Draft...Draft Abstract The role of carboxylesterase 3 (Ces3) in the lipolysis of adipocytes has been...

Draft

Novel regulatory roles of carboxylesterase 3 in lipid metabolism and browning in 3T3-L1 white adipocytes

Journal: Applied Physiology, Nutrition, and Metabolism

Manuscript ID apnm-2018-0814.R1

Manuscript Type: Article

Date Submitted by the Author: 08-Jan-2019

Complete List of Authors: Mukherjee, Sulagna; Daegu University, BiotechnologyChoi, Minji; Daegu University, BiotechnologyYun, Jong Won; Daegu University, Biotechnology

Keyword:lipid metabolism, obesity, thermoregulation, energy balance < energy regulation, fat metabolism < metabolism, protein metabolism < metabolism

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/apnm-pubs

Applied Physiology, Nutrition, and Metabolism

Draft

Novel regulatory roles of carboxylesterase 3 in lipid metabolism and browning in

3T3-L1 white adipocytes

Sulagna Mukherjee, Minji Choi, and Jong Won Yun

Department of Biotechnology, Daegu University, Gyeongsan, Gyeongbuk 38453,

Republic of Korea

Correspondence to: Dr. Jong Won Yun

Department of Biotechnology, Daegu University, Gyeongsan, Gyeongbuk 38453,

Republic of Korea. E-mail: [email protected]; Fax: +82-53-850-6559

Page 1 of 36



Draft

Abbreviations

ACC, acyl-CoA carboxylase; ACOX, peroxisomal acyl-coenzyme A oxidase; AMPK,

AMP-activated protein kinase; ATGL, adipose triglyceride lipase; BAT, brown adipose

tissue; BNPP, Bis (p-nitrophenyl phosphate); Ces/Ces, mouse carboxylesterase protein/

encoding gene; Cidea, gene encoding cell death-inducing DFFA-like effector a; Cited1, gene

encoding Cbp/p300-interacting transactivator 1; C/EBP/Cebp, CCAAT/enhancer-binding

protein/encoding gene; CPT1, carnitine palmitoyltransferase 1; FAS, fatty acid synthase;

HSL, hormone-sensitive lipase; MGL, monoglyerceride lipase; NPA, 4-nitrophenyl acetate;

PGC-1α/Ppargc1α, peroxisome proliferator-activated receptor gamma co-activator 1-

alpha/encoding gene; PPAR, peroxisome proliferator-activated receptor; PRDM16/Prdm16,

PR domain-containing 16/encoding gene; SREBP-1c, sterol regulatory element-binding

transcription factor 1; Tbx1, gene encoding T-box protein 1; Tmem26, gene encoding

transmembrane protein 26; UCP1/Ucp1, uncoupling protein 1/encoding gene;

Page 2 of 36



Draft

Abstract

The role of carboxylesterase 3 (Ces3) in the lipolysis of adipocytes has been overlooked, as

two major lipolytic enzymes, hormone sensitive lipase and adipose triglyceride lipase, play

more powerful roles in lipolysis. In this study, we explored the effects of Ces3 in lipid

metabolism by activating and inhibiting, as well as silencing, Ces3-encoding gene in 3T3-L1

cell model. Our results demonstrated that activation of Ces3 increased adipogenesis, and

attenuated lipogenesis, whereas it promoted lipolysis and fatty acid oxidation. In addition,

activated Ces3 led to enhanced expression of core fat browning marker genes and proteins,

suggesting that Ces3 may play a pivotal role in fat browning and thermogenesis. In contrast,

deficiency of Ces3 nullified the browning effect in white adipocytes, along with decreased

adipogenesis in 3T3-L1 adipocytes. Interestingly, the expression pattern of ATGL was in line

with Ces3, whereas HSL was independently regulated irrespective of Ces3 expression levels,

suggesting that Ces3 may play an important and compensatory role in the breakdown of

triglycerides in white adipocytes. In conclusion, we provide the first evidence that activation

of Ces3 contributes in the browning of white adipocytes, and maintains a balance in lipid

metabolism, which could be a potential strategy in fighting against obesity.

Keywords

3T3-L1 adipocytes; Browning; Carboxylesterase; Lipolysis; Thermogenesis

Page 3 of 36



Draft

Introduction

Obesity is a predisposal factor causing several metabolic diseases and the knowledge

of molecular events underlying this rising problem is a necessity (Heymsfield 2017;

Ström et al. 2008). In order to maintain body homeostasis there are massive amounts of

energy metabolism in basal state occurring in adipose tissue among which non-shivering

thermogenesis and lipid oxidation play a major part (Zhao et al. 2018). The key factors

regulating these metabolisms include adipogenesis (Shiau et al. 2017), lipogenesis (Wang

et al. 2015), lipolysis (Lone 2016), and β-oxidation of the fatty acid components (Parray

et al. 2018).

Recently, it was revealed that the shift of adipocytes is a crucial factor, which sheds

light on maintaining energy regulation, and counteracts obesity (Modica et al. 2016).

Conversion of white fat to brown-like adipocytes (beige adipocytes), so-called

“browning”, is attracting much attention, as it is now recognized as a promising strategy

to alleviate diet-induced obesity (Xiao et al. 2018). The beige adipocytes are reported to

resemble white fat cells characterizing very low basal expression pattern of the

uncoupling protein 1 (UCP1) in the mitochondria, unlike the brown adipocytes, which

respond to the classical cyclic AMP-simulated pathways (Wu et al. 2012). This promotes

the oxidation of the triglycerides, and establishes higher metabolic activity of UCP1 via

the process of thermogenesis preventing the accumulation of excess fat, while engaging

in a regulatory coordination of adipocytes (Xiong et al. 2018).

Carboxylesterases (EC 3.1.1.1) present in mammals are depicted as enzymes

belonging to the multigene superfamily and are mostly responsible for catalyzing short-

and long-chain glycerol esters, amide bonds, and thiol esters by hydrolysis (Lian 2018).

These enzymes are wide determinants of the pharmacokinetic and biotransformation of

Page 4 of 36



Draft

many therapeutic agents (Satoh 1998). The predominant localization of this protein in the

cytosol generally brings about a varied range of tissue distribution, with major abundance

in liver tissues (Xu et al. 2014), as well as displaying moderate activity in the small

intestine, heart, skin, blood, and muscular tissues and cells (Jones et al. 2013).

Carboxylesterase is categorized to contain multiple isoenzymic forms with varying

characteristics, while named distinctly, specified by their occurrence in different

organisms, where the mouse carboxylesterase encoding 20 genes is represented as “Ces”

(Lian 2018), while the human carboxylesterase encoding only 6 genes is annotated as

“CES” (Zhao et al. 2012). Furthermore, Ces has sub-types based on their gene clustering

and chromosomal location, into Ces1 or Ces1g, Ces2 or Ces2c, and Ces3 or Ces1d,

respectively, in mouse species (Lian 2018). The true functional orthologs between human

and mouse was previously known to consist of 73% identity and 88% similarity at amino

acid levels for CES1 and Ces1d (Ces3) (Lian 2018).

