Dr. John Fetzer on - Welcome to NESACS - Home Page · Chikezie I. Eseonu Major: ... fic light onto...

��

yyyyyyyyyyyyyyyyyyyy

NO

RTH

EA

STE

RN

SECTION • AMERICAN

CHEMIC

AL

SO

CIE

TY

FOUNDED 1898

�N�E�S�A�C�S

March 2005 Vol. LXXXIII, No. 7

MonthlyMeetingDr. John Fetzer on “Chemistry as a Soft Science”

MemorialServiceArno Heyn

Science PoetryContestby Sheila Cusolito

Improving AirQualityby Martin Freier

2 The Nucleus March 2005

Harvard UniversityJessica G. BazickMajor: BiochemistryClass: SeniorHome: Bothell, WASharon O. DokuMajor: Chemical EngineeringClass: SeniorHome: Charlotte, NCChikezie I. EseonuMajor: Biochemistry and BiomedicalEngineeringClass: SophomoreHome: Chester, VA

Christina Ann FieldsMajor: ChemistryClass: SeniorHome: Wilmington, NCMark A. GarroMajor: Chemistry and PhysicsClass: FreshmanHome: Reno, NVRoy G. Hughes, Jr.Major: BiochemistryClass: SeniorHome: Greenwood, LAMelissa Q. McCreeryMajor: BiochemistryClass: FreshmanHome: Nevada City, CADurrell B. RobinsonMajor: ChemistryClass: FreshmanHome: Battle Creek, MI

Massachusetts Institute of TechnologySilvana R. ArevaloMajor: Chemical EngineeringClass: SophomoreHome: Silver Spring, MDNia S. BeckleyMajor: Chemical and Biological EngineeringClass: SophomoreHome: Fairburn, GA

Yamicia D. ConnorMajor: Chemical EngineeringClass: SophomoreHome: Jacksonville, FLJamira V. CottonMajor: Chemical EngineeringClass: FreshmanHome: Longview, TXReuben L. CummingsMajor: Chemical EngineeringClass: SeniorHome: Peoria, ILNduka O. EnemchukwuMajor: Material Sciences and EngineeringClass: SeniorHome: Sorrento, FLIsmael J. GomezMajor: ChemistryClass: FreshmanHome: Granada Hills, CADoris M. Grillo GonzalezMajor: ChemistryClass: SophomoreHome: Caguas, PRNicholas A. PearceMajor: Chemical EngineeringClass: SophomoreHome: Chicago, ILJillian A. Smith (NESACS Scholar)Major: Chemical EngineeringClass: SophomoreHome: Boston, MAAline ThomasMajor: Chemical EngineeringClass: FreshmanHome: Miami, FLRoberto VelazquezMajor: ChemistryClass: FreshmanHome: Wichita Falls, TX

Northeastern UniversityMark V. MichelmanMajor: Chemical EngineeringClass: FreshmanHome: Reading, MARyan R. RichardsonMajor: BiochemistryClass: SophomoreHome: Sandy Hook, CA

Tufts UniversityCamille I. PetersenMajor: Chemistry/BiochemistryClass: FreshmanHome: Taos, NM ◆◆

Robert Hughes, manager of the ACSScholars Program in Washington, DC,has provided the following list ofScholars who are studying during the2004-05 academic year at institutionswithin NESACS. Section memberswho are faculty members are urged tomake contact with Scholars at theirinstitutions. For the second year in arow, Jillian Smith of Boston, a sopho-more chemical engineering student atMIT, has been designated as“NESACS Scholar,” and is supportedspecifically by the contribution theSection makes to the Program.

ACS Scholars Within NESACS

The Nucleus March 2005 3

The Northeastern Section of the AmericanChemical Society, Inc.Office: Marilou Cashman, 23 Cottage St., Natick, MA 01760. 1-800-872-2054 (Voice or FAX) or 508-653-6329. e-mail: [email protected] Section business may be conducted via the business office above.NESACS Homepage:http://www.NESACS.orgSamuel P. Kounaves, WebmasterACS Hotline, Washington, D.C.: 1-800-227-5558Officers 2005Chair:Amy TapperPeptimmune64 Sidney Street, Suite 380, Cambridge, MA 02139617-715-8005; [email protected]:Patricia MabroukChemistry Department, Northeastern UniversityBoston, MA 02115617 373 2845; [email protected] Past Chair:Jean A. Fuller-StanleyChemistry Department, Wellesley CollegeWellesley, MA 02481-8203781-283-3224; [email protected]:Michael SingerSigma RBI3 Strathmore Rd. Natick, MA 01760-2447508-651-8151x291 [email protected]:James Piper19 Mill Rd., Harvard, MA 01451978-456-3155 [email protected]:Anthony RosnerArchivist:Myron S. Simon20 Somerset Rd. Newton, MA 02465; [email protected]:Joseph A. Lima, Esther A.H. Hopkins, Michael E. Strem, Councilors: Alternate Councilors:Term Ends 12/31/2005Mary T. Burgess Patrick M. GordonMorton Z. Hoffman Lowell H. HallDoris I. Lewis Donald O. RickterTruman S. Light LawrenceT. ScottAmy E. Tapper J. Donald SmithTerm Ends 12/31/2006Michaeline F. Chen Wallace J. GleekmanCatherine E. Costello Howard R. MaynePatricia A. Mabrouk Alfred ViolaJulia H. Miwa Barbara G. WoodDorothy J. Phillips Michael SingerTerm Ends 12/31/2007Thomas R. Gilbert Arlene W. LightJean A. Fuller-Stanley Pamela M. NagafujiMichael J. Hearn Timothy B. Frigo Michael Singer Susan Chiri-Buta

All Chairs of standingCommittees, the editor of THE NUCLEUS, and the Trustees of SectionFunds are members of theBoard of Directors. AnyCouncilor of the American Chemical Societyresiding within the section area is an ex officiomember of the Board of Directors.

The Nucleus is distributed to the members of the Northeastern Section of the American Chemical Society, to the secretaries of the Local Sections, and to editors of all local A.C.S. Section publications.Forms close for advertising on the 1st of the month of the preceding issue. Text must be received by theeditor six weeks before the date of issue.Editor: Michael P. Filosa, Ph.D., Polaroid Corporation, 1265 Main Street, Waltham,

MA 02451 Email: [email protected]; Tel: 781-386-8479Associate Editors: Myron S. Simon, 20 Somerset Rd., W. Newton, MA 02465, Tel: 617-332-5273

Nancy Simons, Analytical Chemist, Corporate R&D, Boston Scientific Corp., 1 Boston Scientific Place A4, Natick, MA 01760-1537. Email: simonsn(at)bsci.com; Tel. 508-650-8603; Fax 508-647-2329Ao Zhang, Ph.D., Instructor and Assistant Director, Medicinal Chemistry Pro-gram, McLean Hospital, Harvard Medical School Email: azhang(at)mclean.harvard.edu; Tel: 617-855-2159; Fax: 617-855-2519Kelie Williams, Medicinal Chemist and Science Writer, 6 Ainsley Street,Dorchester, MA 02122 Email: wkhw(at)aol.com; Phone: 617-288-2238

Board of Publications: Vivian K. Walworth (Chair), Mary Mahaney, Martin Idelson, E. Joseph Billo (Consultant)

Business Manager: Karen Piper, 19 Mill Rd., Harvard, MA 01451, Tel: 978-456-8622Advertising Manager: Vincent J. Gale, P.O. Box 1150, Marshfield, MA 02050,

Tel: 781-837-0424; FAX: 781-837-8792Contributing Editors: Morton Hoffman, Feature Editor; Dennis Sardella, Book Reviews; Calendar Coordinator: Donald O. Rickter, e-mail: rickter(at)rcn.comProofreaders: E. Joseph Billo, Donald O. Rickter, Myron S. Simon, Ao ZhangWebpage: Webmaster: Samuel P. Kounaves, samuel.kounaves(at)tufts.eduCopyright 2005, Northeastern Section of the American Chemical Society, Inc.

