Eastern Shore Real Estate Guide
-
Upload
lynch-printing-llc -
Category
Documents
-
view
218 -
download
0
description
Transcript of Eastern Shore Real Estate Guide
![Page 1: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/1.jpg)
MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,
Talbot, Caroline, Dorchester, Wicomico & Somerset Counties
DETAILS ON THIS PROPERTY Sunshine Properties, Inc.Kelly Macomber 443-553-4984Located on Page 15
FOR ADVERTISING INFORMATIONCall Lynch Printing: 410/213-9200Toll Free 877/[email protected]
FOR ADVERTISING INFORMATION
Vol. 01 : No. 05
YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g
uid
e
eastern shore’s
ESREG.01.05.indd 1 4/12/11 2:25:04 PM
![Page 2: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/2.jpg)
Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 05
www.sharonre.com [email protected]
Penny M. WindsorRhonda Richardson Carol L. Wolf
BEAUTIFUL LOT – Almost half acre building lot in well established subdivision with public well. Community pier. Just outside of Cambridge, convenient to surrounding towns. $48,000.00 DO7547696
CRAFTSMAN – Totally updated kitchen with oak floors, granite counter tops, warming lights and new ceramic top stove and back splash. New bath fitter shower. Screened front and back porches with one car garage and workshop. $135,000.00 DO7571234
BRICK CAPE COD – 3 bedrooms, 2-1/2 baths on corner lot with beautiful mature trees. Lots of existing flowers and flowerbeds to add color to your landscaping. Rear yard is fenced with a large shed for storage. Great Marsh Park, YMCA and Yacht Club are just a short distance away. Great buy. $139,990.00 DO7560549
A GEM OF A HOME - This 3 bedroom, 2 bath home is well built with classic charm of wood floors, arched doorways and more. Full dry, basement and full attic, enclosed porches, garage, off-street parking and double lot. $129,900.00 DO7556713
EASY LIVING - At this waterview 1st floor condo near Yacht Club and Marina – dock your boat across the street or walk to restaurants and parks. ONLY $85,000.00 DO7568374
UPDATED - Home has been updated since 2004-2005 with replacement windows, plumbing, drywall, roof and electric. Appliances convey, 2 bedroom, 1 bath, perfect starter home. $79,900.00 DO7565531
NEW LISTINGS!
ESREG.01.05.indd 2 4/12/11 2:27:17 PM
![Page 3: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/3.jpg)
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 3
ESTATE SALE – 4.4 acres with 3 separate deeds on these waterfront properties with 3 bedroom, 3 bath main house, 2 bedroom guest house and waterfront building lot. Private setting with 448’ waterfront, outbuildings, paved drive and 2 car garage. $549,000.00 DO7362491
CHARM GALORE – In this 3 bedroom, 2 bath Cape Cod featuring 1st floor master bedroom. Gorgeous living room with fireplace and built-in bookcases, screened side porch, remodeled kitchen, garage, off street parking and more. $199,999.00 DO7537228
VICTORIAN HOME ON HIGH STREET – This 4 bedroom home offers 5 fireplaces, impressive foyer, spacious dining room and living room plus remodeled kitchen. The historic integrity remains with pocket doors, leaded windows, wood molding and trim. Must see to fully appreciate. $329,000.00 DO7518328
RESTORED – Beautiful Victorian with 3 finished floors on corner lot with wrap around porch, new kitchen, 3 new baths, new plumbing, wiring, landscaping and much more. SACRIfICING AT $466,740.00 DO7547400
GORGEOUS CONTEMPORARY – On large lot offers broad water views, sunsets, pier with boat lifts, inground pool and everything for entertaining and living the Eastern Shore lifestyle. Stunning and ready for you to enjoy this summer. $898,500.00 DO7560425
WATERfRONT RANCHER – This 3 bedroom, 2 bath home sits on beautiful dry lot just off the Choptank River. Lovely family room with fireplace, living room, dining room and screened waterside porch. $229,000.00 DO7556975
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 05 - Page 3
Penny M. WindsorRhonda Richardson Carol L. Wolf
ESREG.01.05.indd 3 4/12/11 2:26:49 PM
![Page 4: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/4.jpg)
Page 4 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05
ON THE COVER
For additional information on thislisting, from this realtor see page 15 or contact:
Sunshine Properties, Inc.Kelly MacomberOffi ce: 410.641.8550 / Cell: 443.553.4984www.sunshinepropinc.com
For advertising information in Eastern Shore’s Real Estate Guide
contact:
Craig LynchToll Free: 1-877-213-9220
Offi ce: 410-213-9200Fax: 410-213-9240
Email: [email protected]
Next Ad Submission DeadlineApril 29, 2011
Next Book DistributedMay 19, 2011
Want to see your home advertised in this magazine?Contact any of the real estate professionals
in this magazine.