Previous investigators have focused their attention on liver CES1 and CES2 for drug

detoxification and xenobiotics (Wang et al 2017; Hosokawa 2008; Laizure et al. 2013). In

addition, many other recent studies have linked the different members of the Ces family

(Li et al. 2016), but mainly Ces3, which is identified as triacylglycerol hydrolase (TGH)

as the integrated phenotypic form (Okazaki et al. 2006) of adipocyte lipolysis (Soni et al.

2004). To date, a variety of studies have established definite relations of Ces with obesity

and diabetes (Dominguez et al. 2014), directing a loss in the protein causes weight gain

(Bathiham et al. 2016), hyperlipidemia, and steatosis with the hepatic form of Ces, by

utilizing knockout models as well (Quiroga et al. 2012; Lian et al. 2012). Our previous

proteomic study has demonstrated that protein levels of Ces3 in the white adipocytes of

diet-induced obese rats were gradually increased during the course of obesity

Page 5 of 36



Draft

development (Joo 2011). Thus, the precise regulatory expression or substrate specificity

that governs the metabolic actions led by Ces3 should be identified. Hence, this prompted

our interest in investigating and comparing the effects of activated and deficient forms of

Ces3 in white adipocyte cells. To this end, we employed 3T3-L1 cells as cellular models

to substantiate that Ces3 may play a very important role in maintaining a balance in the

adipocyte metabolism. The current study is the first to hypothesize that Ces3 may

astoundingly promote browning of white adipocytes when active in the cells, while also

preventing lipid accumulation via efficient lipolysis and fatty acid oxidation. The role of

Ces3 in inducing the positive regulation of lipids could be a leading strategy for reducing

obesity.

Materials and methods

Chemicals

Benzil (1,2-diphenylehtane-1,2-dione) was purchased from TCI (Chuo-ku,

Tokyo). BNPP (Bis-(p-nitrophenyl) phosphate)), and NPA (4-nitrophenyl acetate) were

purchased from Sigma Chemical Co. (St. Louis, MO, USA). All other chemicals used

were of analytical grade.

Cell culture and differentiation

3T3-L1 cells (ATCC CL-173, Manassas, VA, USA) were cultured in high-glucose

Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo, Waltam, MA, USA),

supplemented with 10 % fetal bovine serum (FBS, PAA Laboratories, Pasching, Austria),

Page 6 of 36



Draft

and 1 % penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA) at 37 °C for 48 h in a

humidified atmosphere of 5 % CO2. Differentiation was induced in confluent cells by

replacing DMEM with differentiation media that consisted of 10 μg/mL of insulin

(Sigma, St. Louis, MO, USA), 0.25 μM dexamethasone (Sigma), and 0.5 mM 3-isobutyl-

1-methylxanthine (Sigma) in DMEM. After 2 days, cells were switched to maintenance

media for another (6–8) days, with media replacement every 24 h. For BNPP and NPA

treatment, 2-day confluent preadipocytes were incubated with different doses of benzil or

BNPP of (10, 50, and 100) μM during differentiation, and until mature adipocyte

formation. Cells treated with water during differentiation and maintenance were used as a

control.

Cell viability

Preadipocytes were seeded in a 96-well plate at a density of 104 cells/well, and incubated

until greater than 70 % confluency was obtained. Cells were treated with different

concentrations of BNPP and NPA of (1–200) μM for 72 h. Preadipocytes treated with

DMSO (1:1,000) were used as a control. After 72 h, media was removed, and treated with

MTT according to the manufacturer’s instructions. Absorbance was measured at 570 nm

with background subtraction at 690 nm, using a microplate reader, Tecan Infinite M200

Pro (Mannedorf, Switzerland). Six replicate wells were used for each data point

throughout the experiments.

Knockdown of Ces3 by siRNA

Commercially available siRNA specific for Ces3 (a pool of three target-specific 21

Page 7 of 36



Draft

nucleotides siRNA designed to knock down gene expression) from Thermo Fisher

Scientific Corp. (MA, USA) was used for gene silencing in 3T3-L1 cells. Post confluent

3T3-L1 cells in six-well culture dishes were washed twice with transfection medium

overlaid by a previously made mixture of siRNA and transfection reagent (Roche,

Mannheim, Germany). The transfection process was continued for (4–6) h, after which

the differentiation medium was added. After (4–6) days, mature cells were collected for

further experiments.

Oil Red O staining

Preadipocytes were seeded in a 6-well plate, and allowed to reach 70 % confluency. Cells

were treated with either BNPP or NPA in the differentiation and maturation media. After

72 h of treatment, cells were washed with phosphate-buffered saline (PBS), fixed with

10 % formalin for 1 h at room temperature, and washed again three times with deionized

water. A mixture of Oil Red O solution (0.6 % Oil Red O dye in isopropanol) and water

at a ratio of 6:4 was layered onto cells for 20 min, followed by washing four times with

deionized water. Intracellular lipid accumulation was quantified using ORO staining. The

stained lipid droplets were visualized using an inverted microscope. Intracellular lipid

content was quantified after extracting ORO bound to cells with 100 % isopropanol, and

absorbance at 500 nm was determined in triplicate wells using a microplate reader.

Nile Red staining

Preadipocytes were seeded in a 6-well plate, and allowed to reach 70 % confluency. Cells

were treated with NPA in the differentiation and maturation media. After 72 h of

Page 8 of 36



Draft

treatment, cells were washed with phosphate-buffered saline (PBS), and fixed with 4 %

paraformaldehyde in PBS for 1 h at room temperature. P-formaldehyde was rinsed with

PBS, and quenched with 50 mmol/L glycine in PBS. Nile red dye (1,000 µg/ml of

acetone), was then added directly to the preparation to effect a 1:100 dilution, and

incubated for 10 min. Florescence images of the cells were captured using a confocal

laser scanning microscope LSM700 (Carl Zeiss, Oberkochen Germany) with a FITC filter

set. Analysis of images was performed by ImageJ software (NIH).

Total RNA extraction

Preadipocytes were cultured in 6-well cell culture plates, and incubated until greater than

70 % confluency was obtained. Differentiation was initiated by the addition of

differentiation media, which was replaced after 2 days with maintenance media (changed

every 24 h). Cells were treated with siRNA. On day 10 after maturation, cells were

harvested, and then used to extract total RNA using a total RNA isolation kit (RNA-spin,

iNtRON Biotechnology, Seongnam, Korea). The quantitative and qualitative ratio metric

analysis of RNA was carried out using a microplate reader, Tecan Infinite M200 Pro

(Mannedorf). RNA integrity was confirmed using 1.5 % agarose gel electrophoresis.

Real-time RT-PCR

cDNA was synthesized from RNA (1 μg) using Maxime RT premix (iNtRON

Biotechnology). Power SYBR green (Roche Diagnostics Gmbh, Mannheim, Germany)

was employed to quantitatively determine the transcript levels of genes with RT-PCR

(Stratagene 246 mix 3000p QPCR System, Agilent Technologies, Santa Clara, CA,

Page 9 of 36



Draft

USA). PCR reactions were run in duplicate for each sample, and transcript levels of every

gene were normalized to the level of β-actin. Table 1 lists the sequences of primer sets

used in this study.

