cell biochemistry and function

Cell Biochem Funct 2003; 21: 105–111.

Published online 1 November 2002 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cbf.1002

Effect of dexamethasone on neutrophil metabolism

Carolina Garcia1, Marina Costa Xavier de Oliveira1, Rozangela Verlengia1, Rui Curi1

and Tania Cristina Pithon-Curi*2

1Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of Sao Paulo, Brazil2Methodist University of Piracicaba-FACEF and Camilo Castelo Branco University, Sao Paulo, Brazil

The effect of dexamethasone on glucose and glutamine metabolism was investigated. The consumption and oxidation ofglucose and glutamine, and the production of glutamate and lactate were determined in neutrophils cultured for 3 h inthe presence of dexamethasone. The activities and expression of glucose-6-phosphate dehydrogenase (G6PDH) andphosphate-dependent glutaminase were also determined under the same conditions. Addition of dexamethasone to the cul-ture medium caused a significant increase of glucose consumption at 0.5 mM (123.9%) and 1.0 mM (78.3%) concentrations. Inspite of this, however, glucose oxidation remained unchanged. The glucocorticoid did not change glutamine consumptionbut caused a significant increase of glutamate production and did not alter glutamine oxidation. Dexamethasone-treatedneutrophils had a significant decrease of G6PDH activity and expression in particular at 1.0 mM concentration. Phosphate-dependent glutaminase activity was also decreased (about 34%) by dexamethasone treatment. A similar effect was observedon glutaminase expression as indicated by RT-PCR analysis. Thus, the effect of dexamethasone on neutrophil metabolismwas particularly noticeable with respect to G6PDH and glutaminase activities where a decrease in the respective mRNAlevels was demonstrated. Copyright # 2002 John Wiley & Sons, Ltd.

key words— neutrophils; dexamethasone; glucose-6-phosphate dehydrogenase; phosphate-dependent glutaminase

INTRODUCTION

Neutrophils contain a characteristic lobulated nucleusthat has given rise to the term polymorphonuclear leu-kocyte. At any time, more than 90% of the neutrophilpopulation is represented as newly differentiated cellslocated within the bone marrow. The remainder of thepopulation is distributed between the circulation andthe vascular endothelium where the cells are attachedto marginated pools or located within specific tissues.With the onset of phagocytosis of bacteria or tissuefragments by neutrophils, a number of different cellu-lar processes are triggered, including: motility, a res-piratory burst, secretion of cytoplasmic (proteolytic)

enzymes, and immunomodulatory compounds. Thecombination of these processes assists the killing anddigestion of the engulfed bacteria and, if prolonged,the development of a local inflammation. An increasein the respiratory burst, which is characterized by acti-vation of the nicotinamide adenine dinucleotidephosphate (NADPH)-dependent membrane-associatedoxidase, involves a sudden stimulus-induced increasein non-mitochondrial oxidative metabolism that resultsin the production of the superoxide anion and associa-ted reactive oxygen species.1

As is the case with lymphocytes and macro-phages,2,3 neutrophils also utilize glucose and gluta-mine at high rates.4 The role of high rates ofutilization of these fuels by neutrophils has not beenfully determined yet. Evidence has been obtained thatglucose metabolism is required both for new mem-brane synthesis during active periods of phagocytosisand for production of NADPH (through the pentosephosphate pathway).5,6 The metabolism of glutaminehas been associated with phagocytosis7,8 and produc-tion of O:�

2 , 9–11 and TNF12 by neutrophils.