“All real estate advertised herein is subject to the Federal Fair Housing Act which makes it illegal to advertise any preference, limitations, or discrimination based on race, color, religion, sex,
handicap, familial status, or national origin, or intention to make any such preferences, limitation, or discrimination. We will not knowingly accept any advertising for real estate which is in violation of the law. All persons are hereby informed that all dwellings advertised are available on an equalopportunity basis.”
contact:
Craig LynchToll Free: 1-877-213-9220
AN ENTERTAINER’S DELIGHT This magnifi cent waterfront estate property features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. Private resort setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more! $1,499,000
1 Vol. 1 Issue No. 1 - Please saw you saw us in the Eastern Shore Home Improvement Guide
Who Should I Ask For: Specialty:
What Licenses Do You Have:
Service Area: When Were You Established:
What Are Your Hours:
email: web:
Vol. 1 Issue 1
Improving & EnhancingYour Home on the Shore
Hardscapes Perfection443.443.4444 | Page 15
www.ShoreHomeGuide.com
2. Here is Where
7. Business Categories
12. Featured in Each Issue
16. Would be Listed
MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,
Talbot, Caroline, Dorchester, Wicomico & Somerset Counties
DETAILS ON THIS PROPERTY Sunshine Properties, Inc.Kelly Macomber 443-553-4984Located on Page 15
FOR ADVERTISING INFORMATIONCall Lynch Printing: 410/213-9200Toll Free 877/[email protected]
G INFORMATION
Vol. 01 : No. 05
YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g
uid
e
eastern shore’s Be sure to pick up BOTH publications!
Eastern Shore’s Real Estate Guide
to help you fi nd a REALTOR® or a home, and Eastern Shore’s Home Improvement Guide
to help you fi nd local business to improve your new home, or boost your
exisiting home’s value!
With over 25,000 publications distributed over the entire Eastern Shore, whether you are a home owner looking to buy or sell, a REALTOR® looking to gain exposure, or a home improvement business looking to
target clients, both of these publications are here for you!
REALESTATE gui
de
eastern shore’s
ESREG.01.05.indd 4 4/12/11 2:28:03 PM
![Page 5: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/5.jpg)
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 5
MHBRMHBR MHBR MHBR H # 457# 4545# 45775700
Actual view from residence
Have it all at The Gateway Grand, Ocean City’s premier oceanfront property. Ocean and bay views. Private terraces and shared lounges. Indoor and outdoor pools. The Vista residences off er beach lovers twice the luxury all year long.
Schedule your tour of the new Vista models today. Sales offi ce open daily from 10 a.m. to 5 p.m.
GrandValueOC.com866-531-5942 Two 48th Street, Ocean City, MD 21842
TTHHHHEEE GGGGGGGAAAAAAAATTTTTTEEEEEEEWWWWWAAAAYYYY GGGGGRRRRAAANDD IINNNTTTRRROOODDDDUUUCCEEEESSS......
LuLuLuLuxuxuxuxuryryryry T T T Thrhrhreeeeeee- - anana d d FoFoururu -BB- eddede rooommom R Resese iddididennenencececec sss wiwithth B Bototth h hh OcOceaean nn n anand d BaBaBay yy ViViViV ewewws s StStara tingg at $6$69999,9,90000..