Immunoblot analysis

Cell lysates were prepared using RIPA buffer (Sigma) by homogenization and

centrifugation at 14,000 × g for 20 min. Cell extract was diluted in 5X sample buffer (50

mM Tris at pH 6.8, 2 % SDS, 10 % glycerol, 5 % β-mercaptoethanol, and 0.1 %

bromophenol blue), and heated for 5 min at 95 °C before (8, 10, or 12) % SDS-

polyacrylamide gel electrophoresis (PAGE). After electrophoresis, samples were

transferred to a polyvinylidene difluoride membrane (PVDF, Santa Cruz Biotechnology,

Santa Cruz, CA, USA), and then blocked for 1 h with TBS-T (10 mM Tris-HCl, 150 mM

NaCl, and 0.1 % Tween 20) containing 5 % skim milk or bovine albumin serum (BSA).

The membrane was rinsed three times consecutively with TBS-T buffer, followed by

overnight incubation with 1:1,000 dilutions of primary polyclonal antibodies, including

anti-ACC, anti-ACOX, anti-AMPK, anti-β-actin, anti-CPT1, anti-C/EBPα, anti-Ces3,

anti-FAS, anti-PGC-1α, anti-PPARγ, anti-p-AMPK, anti-UCP1 (Santa Cruz

Biotechnology), anti-p-ACC, anti-p-HSL (Cell Signaling Technology, MA, USA), anti-

PRDM16, and (Abcam, Cambridge, UK) in TBS-T buffer containing 1 % skim milk or

BSA. After three washes, the membrane was incubated for 1 h with horseradish

peroxidase-conjugated anti-goat IgG, anti-mouse IgG, or anti-rabbit IgG secondary

antibody (1:1,000, Santa Cruz Biotechnology), in TBS-T buffer containing either 1 %

skim milk or BSA. Development was carried out using enhanced chemiluminescence

(ImageQuant LAS500, GE, Malborough, MA, USA). Quantification of band intensities

Page 10 of 36



Draft

was performed using ImageJ software (NIH).

Immunofluorescence

Cells grown on poly-L-lysine-pre-treated coverslips were fixed with 4 % p-formaldehyde,

followed by washing with PBS, and then permeabilization with 0.25 % Triton X-100

(Sigma). Cells were washed with PBS three times, blocked with 1 % BSA in PBS-T for 1

h, and incubated with polyclonal anti-UCP1 antibody (1:200 dilution) (Santa Cruz

Biotechnology) overnight at 4 °C, followed by three washes with PBS. Cells were then

incubated with FITC-conjugated anti-goat secondary antibody (1:400 dilutions). DAPI

(Invitrogen) was used to stain the nuclei of cells. Florescence images were captured using

a confocal laser-scanning microscope LSM700 (Carl Zeiss, Oberkochen Germany).

Analysis of images was performed by Zen 2009 software (Carl Zeiss). For staining of

mitochondria, MitoTracker® Green (1 mM, Cell Signaling Technology) was directly

added to the growing media at a concentration of (20–25) nM, and cells were kept for

(30–40) min at 37 °C. After incubation, cells were fixed in 4 % p-formaldehyde, followed

by a single wash with PBS and immunostaining.

Statistical analysis

All data are presented as the mean ± SD of at least three independent experiments.

Statistical significance among multiple groups was analyzed by using One-way ANOVA

using the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago,

IL, USA) program, followed by Tukey’s post hoc test or two-tailed Student’s t-test.

Statistical significances were indicated as either p<0.05 or p<0.01.

Page 11 of 36



Draft

Results

Pharmacological activation and inhibition of Ces3 as well as silencing of Ces3 in 3T3-L1

adipocytes

Initially, we investigated the effect of Ces3 present in 3T3-L1 cells by altering the

activity of Ces3. To activate the enzyme, we treated the cells with NPA, a specific substrate

of Ces at different concentrations of (10–400) µM to optimize the dose for treatment. The cell

viability was recorded up to 200 µM of NPA (Fig. 1 A), and thus the dose of 100 µM was

used for further experiments. For inhibition of Ces3, we used two different pharmacological

inhibitors benzil and BNPP, and checked the cytotoxicity first at 200 µM (Fig. 1 B, and Fig.

S1 A of the Supplementary Information (SI)). As expected, induction of NPA significantly

activated Ces3 by elevating its protein levels in the cells (Fig. 1 C), and both the inhibitors

successfully reduced the expression levels of Ces3 (Fig. 1 D, and Fig. S1 B of the SI). We

preferably selected BNPP as the potent Ces3 inhibitor in 3T3-L1 cells, due to its water-

soluble property. Benzil also actively inhibited Ces3, but it displayed slight damage to the

cells during the experimental procedure, which was presumably due to its solubility in

DMSO. A dose of 100 µM of BNPP was selected as an optimum dose for the further

experiments. To further specifically investigate the role of Ces3, we utilized Ces3-specific

siRNA for the silencing of Ces3 (Fig. 1 E).

Ces3 alleviates lipogenesis while aggravates adipogenesis in 3T3-L1 mature adipocytes

To determine whether alterations of Ces3 in the 3T3-L1 cells have any regulatory effects

on lipid metabolism, we investigated the expressions of lipogenic marker proteins, such as

FAS and SREBP-1c, as well as, AMPK, phosphorylated form of AMPK (phosphorylation

site: Thr172), ACC, phosphorylated form of ACC (phosphorylation sites: Ser78 and Ser80)

and calculated the relative ratio, in response to the activation and inhibition of Ces3 at the

Page 12 of 36



Draft

differentiation stage of 3T3-L1 adipocytes. The results indicated a significant increase in

lipogenesis when Ces3 were suppressed by chemical inhibition, as well as Ces3 gene

ablation. These results are exactly opposite to the decreased lipogenesis in the activated state

of Ces3 (Fig. 2 A). The protein levels of the key adipogenic transcription factors (e.g. PPARγ

and C/EBPα) were increased when Ces3 was activated by NPA, whereas they were nullified

during the deficiency of Ces3 by siRNA (Fig. 2 B).

Ces3 influences maturation of 3T3-L1 white adipocytes

To directly observe the effect of Ces3 on cell morphological change and lipid

accumulation, cells were stained with Oil Red O in normal and activated condition of Ces3,

which led to the formation of a higher number of adipocytes, but comparatively smaller size

of lipid droplets (Fig. 3 A), consequently resulting in slightly reduced lipid content. However,

we observed striking results for the cells in the suppressed condition of Ces3 upon inhibitor

treatment (Fig. 3 B), which displayed a smaller number of adipocytes, but bigger and larger

lipid droplets in comparison to the normal cells, projecting a rise in lipid content.

Ces3 highly regulates lipolysis in white adipocytes, and promotes fatty acid oxidation

Since the direct roles of Ces3 in lipolysis and fat oxidative metabolism in adipocytes

have not been extensively studied, the expression levels of Ces3 were determined, together

with the key lipolytic enzymes, ATGL and p-HSL. Interestingly, the expression pattern of

ATGL was in line with Ces3, whereas p-HSL (phosphorylation site: Ser565) was

independently regulated, irrespective of Ces3 expression levels (Fig. 4 A). This result

suggests that Ces3 may play an important and compensatory role in the breakdown of

triglycerides in white adipocytes. The expression levels of core fat oxidative markers,

Page 13 of 36



Draft

ACOX1 and CPT1 marked a positive increase in the activated Ces3 condition. This result

indicated that Ces3 might prevent lipid accumulation by positive regulation of fat oxidative

enzymes, whereas the expression of markers of fat oxidation was reduced drastically when

Ces3 was deficient in 3T3-L1 adipocytes (Fig. 4 B).