Received 12 February 2002Copyright # 2002 John Wiley & Sons, Ltd. Accepted 3 July 2002

* Correspondence to: T. C. Pithon-Curi, Departamento de Fisiologiae Biofısica, Instituto de Ciencias Biomedicas, Universidade de SaoPaulo, Av. Prof. Lineu Prestes, 1524, 05508-900, Butantan, SaoPaulo, SP, Brasil. Tel: 55-11-3091-7245. Fax: 55-11-3091-7285.E-mail: tcuri@fisio.icb.usp.br

Glucocorticoids exert powerful inhibitory effectson neutrophil functions,13 particularly for those cellsthat have undergone priming or activation. The effectof glucocorticoids on neutrophils has been examinedin vitro, using high doses of synthetic steroids such asdexamethasone. There is also evidence that the levelsof cortisol produced during stress responses can havesimilar effects in vivo. Therapeutically, this can becounter-productive, as one of the most notable side-effects of high dose steroid treatment is decreasedresistance to infection due to impaired neutrophil bac-tericidal activities. Interestingly, glucocorticoids actto inhibit apoptosis in neutrophils.14 This raises theapparent anomalous response to steroids, i.e. increas-ing the survival of these cells, while suppressing theirfunction.

In the present study, the effect of dexamethasone onglucose and glutamine metabolism of rat neutrophilswas investigated. The consumption and oxidation ofglucose and glutamine, and the production of glutamateand lactate were determined in neutrophils cultivatedfor 3 h in the presence of dexamethasone. Also, theactivities and expression of glucose-6-phosphate dehy-drogenase (G6PDH) and phosphate-dependent gluta-minase were determined under the same conditions.

MATERIALS AND METHODS

Chemicals and enzymes

All reagents were of analytical grade. RPMI-1640,penicillin–streptomycin, fetal calf serum (FCS), pri-mers, SUPERSCRIPTTM RNase H� Reverse tran-scriptase, magnesium chloride, EDTA, DTT, Trizol,agarose, and DNAse were obtained from GIBCOBRL, Gaitheresburg, MD, USA. Glycogen type IIfrom oyster, glutaminase, Triton X-100, NAD, ADP,dexamethasone, trypan blue, acetic acid, trichloroace-tic acid (TCA), phenylethylamine, glucose, gluta-mine, and lactate dehydrogenase were obtained fromSigma Chemical Co., St. Louis, MO, USA. Ethanol,isopropanol, methanol, and chloroform were obtainedfrom Merck, Darmstadt, Germany. Ethidium bromide,dNTPs, xilenocianol-FF, Taq DNA polymerase,[U-14C] glucose and [U-14C] glutamine were obtainedfrom Amersham Pharmacia Biothec, Buckingham-shire, UK. Tris, NaCl, KCl, KH2PO4.H2O, K2HPO4,Na2HPO4.7H2O, MgCl2, were obtained from ReagenQuimibras Industria Brasileira S/A (Rio de Janeiro,RJ, Brazil). Bromophenol blue was obtained fromBDH Chemical, Poole, UK. The liquid scintillationcocktail was obtained from ICN Biomedical, CostaMesa, CA.

Animals

Male Wistar rats weighing 180 g (about 2 months ofage) were obtained from the Biomedical Institute(USP, Sao Paulo, Brazil). The rats were maintainedat 23�C under a cycle of 12 h light: 12 h darknessfor 2 weeks before being used. The Animal CareCommittee of the Institute of Biomedical Sciencesapproved the experimental procedure of this study.

Peritoneal neutrophil preparation

The cells were obtained from the rats killed by decap-itation without anaesthesia. Neutrophils wereobtained by intraperitoneal (i.p.) lavage with 40 mlof sterile phosphate-buffered saline (PBS), 4 h afterthe i.p. injection of 20 ml of sterile oyster glycogensolution (1%) in PBS. The cells were washed by cen-trifugation (850 g for 8 min) three times in PBS. Thenumber of viable cells, (>95% neutrophils), wascounted in a Neubauer chamber in an optical micro-scope (Axiovert 100 M, Zeiss), using a Trypan Bluesolution (1%).

[U-14C]-Glucose and [U-14C]-glutaminedecarboxylation

Neutrophil production of 14CO2 from [U-14C] glucoseor [U-14C] glutamine was determined as previouslydescribed.15 Neutrophils were incubated for 1 h inthe presence of [U-14C]-glucose or [U-14C]-glutaminein a stoppered Erlenmeyer flask (25 ml) containingone compartment for cell incubation and another forCO2 collection. Cells were then disrupted by adding200ml of trichloroacetic acid solution (25%). Thelabelled CO2 was collected over 1 h in a solution ofphenylethylamine: methanol (1:1, v/v) and the radio-activity counted in a Beckman-LS 5000 TD liquidscintillation counter (Beckman Instruments, Fullerton,CA, USA).