TCC_GG_SpringAd_RealEstate_42806a.indd 1 4/6/11 11:20:48 AMESREG.01.05.indd 5 4/12/11 2:28:50 PM
![Page 6: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/6.jpg)
Page 6 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
VERY NICE 3 BR rancher within short distance of Schumaker Park pavil-ion & playground. Family rm has FP w/gas insert, sunroom, wood & tile floors, granite countertops & central air, 2-car detached garage w/shop area & woodstove, 10x21 shed & paved drive. $199,900. (468513)
SPACIOUS COLONIAL Northwest spa-cious colonial has 3Br, 2.5 bath with great room, DR, beautiful kitchen, screened porch, large MBR w/ walk-in closet and bath. 2 car attached garage and fenced patio. $249,900. Call Jill Yost 443-523-1365. (471089)
23 TIDEWATER SEAFORD, DEGlamorous contemporary 4BR, 4 bath Seaford home in Holly Shores has full finished basement, FP in Fam Rm, beau-tiful cathedral ceilings & state of the art kitchen, 3 car garage, walk up attic, spe-cial financing available. $599,900. Call Jill Yost (578562)
CHARMING rancher in a private setting. 3 bedrooms, 2 baths, fireplace in living room. Outside includes a deck, patio & a attached garage. $174,900. Call Jill Yost 443-523-1365. (470187)
NEW 3 BR 2 bath country Cape in He-bron has city services, central air, large front porch, main floor bedroom & bath. $169,900. Call Jill Yost 443-523-1365. (469208)
GREAT RANCHER Just around the corner from marina, over 4.5 acres sur-rounded by County Park. 3 bedroom rancher with central air, family room, and several outbuildings. $155,000. (468341)
CUSTOM bUILT 5bR, 3.5 bath Contem-porary with beautiful fireplace, cathedral ceiling Great Room, hardwood & tile floors, loft overlooking Great Room, of-fice, 2 master bedrooms, deck & 3 car garage on cul-de-sac just 13 miles East of Salisbury. $424,900 Call Jill Yost @ 443.523.1365 (453550)
CHARMING HOME In established neighborhood. Nice kitchen with tile floor, center island, recessed lighting, 2-car detached garage and large deck. $229,900. Call Jill Yost 443-523-1365.
SPECTACULAR RIVER VIEWS, Three acres, waterfront on creek, pond on property. 3BR, 3 baths new contempo-rary home with spacious rooms. Third floor loft room and much more. $624,900 Call Jill Yost 443.523.1365 (461623)
Jill Yost REALTOR® / AGENT
cell 443.523.1365 office 1.800.842.5704
Long & Foster® Real Estate, Inc.
Salisbury, Md
Page 6 - Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
ESREG.01.05.indd 6 4/12/11 2:29:25 PM
![Page 7: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/7.jpg)
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 7
107 S. Commerce StreetCentreville, MD 21617
www.AshleyPremier.com
410.758.3000 410.763.7000
123 N. Washington StreetEaston, MD 21601
PRESQUILE ON THE WYEEaston - Over 5 Acres and 800 feet of Waterfront $2,599,000 Joyce Wallace 410-829-5031
CENTREVILLEBeautiful 5 br, 3 ba, 1st & 2nd flr masters. Gorgeous inground pool and patio area. HUGE outbuilding w/elec/water/concrete floor. All on 2 acres in a lovely country location. $585,000 Kelli Miles 410-490-9107
HaRmONY Nice Farmette that has been redone w/new roof, siding, replacement windows. There is a stream and small pond. Mostly cleared; bring the horses. $298,000 Shirley Joyce 410-310-8635
TOTaL PRIVaCY - ON THE WaTER10+ Acres, tree lined drive. 5500 SF Georgian Revival Colonial, pier, boatlift, waterside pool. $2,100,000 Jack Ashley 410-310-0800
CHURCH HILLEquestrian Delight- 41.56 Acre Farm w/4 Stall Barn, Fenced Pasture, Run In Shed and Track. Remodeled kitchen and baths, sunroom, separate in-law suite. $634,900 Norma Coursey 410-490-1307
CENTREVILLE15 acres, deer and wildlife abound.Warm and inviting home with lots of upgrades and tons of space for the whole family. $399,900. Joyce Wallace 410-924-5031
CENTREVILLEA BEAUTY- Great kitchen w/breakfast area overlooking farm fields. Gas fire place in spacious living room, bright and airy foyer and open dining. Large master suite w/soaking tub,separate shower. (QA7526897) $424,900 Norma Coursey 410-490-1307
WYE mILLS2+ unrestricted acres in picturesque Wye Mills. from the public boat ramp. First floor master, living areas upstairs and down, inground pool, and more! $450,000 Cynthia DeGuzman 410-725-6977
CENTREVILLE4 BR, 2.5 bath, hrdwd flrs,office, cherry cabinets, dual ovens, stone gas fireplace, 3 sided fireplace, wet bar,two zone HVAC,sky lights. $379,000 David Kaufmann 443-223-3026
79+ Wooded Acres in Queen Anne Co. $475,000
ESREG.01.05.indd 7 4/12/11 2:29:58 PM
![Page 8: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/8.jpg)
Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801
410.912.4700 800.241.9590
Prudential Carruthers SalisburyPrudentialCarruthers.com
“Model Home”Captain’s Cove, VA757.854.0548
Captain’s Galley Condo, Crisfield410.968.9686
Visit us Online Search the Entire MLS
www.prudentialcarruthers.com
Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
An independently owned and operated member of the Prudential Real Estate Affiliates.