Ces3 regulates the browning of white adipocytes

The most remarkable outcome of this study is the finding of the browning event in

3T3-L1 adipocyte when Ces3 was activated. As induction of NPA significantly activated

Ces3, we checked genes encoding Ces3, where we noticed a rise in expression, particularly in

Ces3 compared to Ces1 and Ces2, along with beige-specific genes responsible for

thermogenesis (Cidea, Cited1, Ppargc1α, Prdm16, Tbx1, Tmem26, and Ucp1), which

displayed upregulated expression (Fig. 5 A). Also, we found gradual increase of core fat

browning marker proteins (PGC-1α, PRDM16, and UCP1), when treated with NPA in a

dose-dependent manner (Fig. 5 B). We also conducted microscopic imaging of the cells with

labeled fluorescent markers of Ces3 and UCP1 separately, to confirm the enhanced

expression at cellular levels (Figs. 5 C and D). Conversely, chemical inhibitions of Ces3 by

BNPP led to decreased expression of core browning marker proteins dose-dependently (Fig.

6 A, and Fig. S1 C of the SI). Moreover, the deficiency of Ces3 gene by siRNA resulted in

striking decline in the expression of browning marker genes (Fig. 6 B) and also led to dose-

dependent decrease in the expression of core browning marker proteins (Fig. 6 C). We

confirmed these results at the cellular level by immunocytochemistry, using fluorescent

labeled markers on Ces3-silenced cells to evaluate the fluorescent levels of Ces3 (Fig. 6 D)

and UCP1 (Fig. 6 E), which clearly showed equivalent decrease in fluorescence when Ces3

was depleted from the white adipocytes.

Page 14 of 36



Draft

Discussion

Since carboxylesterases are widely distributed in the mammalian liver, most of the earlier

studies have focused on their physiological roles in the liver. For example, deficiency of

hepatic Ces1g could lead to obesity reduction with improved insulin signaling (Bathiham et

al. 2016; Quiroga et al. 2012; Lian et al. 2012). To date, no evidence has linked Ces3 to fat

browning, or to lipid catabolic metabolisms. The starting line of the current study was our

previous finding that Ces3 was highly expressed in the white adipocytes of diet-induced

obese rats (Joo 2011). Hence, we tried to test the hypothesis that alterations of Ces3 in 3T3-

L1 white adipocytes can implicate the different changes occurring during lipid metabolism.

To this end, we precisely dealt with the activation of Ces3 by its specific substrate, NPA

(Takumi et al. 2017), and inhibition by the reported pharmacological inhibitors, benzil

(Hatfield 2011) and BNPP (Eng et al. 2010). The major limitation of this study was the

failure to determine appropriate substrate specificity of Ces3, due to the large group of

isoforms.

Caution must be used when interpreting data obtained from a wide variety of Ces family

proteins, due to their confusing nomenclature, and complicated metabolic differences. Ces1d

is known to be a key player in the development of adipocytes (Challa et al. 2015), and

promotes adipogenesis (Bontana 2012). This was likely to be another corresponding

conspicuous observation in our result for Ces3 activation that raised PPARγ and C/EBPα

levels. PPARγ and C/EBPα are considered as the positive transcriptional effectors for

increased lipid accumulation and adipogenesis (Xiong et al. 2018). Conflicting evidence was

found that down-regulation of Ces3 was associated with PPAR signalling and lipid

accumulation in rats (Chang et al. 2014), as well as perturbing the genetic regulation of

Page 15 of 36



Draft

PPARγ in human macrophages when Ces1 was absent (Mangum et al. 2018). However, as

our work is restricted to only mouse cell models, these data rather suggest the possibility of

the diversified activity pattern of Ces isoforms, when targetting functional studies in different

locations and organisms.

One of the interesting results in this study is the association of Ces3 with the regulation of

AMPK, a regulator of energy metabolizing signaling pathways in various tissues, directing

towards an active thermogenic mechanism (Wu et al. 2018). Several lines of evidence have

suggested that AMPK activation led to the inhibition of lipogenesis via the phosphorylation

of ACC (Park et al. 1985; Woods et al. 2017; Xin et al. 2018). In addition, active AMPK

plays a role in the suppression of SREBP-1c in adipocytes (Daval 2006). Also, in adipocytes,

the lack of AMPK demonstrated exacerbation of insulin resistance, and impaired

mitochondrial activity (Motillo et al. 2016). The results of our study can be postulated based

on this evidence that Ces3 may regulate the AMPK activity in adipocytes considering the

substrate level activation of the enzyme in 3T3-L1 cells, while displaying an effective

abrogation of lipogenesis. There exists a report demonstrating that human CES2

overexpression leads to aggravated lipogenesis (Takumi et al. 2017), similar to our results

when Ces3 was silenced in white adipocyte cells.

Regulation of robust lipolysis program is reported as a feature of Ces3, also known as

triglyceride hydrolase (Soni et al. 2004). Other evidence supports that the loss of CES2

diminished the mobility of cholesterol esters with an excess accumulation (Ross et al. 2010),

and impaired lipid and glucose metabolism in humans, as well as reduced hepatic steatosis

(Ruby et al. 2017). The etiology of lipolysis comprises the liberation of non-esterified fatty

acids along with glycerol from white adipocyte stores (Duncan et al. 2007), among which

adipose triglyceride lipase (ATGL) and hormone sensitive lipase (HSL) are reported as the

Page 16 of 36



Draft

chief mediators for the first two steps, accounting for almost 90 % of the lipolytic process,

while monoglyceride lipase (MGL) acts as the rate-limiting step (Zechner et al. 2012). An

earlier study indicated the excess release of lipids communed to lipotoxicity, but the absence

of ATGL corrected the ameliorated obesity by improving the diet-induced insulin resistance

(Schweiger et al. 2017). However, another contrasting study certified that overexpression of

ATGL attenuated diet-induced obesity by promoting fatty acid use (Ahmandian 2010).

Previous reports demonstrated that deficiency of ATGL down-regulates mammalian

carboxylesterase (Morak et al. 2012). The alterations of Ces3 level in the cells affected

ATGL equivalently in our study, but interestingly, the HSL levels remained independent, and

were rather elevated, regardless of Ces3 activation or inhibition. According to another earlier

study in human carboxylesterase (CES1), no visible change was reported in expression of

ATGL (Jernas et al. 2009). Contrasting results from a previous study demonstrated that

partial inhibition of HSL in adipose tissues improved glucose metabolism (Girousse et al.

2013). In contrast, another study reported complete deletion of HSL could feature the

browning of adipocytes, leading to reduction in obesity (Ström et al. 2008). Accordingly, we

presumed the reason behind this abnormality in our study could be due to substrate similarity.

Previous studies related substrate similarity between the lipases, such as CES1 shared

substrate specificity with MGL (Isglesias et al. 2016), while Ces and HSL were termed

homologous consisting of structural identity with varied domains (Chainian et al. 2005).