Metabolite measurements

Neutralized samples of the incubation medium wereused for measurements of glucose,16 glutamine,17 glu-tamate18 and lactate.19 The production of NADH orNADPH was monitored at 340 nm, using a PharmaciaBiotech spectrophotometer (Ultrospec 3000 model).By comparing the values at time zero and thoseobtained after a 1-h incubation, glutamine and glucoseconsumption and production of glutamate and lactateby incubated neutrophils were calculated.

106 c. garcia et al.

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.

Glutaminase (phosphate-dependent) and glucose-6-phosphate dehydrogenase assays

For the measurement of phosphate-dependent gluta-minase activity in neutrophils, the cells were obtainedby centrifugation at 4�C and then homogenized in anextraction medium, containing 150 mM potassiumphosphate, 1 mM EDTA, 50 mM Tris-HCl at pH 8.6.Phosphate-dependent glutaminase (E.C. 3.5.1.2) wasassayed as described by Curthoys and Lowry.20 Theassay medium consisted of 50 mM phosphate buffer,0.2 mM EDTA, 50 mM Tris-HCl, 20 mM glutamine,and 0.05% (v/v) Triton X-100, to which 100 ml of neu-trophil homogenate were added. The total volume was1.0 ml and the pH was 8.6. Assay media, in duplicate,were incubated at 37�C. The reaction was initiated bythe addition of freshly prepared glutamine, promotinga 10-min linear reaction time course. The reaction wasstopped by adding 0.2 ml of 25% (w/v) TCA solutionfollowed by neutralization with 40% KOH solutionand a tris(hydroxymethyl)aminomethane (Tris).KOH(0.5–2.0 M) solution. The amount of glutamate wasdetermined through enzymic reactions which generateNADH and the changes in absorbance were followedat 340 nm (Ultrospec 3000 model) for 60 min asdescribed by Bernt and Bergmeyer.18 Glutamate wasassayed using glutamate dehydrogenase (4.5 U ml�1)and NAD (1.6 mM) in a buffer solution containing300 mM glycine and 250 mM hydrazine, 1 mM ADP,at pH 9.0. The final volume of the assay mixture inall cases was 1.0 ml. The activity of glucose-6-phosphate dehydrogenase (G6PDH; EC 1.1.1.49)was determined as previously described.4,10 Theextraction medium contained 50 mM Tris-HCl and1 mM EDTA; the final pH was 8.0. For the enzymeassay, Triton X-100 0.05% (v/v) was added to theassay system to complete the extraction of theenzyme. The released enzyme was assayed by follow-ing the changes at 340 nm and 25�C.

Expression of the results

The enzyme activities are expressed as nmolmin�1 mg�1 protein. The consumption of glucoseand glutamine, the production of glutamate and lac-tate, and the decarboxylation of [U-14C]-glucose and[U-14C]-glutamine of 3 h-incubated neutrophils areexpressed as nmol h�1 mg�1 protein.

RNA extraction

Neutrophils were cultured in RPMI-1640 in the pre-sence of dexamethasone (0.5 or 1.0 mM) for 3 h, and

compared with control cells (to which no dexametha-sone was added). Neutrophil total RNA was obtainedfrom 0.5–1� 107 cells by the guanidinium isothiocya-nate extraction method as described by Chomczynskiand Sacchi21, using Trizol reagent (Life Technolo-gies). Briefly, the cells were lysed using 1 ml of Trizolreagent. After a 5-min incubation at room tempera-ture, 200 ml chloroform was added to the tubes fol-lowed by centrifugation at 12 000 g. The aqueousphase was transferred to another tube and the RNAwas precipitated by cold isopropanol and pelleted bycentrifugation (12 000 g). The pellets were washedwith ethanol and dried in air. RNA pellets were resus-pended in RNase-free water, and aliquots were storedat � 70�C until the time of the experiment. The RNAwas quantified by measuring absorbance at 260 nm.The purity of the RNA was assessed by the 260/280 nm ratios and by electrophoresis on a 1% agarosegel containing ethidium bromide at 5 mg ml�1.