3 Bedrooms, 2 Baths$117,600(468611)
2 Bedrooms, 1 Bath$117,900(471773)
3 Bedrooms, 1.5 Baths$114,900(467744)
3 Bedrooms, 2 Baths$132,495(470115)
2 Bedrooms, 1 Bath$89,900(469294)
3 Bedrooms, 1 Bath$89,000(465367)
3 Bedrooms, 1 Bath$69,900(467666)
3 Bedrooms, 2.5 Bath$83,000(468712)
3 Bedrooms, 2.5 Baths$164,900(471192)
3 Bedrooms, 2 Baths$159,900(468314)
4 Bedrooms, 2 Baths$149,900(470366)
3 Bedrooms, 2 Baths$164,900(470763)
3 Bedrooms, 2 Baths$174,986(468882)
Smart Phone?Here’s the QR Code
for SALISBURY Prudential CarruthersREALTORS Website
www.facebook.com/SalisburyHomes
1.2 ACRES
3 Bedrooms, 2 Baths$177,900(469555)
3 Bedrooms, 2 Baths$179,900(465077)
ESREG.01.05.indd 8 4/12/11 2:30:43 PM
![Page 9: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/9.jpg)
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 9
Kevin White
MAnAGeR
CinDYWeLSh
302-381-6910
“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801
410.912.4700 800.241.9590
Prudential Carruthers SalisburyPrudentialCarruthers.com
“Model Home”Captain’s Cove, VA757.854.0548
Captain’s Galley Condo, Crisfield410.968.9686
JOhn B.ROBinSOn
443-235-5563
KAthLeen SheeRAn
410-968-3333
SALLY StOut
410-726-3506
Steve viLKAS
443-880-8560
LeAWiMBROW
410-430-6923
BiLLieWiLKeRSOn
410-251-1709
ShAROn ShiRK
410-251-6990
Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE- Vol. 01, no. 05 - Page 9
4 Bedrooms, 3.5 Baths32.5 Acres $1,800,000
(469465)
3 Bedrooms, 2.5 Baths$1,495,000(460879)
4 Bedrooms, 2.5 Baths$189,850(466439)
2 Bedrooms, 1.5 Baths$179,000(470326)
3 Bedrooms, 2 Baths$199,750(463924)
3 Bedrooms, 2 Baths$249,000(467835)
4 Bedrooms, 2 Baths$315,000(467876)
5 Bedrooms, 3 Baths$269,900(469550)
4 Bedrooms, 2.5 Baths$275,000(464516)
3 Bedrooms, 2.5 Baths$282,000(471639)
3 Bedrooms, 2.5 Baths$199,000(470767)
4 Bedrooms, 2.5 Baths$369,800(466803)
JOhnphiLLipS
410-603-6555
WATERFRONT21+ ACRES
4 Bedrooms, 1.5 Baths $289,900(468221)
15 ACRES
Visit us Online Search the Entire MLS
www.prudentialcarruthers.comAn independently owned and operated member of the Prudential Real Estate Affiliates.
MARYKinniKin
443-359-0268
SKip LYOnS
443-235-0200
RuStYMOLnAR
410-726-2095
AnnA MYeRS
443-956-2662
BiLL BABKOWSKi
410-430-3269
BOBCALDWeLL
410-251-2799
JeffReY JACKSOn
609-839-9078
4 Bedrooms, 2.5 Baths$329,000(471224)
4 Bedrooms, 2.5 Baths$279,900(466099)
ESREG.01.05.indd 9 4/12/11 2:31:58 PM
![Page 10: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/10.jpg)
Page 10 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
8407 Fishing island rd., westover - Comfortable and spacious home on 1.07 acre
lot close to the bay. 3 BR and 2BA plus large kitchen and LR. Fenced yard and
storage shed. $145,000 MLS# 464263
1204 orChard Cr., salisbury Close to the Universtiy- city
services and no city taxes. 3 bedroom 2 bath rancher with sunroom, living room, family room with fireplace, and din-
ing room. $205,000 MLS# 448793
20 sandyhooK rd.,oCean pines - An Ocean
Pines best buy! Remodeled with all new appliances. 3 bed 2 bath home with large
fenced rear yard conve-nientlly located inside the
North Gate of Ocean Pines $177,853 MLS# 465630
8605 Middlesex dr., delMar 4 bedsrooms 2 baths on .95 acres in Essex Ridge. Open floorplan with first floor bed
and bath $215,000 MLS# 471481
426 prisCilla st., salisbury REMODELED! This beautiful
home boasts 3BR and 2.5 BA including a 1st floor master, hardwood and tile flooring.