Although the ablation of Ces3 has been considered susceptible for the removal of blood

lipids (Wei et al. 2010), the adequate mitochondrial oxidation of the free fats can counteract

lipid accumulation (Parray et al. 2018) and clear the excess free fatty acids generated as a

result of lipolysis (Serra et al. 2013). Consequently, the current data demonstrate that the

activation of Ces3 resulted in elevation of markers of fat oxidation, showing the prevention of

Page 17 of 36



Draft

extra fat storage in the adipocytes.

Generally, the involvement of fat oxidation while metabolizing lipid molecules leads to

thermogenesis, which affects the process of browning in adipocytes (Tan et al. 2015),

demonstrating a positive reduction in obesity (Wu et al. 2017). Hence, we explored the

unappreciated role of Ces3 in the mechanism of browning. Our results demonstrate an

upregulation in the brown and beige-specific genes along with the marker, as a key feature

for conversion of white fat cells into beige cells, after acquiring the brown adipocyte-like

characteristics (Tan et al. 2015; Lone 2016; Xiao et al. 2018). Remarkably, our data show

observations relevant to these studies, displaying an induction of browning when Ces3 is

activated in 3T3-L1 cells.

Conclusion

In conclusion, we provide the first evidence that activation of Ces3 plays a vital role in

the browning of white adipocytes, and maintains a balance in lipid metabolism, which could

be a potential strategy in fighting against obesity and its related metabolic disorders.

Acknowledgement

This work was supported by the Mid-career Researcher Program (2016R1A2B4006526),

through an NRF grant funded by the Ministry of Science and ICT, Korea.

Reference

Ahmandian, M., Wang, Y., Sul, H.S. 2010. Medicine in focus: lipolysis in adipocytes.

Int. J. Biochem. Cell. Biol. 42: 555-559.

Page 18 of 36



Draft

Bahitham, W., Watts, R., Nelson, R., Lian, J., Lehner, R. 2016. Liver-specific

expression of carboxylesterase 1g/esterase-x reduces hepatic steatosis, counteracts

dyslipidemia and improves insulin signaling. Biochemica. et. Biophysica. Acta. 1861:

482-490.

Bontana, L.M., Loza, M. 2012. Therapeutic targets: modulation, inhibition and

activation, second ed., John Wiley and Sons pub, pp. 293-95

Chainian, H., Ali, Y.B., Absousalham, A., Petry, S., Mandrich, L., Manco, G., et al.

2005. Substrate soecificity and kinetic properties of enzymes belonging to the

hormone-sensitive lipase family: comparison with the non-lipolytic and lipotylic

carboxylesterases. Biochemica. et. Biophysica. Acta. 1738: 29-36.

Challa, T.D., Straub, L. G., Balaz, M., Kiehlmann, E., Donze, O., Rudofsky, G., et al.

2015. Regulation of de novo adipocyte differentiation though cross talk between

adipocytes and Preadipocytes. Diabetes. 64: 4075-87.

Chang, J., Oikawa, S., Iwahashi, H., Kitagawa, E., Takeuchi, I., Yuda, M., et al. 2014.

Expression of proteins associated with adipocyte lipolysis was significantly changed

in the adipose tissues of the obese spontaneously hypertensive/NDmcr-cp rat.

Diabetol. Metab. Syndr. 6: 8.

Daval, M., Foufelle, F., Ferre, P. 2006. Functions of AMP-activated protein kinase in

adipose tissue. J. Physiol. 574: 55-62.

Dominguez, E., Galmozzi, A., Chang, J.W, Hsu, K.L., Pawlak, J., Li W., et al. 2014.

Integrated phenotypic and activity-based profiling links Ces3 to obesity and

diabetes. Nat. Chem. Biol. 10: 113-121.

Duncan, R.E., Ahmandia, M., Jaworski, K., Sarkadi-nagy, E., Sul, H.S,. 2007.

Regulation of lipolysis in adipocytes. Annu. Rev. Nutr. 27: 79-101.

Page 19 of 36



Draft

Wei, E., Ali, Y. B., Lyon, J., Wang H., Nelson, R., Dolinsky, V.W., et al. 2010. Loss of

TGH/Ces3 in mice decrease blood lipids, improves glucose tolerance, and increases

energy expenditure. Cell Metab. 11: 183-193

Eng, H., Niosi, M., MDonal, T.S, Wolford, A., Chen, Y., Simila, S.T., et al. 2010.

Utility of the carboxylesterase inhibitor bis-para-nitrophenylphosphate (BNPP) in the

plasma unbound fraction determination for the hydrolytically unstable amide

derivative and agonist of the TGR5 recepto. Xenobiotica. 40: 369-380.

Girousse, A., Taverinier, G., Valle, C., Moro, C., Mejhert, N., Dinel, A.L., et al. 2013.

Partial inhibition of adipose tissue lipolysis improves glucose metabolism and insulin

sensitivity without alteration of fat mass. Plos Biol. 11: e1001485.

Hatfield, M.J., Potter, P.M. 2011. Carboxylesterase inhibitors. Expert. Opin. Ther. Pat.

21: 1159-71.

Heymsfield, S. B., Wadden, T.A. 2017. Mechanisms pathophysiology a management of

Obesity. N. Engl. J. Med. 376: 254-266.

Hosokawa, M. 2008. Structure and catalytic properties of carboxylesterase isoenzymes

involved in metabolic activation of prodrugs. Molecules. 13: 412-431.

Isglesias, J., Lamontage, J., Erb, H., Gezzar, S., Zhao, S., Joly, E., et al. 2016.

Simplified assays of lipolysis enzymes for drug discovery and specificity assessment

of known inhibitors. J. Lipid. Res. 57: 131-41.

Jernas, M., Olsson, B., Arner, P., Jacobson, P., Sjostrom, L., Walley, A., et al. 2009.

Regulation of carboxylesterase 1 (CES1) in human adipose tissue. Biochem. Biophys.

Res. Commun. 383: 63-7.

Jones, D.J., Taylor, A.M, Tong, E.Y., Repa, J.J. 2013. Carboxylesterase are uniquely

expressed among tissues and regulated by nuclear hormone receptors in mouse. Drug.

Metab. Dipos. 41: 40-49.

Page 20 of 36



Draft

Joo, I.N., Yun, J.W. 2011. Gene expression profiling of adipose tissues in obesity

susceptible and resistant rats under a high fat diet. Cell. Physiol. Biochem. 27: 327-

340.

Laizure, S.C., Herring, V., Witbrodt, K., Parker, R.B. 2013. The role of human

carboxylesterase in drug metabolism: have we overlooked their importance?

Pharmacotherapy. 33: 210-22.

Li, Y., Zalzala, M., Jadhav, K., Xu, Y., Kasumov, T., Yin, L., et al. 2016.

Carboxylesterase 2 prevents liver steatosis by modulating lipolysis, ER stress and

lipogenesis and is regulated by HNF4α. Hepatology. 63: 860-1874.

Lian, J., Nelson, R., Lehner, R. 2018. Carboxylesterase in lipid metabolism: from

mouse to human. Protein Cell. 9: 178-195.