Reverse transcription-polymerase chain reaction(RT-PCR)

Total RNA (2 mg) was treated with 1 U DNase I for25 min at 25�C and inactivated with 2.5 mM EDTA.Afterwards, the cDNA was synthesized in a 20-mlreaction medium containing 10 mM of each dNTP,10 mM DTT, and 200 units SUPERSCRIPTTM IIRnase H� reverse transcriptase (Gibco-BRL LifeTechnologies) at 42�C for 50 min.

Primers used

The primer sequences were designed using the GeneJockey Sequence Processor software from informa-tion contained in the GeneBank of the National Centerfor Biotechnology Information (NCBI). The seq-uences were (50–30): (a) glutaminase TGACAA-GATGGGCAACAGTG (sense) and GTTATTCCACCTGTCCTTGG (antisense), (b) G6PDH CCTCTATGTGGAGAATGAACGG (sense) and TCGGCTGCCATAGACATACG (antisense), (c) bcl-2 GATGACTTCTCTCGTCGCTACC (sense) and TGAAGAGTTCCTCCACCACC (antisense) and (d) �-actin GTGGGGCGCCCCAGGCAGCA (sense) and CTCCTTAATGTCACGCACGATTTC (antisense). The predictedsizes of the PCR-amplified products were 348 basepairs (bp) for glutaminase, 438 bp for glucose-6-phos-phate dehydrogenase, 111 bp for bcl-2, and 549 bp for�-actin. The PCR products were of the expected sizeand showed authenticity to the sequences deposited inthe GeneBank (glutaminase, accession no. NM012569; G6PDH, accession no. X07467; and bcl-2,accession no. NM016993).

dexamethasone and neutrophil metabolism 107

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.

Standardized conditions for RT-PCR

The PCR performed in a 50-ml final volume was car-ried out in a Techne-Genius Thermal cycler (Oxford,UK). The PCR for each primer was optimized toobtain a better linear amplification of the cDNA understudy. The optimized conditions for amplificationwere: (a) glutaminase, 2.5 mM MgCl2, 55�C annealingtemperature and 35 cycles, (b) G6PDH, 3 mM MgCl262�C annealing temperature and 40 cycles, (c) bcl-2,2.5 mM MgCl2, 60�C annealing temperature and 35cycles, and (d) �-actin, 2.0 mM MgCl2, 60�C anneal-ing temperature and 25 cycles. For a semi-quantitativeanalysis of the PCR, the housekeeping �-actin genewas used as reference.

Analysis of the PCR products

For the analysis of PCR amplification products, ali-quots of amplification reaction (0.25% bromophenolblue, 0.25% xilenocianol-FF and 30% glycerol) wereapplied to a 1.5% agarose gel containing 0.5 mg ml�1

ethidium bromide and electrophoresed for 1 h at100 V. The gels were photographed using a DC120Zoom Digital Camera system from Kodak (Gibco-BRL, Life Technologies). The images were processedand analysed using software from Kodak DigitalScience 1D Image Analysis (Gibco-BRL, Life Tech-nologies). Gene expression was analysed in relative

values (relative expression) between the OD of thegene of interest and OD of �-actin (gene of interest/�-actin) for each treatment with dexamethasone.

Statistical analysis

Differences were assessed by ANOVA, using InStatsoftware (GraphPad Software, Inc., San Diego, CA).The significance level was set for p< 0.05.