ContentsACS Scholars _________________________________________2

Monthly Meeting _______________________________________5Dr. John Fetzer

Myron’s Remarks on Arno________________________________6

Memorial Service ______________________________________7Arno Heyn

Science Poetry Contest ________________________________11by Sheila Cusolito

Summer Research Scholar ______________________________12“Toward determination of the structural basis for HIV-1 integrase substraterecognition”

Book Review _________________________________________15“Quack, Quack, Quack. The Sellers of Nostrums in Posters, Ephemera & Books”

Historical Notes ______________________________________16Obituaries of recently deceased chemists and chemical engineers

Improving Air Quality __________________________________18An article by Martin Freier

Cover: Dr. John Fetzer

Deadlines: May 2005 Issue: March 21, 2005Summer 2005 Issue: June 18, 2005

DirectionsFrom the Mass Pike East/Route 90:(New York, Connecticut & WesternMassachusetts)Take the Mass Pike East to exit 18,Allston/Cambridge, the exit will be onthe left. Bear right, following signstowards Cambridge. Turn right on toStorrow Drive. Follow Storrow Driveto the Boston University exit. Off theexit follow Carlton Street approxi-mately one block to CommonwealthAvenue. Follow CommonwealthAvenue and turn left at the second traf-fic light onto Saint Paul Street. Thehotel is six blocks down on the left, onthe corner of Beacon Street and SaintPaul StreetFrom 93 North or SouthTake Exit 26, Storrow Drive. FollowStorrow Drive to the Kenmore Squareexit, the exit will be on the left. Of f theexit, turn right at the first light ontoBeacon St. The hotel is one mile up onthe right at 1200 Beacon St..The Holiday Inn is located at theGreen C Line “St. Paul Street” T StopParking: Meter parking is available onBeacon Street as well as Holiday Inngarage parking (It is $6 for unlimitedparking. Guests can pick up a voucherfrom the hotel and pay when theyleave.) ◆◆

Thursday, March 31, 2005 Brookline Holiday Inn1200 Beacon Street, Brookline, MASchedule:(Whitney Hall A)

3pm-7pm ACS Career Services workshops on resume writing and inter-viewing skills

(Whitney Hall B)3pm-7pm Job Fair – Meet with representatives from companies

in the Northeast about employment opportunitiesHave your resume reviewed by ACS Careers services

FREE REGISTRATION (Returnable Deposit):Please register at the Northeastern Section Younger Chemists Committee website: www.nsycc.orgParticipating companies will be listed. ◆◆

Second Annual

Northeast StudentChemistry Career Fair


Corporate PatronsAstraZeneca R&D BostonGenzyme Drug Discovery & Dev.IBMPhasex CorporationStrem Chemicals Inc.Zone EnterprisesCorporate SponsorsAerodyne Research Inc.Cambridge Isotope LaboratoriesNew England BioLabs, Inc.PfizerSigma-RBIDonorsConsulting Resources Corp.Houghton Chemical CompanyOrganix Inc.

CandidatesChair Elect

Mukund S. ChorghadeTBD

TrusteeMichael E. Strem

SecretaryMichael Singer

Esselen Award CommitteeJohn L. NeumeyerJoseph A. LimaTBD

Richards Medal CommitteePaul DavidovitsRoy G. GordonGregory L. Verdine

Directors at LargeDr. Henry BrownErnest V. GromanDavid M. Lemal

Candidates for Councilors/AlternateCouncilors 2006-2008

Mary BurgessPatrick GordonMichael FilosaChristine Jaworek-LopesMorton HoffmanDoris LewisMary MahaneyDonald O. RickterAmy TapperRaj (SB) RajurLawrence ScottLiming Shao ◆◆

The 7th Annual NortheastStudent Chemistry ResearchConferenceSaturday, April 23, 2005, 9am – 4pmMassachusetts Institute of Technology

REGISTRATION $5 (payable at door)Undergraduate, graduate, and post-doctoral students in all areas of chemistry welcome

CASH AWARDSfor best presentations

Abstract Deadlines:Oral presentations: April 8, 2005Poster presentations: April 15, 2005

For details, directions, registration, andabstract submission, please visit theNortheastern Section YoungerChemists Committee website:www.nsycc.org ◆◆

Action item

Call forPapers


BiographyDr. John C. Fetzeris a recognized expert in the analysisof PAHs and petroleum-related materi-als. He has served as the president ofthe International Society on PolycyclicAromatic Compounds, is the topicaleditor for analytical chemistry for thejournal Polycyclic Aromatic Com-pounds, and has served or is servingon the editorial advisory boards for the

Journal of Chromatography, A pagesof Analytical Chemistry, and Analyti-cal and Bioanalytical Chemistry. Hehas published over 140 technical andreview articles and book chapters,holds three US patents, and is theauthor of two books, The Chemistryand Analysis of the Large (C>=24C)Polycyclic Aromatic Hydrocarbons(Wiley-Interscience, 2000) and CareerManagement for Chemists (Springer,2004). His monthly column “Buildinga Professional Career” appears in Ana-

lytical and Bioanalytical Chemistry.Dr. Fetzer founded Fetzpahs Con-

sulting in 2002 after over twenty yearsas a research analytical chemist in thepetroleum industry. ◆◆

Monthly MeetingThe 859th Meeting of the Northeastern Section of the AmericanChemical SocietyAnd Joint meeting with the Younger Chemists Committee (YCC)Thursday, March 10, 2005Holiday Inn Brookline, 1200 Beacon Street, MAWhitney Hall B3:30-5:30pm Younger Chemists Committee Symposium and Networking

Event “Making the Transition from School to a Career: Expe-riences and Advice.”Speakers:

Dr. Nora Conlon of the EPA (government)Dr. Alexander Kolchinski of Pharm-Eco (industry)Prof. Oleg Ozerov of Brandeis University (academia)

Schedule and details available on the YCC website,www.nsycc.org.

Hall Foyer5:30 pm Social HourWhitney Hall B6:30 pm Dinner7:45 pm Evening Meeting, Dr. Amy Tapper presiding

“Chemistry as a Soft Science”Dr. John Fetzer, Fetzpahs Consulting

Dinner reservations should be made no later than noon, March 3, 2005. Call orfax Marilou Cashman at (800) 872-2054 or e-mail at [email protected] not cancelled at least 24 hours in advance must be paid. Members,$28.00; Non-members, $30.00; Retirees, $18.00; Students, $10.00.THE PUBLIC IS INVITED.Anyone who needs handicap services/transportation, please call Marilou Cash-man a few days in advance so that suitable arrangements can be made.Next Meeting: Esselen Award Meeting, April 14, 2005, Harvard University.Reception and dinner 5:30 pm, Harvard Faculty Club;Award Meeting: 8:15 pm, Pfizer Hall, Mallinckrodt Chemistry Building, 12Oxford St., Cambridge. Dr. Jean M. J. Fréchet, Rapoport Chair of OrganicChemistry, University of California, Berkeley and Head of Materials Synthesis,Lawrence Berkeley National Laboratory: “Functional Macromolecules: FromDesign and Synthesis to Applications.”

AbstractThe physical sciences are known as thehard sciences because their experimen-tal areas are reproducibly done in thelaboratory. The science is controlled bythe conditions. The sciences get“softer” as they move away from thiscontrolled experimental model. Thoseinvolving people and their thinkingand interactions – psychology, sociol-ogy, and communications – are thoughtof as soft sciences because individualsvary so widely that even generalbehaviors are difficult to define.

A successful career in a hard sci-ence, however, includes much of thesoft sciences of psychology, sociology,and communications. Chemists arepeople. Underlying their work are thethinking and emotions of individuals.Over the course of a career, an individ-ual has more opportunities and takesbetter advantage of them if she or heuses skills in these three areas.

In communications, better givenpresentations are more well-received.The speaking skills are generally simi-lar to other types of oratory, but high-light the storytelling of good research.Better written papers are more likely tobe accepted. Listening skills createopportunities and better knowledge.Most people are not good listeners.Some listening skills include slowingdown and making it a dialogue.

