- to 705-nm range. Journal of Biomedical Optics, 22(4), 049802.

https://doi.org/10.1117/1.jbo.22.4.049802

Van De Berg, W. D. J., Blokland, A., Cuello, A. C., Schmitz, C., Vreuls, W., Steinbusch, H. W.

M., & Blanco, C. E. (2000). Perinatal asphyxia results in changes in presynaptic bouton

number in striatum and cerebral cortex - A stereological and behavioral analysis. Journal of

Chemical Neuroanatomy, 20(1), 71–82. https://doi.org/10.1016/S0891-0618(00)00078-8

Vanni, M. P., & Murphy, T. H. (2014). Mesoscale Transcranial Spontaneous Activity Mapping

in GCaMP3 Transgenic Mice Reveals Extensive Reciprocal Connections between Areas of

Somatomotor Cortex. Journal of Neuroscience, 34(48), 15931–15946.

https://doi.org/10.1523/jneurosci.1818-14.2014

Weitzdoerfer, R., Gerstl, N., Pollak, D., Hoeger, H., Dreher, W., & Lubec, G. (2004). Long-term

influence of perinatal asphyxia on the social behavior in aging rats. Gerontology, 50(4),

200-5. https://doi.org/10.1159/000078348

Yin, X.-L., Jie, H.-Q., Liang, M., Gong, L.-N., Liu, H.-W., Pan, H.-L., … Yin, S.-K. (2018).

Accelerated Development of the First-Order Central Auditory Neurons With Spontaneous

Activity. Frontiers in Molecular Neuroscience, 11, 1–17.

https://doi.org/10.3389/fnmol.2018.00183

Zimna, A., & Kurpisz, M. (2015). Hypoxia-Inducible Factor-1 in Physiological and

Pathophysiological Angiogenesis: Applications and Therapies. BioMed Research

International, 2015, 1–13. https://doi.org/10.1155/2015/549412