RESULTS

Addition of dexamethasone to the neutrophil incuba-tion medium caused a significant increase in glucoseconsumption at 0.5 mM (123.9%) and 1.0 mM (78.3%)(Table 1). Dexamethasone caused a decrease in lactateproduction at 0.5 mM (17.3%) but had no effect at1.0 mM concentration. In spite of the increment in glu-cose consumption, glucose oxidation was not affectedby dexamethasone (Table 1).

Dexamethasone treatment did not change gluta-mine consumption and glutamine oxidation by incu-bated neutrophils (Table 2). This sterol howeverraised glutamate production at 0.5 mM (33%) and1.0 mM (43 %).

Dexamethasone treated-neutrophils exhibited adecrease (by 25%) in G6PDH activity (Table 3) andexpression (Figure 1) at 1.0 mM concentration. Phos-phate-dependent glutaminase activity was decreased

Table 1. Effect of dexamethasone on glucose consumption, lactate production, and [U-14C]-glucose oxidation in 3-h cultured neutrophils

Dexamethasone (mM)

Control 0.5 1.0

Glucose consumption (nmol h�1 mg�1 protein) 460� 10 1030� 30* 820� 10*,y

Lactate production (nmol h�1 mg�1 protein) 550� 10 455� 30* 520� 40[U-14C]-glucose decarboxylation (nmol h�1 mg�1 protein) 2.94� 0.13 3.08� 0.48 2.68� 0.22

The values are expressed as mean�SEM of 10 determinations from five different cell preparations.*p< 0.05 as compared with control.yp< 0.05 due to the effect of 1.0mM as compared with 0.5 mM dexamethasone.

Table 2. Effect of dexamethasone on glutamine consumption, glutamate production, and [U-14C]-glutamine oxidation in 3-h culturedneutrophils

Dexamethasone (mM)

Control 0.5 1.0

Glutamine consumption (nmol h�1 mg�1 protein) 356� 44 285� 37 275� 39Glutamate production (nmol h�1 mg�1 protein) 145� 3.2 193� 15.4* 207� 12.1*[U-14C]-glutamine oxidation (nmol h�1 mg�1 protein) 5.7� 0.5 6.9� 0.8 5.7� 0.7

The values are expressed as mean�SEM of 10 determinations from five different cell preparations.*p< 0.05 as compared with control.

108 c. garcia et al.

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.

by 32.3 and 36.0% at 0.5 and 1.0 mM dexamethasone,respectively (Table 3). A similar effect was observedon glutaminase expression as indicated by RT-PCRanalysis (Figure 1).

DISCUSSION

Glucocorticoids are well known to regulate the functionof the immune system following changes in secretioninduced by stressful conditions such as prolonged exer-cise22 and injuries.23 These hormones are commonlyused in the treatment of a wide variety of immuneand inflammatory diseases, including rheumatoidarthritis, asthma and psoriasis. However, the mechan-ism by which glucocorticoids exert their immunosup-pressive and anti-inflammatory actions remains to befully established. Rats injected with dexamethasoneshow marked changes of metabolism in macrophages24

and lymphocytes.25 In spite of this information, and thefact that the metabolic profile of lymphocytes, macro-phages and neutrophils is very similar,2 the effect ofglucocorticoids on the metabolism of the latter cellshas, until now, remained unknown.

Evidence is presented herein that dexamethasoneaffects the metabolism of glucose and glutamine inneutrophils as has also previously been shown foradrenaline10 and L-triiodothyronine (T3).26 Dexa-methasone caused a significant increase in glucoseconsumption by incubated neutrophils. A similarincrease in glucose consumption was found in macro-phages from hyperthyroid rats.26 In diabetic rats, how-ever, macrophage glucose consumption is low.27 Theslight reduction in lactate production may be relatedto an effect of dexamethasone on pyruvate metabo-lism as reported for lymphocytes.25 The oxidation ofglucose however was not affected by dexamethasone.Therefore, this glucocorticoid may cause an accumu-lation of glucose-derived carbons in neutrophils.