In the sociology within chemistryare such areas as teamwork and collab-oration, competitiveness and credit,networking, and supervision and lead-ership. Teamwork and mutual supportare essential in this era of specializa-tion. Innovation grows among adynamic multi-disciplinary team.Research advisors are supervisors andmust deal with personalities and inter-actions.

In the psychology within chem-istry, understanding others in all

continued on page 6

Awards Committee ...............................Dr. Michael J. DubeBoard of Publications ...........................Mrs. Vivian K. WalworthBudget Committee................................Dr. James U. PiperChem Health & Safety..........................Ms. Mary Ann SolstadChemical Education..............................Dr. Ruth TannerChem. Ed./College................................Dr. Morton Z. HoffmanChem. Ed./H.S. .....................................Mr. Steve LantosConst. & Bylaws ..................................Dr. Catherine CostelloContinuing Education...........................Dr. Alfred ViolaCorporate Funding................................Dr. Dorothy J. PhillipsEsselen Committee ...............................Dr. Paul VourosGovernment Relations ..........................Dr. Doris I. LewisLiaison to Businesses ...........................Dr. James QuickLocal Arrangements..............................Miss Mary BurgessMembership..........................................Mrs. Michaeline ChenNational Chemistry Week.....................Dr. Christine H. Jaworek-LopesNominating - Chair Pro Tem ...............Dr. Jean A. Fuller-StanleyNorris Committee .................................Dr. Howard R. MayneProf. Rel./Career Serv...........................Mrs. Arlene W. LightProf. Rel./Career Serv...........................Dr. Truman S. LightProgram Chair ......................................Dr. Patricia A. MabroukProject SEED........................................Dr. Patricia A. MabroukPublic Relations....................................Dr. Stephen DohertyPublic Service.......................................Dr. James A. GolenRichards Medal.....................................Dr. Charles KolbSenior Chemists....................................Mr. Charles J. BardsleySpeakers’ Bureau ..................................Ms. Susan M. Chiri-ButaSummerthing ........................................Dr. Wallace J. GleekmanYCC Co-Chair ......................................Mr. Ivan KorendovychYCC Co-Chair ......................................Ms. Lauren Wolf ◆◆

Committee Chairs


aspects can help make things easier.Differences in thinking and style arecommon. In one example, some peopleare detail oriented and naturally metic-ulous. Others are “bigger picture”thinkers. Personalities often come intoplay. Egotism, generosity, competitive-ness, trust and mistrust, and otherattributes vary among chemists just asthey do among other people. Ignoringpersonalities can make you less effec-tive or even leave you vulnerable. ◆◆

AbstractContinued from page 5

I have known Arno for a little overfifty years. We were brought togetherby George Ehrenfried and later the SubSig Outing Club, and remained friendsbecause of our mutual interest in hik-ing and other outdoor sports, andchemistry. But it was only in the lastfifteen years that I have learned toknow him really well, as a result of ourwork together on the Nucleus, the pub-lication of the local chemistry group.

Around 1990 Arno asked me tohelp him with the Nucleus, to take onthe post of Associate Editor. Weworked well together, each supple-menting gaps in the other, and I wantto give you my understanding of him.

Arno was not only highly intelli-gent and extremely well organized,but, unlike many brilliant people, hewas also a hands-on person, capable ofhandling problems mechanical, chemi-cal or in the kitchen. He was a great

hiker, a good skier, but also a greatreader and thinker, electrician, carpen-ter, and gas stove repairer. That he tookup locksmith work when he retiredfrom teaching should be no surprise.He was just fond of working withmechanical things.

The side of Arno I most admired,however, was his exceptional precisionin planning and executing. For exam-ple, he was able to plan out everyphase of the production of the Nucleusa year in advance, and see to it that itwas carried through just as he hadplanned.

He was a gentle person, pleasantto work with, a reliable friend, a wel-come voice on the phone, and consis-tent with his sign-off, “See you.”

He will be remembered, he will bemissed. “See you”, Arno.

M. S. Simon ◆◆

Myron’s Remarks on Arno

SUMMER-THING 2005Boston Red SoxThis is advance notice for members ofthe Northeastern Section, ACS. Due tothe response of our members to thethree games offered for the Boston RedSox games in 2004, Summerthing willcontinue to offer tickets for the “WorldChampion” Red Sox in 2005. Unfortu-nately our discounts have all disap-peared due to “inventory constraints”so we shall be offering right fieldgrandstand tickets at $27 plus $5 forNESACS education activities. Ticketsare hard to get but the following gameswill be available:

1. Sat, May 21 @ 2:05 or 7:05*Atlanta Braves

2. Sun, Jun 19 @ 2:05 or 7:05*Pittsburgh Pirates

3. Tue, Jun 28 @ 7:05Cleveland Indians

4. Sat, Jul 30 @ 2:05 or 7:05*Minnesota Twins

5. Sat, Sep 17 @ 2:05 or 7:05*Oakland Athletics

*time may vary because of TV sched-ule commitmentsFor further information or to reservetickets, contact the Summerthing chair,Wally Gleekman, at 617-527-1192 [email protected] ◆◆


It is a great honor for me, albeit tinged with sadness, to havebeen asked to say a few words today at this memorial serv-ice for our colleague and friend, Arno Heyn. I thank Bob forcontacting me and sharing some memories, and offer mycondolences to Helen and the entire Heyn family. Arnofought the good fight, and will be missed.

I always felt a kinship with Arno because of our mutualconnections to the University of Michigan at Ann Arbor; hedid his undergraduate and graduate work there, receiving hisPh.D. in analytical chemistry in 1944, while I received myPh.D. in physical chemistry there 16 years later. We wereable to compare notes about the changes that had takenplace in the university, especially in the chemistry depart-ment, and in Ann Arbor. We even had some of the sameteachers!

When I came to B.U., together with Al Prock in the fac-ulty class of 1961, Arno was one of the “middle-aged” pro-fessors, sandwiched with Norman Lichtin between veteransPhil Mason and Lowell Coulter, and the more youthful LouBaker, Klaas Eriks, and Ron Milburn. I was, indeed, theyoungest kid on the block, and Arno provided the guidanceand mentoring about teaching and research that new facultyneed for their growth and development.

A lot of this mentoring took place at lunchtime inArno’s office on the first floor of the Stone Science Buildingat 675 Comm. Ave. At that time in the early 1960’s, all ofthe chemistry department, including faculty and administra-tive offices, teaching and research laboratories, and support-ing services were housed in that relatively small space;several faculty members had just moved their operationsinto the Stone Building from the Quonset huts, which occu-pied the area where the Union is now.

Lunch with Arno included Klaas Eriks, and occasion-ally others as the faculty grew in subsequent years; hisoffice was a welcoming venue for committee meetings.Lunchtime featured Arno’s cookie box, which was alwaysfilled with goodies that I could not resist, and his ConstantComment loose tea, which he steeped from a spoon-likedevice into the cup with boiling water . How he would care-fully measure out the tea; too little and the tea would beinsipid, too much and it would be acerbic.

Arno was, after all, a card-carrying analytical chemist;he was part of that tradition where the proper application ofquantitative volumetric and gravimetric techniques was thedifference between being a chemist and something else. Heprided himself on the time he spent with the students in thequantitative analysis and instrumental analysis laboratories,answering their questions and showing them the proper useof the pipette, burette, and rubber policeman. He relishedthe quest for the perfect measurement while knowing full

well the limits to precision. Precision of speech, writing, andattitude characterized Arno’s professional and personal life.

Within the Chemistry Department, Arno was the institu-tional memory. He not only took the minutes at facultymeetings, he remembered for years (or, perhaps, decades)this or that action of the past and all the debating points, andwould not hesitate to let the historical strength or weaknessof one’s position be known. It was not possible to beat Arnoin the memory game.

Later, when he retired from B.U. and became Editor ofThe NUCLEUS of the Northeastern Section of the AmericanChemical Society, a position he held for 14 years, hebecame the institutional memory of NESACS. As a memberof the Board of Directors of the Section and Councilor,Arno cast a critical eye over the governance of the nationalSociety and local Section. When I was Chair of NESACSin 2002, my greatest fear as the presiding officer at theBoard meetings was that of Arno raising his hand, and witha smile, making a point of order. I knew I was about to beskewered, and there wasn’t a damn thing I could do aboutit.