Screend porch and rear deck plus garage and shed.
$134,900 MLS# 467906
29833 deer harbour dr., salisbury - 5 bedrooms, 3.5 baths with first floor master in Deer Harbour. $278,000 MLS# 471778
9331 Croppers island rd., newarK custom built 4 bedrm 2.5 bath home on 1.5 acres in Newark. attention to detail throughout,
gourmet kitchen and delux master suite with private porch.
$369,800 MLS#466803
lots
Sally Todd Stout 410.726.3506
2618 N. Salisbury Blvd. Suite 120, Salisbury, MD 21801 • 410-912-4700An Independently owned and operated member of the Prudential Real Estate Affiliates
Skip Lyons 443.235.0200
34335 parKer pl., pittsvilleLocation! Close to Salisbury
and Ocean City, this 3 bed and 2 bath home on .23 acre lot with above ground pool is a great value- must see! 100%
financing available to qualified buyers. $144,900 MLS#466689
134 nina ln., Fruitland .41 acres $69,900 nantiCoKe rd., nantiCoKe 4.06 acres $69,900 2310 hudson, salisbury .22 acres $13,358
Cove st., CrisField .20 acres $13,900 Cove st., CrisField .17 acres $11,900
20214 nantiCoKe rd.700 feet of private beach on Nanticoke River on this 13 acre parcel with 4 bedroom
1600 square foot home. $579,258 MLS# 463711
28305 nantiCoKe rd., salisbury - Spacious
2100 square foot home on 1.62 acres with fenced yard, outbuilding and two
master suites, a great value! $199,900 MLS# 457283
7 139th st., oCean CityLooking for a great invest-
ment? This first floor 2 bed 2 bath unit is only 1/2 block from the beach with great rental potential! $239,900
MLS# 468214
404 st. luKe’s rd., FruitlandRemodeled 2400 square foot home with 5 bedrooms and 2 baths. Large kitchen and liv-ing room plus separate room
for office space. $179,500 MLS# 460474
231 Canal parK dr - salisbury2 bedroom 2 bath condo in Canal Woods- enjoy maintenance free living! Freshly painted and great
views of the pond in this first floor unit. $93,900 MLS# 465784
1201 taney ave., salisbury - Close to University, city services and no city tax. This 1766 sq foot 3 bedroom 2 bath home with basement on a lg corner lot is a must see. $169,900
MLS#470064
reduCed new listing
new listing
161 nina ln, FruitlandBeautiful 5 BR home in East Field subdivision. 1st floor BR & BA along with large
LR, formal DR, FP, and back deck.
$269,900 MLS# 469550
reduCed
reduCed
reduCedreduCed
reduCed
reduCed
reduCed
See more of these listings at
www.youtube.com-enter property
address.