The pentose phosphate pathway provides NADPHfor the respiratory burst. G6PDH is an importantenzyme of this metabolic pathway and changes in its

activity affect neutrophil function.28 Dexamethasone-treated neutrophils exhibited a significant decrease inG6PDH activity and expression. A previous study hasshown that the activity of this enzyme is also reducedby T3 in human lymphocytes.29 In rat macrophages,dexamethasone does not affect G6PDH activity,whereas insulin causes a significant increase.30 Pro-gesterone seems to play a role in maintainingG6PDH activity in macrophages whereas estrogendoes not have a significant effect.31

Glutamine metabolism plays an important role inlymphocyte,32,33 macrophage34,31 and neutrophilfunction.10,12 Dexamethasone did not markedly affectglutamine consumption and oxidation in incubatedneutrophils. These findings support the belief thatdexamethasone does not markedly affect glutaminemetabolism in neutrophils something that has alsobeen found in lymphocytes.25 The increase in gluta-mate production may result from proteolysis whichis known to be stimulated by glucocorticoids.35 Mea-surement of the release of other amino acids wouldtest this possibility.

As is the case with macrophages and lymphocytes,neutrophils express a kidney-type phosphate-depen-dent glutaminase activity as a key enzyme of the glu-tamine metabolic pathway. Phosphate-dependentglutaminase activity and expression were decreasedby dexamethasone treatment. Experiments carriedout in rats show that reduction of glucocorticoid pro-duction by adrenalectomy and metyrapone treatmentcauses a significant increase of glutaminase activityin macrophages.7 These findings support the proposi-tion that in neutrophils the expression of the kidney-type glutaminase RNA is not regulated by acidosisalone, as reported for other tissues.36,37

Glucocorticoids modulate several aspects of neu-trophil function such as adhesion, migration, phago-cytosis and oxidative burst.14 The results presentedherein lead us to postulate that at least some of thesefunctional effects of dexamethasone may result fromchanges in glucose and glutamine metabolism. The

Table 3. Effect of dexamethasone on activities of glucose-6-phosphate dehydrogenase and phosphate-dependent glutaminase in 3-hcultured neutrophils

Dexamethasone (mM)

Control 0.5 1.0

Glucose-6-phosphate dehydrogenase (nmol h�1 mg�1 protein) 133.2� 9.3 128.6� 7.3 98.2� 8.6*,y

Phosphate-dependent glutaminase (nmol h�1 mg�1 protein) 30.0� 3.2 20.3� 2.2* 19.2� 3.2*

The values are expressed as mean�SEM of 10 determinations from five different cell preparations.*p< 0.05 as compared with control.yp< 0.05 due to the effect of 1.0mM as compared with 0.5 mM dexamethasone.

dexamethasone and neutrophil metabolism 109

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.

effect of dexamethasone on neutrophil metabolismwas particularly noticeable on activities of G6PDHand glutaminase. Dexamethasone led to a reductionof these enzyme activities by a decrease in the respec-tive mRNA levels. This effect was specific for theenzymes studied since no effect of dexamethasonewas observed on expression of bcl-2.

ACKNOWLEDGMENTS

The authors are grateful for the technical assistance ofJ. R. Mendonca, C. K. Miyasaka, G. Souza, and toProfessor E. A. Newsholme (Oxford University) forhis constant interest and encouragement.

REFERENCES

1. Babior BM. NADPH oxidase: an update.Blood 1999; 93: 1464–1476.

2. Curi R, Newsholme P, Pithon-Curi TC, et al. Metabolic fate ofglutamine in lymphocytes, macrophages and neutrophils. Braz JMed Biol Res 1999; 32: 15–21.

3. Newsholme P, Costa Rosa LFBP, Newsholme EA, Curi R. Theimportance of fuel metabolism to macrophage function. CellBiochem Funct 1996; 14: 1–10.

4. Pithon-Curi TC, Melo MP, Azevedo R, Zorn TMT, Curi R.Glutamine utilization by rat neutrophils. Presence of phosphate-dependent glutaminase. Am J Physiol 1997; 273: C1124–C1129.