Arno loved to travel to Europe. One of the great storiesthat we liked to share with each other was that of anextremely low-probability event. In the summer of 1973, mywife, Sandy, and I were in Italy on one of my research jun-kets to Bologna. We happened to be visiting Florence oneday, and were sauntering across the crowded Ponte Vecchiowhen, to our absolute astonishment, we ran smack into Arnoand Helen coming the other way! They were equally aston-ished. Arno had just finished a sabbatical leave in Karlsruhe,and he and Helen were touring Italy before going back toBoston. If that event were set in a novel or movie, no onewould believe it. It truly is a remarkably small world.

Before closing, I would like to point out the little-known fact that Arno and I share three publications and onegrant citation in our respective résumés, and take the oppor-tunity to introduce a little chemistry into this memorial serv-ice for him, which seems appropriate.

In the mid-1960’s, Arno had an Indian graduate studentby the name of M. Das who was working on his Ph.D. inanalytical chemistry. As is still required today, Das had tomake an oral presentation of an original research proposal toa faculty committee of which I was a member. Das proposedthat ultraviolet light be used as the initiator of the analyticalchemical technique known as “precipitation from homoge-neous solution,” in which a precipitating reagent is chemi-cally generated in situ, resulting in smaller, more easilyfiltered, and purer crystals. Das suggested that the photo-chemical reduction of metaperiodate ion (IO4–) to iodate

Memorial Service for Arno HeynJanuary 6, 2005

continued on page 8

ion (IO3–) could be used to initiate the precipitation of tho-rium(IV) ions as Th(IO3)4. The committee thought that thiswas a good proposal and advanced Das to Ph.D. candidacy .I remember asking Das if he would like to try out his pro-posal to see if it would work.

Now, one of my research ef forts at that time involved acollaboration with John Endicott on the photochemical reac-tions of coordination compounds, and there were many low-pressure mercury lamps in my lab that emitted intensely at254 nm. Das borrowed a lamp, set up the experiment, and itworked! Preliminary results were published in the journalTalanta in 1967, and Das included this study in his thesis; hereceived the Ph.D. degree that year, and went on to a posi-tion at the University of Tabriz in Iran.

In the meantime, Arno and I wrote a proposal to theNational Science Foundation for a grant to support furtherstudy of precipitation from homogeneous solution by photo-chemical action. We received a two-year grant from NSF forthe princely sum of $30,000. I learned a lot from Arno aboutmaking a little money go a long way! The funds helped usget a custom-designed mercury lamp constructed, and pro-vided support for a professor from India, R.P. Agarwal ofRoorkee University, who had come to work with Arno.Agarwal expanded the studies on thorium, investigated thephotochemical precipitation of cerium, and established thelimits of the impurities of other ions for quantitative separa-tion. A preliminary report was published in 1969 in Analyti-cal Letters, followed by a full paper in Talanta in 1970.After that, Arno and I went off in our own directions, butmy experience of working with him focused my attention onthe importance of precise techniques and measurements inthe research and teaching of chemistry.

Telephone and e-mail communications with Arno usu-ally ended with his very characteristic “See you.” And so, inArno’s everlasting memory, one final time.

See you.Morton HoffmanProfessor of Chemistry, Boston University

Margaret’s Memories of Her Father Arno HeynThose of us here today probably know very dif ferent sidesof my father. He was a person with many interests, talentsand abilities and somehow he managed to balance all ofthem into one very full life. I remember at age 3, or so,being introduced to mountaineering and camping, whichwere part of his passion for the outdoors, for nature, forstaying fit, and for life itself! Older members of the outingclub named Sub Sig will remember the old Sub Sig Bus.After much convincing, my father allowed me to go on myfirst ski trip in the Sub Sig Bus at age 7. At the end of theday, he directed me to ski down the slope to the parking lot.When I asked him how I would stop, he said playfully,

“You’ll figure something out.” I ended up sitting down,which he called the “tail stop”. He was a “hands off” type ofparent. Over the years, he was deeply involved with SubSig, leading mountaineering, skiing, canoeing, renovation &other trips up north, serving as various officers, as lock-smith, and working on building and improvement projects.

One other tale I can’t resist telling is when the Sub SigSchoolhouse in Vermont had a problem with mouse infesta-tion. My father decided we should bring our kitten up there,as she was a good huntress. Although she became car-sickon the winding roads, we could tell she was still able to doher duty in the middle of the night, when we heard muchsqueaking from a mouse. All of a sudden my father got outof his sleeping bag, rescued the mouse and put it outside. Hesaid he couldn’t bear to hear the poor mouse any longer . Hetended to do the same with flies: he would catch them & putthem outside.

Back to camping: his influence led to my becoming alover of back-packing, hiking, and the outdoors. In recenttimes, he and I had begun a tradition when I would comehome for a visit in the spring. We would climb a mountainin New Hampshire, after spending a night together in theSub Sig Cabin. But after we had climbed Mt. Cardigan andMt. Willard, he became too ill to continue this tradition. Hewas 84 when we climbed Mt. Willard and was very proud ofit! He was just beginning then to show signs of weaknessand fatigue, but he still had a sharp mind, naming off theLatin names for many of the plants and trees. On the waydown, he fell, but recovered by turning a somersault andkept hiking!

I remember he used to tell a camping joke about howthe first person to complain about the food would be thenext cook. This led to his becoming the cook in our homefor about the last 10 years of his life. He had always beengood at making sauces, gravies, and especially a certainspinach dish. He branched out and became quite a gourmetcook. When he and I cooked together, we both moved likelightning. Many times we came close to unintentionallystabbing each other with the knives that my brother Evankept extremely sharp.

Another way he touched my life was through his greatlove for classical music, and that’s an understatement! Hiscollection of records and CDs is probably enough to lead toa diagnosis of OCD (that’s obsessive-compulsive disorder),especially when coupled with his collections of books, peri-odicals, magazines, camping equipment, etc. We still have athome a huge collection of 78 RPM records. Now , wheneverI play classical CDs, most of which he gave to me, or whenI hear classical music, it seems as if he is near . When I hadstarted taking classical piano lessons at a young age, hebegan trying to play Bach, his favorite composer, but wasfrustrated that he could never build up the speed. But henever gave up trying.

As a professional, he was into many dif ferent pursuitsover the years: professor at BU, chemical consultant withthe FDA and also with the Hazardous Waste Committee inNewton, very active with the American Chemical Society


Memorial Service for ArnoContinued from page 7


and editor of the Nucleus magazine. After his retirement, headded on a locksmithing business, and helped my brotherBob with some computer aspects of his construction busi-ness. On his office door, he had a newspaper cartoon thatsaid “Arno Heyn – THE UNCOLLECTED WORKS” (therewas a place to fill in the name). In other words, he was notknown for his neat office, though I understand he kept hischemical lab so well that my mother thought she was marry-ing an orderly sort of man. Never -the-less, they were mar-ried for almost 63 years, sharing many common interests!That alone is an accomplishment in these times! Goingthrough his things is currently a full-time job for my olderbrother, Evan, who is the opposite of a pack-rat, and veryneat and thorough. My father kept everything, right down toConsumer Reports from the 1940s! Another tid-bit: Evanfound little bags of sunflower seeds, raisins & nuts in thepocket of almost every jacket & pack he owned!

Another of my father’s talents was mechanics and gen-erally being handy. He kept my mother’s old 1948 NashAmbassador going until it was an antique. After the frontwheel came off while it was moving, however, we kids wereafraid to ride in it, so it was finally sold, to the neighbors’delight, I’m sure. In his later years, he also took to doing theyard work, as my mother became less able.

Let it never be said that he lacked class, for he alwayshad his afternoon tea, with a bit of fanfare, always spoke inthe most pleasant voice when he answered the phone andclosed with “Right-O”. He loved to visit art and historicalmuseums. In his latter years, he traveled back to Germanyand around Europe almost annually, visiting relatives andfriends and attending his high school reunions. Last winter ,he went to New York City to see the Metropolitan Opera!He had sung 2nd base in some choral groups in the past.