Lian, J., Wei, E., Wang, S.P., Quiroga, A.D., Li L., Di Pardo, A., et al. 2012. Liver

specific inactivation of carboxylesterase 3/triacylglycerol hydrolase decreases blood

lipids without causing severe steatosis in mice. Hepatology. 56: 25881.

Lone, J.B., Yun, J.W. 2016. Curcumin induces brown fatlike phenotype in 3T3L1 and

primary white adipocytes. J. Nutr. Biochem. 27: 193-202.

Mangum, L. C., Hou, X., Borazjani, A., Lee, J.H, Ross, M.K., Crow, J.A., et al. 2018.

Silencing carboxylesterase 1 in human THP-1 macrophages perturbs genes regulated

by PPARγ/RXR and RAR/RXR: down-regulation of CYP27A1-LXRα signaling.

Biochem. J. 475: 621-642.

Modica, S., Straub, L.G., Balaz, M., Sun, W., Varga, L., Srefanicka, P., et al. 2016.

Bmp4 promote a brown to white-like adipocyte shift. Cell. Rep. 16: 1-6

Morak, M., Schmidinger, H., Reisenhuber, G., Rechberger, G. N., Kollroser, M.,

Zechner, R., et al. 2012. Adipose triglyceride lipase (ATGL) and hormone-semsitive

Page 21 of 36



Draft

lipase (HSL) deficiencies affect expression of lipolytic activities in mouse adipose

tissues. Mol. Cell. Proteomics. 11: 1777-89.

Motillo, E.P., Desjardins, E.M., Crane, J.D., Smith, B.K., Green, A.E., Ducommun, S.,

et al. 2016. Lack of adipocyte AMPK exacerbated insulin resistance and hepatic

steatosis through brown and beige adipose tissue function. Cell. Metab. 24: 118-129.

Okazaki, H., Igarashmi, M., Nishi, M., Tajima, M., Sekiya, M., Okazaki, S., et al. 2006.

Identification of a novel member of the carboxylesterase family that hydrolyzes

triacylglycerol: a potential role in adipocyte lipolysis. Diabetes. 55: 2091-7.

Park, S.H., Gammon, S.R., Knippers, J.D., Paulsen, S.R., Rubink, D.S., Winer, W.W.

1985. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in

muscle. J. Appl. Physiol. 92: 2475-82.

Parray, H.A., Lone, J.B., Park, J.P., Choi, J.W, Yun, J.W. 2018. Magnolol promotes

thermogenesis and attenuates ROS production in 3T3L1 adipocytes. Nutrition. 50: 82-

90.

Quiroga, A.D., Li L., Trötzmuller, M., Nelson, R., Proctor, S.D., Kofeler, H., et al.

2012. Deficiency of carboxylesterase 1/esterase-x results in obesity, hepatic steatosis,

and hyperlipidemia. Hepatology. 56: e25961.

Ross, M.K., Treit, T.M., Herring, K.T. 2010. Carboxylesterases: dual roles in lipid and

pesticide metabolism. (2010) J. Pestic. Sci. 35: 257-264.

Ruby, M.A., Massart, J., Hunerdosse, D.M., Nasuland, E., Nomura, D.K., Rusas, J.L.,

et al. 2017. Human carboxylesterase 2 reverses obesity-induced diacylglycerol

accumulation and glucose intolerance. Cell. Rep. 18: 636-646.

Satoh, T., Hosokawa, M. 1998. The mammalian Carboxylesterase: from molecules to

functions. Annu. Rev. Pharmacol. Toxicol. 38: 257-88.

Page 22 of 36



Draft

Schweiger, M., Romauch, M., Schreiber, R., Grabner, G.F., Hutter, S., Kotzbeck, P., et

al. 2017. Pharmacological inhibition of adipose triglyceride lipase corrects high-fat

diet-induced insulin resistance and hepatosetatosis in mice. Nat. Comm. 8: 15490.

Serra, D., Mera, P., Malandrino, L.I., Mir, J.F., Herrero, L. 2013. Mitochondrial fatty

acid oxidation in obesity. Antioxid. Redox. Signal. 19: 269-284.

Shiau, M.Y., Lee, P.S., Huang, Y.J., Yang, C.P., Hsiao, C.W., Chang, K.Y., et al. 2017.

Role of PARL-PINK1-Parkin pathway in adipocyte differentiation. Metabolism. 72:

1-17.

Soni, K.G., Lehner, R., Metalnikov, P., O’Donnell P., Semache, M., Gao, W., et al.

2004. Carboxylesterase 3 (EC 3.1.1.1) is a major adipocyte lipase. J. Biol. Chem. 279:

40683-9.

Ström, K., Hansson, O., Lucas, S., Nevsten, P., Fernandez, C., Klint, C., et al. 2008.

Attainment of brown adipocytes of hormone-sensitive lipase null mouse. Plos One. 3:

e1793

Takumi, S., Shimono, T., Ikem, S., Hotta, Y., Chigwechokha, P.K., Shiozaki, K., et al.

2017. Overexpression of carboxylesterase contributes to the attenuation of cyanotoxin

microcystin-LR toxicity. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 194: 22-27.

Tan, C.Y., Virtue, S., Bidault, G., Dale, M., Hagen, R., Griffin, J.L., et al. 2015. Brown

adipose tissue thermogenic capacity is regulated by Elvol6. Cell Rep. 13: 2039-2047.

Wang, X., Rida, N., Shi, J., Wu, A., Bleske, B., Zhu, H.J. 2017. A comprehensive

functional assessment of carboxylesterase 1 nonsynonymous polymorphisms. Drug.

Metab. Dipos. 117: e077669.

Wang, Y., Viscarra, J., Kim, S.J., Sul, H.S. 2015. Transcriptional regulation of hepatic

lipogenesis. Nat. Rev. Mol. Cell. Biol. 16: 678-89.

Page 23 of 36



Draft

Wei, W., Wang, X., Yang, M., Smith, L.C., Dechow, P.C., Sonoda, J., et al. 2010.

PGC1beta mediates PPARgamma activation of osteoclastogenesis and rosiglitazone-

induced bone loss. Cell. Metab. 11: 503-16.

Woods, A., Williams, J.R., Muckett, P.J., Mayer, F.V., Liljevald, M., Bohlooly-Y M., et

al. 2017. Liver-specific activation of AMPK prevents steatosis on a high-fructose diet.

Cell. Rep. 18: 3043-3051.

Wu, J., Bostrom, P., Sparks, L.M., Choi, J.H., Giang, A.H., Khandekar, M., et al. 2012.

Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell.

150: 366-376.

Wu, L., Zhang, L., Li, B., Jiang, H., Duan, Y., Xie, Z., et al. 2018. AMP-activated

protein kinase (AMPK) regulates energy metabolism through modulating

thermogenesis in adipose tissue. Front. Physiol. 9: 122.

Wu, R., Liu, X.M., Sun, J.G., Chen, H., Ma, J., Dong, M., et al. 2017. DJ-1 maintains

energy and glucose homeostasis by regulating the function of brown adipose tissue.

Cell Discov. 3: 16054.