ESREG.01.05.indd 10 4/12/11 2:33:10 PM
![Page 11: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/11.jpg)
Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 11 Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 11
7802 Coastal HighwayOcean City, Maryland 21842
MELISSA BEROTTIREALTOR®, Licensed in MD
Cell: 443-497-1888Office: 410-723-0988Email: [email protected]
Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 11
Austin Circle- Fabulous 4 bedroom home located just minutes from downtown Berlin. Great kitchen, gas fi replace, 3 full baths, open living area, fi rst fl oor master suite w/whirlpool tub, and a bonus room with a full bath as well. Great backyard with a rear screened deck for you to BBQ. This Contemporary home also features an oversized attached garage w/plenty of storage, ceiling fans in every room, and a vinyl fenced in rear yard...Priced to sell at $284,500!! Call Melissa Berotti
for your appointment to see Austin Circle today at 443-497-1888
ESREG.01.05.indd 11 4/12/11 2:34:19 PM
![Page 12: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/12.jpg)
Page 12 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 Page 12 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05
$15,000 GRANT FOR BUYER * Available through SNHS* $95,000 (www.LNF.com\470074)* 4BR/2BA classic; 1954 Sq. Ft.* Move in ready - nicely updated* 9’ Ceilings; W-U Attic; Bsmt* C. Air; DOUBLE LOT
$15,000 GRANT FOR BUYER * Available through SNHS* NOW $70,950 (www.LNF.com\465412)* 4BR/1.5BA cutie; 1848 Sq. Ft.* New Roof & C. Air* Walk-up Attic; Basement* Fenced Yd w/Koi Pond
$15,000 GRANT FOR BUYER * Available through SNHS* $162,000 (www.LNF.com\470558)* 4BR/2BA gem; 1952 Sq. Ft.* Fireplace; beautiful HW fl oors* 3 Season Porch; brick Patio* Fenced DOUBLE LOT; 2 C. garage
QUALIFIES for RURAL HOUSING! * Covered Bridge location provides special fi nancing!* $280,000 (www.LNF.com\470772)* 3BR/2.5BA jewel; 2800 Sq. Ft.* 2 Bonus Rms: now used as “Man Cave” & Offi ce with private entry* Exceptional use of Oak Wood throughout* Porch, Pool & Garages for 3 cars
RUARK’S MODEL HOME* Talk about bells and whistles!!!* 4BR/3BA w/ First Floor B&B* A WOW Master Bathroom * Potential 5th BR* Garage on own HVAC system* $325,000 (www.LNF.com\471393)
COUNTY TAXES W/ CITY SERVICES * $185,000 (www.LNF.com\469586 )* 4BRs/1 full, 2 half Baths, on .4 A * 2 Bonus Rms; 2617 Sq. Ft.* 3 Zone HVAC; Basement* AWESOME Kitchen & FR Addition* 3 Season Porch; Deck* Outstanding location near S.U. & PRMC
LOTS of LOTS! City: $19,900 (463053) or County: .4A for $29,900 (463041) CALL NANCY ALTHAUS 410-726-6080
GOLDEN OPPORTUNITY * To own in FOXCHASE!* $300,000 (www.LNF.com\458215)* 4BR/3BA Original Modle Home* First fl oor Offi ce* 2 Bonus Rooms* Expanded FR w/brick FP* 3 Zone HVAC; 3400 Sq. Ft* .8 Acres w/IGI
FIRST FLOOR MASTER * $265,000 (www.LNF.com\470073)* 4BR/3BA w/2nd fl r MBR also* Like to entertain? Awesome FR & Deck* 2436 Sq. Ft of perfection! * 1.74 A. park-like setting on Cul-de-Sac* Great Eastside location
LIVE FREE & EASY * No better time than the present!* Resize & relax @ Mallard Landing* NOW $113,900* 1BR/1.5 BA; (www.lnf.com\470127)* Bonus Rm; 1187 Sq. Ft)* “Oxford” modle w/upgrades* One of the few to have a Fireplace
THINK ABOUT ITWhether you rent or own, YOU pay for the house you live in. So, why pay the Landlord? Rates are THE GREATEST EVER! Doesn’t it make sense to invest in
yourself? Call Nancy Althaus 410-726-6080 for FREE Buyer counseling.
FIRST FLOOR MASTER * Call for the new pricing value.* (www.LNF.com\465146)* 3BR/2.5BA Townhouse; 1916 Sq. Ft.* 2 Bonus Rooms = 4th BR & Craft Rm.* FR w/FP; E-I Kitchen; Formal LR & DR* California-style fi nished Garage
ESREG.01.05.indd 12 4/12/11 2:35:07 PM
![Page 13: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/13.jpg)
Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 13
Vickie D. Rohrer, REALTOR®Direct: 401-334-3076 • Offi ce: 410-912-0310
http://[email protected]
Tom Rohrer, Leasing ConsultantDirect: 443-397-1140 • Offi ce: 410-912-0310
Come visit us at our new location!327 Tilghman Road • Salisbury, MD 21804
MOTIVATED - Beautiful Bay and Skyline views from this nice 3
Bedroom, 2 Bathroom townhouse with boat slip.