Regarding his other sides, some say he reminded thema bit of a munchkin. Once he attended a costume party asthe Mad Hatter. The costume was really a fit for him! He didhave a sense of humor, and an ability to laugh at himself, asyou probably know.

He was not one to wear his heart on his sleeve, but hetended to tear up when he saw dachshunds. We had had twodachshunds: Ogie 1; then Ogie 2. He had sometimesthreatened to come home with another Dachshund afterOgie 2 died. I guess you could say he was unmistakablyGerman.

Last, but not least, he probably saved my life when Ihad had two surgeries within 3 weeks, with serious compli-cations. He dropped everything and came out to Louisville,KY for a month to nurse me and cook for me until I wasable to manage on my own. Immediately after he returned toMassachusetts, my mother developed colon cancer, and hedid the same for her.

We are grateful to him and will all miss him, but ourmemories of him live on … I only wish he had believed inthe afterlife so I could feel sure of seeing him again, but he

made it clear that he did not share that belief. He wanted usto enjoy the memories and any good that he may have donewhile he was among us. And we all have many fond memo-ries.

M. Heyn

Vivian Walworth’s Tribute to Arno HeynI have the distinction of having known Arno longer thananyone else here, even Helen Heyn, as I was the person whointroduced them to one another.

Arno was at that time a graduate student at the U. ofM., and I was an undergraduate chemistry major. Helen wasa recent graduate who worked in the School of PublicHealth. Arno and I were assistants to Professor Hobart H.Willard, who some of the chemists here will recall as theauthor of the major text on Quantitative Analysis and leadauthor of Willard, Merritt and Dean's Instrumental Methodsof Analysis. There's a strong connection here with theNortheastern Section of ACS, as Willard had earned hisPh.D. at Harvard under the much-revered T. W. Richards.

Arno was characteristically curious and eager to learnfrom experience, and those traits persisted throughout hislifetime. He loved chemistry, but he also had a passion forclassical music and literature, as well as an enthusiasm forthe outdoor world and a desire to know how everythingworked. Arno's broad interests led to diverse activities, asevidenced by his leadership in the NESACS and in the Sub-Sig Outing Club, as well as his construction skills and hiswork in later life as a locksmith.

You have heard by now a good bit about Arno's variousactivities. I want to relate just one early adventure that illus-trates how well Arno learned from experience. It was Mayof 1948, my first Mother's Day, to be precise, and four of us- George Ehrenfried. Arno, my husband Wilbur, and I setforth on a mountain-climbing trip. We left our 6-month-olddaughter, diapers and emergency bottles with friends withwhom we had stayed overnight at Lake Winnipesaukee, andwe told them that we would be climbing Mt. Chocorua.

From that point on we made so many mistakes that itbecame a great learning experience, though it was only Arnowho appreciated it as such, and it was only Arno whoremained cheerful throughout our entire misadventure. First,while driving toward the mountains we decided to climb Mt.Whiteface instead of Mt. Chocorua. We parked and startedthe climb, only to discover after a time that we were on thewrong trail, one that led up a secondary peak west of themain peak. We then decided to continue upward and to pickup a trail that the guidebook showed connecting the twopeaks. However, there was so much snow up there that wecouldn't find any sign of a trail.

We finally made one of our few sensible decisions,gave up on the trail between peaks, and elected to follow astream down the mountain. Unfortunately, that stream ledthrough one of the worst blowdowns we had ever seen, a

Margaret’s Memories Continued from page 8

continued on page 10


result of the 1938 hurricane. We per-sisted in following the stream, climb-ing over and under enormous fallentrees, and eventually we descendedinto a woods. By then it was gettingdark, and among us we had only onestrong flashlight. Wilbur had managedto lose his jacket during the climbdown, and we had wasted valuabledaylight time backtracking to look forit. The going through the woods wasdifficult and it was beginning to rain.We decided to spend the night rightthere, and the men did a fine job ofbuilding a bed of spruce boughs. Ofcourse we had no sleeping bags. Webuilt a tiny fire, shared a can of tinnedbeef and some crackers, and huddledtogether under our raingear for a mis-erable chilly night.

At dawn we were up and moving,and we found that it was only a 10-minute hike to where we had parkedthe car. We got back to Winnipesaukeein time for breakfast. Of course our

worried hosts had notified the StatePolice that we were lost on a dif ferentmountain, and we had to call off theirhunt. George had missed an importantMonday morning meeting at work, andwe each had to call our workplaces toreport that we would be arriving late.

Arno cheerfully observed that wehad benefited greatly from our experi-ences and we would all be better tripleaders for having made so many mis-takes in just one weekend. I think thatthis point of view was one of Arno'sreally strong traits. He was willing toexperiment, as well as to accept mis-takes and to learn from each and everyone of them. I believe that this attitudecontributed to his strength and leader-ship in the many-faceted life we arecelebrating today.

Vivian Walworth ◆◆

Tribute To Arno Continued from page 9

Board ofPublicationsVivian Walworth, ChairThe Board of Publications expressessincere gratitude to retiring NucleusEditor Mark Spitler, who is leaving thearea to take on new challenges at theNational Renewable Energy Labora-tory. We are pleased to announce theappointment of Mike Filosa as our newNucleus editor, effective January 1.Mark and Mike have worked togetherto assure a smooth transition. The edi-torial responsibility is shared by astrong team of Associate Editors, Con-tributing Editors, Proofreaders, andCalendar Coordinator, as listed on page3 of each issue. We are indebted tothem all for their parts in making theNucleus an outstanding newsletter.

Another responsibility of theBoard of Publications is the NESACSwebsite, www.nesacs.org. We greatlyappreciate the contributions of SamKounaves, who has performed out-standing service to NESACS as Web-Master/WebEditor. Not only has hebeen overseeing our website, but hemade a comprehensive revision andupdate when he came on board, takingthe website to a new, professional webpresence. Sam’s work responsibilitieshave increased, and for this reason heis resigning from active managementof our website. Please note the ad thatappears in this issue for his replace-ment, and spread the word to web-experienced colleagues who may wantto participate in this important func-tion.

As of January 1, the membershipof the Board of Publications has alsoundergone change. Retiring membersMarietta Schwartz and Patrick Gordondeserve special thanks for the success-ful management of Nucleus publica-tion for the past several years, aparticularly demanding responsibilityin the months following Arno Heyn’sunexpected early retirement due to hisillness. We are grateful, too, toMukund Chorgade, who stepped in as

Continued on page 14


For the seventeenth year, the annualMassachusetts Science Poetry Contestis underway. Spearheaded by ProfessorGeorge Ladd of the Boston CollegeLynch School of Education, the contestis designed for K through 8 students asa way to enhance writing, reading, andartistic expression by applying thesetools to topics in the world of sciencearound them. The poetry contest hasgrown from about 400 entries at itsinception to over 3,000 entries inrecent years.

Students are invited to write andillustrate a scientifically accurate, orig-inal poem, then submit it for consider-ation in one of several categories. Thecategories include most humorous,most expressive, best long poem, andbest foreign language poem. Also con-sidered are cooperative poems involv-ing the combined efforts of two ormore children, including multi-gradesubmissions. Professor Ladd citesdinosaurs, snakes, and birds among theannual favorite topics, but chemistry isalso well represented in poems aboutatoms, mixtures, food, drugs, and thestates of matter.

Requests for poems are mailed toelementary school principals in earlywinter for submission by mid-April.Poems are judged by school of educa-tion students enrolled in children’s lit-erature and science methods classes atBoston College and winners areannounced in June. Judged by type andgrade level, criteria include scientificaccuracy, originality, use of metaphor,and quality of illustration. Participatingstudents are recognized with certifi-cates and awardees are recognized withan additional certificate and a pressrelease sent to the local newspaper oftheir choice. Ladd views the contest asa mutually beneficial experience,where the future teachers are provided“insight into the thinking of studentsand the value of using science as avehicle for expressing one’s thoughts.”