5. Newsholme P, Curi R, Pithon-Curi TC, Murphy CJ, Garcia C,Melo MP. Glutamine metabolism by lymphocytes, macro-phages, and neutrophils: its importance in health and disease.J Nutr Biochem 1999; 10: 316–324.

6. Newsholme P. Why is L-glutamine metabolism important tocells of the immune system in health, post injury, surgery orinfection? J Nutr 2001; 131: S2515–S2522.

7. Costa Rosa LFBP, Cury Y. Hormonal control of macrophagefunction and glutamine metabolism. Biochem Cell Biol 1991;69: 309–312.

8. Pithon-Curi TC, Melo MP, Palanch AC, Miyasaka CK, Curi R.Percentage of phagocytosis, production of O.�

2, H2O2 and NO,and antioxidant enzyme activities of rat neutrophils in culture.Cell Biochem Funct 1998; 16: 43–49.

9. Furukawa S, Saito H, Inoue T, et al. Supplemental glutamineaugments phagocytosis and reactive oxygen intermediate pro-duction by neutrophils and monocytes from postoperativepatients in vitro. Nutrition 2000; 16: 323–329.

10. Garcia C, Pithon-Curi TC, Firmano ML, Melo MP, NewsholmeP, Curi R. Effects of adrenaline on glucose and glutaminemetabolism and superoxide production by rat neutrophils. ClinSci 1999; 96: 549–555.

11. Ogle CK, Ogle JD, Mao JX, et al. Effect of glutamine onphagocytosis and bacterial killing by normal and pediatric burnpatient neutrophils. J Parenter Enteral Nutr 1994; 18: 128–133.

12. Pithon-Curi TC, Trezena AG, Tavares de Lima W, Curi R.Evidence that glutamine is involved in neutrophil function. CellBiochem Funct 2001; 19: 1–6.

13. Takahira R, Yonemura K, Furse Y, Hishida A. Dexamethasoneattenuates neutrophil infiltration in the rat kidney in ischemia/reperfusion injury: the possible role of nitroxyl. Free Rad BiolMed 2001; 31: 809–815.

14. Liles WC, Dale DC, Klebanoff SJ. Glucocorticoids inhibitapoptosis of human neutrophils. Blood 1995; 86: 3181–3188.

15. Fernandes LC, Mattozo CA, Machado UF, Costa Rosa LFBP,Curi R. Insulin treatment can abolish changes in glucose andglutamine metabolism of lymphocytes and macrophages causedby the implantation of the Walker 256 tumor. Cell BiochemFunct 1996; 14: 187–192.

16. Barham D, Trinder P. An improved colour reagent for thedetermination of blood glucose by the oxidase system. Analyst1992; 97: 142–145.

Figure 1. Effect of Dexamethasone (0.5 and 1.0 mM) on: A)phosphate-dependent glutaminase, B) glucose-6-phosphate dehy-drogenase (G6PDH) and C) bcl-2 gene expression as determined byRT-PCR. The values are presented as mean�SEM of fourdeterminations from two different cell preparations.*(P< 0.05) for comparison with control.

110 c. garcia et al.

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.

17. Windmueller HG, Spaeth AE. Uptake and metabolism ofplasma glutamine by the small intestine. J Biol Chem 1974;249: 5070–5079.

18. Bernt E, Bergmeyer HU. L-Glutamate UV-assay with glutamatedehydrogenase and NAD. In Methods of Enzymatic Analysis,Bergmeyer HU (ed.). Academic Press: London, 1974;1704–1708.

19. Engel PC, Jones JB. Causes and elimination of erratic blanks inenzymatic metabolite assays involving the use of NADþ inalkaline hydrazine buffers: improved conditions for the assay ofL-glutamate, L-lactate, and other metabolites. Anal Biochem1978; 88: 475–484.

20. Curthoys NP, Lowry OH. The distribution of glutaminase iso-enzymes in the various structures of the nephron in normal,acidotic,andalkaloticratkidney.JBiolChem1973;248:162–168.