$289,900 (WO470920)
LOCATION, LOCATION, LOCATION - Nice 3 Bedroom, 2 Bathroom
condo. Walk to SU. Look at this price! $79,900 (WO471027)
UPLAND - 3 Bedroom, 2.5 Bathroom $1,650/month
3 Bedroom, 2 Bathroom rancher in The Stonegate Subdivision.
Come take a LOOK at this. $149,900 (WO466961)
CROSSWINDS CONDOS - 2-3 Bedrooms, 1-2 Bathrooms from
$750-850/month
SUPER NICE - 3 Bedroom, 2 Bathroom mobile on .25 acres. Nice Florida room w/ fi replace.
Just minutes to Bethany Beach. $124,900 (WO471579)
ZIRCON - 3 Bedroom, 2.5 Bathroom $1,300/month
UNION - 3 Bedroom, 2 Bathroom $1,600/month
LOCATION, LOCATION, LOCATION - Nice 3 Bedroom, 2 Bathroom condo. Walk to SU. Wow, what a price. Buy both! Live in one, rent the other. $79,900 (WO471028)
WYE OAK - 3 Bedroom, 2.5 Bathroom $1,350/month
Open Loft Waterfront townhouse with boat slip. 1 Bedroom, 1.5
Bathrooms with pool. Walk to the boardwalk. $219,900 (WO471000)
SHARPTOWN - 4 Bedroom, 2 Bathroom $900/month
WATERFRONT
WATERFRONT
ESREG.01.05.indd 13 4/12/11 2:36:07 PM
![Page 14: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/14.jpg)
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 14
Staples & Associates Insurance offers peace of mind through quality insurance products and a caring staff of professionals that is always ready to serve. As a full service Insurance Agency providing Auto, Home, Life, Business, and Farm insurance solutions, Staples & Associates Insurance can help you control uncontrolable cirumstances.
Securities offered through Billy Staples as a Registered Representative of Nationwide Securities, LLC P.O. Box 183137, Columbus, OH 43218, 888-753-7364. Member FINRA, SIPC. DBA Nationwide Advisory Services, INc. in AR, FL, IL, WV. DBA NAtionwide Advisory Services in MA, NY, OK. Representative of Nationwide Life Insurance Copman af liated companies and other companies.
Billy Staples, MBA
Staples & Associates Insurance
1410 S. Salisbury Blvd.Salisbury, MD 21801
[email protected]: 410.546.3999 | Fax: 410.546.6165
On Your Side Certified Agent
Nationwide Financial Network®
37101.22.13.indd 6 4/12/11 3:21:59 PMESREG.01.05.indd 14 4/12/11 3:25:16 PM
![Page 15: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/15.jpg)
Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 15
Kelly MacomberCell: 443-553-4984
Offi ce: 410-641-8550www.sunshinepropinc.com
Sunshine Properties, Inc.61 Quarter Staff Place • Berlin, MD 21811
AN ENTERTAINER’S DELIGHT! Welcome to this magnifi cent waterfront estate property of over fi ve acres. The home and grounds area true respite. Highlights are many both inside and out. The home features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. The main level is spacious and includes formal living and dining rooms, large open kitchen with table area, family room, game (or lounge) room, and a master suite. The upper level has four bedrooms and over three full baths with a spectacular theatre/media room. The exterior has it all! Private resort
setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more!
Priced to sell at $1,499,000! Call Kelly Macomber today for your appointment to see this stunning home!
Visit this home online at www.MR4.View24Hours.com
Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 15
ESREG.01.05.indd 15 4/12/11 2:37:52 PM
![Page 16: Eastern Shore Real Estate Guide](https://reader031.fdocuments.us/reader031/viewer/2022020221/568c539a1a28ab4916bb7d97/html5/thumbnails/16.jpg)
Page 16 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05
ALL BRICK BEAUTY Offering a complete re do inside! Beautifully refinished hard-wood floors, all new kitchen with upgraded appliances, new tile floors, new high end cabinets, faucet, sink. A complete package! Custom painted through out. lovely crown molding. All new bathrooms. Two masonry fireplaces. Partial basement. Full walk up attic. This is a showplace!New high efficiency oil furnace installed 2007. $179,900 (471190)
2.26 ACRES Great potential for an in home business, in law quarters or just a lot of home for the money! Huge Deck w/screened room, lg open floor plan, skylights on the 2nd flr, Loads of possi-bilites w/adddition side, ramp already in place! Highly motivated seller that is easy to work with. Bring all offers for this coun-try living yet walk to Wor Wic convenient location!. $195,000 (467871)
SOLD!