In addition to exercising the young stu-dents’ skills, particularly in writing, thecontest also provides a way to highlightscience in the classroom.

Lori Casavant, a kindergartenteacher at the Charlotte A. DunningSchool in Framingham, has partici-pated in the contest for the past fiveyears. Her students won awards in2001 for a class cooperative poem andin 2002 for a cooperative poem withthe kindergartner’s fifth-grade readingbuddies. She finds the contest a terrificway to impart lessons innate to anycurriculum: understanding and follow-ing rules; brainstorming original ideas,both independently and as part of agroup; and organizing work. Addition-ally, she observes that her classes takegreat pleasure and pride in participat-ing and find it quite natural to go fromgeneral writing exercises to writingfocused on topics in their science cur-riculum. Casavant notes that for akindergartner, the wait for the Juneaward announcements seems an eter-nity, but the process generates consid-erable enthusiasm, both within theclassroom and within the school.

Professor Ladd, a former middleand high school biology and earth sci-ence teacher, began teaching at BostonCollege in 1969. Prior to earning hisD. Ed. in science education at IndianaUniversity, Bloomington, ProfessorLadd received a master’s degree in

geology and earth science there, and abachelor’s degree in biology fromSUNY, Oswego. Ladd cites a visit toan elementary school classroom as theimpetus for creating the contest. Dur-ing his visit, he observed a teacherreading science poetry to her class as away to inspire the children to thinkabout the world around them. The chil-dren weren’t the only ones inspiredthat day, as Ladd immediately begun tosynthesize the idea for the contest. Pro-fessor Ladd continues to be inspired bythe entries received each year. He envi-sions someday creating a web sitehighlighting the poetry contest, as wellas an anthology of science poems.With so many entries each year, hisonly difficulty may be in choosingwhich poems to include!The Scientific MethodUsed with permission of the author,Grade 7 The question comes first in the scien-tific method, Like why is it big or why is it red?Research comes next, when you getinformation About what is involved in your experi-mentation.Make a hypothesis, an educated guess, About how your experiment is going toprogress.Now plan your experiment, do it withcare!So your experiment won’t be a night-mare!Observe and record all significant data, But keep it handy, you’ll be using itlater.Review your results and draw a con-clusion,But make sure your data doesn’t causeyour confusion.You’re finally done! Now look overyour work,And for future experiments, use it asgroundwork.

Schoolchildren Wax Poetic About Science By Sheila Cusolito

Professor George Ladd of the Boston CollegeLynch School of Education


Human immunodeficiency virus(HIV) infection requires integration ofa double-stranded DNA copy of theviral genome into the host cellgenome. The enzyme HIV-1 Integrase(IN) is a 32 kDa protein encoded bythe viral pol gene that catalyzes tworeactions necessary for this integrationstep. The first is 3’-end processing,during which two nucleotides (GT) areremoved from the ends of the viraldsDNA, leaving a characteristic 3’-CAand 5’ 2-nt overhang. The second step,strand transfer, utilizes the 3’-processed ends as nucleophiles toattack phosphodiester bonds on oppo-site strands of the target DNA. Com-pletion of the integration processrequires the excision of the two 5’-unpaired viral nucleotides, and gap fill-ing, which is thought to beaccomplished by cellular enzymes.

HIV-IN is a 288 amino acid pro-tein comprising three distinct domains.The N-terminal domain contains a con-served HHCC zinc finger motif thatbinds zinc in a 1:1 stoichiometry. Ahighly conserved DDE motif that isessential for catalysis is present in thecatalytic core. The C-terminal domaincontributes to nonspecific binding toDNA and oligomerization necessary

for the integration process. The struc-ture of each domain has been deter-mined by X-ray crystallography orNMR spectroscopy, and structures oftwo-domain fragments have also beenelucidated1. Crystals of full-length INhave been obtained; however, thesehave diffracted to 8Å resolution1a. Nostructure of IN bound to DNA has beenreported.

To date, it remains unclear whatthe structural organization of full-length IN is and how it recognizes theviral DNA ends. Studies that utilizephoto-cross-linkable groups in syn-thetic DNA to elucidate the arrange-ment of protein domains complexed toDNA provided some information onsegments of IN close to parts of thesubstrate2. More recently, site-specificcross-linking based on convertiblenucleoside approach has beenemployed to determine IN-DNA con-tacts in active complexes. These stud-ies establish that the DNA-bindingC-terminal domain of one IN monomeracts with the central catalytic domainfrom another monomer at each viralDNA end.

Combinations of reverse transcrip-tase and protease inhibitors are cur-rently the most effective strategies forinhibiting HIV. However, developmentof resistance has provided the impetusfor generating new alternatives foranti-viral therapy. HIV-1 Integrase isan attractive target for drug develop-ment because it is essential for viralreplication. Generation of the crystalstructure of the IN with its substrateDNA would be invaluable, as it wouldprovide insight to the precise mecha-nism of the integration process as wellas the specific contacts used by theprotein to recognize its substrate DNA.With this knowledge, inhibitors of theIN could in principle be designed anddeveloped as potential therapeuticagents. The long-term goal of our stud-

ies is thus to obtain a crystal structureof IN bound to a DNA integration sub-strate.

One impediment to structuralstudies on IN-DNA complexes hasbeen the difficulty of forming homoge-neous forms suitable for crystalliza-tion. In the current study, we havepursued a strategy that imposes struc-tural homogeneity on IN-DNA com-plexes by introducing a covalent,disulfide linkage between the proteinand its substrate DNA (Figure 1). Morespecifically, the disulfide cross-linkingfunctionality is attached to the phos-phate group at the site of the scissilephosphodiester bond (Figure 2). IN isengineered to contain a cysteineresidue at one of its catalytic residues(E152C) by site-directed mutagenesis.The rationale is that these catalyticresidues are in close proximity to thescissile phosphodiester bond such thatupon contact, a covalent linkage resultsby the formation of a disulfide bond.By doing so, a stable protein-DNAcomplex is generated.Design and synthesis of backbone-modified DNA substrate

The oligonucleotide used as across-linking counterpart is a 20merthat mimics the terminal portion of theU3/U5 LTR of the HIV viral genome(5’TGTGGAAAATCTCTAGCAGT3’), referred to subsequently as W2Up.This 20mer contains the region of theviral DNA which undergoes 3’ pro-cessing. The phosphoramidate cross-linking functionality is placed betweenthe A and G nucleotides at the eigh-teenth and nineteenth nucleotide posi-



Summer Research ScholarToward determination of the structural basis for HIV-1 integrase substrate recognitionYehuda Edo Paz, Webster L. Santos, and Gregory L. VerdineHarvard University Department of Chemistry and Chemical Biology

Now that you know this method sowell,In science and knowledge you willexcel!Salt Cubes Through a MicroscopeUsed with permission of the author,Grade 6CrystalsOdd-looking cubesBeautiful swirly linesEnormous patterned blocks; a newVision ◆◆

Schoolchildren WaxContinued from page 11

Figure 1. Disulfide cross-linking reactionbetween protein and activated DNA


tion as this is the location of the scis-sile phosphodiester bond. This is thearea of the oligonucleotide that is prox-imal to the catalytically conservedresidues (D64, D116, E152), and inprinciple should be the best candidatefor disulfide cross-linking.

Synthesis of 5-thio-2-nitrobenzoicacid (DTNB) activated DNA createsthe DNA cross-linking partner (Figure2). DNA-phosphoramidate 1 is synthe-sized using an automated DNA synthe-sizer via a modified protocol alreadyestablished in the Verdine laboratory.The DNA-phosphoramidate is thenreduced with 10% DTT yielding thiol2, and activated using DTNB to affordactivated DNA 3. Oligonucleotide 3contains a highly activated disulfidebond that can under go disulfideexchange in the presence of a cysteineresidue3. Upon purification of 3 viapassage over NAP5 column, cross-linking with IN can be performed.Disulfide cross-linking

Because HIV-1 IN contains a con-served catalytic triad DDE motif, wedecided to strategically engineer a cys-teine residue in place of glutamate 152generating an E152C mutant. SinceE152 plays an important role in theactive site of the protein, we hypothe-sized that it must be in close proximityto the scissile phosphodiester bond anda good candidate as a disulfide cross-linking partner. The E152C mutationrenders the protein catalytically inac-tive and therefore, this form of the pro-tein is unable to process the substrateDNA.