21. Chomczynski P, Sacchi N. Single-step method of RNA isolationby acid guanidinium thiocyanate–phenol–chloroform extrac-tion. Anal Biochem 1987; 162: 156–159.

22. Pedersen BK, Hoffman-Goetz L. Exercise and the immunesystem: regulation, integration, and adaptation. Physiol Rev2000; 80: 1055–1081.

23. Yaqoob P, Calder P. Cytokine production by human peripheralblood mononuclear cells: differential sensivity to glutamineavailability. Cytokine 1998; 10: 790–794.

24. Pereira B, Bechara EJH, Mendonca JR, Curi R. Superoxidedismutase, catalase and glutathione peroxidase activities in thelymphoid organs and skeletal muscles of rats treated withdexamethasone. Cell Biochem Funct 1999; 17: 15–19.

25. Serrano MAR, Curi R, Parry-Billings M, Williams JF, News-holme EA. Effects of glucocorticoids on lymphocyte metabo-lism. Am J Physiol 1993; 264: E24–E28.

26. Costa Rosa LFBP, Safi DA, Curi R. Effect of hypo- andhyperthyroidism on the function and metabolism of macro-phages in rats. Cell Biochem Funct 1995; 13: 141–147.

27. Costa Rosa LFBP, Safi DA, Cury Y, Curi R. The effect of insulinon macrophage metabolism and function. Cell Biochem Funct1996; 14: 33–42.

28. Lopes RL, Laurindo FRM, Mancini-Filho J, Curi R, SannomiyaP. NADPH-oxidase activity and lipid peroxidation inneutrophils from rats fed fat-rich diets. Cell Biochem Funct1999; 17: 57–64.

29. Werner MC, Costa Rosa LFBP, Romaldini JH, Curi R. Meta-bolism of glucose and glutamine in lymphocytes from Graves’hyperthyroid patients: influence of methimazole treatment. CellBiochem Funct 1996; 14: 97–104.

30. Costa Rosa LFBP, Cury Y, Curi R. Effects of insulin, gluco-corticoids and thyroid hormones on the activities of keyenzymes of glycolysis, glutaminolysis, the pentose-phosphatepathway and the Krebs cycle in rat macrophages. J Endocrinol1992; 135: 213–216.

31. Azevedo RB, Costa Rosa LFBP, Lacava ZGM, Curi R. Gona-dectomy impairs lymphocyte proliferation and macrophagefunction in male and female rats. Correlation with key enzymeactivities of glucose and glutamine metabolism. Cell BiochemFunct 1997; 15: 293–298.

32. Costa Rosa LFBP, Almeida AF, Safi DA, Curi R. Thioglycollatestimulus modifies lymphocyte metabolism and proliferation: acomparison with lymphocyte activation by Walker 256 tumorimplantation. Cell Biochem Funct 1993; 11: 251–255.

33. Otton R, Graziola F, Souza JAA, Pithon-Curi TC, Hirata MH,Curi R. Effect of dietary fat on lymphocyte proliferation andmetabolism. Cell Biochem Funct 1998; 16: 253–259.

34. Costa Rosa LFBP, Safi DA, Curi R. Effect of thioglycollate andBCG stimuli on glucose and glutamine metabolism in ratmacrophages. J Leukoc Biol 1994; 56: 10–14.

35. Muhlbacher F, Kapadia CR, Colpoys MF, Smith RJ, WilmoreDW. Effects of glucocorticoids on glutamine metabolism inskeletal muscle. Am J Physiol 1984; 247: E75–E83.

36. Labow BI, Souba WW, Abcouwer SF. Mechanisms governingthe expression of the enzymes of glutamine metabolism—glutaminase and glutamine synthetase. J Nutr 2001; 131:S2467–S2474.

37. Curthoys NP. Role of mitochondrial glutaminase in rat gluta-mine metabolism. J Nutr 2001; 131: S2491–S2495.

dexamethasone and neutrophil metabolism 111

Copyright # 2002 John Wiley & Sons, Ltd. Cell Biochem Funct 2003; 21: 105–111.