Xiao, X.H., Qi, X.Y., Wang, Y.D., Ran, L., Yang, J. 2018. Zinc alpha2 glycoprotein

promotes browning in adipocytes. Biochem. Biophy. Res. Comm. 496: 287-293.

Xin, M., Sun, Y., Chen, H., Li, Q., Dun, Y., et al, 2018. Propylene glycol gluronate

sulfate (PGRS) reduces lipid accumulation via AMP-activated kinase activation in

palmitate-induced HepG2 cells. Int. J. Biol. Macromol. 114: 26-34.

Xiong, Y., Yue, F., Jia, Z., Hu, W., Zhang, Y., Zhu, D., et al. 2018. A novel brown

adipocyte-enriched long non-coding RNA that is required for brown adipocyte

differentiation and sufficient to drive thermogenic gene program in white adipocytes.

Biochemica. et. Biophysica. Acta. 1863: 409-419.

Page 24 of 36



Draft

Xu, J., Yin, L., Xu, Y., Li, Y., Zalzala, M., Cheng, G., et al. 2014. Hepatic

Carboxylesterase 1 is induced by glucose and regulates postprandial glucose levels.

Plos One. 9: e109663

Zechner, R., Zimmermann, R., Eichmann, T.O., Kohlwein, S.D., Haemmerle, G., Lass,

A., et al. 2012. Fat signals – Lipases and lipolysis in lipid metabolism and signaling.

Cell. Rep. 15: 279-291.

Zhao, B., Bie Z., Wang, J., Marqueen, S.A., Ghosh, S.A. 2012. Identification of a novel

intracellular cholesteryl ester hydrolase (carboxylesterase 3) in human macrophages:

compensatory increase in its expression after carboxylesterase 1 silencing. Am. J.

Physiol. Cell. Physiol. 303: 427-435.

Zhao, P., Wong, K.I., Sgannon, M.R., Uhm, M., Liao Z., Skorobogatko, Y., et al. 2018.

TBK1 at the Crossroads of Inflammation and Energy Homeostasis in Adipose Tissue.

Cell. 172: 731-743.

Page 25 of 36



Draft

Figure captions

Fig. 1. Activation and inhibition of carboxylesterase 3 (Ces3), as well as silencing of Ces3 in

3T3-L1 adipocytes. Cytotoxicity of (A) NPA, a specific substrate, and (B) BNPP, the

inhibitor of Ces3. The expression of Ces3 was (C) significantly enhanced upon the induction

of NPA, whereas (D) it gradually decreased when imbibed with BNPP. (E) Depletion of Ces3

in 3T3-L1 adipocytes was achieved by knocking down Ces3 gene by siRNA in a dose-

dependent manner. Protein expression levels were measured by Western blotting and

quantified by densitometric analysis. Relative intensities (%) proteins were normalized with

β-actin. All data are presented as the mean ±SD (standard deviation) of three independent

experiments, and differences between groups were determined by one-way ANOVA by the

Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA)

program or two-tailed Student’s t-test. Statistical significance between control and cells

treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

Fig. 2. Carboxylesterase 3 (Ces3) regulates lipogenesis and adipogenesis in mature white

adipocytes. (A) The activation of Ces3 via its substrate NPA upregulates the lipogenic maker

proteins, while the suppression of Ces3 by its inhibitor BNPP, as well as Ces3 gene depletion

after knockdown, particularly elevates lipogenesis in 3T3-L1 cells. (B) The deficiency of

Ces3 deteriorates adipogenesis at the transcription levels, by reducing the expression of

C/EBPα and PPARγ, while activated Ces3 markedly elevates adipogenesis. Protein

expression levels were measured by Western blotting and quantified by densitometric

analysis. Relative intensities (%) proteins were normalized with β-actin. All data are

presented as the mean ±SD (standard deviation) of three independent experiments, and

differences between groups were determined by one-way ANOVA by the Statistical Package

Page 26 of 36



Draft

of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed

Student’s t-test. Statistical significance between control and cells treated with NPA, BNPP,

and siRNA is shown as *p < 0.05, **p < 0.01.

Fig. 3. Imaging lipid droplet influenced by Ces3. Representative images of Oil Red O

staining of 3T3-L1 were taken at ×20 magnification (scale bars = 50 μm), and ×40

magnification (scale bars = 100 μm), where lipid content was quantified by extracting Oil

Red O stain bound to cells with 100 % isopropanol in 3T3-L1 adipocytes in the (A) activated,

and (B) suppressed state of Ces3, respectively. Statistical significance between control and

cells treated with NPA and BNPP is shown as either *p<0.05 or **p< 0.01.

Fig. 4. Carboxylesterase 3 (Ces3) highly regulates lipolysis and fat oxidation in 3T3-L1

adipocytes. (A) Ces3 acts a major lipolytic enzyme in white adipocytes alongside p-HSL,

which remains independent of the presence or absence of Ces3, while (B) fat oxidation is

sensitively reduced in the absence of Ces3, but is elevated when Ces3 is activated. Protein

expression levels were measured by Western blotting and quantified by densitometric

analysis. Relative intensities (%) proteins were normalized with β-actin. All data are

presented as the mean ±SD (standard deviation) of three independent experiments, and

differences between groups were determined by one-way ANOVA by the Statistical Package

of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed

Student’s t-test. Statistical significance between control and cells treated with NPA, BNPP,

and siRNA is shown as *p < 0.05, **p < 0.01.

Page 27 of 36



Draft

Fig. 5. Activation of carboxylesterase 3 (Ces3) leads to browning in 3T3-L1 adipocytes.

Activation of Ces3 (A) increases the relative expression of genes encoding Ces3, as well as

beige-specific thermogenic genes, along with (B) core fat browning marker proteins (PGC1α,

PRDM16, and UCP1), in a dose-dependent manner. 3T3-L1 white adipocytes with activated

Ces were fixed with p-formaldehyde, subjected to staining for Mitotraker Red, and then ICC

staining for (C) Ces3, and (D) UCP1, where the immunofluorescent images were captured at

×40 magnification. Protein expression levels were measured by Western blotting and

quantified by densitometric analysis. Relative intensities (%) mRNAs and proteins were

normalized with β-actin. All data are presented as the mean ±SD (standard deviation) of three

independent experiments, and differences between groups were determined by one-way

ANOVA by the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc.,

Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical significance between

control and cells treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

Fig. 6. Inhibition of carboxylesterase 3 (Ces3) and depletion of Ces3 gene in 3T3-L1 cells

results in down-regulation of browning marker proteins. (A) The relative expression of core

fat browning markers (PGC1α, PRDM16, and UCP1) reduces significantly upon inhibition of

Ces3 by BNPP dose-dependently. (B) Absence of Ces3 reduces the browning marker genes

and beige-specific genes, as well as (C) their encoding proteins, in a dose-dependent manner.

Ces3 knock down cells by siRNA were fixed with p-formaldehyde, subjected to staining for

Mitotraker Red, and then ICC staining for (D) Ces3, and (E) UCP1, where the

immunofluorescent images were captured at × 40 magnifications. Protein expression levels

were measured by Western blotting and quantified by densitometric analysis. Relative

intensities (%) mRNAs and proteins were normalized with β-actin. All data are presented as

Page 28 of 36



Draft

the mean ±SD (standard deviation) of three independent experiments, and differences

between groups were determined by one-way ANOVA by the Statistical Package of Social

Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s

t-test. Statistical significance between control and cells treated with NPA, BNPP, and siRNA

is shown as *p < 0.05, **p < 0.01.