A five-fold HIV-1 IN mutant

(C56S, C64S, W131D, F139D,F185K) was reported to be catalyti-cally active both in 3’-end processingand strand transfer, and produced ahighly soluble protein1a. As a startingpoint, we decided to perform cross-linking studies with the catalytic coredomain (50-212) containing the addi-tional mutation (E152C) and an N-ter-minal hexahistidine tag. Purification ofthe mutant protein construct is readilyaccomplished via passage over Ni-NTA-agarose beads followed by ionexchange column (MonoQ), and gelfiltration column (Superdex 200).

Cross-linking experiments wereperformed and optimized to provideIN-DNA complex in high yield. Asshown in Figure 3a, a successful IN-DNA cross-link is formed. Approxi-mately 50 percent of DNA-proteincomplex is formed; this result is con-sistent with the oligomerization stateof HIV-1 IN. The resulting IN-DNAcomplex was purified via passage overan ion exchange column (Figure 3b).

After concentrating the purifiedIN-DNA complex to 10 mg/mL, thecomplex was subjected to initial crys-tal screening at 4°C using pre-mixedbuffers from Hampton Research (HR).

The specific screens used were CrystalScreen, Crystal Screen 2, Grid ScreenPEG/LiCl, Crystallization Kit SolutionSet 1, and Crystallization Kit SolutionSet 2. Initial hits yielded microcrystalsusing the following conditions: 0.2 Msodium acetate trihydrate, 0.1 MTris•HCl pH 8.5, 30% w/v Polyethyl-ene glycol (Figure 4). With the goal ofoptimizing the crystallization condi-tions, grid screens around the hit wereperformed by modifying the percentgradient of PEG 4000 as well as a pHgradient of the Tris buffer. Most ofthese crystal drops yielded furthermicrocrystal hits. Follow-up optimiza-tion is currently underway.Oligonucleotide variation

With the hope of generating crys-tals suitable for x-ray crystallograph,we synthesized a series of oligonu-cleotides of various lengths. Threeshorter oligonucleotides demonstratedto have high binding affinity to INwere selected: 16mer(5’GAAAATCTCTAGCAGT 3’),14mer (5’AAATCTCTAGCAGT 3’),and 10mer (5’CTCTAGCAGT 3’) 4.These oligonucleotides also contain thephosphoramidate functional group atthe scissile phosphodiester bond. Afterpurification and activation, we per-formed cross-linking reactions withIN. As shown in Figure 5, all oligonu-cleotides tested formed IN-DNA com-plex. A laddering effect is seen as thesize of the DNA is increased from a10mer to a 20mer. The scale-up of thecross-linking reactions with variousoligonucleotides is currently being pur-sued.Conclusion

We have synthesized and purifiedmodified phosphoramidate DNA thatcross-links to HIV-1 IN. Cross-linking

Summer Scholar Continued from page 12

Figure 2. Activation and cross-linking ofDNA with HIV-1 IN

Figure 3: DNA/protein cross-link. a) Formation of IN-DNA cross-link.Arrow points at IN-DNA complex. b) Purification of IN-DNA cross-link viaion exchange (MonoQ) column. ssDNA,single stranded DNA; x-link, IN-DNAcomplex; TNB, 2-nitro-5-thiobenzoic acid.

Figure 4. Preliminary crystal hit.

Figure 5. HIV-1 IN cross-linked to variouslength oligonucleotides



of this DNA to catalytically inactiveHIV-1 IN that contains an engineeredcysteine mutation at position 152 pro-duced a stable DNA-protein complexin high yield. Initial crystallizationscreens of the complex provided prom-ising microcrystal hits that need furtheroptimization. Variation of the oligonu-cleotide may assist in generating a highresolution crystal structure of IN-DNAcomplex. Current experiments alongthese lines are underway.Experimental procedures

Oligonucleotides were synthesizedusing an ABI-392 synthesizer and puri-fied using 20% polyacrylamide gel.Purified oligonucleotides were dis-solved in 200 µL water and reducedwith 10% DTT for 30 minutes, fol-lowed by purification on a NAP5 col-umn. After lyophilizing, the DNA wasdissolved in 150 µL water, 30 µL phos-phate buffer (pH 8), and 20 µL DTNBsolution (20 mg/mL DTNB/DMSO).Ethanol precipitation yielded DTNB-activated DNA. To anneal dsDNA, one

equivalent of DTNB-activated DNAwas mixed in water with 1.5 equiva-lents of its complement DNA andheated to 80ºC for 10 minutes, andthen allowed to cool slowly to roomtemperature. The cross-linking condi-tions were 30 µM protein, 120 µMDNA, 200 mM NaCl, 10% glycerol,and 50 mM Tris. The cross-linkingreactions were confirmed by PAGEand Coomassie Brilliant Blue staining.References1. (a) Chen, J.C., Krucinski J, Miercke

LJ, Finer-Moore JS, Tang AH,Leavitt AD, and Stroud RM. (2000)Crystal structure of the HIV-1 inte-grase catalytic core and C-terminaldomains: a model for viral DNAbinding, Proc. Natl. Acad. Sci. 97(15), 8233-38. (b) Dyda, F, Hick-man AB, Jenkins TM, Engelman A,Craigie R, and Davies DR. (1994)Crystal structure of the catalyticdomain of HIV-1 integrase: similar-ity to other polynucleotidyl trans-ferases, Science 266 (5193),1981-86. (c) Wang, J.Y., Ling, H.,Yang, W., and Craigie, R. (2001)Structure of a two-domain fragment

of HIV-1 integrase: implications fordomain organization in the intactprotein, EMBO 20 (24), 7333-43.

2. Gao, K., Butler, S.L., and Bushman,F. (2001) Human immunodefi-ciency virus type 1 integrase:arrangement of protein domains inactive cDNA complexes, EMBO 20(13), 3565-76.

3. Wolfe, S.A., Ferentz, A.E.,Grantcharova,V., Churchill, M.E.A.,and Verdine, G.L. (1995) Modifyingthe helical structure of DNA bydesign: recruitment of an architec-ture-specific protein to an enforcedDNA bend, Chem. & Biol. 2, 213-221.

4. Bugreev, D.V., Baranova, S.,Zakharova, O.D., Parissi, V.,Desjobert, C., Sottofattori, E.,Balbi, A., Litvak, S., Tarrago-Lit-vak, L., and Nevinsky, G.A. (2003)Dynamic, Thermodynamic, andKinetic Basis for Recognition andTransformation of DNA by HumanImmunodeficiency Virus Type 1Integrase, Biochemistry 42, 9235-9247. ◆◆

Summer Scholar Continued from page 13

Interim Editor during that criticalperiod. We welcome as new membersof the Board of Publications NESACSmembers Mary Mahaney and MartyIdelson.

This board will appreciate recom-mendations and comments fromNESACS members regarding the con-tent of both the Nucleus and the web-site. We are interested in publishingbook reviews, accounts of little-knownhistory of chemistry , articles onresearch and development of currentinterest, and interviews with scientistsdoing such work. ◆◆

Board of PublicationsContinued from page 10


One of the inescapable features of lifeis illness – minor, major, transient,chronic, terminal – and so it is no sur-prise that, throughout the centuries, alarge amount of energy and ingenuityhas been devoted to seeking ways tocure it, to minimize its side effects, andto eliminate, or at least make tolerable,the pain associated with it. Typically,treatment fell into one of two cate-gories: surgical and medical. Prior tothe development of aseptic methods,anesthesia, and reliable anatomicaltraining, surgery was, to say the least,painful, risky, and often lethal, and itwas generally avoided at all costs. Thealternative mode of treatment, applica-tion or ingestion of pure substances ormixtures, must have seemed in mostinstances, infinitely preferable topatients.