GORGEOUS! 9 foot ceilings! Hardwood floors! Granite countertops! Lots of windows! 3 car garage! This 4 bedroom home has it all. Delmar school district. $275,000 Call Elaine Gordy 410-726-9001 (467424)
BEAUTIfUL LOCATIOn across from Tony Tank Lake. Gorgeous home with hard-wood floors, brand new gourmet kitchen, screened porch, fenced yard, 2 car garage, 2 fireplaces, 4 bedrooms, 2.5 baths & hardwood floors!! BEST Of BOTH WORLDS: COUnTY TAxES & CITY SERvICES... CALL ELAInE GORDY 410.726.9001 $324,900 (468678)
BEAUTIfUL TOWnHOME - Very well cared for one owner home in the new-est section of Stone Gate. Privacy in the back yard, attached storage shed. Huge living area flows into a large kitchen and dining area perfect for entertaining. Upstairs the master bed-room affords privacy and a larger than life walk in closet. This floorplan offers the most living space for the dollar in a Salisbury townhome. $139,900 (470250)
GREAT RAnCHER! - Beautiful little one owner home. Hardwood floors, oil furnace replaced 8 years ago, roof is 12 years old. Solid, well built and well cared for home. $69,900 (470283)
BEAUTIfUL double wide home with ca-thedral ceilings, 3 bedrooms, 2 baths, fireplace, deluxe master bathroom, almost 1800 square feet. Only 6 years old this home has been gently lived in, very clean and well cared for. New shed. Nicely landscaped.$59,900 (469554)
DELIGHTfULLY DECORATED Easy liv-ing home with a delightful screened porch, rear deck, full walk up attic, lovely upgraded kitchen with pantry, 2 lazy susans, appliance garage. HOA maintains the yard, sprinklers, shrub-bery, mulch. Lock it up and go lifestyle in a very comfortable setting. Located near the historic Teackle Mansion. $174,000 (471165)
CLOSE TO BEACH! - 3 Bedrooms, 2 baths, great floorplan, home features a sun-room overlooking a large back yard, an oversized 2 car detached garage, paved driveway, rear deck. Very com-fortable, convenient and economical. 15 minute drive to the beach. Call Elaine Gordy 410.726.9001 $164,900 (462211)
SPRInG CHASE BEAUTY located on a beau-tiful lot overlooking a serene and private wooded area. Comfortably updated and ready to move into this custom decorat-ed home is warm and perfect for anyone looking for a low maintenance home in a convenient location. $179,900 (462362)
GREAT LOCATIOn Close to Salisbury Uni-versity. Nice waterfront end unit with great views and extra windows. Water-front balcony. Updated bathrooms. Very nice, convenient carefree living. Condo fee includes water, sewer, and trash fee. No maintenance, no worries. $109,900 (466282)
LOvELY REMODELED and updated home on a very quiet dead end street. New carpeting, new vinyl, replacement windows,new exterior doors, brand new bathroom with tile wall and floors, freshly painted. Great back yard with a deck overlooking a wooded back drop. Attached garage. Well maintained and gently lived in, this home is in move in condition. .$159,900 (466607)
EASY LIvInG LIfESTYLE! Custom built, gently lived in one owner home in a convenient, well manicured com-munity. Lg open one floor living w/9 ft ceils, designer kitchen, FR w/FP, screened porch overlooking a peaceful, tranquil setting. Attached 2 car garage. $239,900 (454671)
PREPARE fOR nO MAInTEnAnCE! Prepare for low heating & cooling costs! Lock it up and go on vacation! - No worries! This lovely, all brick, Village in the Park home provides you peace of mind, se-curity & elegance! Move in tomorrow! Very private setting this 3 bedroom, 2 bath home with 2 car garage is a carefree home in a convenient location. $274,900 (457227)
Elaine Gordy410-726-9001
1-800-842-5704 [email protected]
LonG & FostEr rEaL EstatE , Inc.
LOTS...LOTS...LOTS 2.3 acres south of Salisbury. Country living! Cleared, perced, ready to go! fruitland School District. $69,900
Beautiful wooded private 1.5 acre lot in established neighborhood. Approved & ready to build on! $69,900
REDUCED
REDUCED
REDUCED
ESREG.01.05.indd 16 4/12/11 2:38:50 PM