Page 29 of 36



Draft

Table 1. Primer sequences used for real-time quantitative RT-PCR.

Gene Forward Reverse

Ces1Ces2Ces3Cidea

TAAAACCACCACCTCCGCTGAATGCTGGGTTCTTCGGGGCCAACTTTGCTCGGAATGGCGGGAATAGCCAGAGTCACC

GGGATAGCTCTCTCTGGGGTCTTCACGTGGATAAGGCTGCGCCTGAGTTGAGGCACCAATTGTGCATCGGATGTCGTAGG

Cited1 GGGGTAAAAGATCGCAAGGC TGGTAGAAGGGGTGGCAGTAPpargc1α ATGAATGCAGCGGTCTTAGC AACAATGGCAGGGTTTGTTCPrdm16 GATGGGAGATGCTGACGGAT TGATCTGACACATGGCGAGGTbx1 AGCGAGGCGGAAGGGA CCTGGTGACTGTGCTGAAGTTmem26 GAAACCAGTATTGCAGCACCC CCAGACCGGTTCACATACCAUcp1 CCTGCCTCTCTCGGAAACAA GTAGCGGGGTTTGATCCCAT

Page 30 of 36



Draft

Fig. 1. Activation and inhibition of carboxylesterase 3 (Ces3), as well as silencing of Ces3 in 3T3-L1 adipocytes. Cytotoxicity of (A) NPA, a specific substrate, and (B) BNPP, the inhibitor of Ces3. The expression of Ces3 was (C) significantly enhanced upon the induction of NPA, whereas (D) it gradually decreased when imbibed with BNPP. (E) Depletion of Ces3 in 3T3-L1 adipocytes was achieved by knocking down Ces3 gene by siRNA in a dose-dependent manner. Protein expression levels were measured by Western blotting and

quantified by densitometric analysis. Relative intensities (%) proteins were normalized with β-actin. All data are presented as the mean ±SD (standard deviation) of three independent experiments, and differences between groups were determined by one-way ANOVA by the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical significance

between control and cells treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

139x98mm (300 x 300 DPI)

Page 31 of 36



Draft

Fig. 2. Carboxylesterase 3 (Ces3) regulates lipogenesis and adipogenesis in mature white adipocytes. (A) The activation of Ces3 via its substrate NPA upregulates the lipogenic maker proteins, while the suppression

of Ces3 by its inhibitor BNPP, as well as Ces3 gene depletion after knockdown, particularly elevates lipogenesis in 3T3-L1 cells. (B) The deficiency of Ces3 deteriorates adipogenesis at the transcription levels,

by reducing the expression of C/EBPα and PPARγ, while activated Ces3 markedly elevates adipogenesis. Protein expression levels were measured by Western blotting and quantified by densitometric analysis. Relative intensities (%) proteins were normalized with β-actin. All data are presented as the mean ±SD

(standard deviation) of three independent experiments, and differences between groups were determined by one-way ANOVA by the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical significance between control and cells treated with

NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

121x164mm (300 x 300 DPI)

Page 32 of 36



Draft

Page 33 of 36



Draft

Fig. 3. Imaging lipid droplet influenced by Ces3. Representative images of Oil Red O staining of 3T3-L1 were taken at ×20 magnification (scale bars = 50 μm), and ×40 magnification (scale bars = 100 μm), where lipid

content was quantified by extracting Oil Red O stain bound to cells with 100 % isopropanol in 3T3-L1 adipocytes in the (A) activated, and (B) suppressed state of Ces3, respectively. Statistical significance

between control and cells treated with NPA and BNPP is shown as either *p<0.05 or **p< 0.01.

173x69mm (300 x 300 DPI)

Page 34 of 36



Draft

Fig. 4. Carboxylesterase 3 (Ces3) highly regulates lipolysis and fat oxidation in 3T3-L1 adipocytes. (A) Ces3 acts a major lipolytic enzyme in white adipocytes alongside p-HSL, which remains independent of the

presence or absence of Ces3, while (B) fat oxidation is sensitively reduced in the absence of Ces3, but is elevated when Ces3 is activated. Protein expression levels were measured by Western blotting and

quantified by densitometric analysis. Relative intensities (%) proteins were normalized with β-actin. All data are presented as the mean ±SD (standard deviation) of three independent experiments, and differences between groups were determined by one-way ANOVA by the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical significance

between control and cells treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

123x96mm (300 x 300 DPI)

Page 35 of 36



Draft

Fig. 5. Activation of carboxylesterase 3 (Ces3) leads to browning in 3T3-L1 adipocytes. Activation of Ces3 (A) increases the relative expression of genes encoding Ces3, as well as beige-specific thermogenic genes,

along with (B) core fat browning marker proteins (PGC1α, PRDM16, and UCP1), in a dose-dependent manner. 3T3-L1 white adipocytes with activated Ces were fixed with p-formaldehyde, subjected to staining for Mitotraker Red, and then ICC staining for (C) Ces3, and (D) UCP1, where the immunofluorescent images

were captured at ×40 magnification. Protein expression levels were measured by Western blotting and quantified by densitometric analysis. Relative intensities (%) mRNAs and proteins were normalized with β-actin. All data are presented as the mean ±SD (standard deviation) of three independent experiments, and

differences between groups were determined by one-way ANOVA by the Statistical Package of Social Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical

significance between control and cells treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p < 0.01.

200x170mm (300 x 300 DPI)

Page 36 of 36



Draft

Fig. 6. Inhibition of carboxylesterase 3 (Ces3) and depletion of Ces3 gene in 3T3-L1 cells results in down-regulation of browning marker proteins. (A) The relative expression of core fat browning markers (PGC1α,

PRDM16, and UCP1) reduces significantly upon inhibition of Ces3 by BNPP dose-dependently. (B) Absence of Ces3 reduces the browning marker genes and beige-specific genes, as well as (C) their encoding proteins, in

a dose-dependent manner. Ces3 knock down cells by siRNA were fixed with p-formaldehyde, subjected to staining for Mitotraker Red, and then ICC staining for (D) Ces3, and (E) UCP1, where the immunofluorescent images were captured at × 40 magnifications. Protein expression levels were measured by Western blotting and quantified by densitometric analysis. Relative intensities (%) mRNAs and proteins were normalized with

β-actin. All data are presented as the mean ±SD (standard deviation) of three independent experiments, and differences between groups were determined by one-way ANOVA by the Statistical Package of Social

Science (SPSS, version 17.0; SPSS Inc., Chicago, IL, USA) program or two-tailed Student’s t-test. Statistical significance between control and cells treated with NPA, BNPP, and siRNA is shown as *p < 0.05, **p <

0.01.

167x183mm (300 x 300 DPI)

Page 37 of 36



Draft...Draft Abstract The role of carboxylesterase 3 (Ces3) in the lipolysis of adipocytes has been...

Documents

Transcript of Draft...Draft Abstract The role of carboxylesterase 3 (Ces3) in the lipolysis of adipocytes has been...