For most of human history, therewas no scientifically trained class ofmedical practitioners. Until compara-tively recently, what medications wereavailable had been discovered by folkhealers and herbalists, working by trialand error. Some were effective, othersweren’t. In the absence of a scientifictradition, knowledge of the sources andcompounding of these medicaments,and their method of administration wasoften standardized by incorporating itinto a religious, mystical or mythicalframework. In such cases, the ef ficacyof the treatment must necessarily havebeen inextricably bound up with thepatient’s faith in the powers of the per-son administering the treatment.Under the circumstances, and given thegreat potential for profit, it is not sur-prising that practitioners often madegrandiose claims for both themselvesand their treatments, likely in inverseproportion to their efficacy. It is thisconjunction of profiteering, misrepre-sentation and hucksterism that definesthe quack, as portrayed in William

Helfand’s Quack, Quack, Quack, avisual survey of quackery from theseventeenth to the early twentieth cen-turies.

Helfand, who spent his profes-sional career on the marketing andadvertising side of the pharmaceuticalindustry, has written several books onthe history of pharmacy and medicine,and is also a collector of materialsrelating to the advertising and mer-chandising of bogus medications andtreatments. Quack, Quack, Quack is acollection of prints, posters and figuresfrom books and pamphlets in his col-lection, depicting quacks and their nos-trums, as well as exposés of fraudulentclaims. They largely span the eigh-teenth and nineteenth centuries, with afew earlier and later examples.Helfand’s textual commentary beginswith an introductory survey of quack-ery and quacks, moves on to a discus-sion of their characteristics, looks athistorical attempts to weed out quacksthrough professional certification andlicensing by medical organizations andgovernments, culminating (at least inthe United States) in the passage of theFood, Drugs and Cosmetics Act andthe establishment of the Food andDrug Administration, both of whichwere intended to certify the safety andefficacy of drugs, then ends with a sec-tion on the persistence of quackery.The illustrations are grouped into tensubsequent sections (“The ItinerantQuack,” “The Ways of the Quack,”“Systems,” “Morison’s Pills,” “VinMariani,” “Anatomical Museums &Medicine Shows,” “Selling SexCures,” Addiction & ElectricityCures,” “Quacks in the Arts,” and “TheEvils of Quackery.” The illustrationsare enjoyable and the accompanyingcaptions are helpful, though I wouldhave liked to see a bit closer integra-tion with the text.

Regrettably, attempts to eliminatequacks have not succeeded, and likelynever will. Indeed, one could arguethat they are more prevalent than ever .Perhaps that’s why, in recent months,I’ve seen advertisements in magazines,newspapers, store windows, and espe-cially the internet, for a wide range of“miraculous” products, including cop-per bracelets claimed to alleviate pain;“ionized water,” alleged to reverse theaging process, lower blood pressure,and increase one’s capacity for aerobicactivity; magnetic apparatus claimed tobe able to cure anything from tired feetto arthritic pain; and the ever-popularpyramid, alleged to do everything fromimproving sleep quality, to extendingthe life expectancy of pets, to a prop-erty of special interest to chemists –producing “a change in the molecularstructure” of foodstuffs, supposedlydetectable by “a spectrographic read-ing”. “Artificial flavorings in food willloose [sic] their taste, but natural fla-vors are enhanced. The taste of foodschange [sic]; they become less bitterand acid.” (Quotations taken from awebsite). As the French say, “Plus çachange, plus c’est la même chose”(“The more things change, the morethey remain the same”), or maybe asP.T. Barnum put it, “There’s one bornevery minute.”

Three factors that likely contributeto the proliferation of quacks and theirproducts in today’ s world are anincreasingly scientifically illiteratepopulace, a growing fascination withthe occult, and especially the exponen-tial rise of the internet, that vast reposi-tory of unchecked information. Whilequacks’ claims seem ludicrous to peo-ple with even a modicum of scientifictraining, they may seem eminently rea-sonable to an otherwise intelligent per-son who believes in things like lucky

Book ReviewQuack, Quack, Quack. The Sellers of Nostrums in Posters, Ephemera & Books, by William H. Helfand (The Grolier Club, 2002) 252 pp., ISBN 0-910672-40-76; $40.00 (hardcover)Reviewed by Dennis J. Sardella, Department of Chemistry, Merkert Chemistry Center, Boston College, Chestnut Hill, MA 02467


HistoricalNotesWe present here short biographies ofchemists and chemical engineerswhose deaths have been reported to usduring the past year. We thank mem-bers of the Northeastern Section whohave sent us obituary notices appear-ing in community newspapers we donot see.

George P. FlynnDr. George P. Flynn died August 29,2004 at the age of 68. He was born inWarren, RI the son of George andAnna Flynn, and attained early interestas a child prodigy. He graduated fromWarren High School at 16 and went onto Providence College, where he took aBachelor of Science degree in Chem-istry, summa cum laude, in 1957. Hestarted his graduate work at Yale, thenearned the Doctorate at Brown in1961. His research topic was the preci-sion measurement of the viscosity ofgases and his graduate adviser, Profes-sor John Ross, now emeritus professor

at Stanford, observes that Flynn’smeasurements have not been betteredto this day. Flynn stayed on at Brownto work with Ross. In 1972 Flynn wasco-author with Brown Chemistry pro-fessor William Risen of ”Problems forGeneral and Environmental Chem-istry” and John Ross , Stephen Berry,Stuart Rice with the assistance ofFlynn and Joseph N. Kushick pub-lished the textbook “Physical Chem-istry” in 1980.

Ross moved to MIT in 1975 andFlynn went with him. However, whenRoss moved to Stanford four yearslater, the twenty year collaborationended. Flynn remained in Boston andstarted a new career as proof readerand copy editor.

Flynn had a strong interest in sci-ence fiction. He was a member of theScience Fiction Society of Cambridgeand the New England Science FictionAssociation, and was elected to theWorld Science Fiction Society in 1986.This avocation led him to travel abroadto SciFi conventions, where he wasable to use the many languages he hadtaught himself, German, Russian,Hebrew, Spanish, French and Italian.

In the words of his brother Jack, hewas a genius.

Much of the information for thisobituary was obtained from an articleby Gloria Negri which appeared in theBoston Globe, 9/2/04. MSS

John J. RoderickJohn J. Roderick died February 7, 2004in Harwich, MA. He was 85 years old.He was an emeritus member of theAmerican Chemical Society and of theNew York Academy of Sciences.

Mr. Roderick was born and raisedin Harwich. He served in the Armyduring World War II, and then took hisbachelor’s degree in chemistry atBoston College. He later earned a mas-ter’s degree in business administrationat Fairleigh Dickinson University.

He was a research and develop-ment chemist at Dart Industries inParamus, NJ, then a technical managerin the catalyst division of Ohio AztecChemical Company, a division of Dart.He retired in 1980, and worked at ElPaso Chemical Company until 1984.Mr. Roderick holds two patents onhigh pressure polyethylene.

Alexander BoagSeptember 24, 1927-March 01, 2004Alexander Boag, 76, of Melrose, MA,died at the home of his niece CarolCeran in New Cumberland, WV on thefirst of March, 2004. He was a chemistat Polaroid Corporation for thirtyyears, principally in the ProcessResearch Laboratory. Alex was in thegroup responsible for scaling upResearch Laboratory syntheses ofchemicals and providing large enoughquantities for use in the invention ofinstant color and black and whitefilms. He fittingly took great pride inhis contributions to the photographicresearch efforts.

Alex was the son of Alexanderand Margaret (Letham) Boag. He wasborn in Weirton, WV on September 24,1927. He graduated from Weir HighSchool in 1945, served in the army inWorld War II, and returned to WestVirginia University to take Bachelorsand Master of Science degrees inchemistry, the latter in 1956. He was a


GATEWAY CHEMICAL TECHNOLOGY

11810 Borman Dr • Saint Louis, Missouri 63146314.220.2691 (office) • 314.991.2834 (fax)

www.gatewaychemical.com • [email protected]

CUSTOM SYNTHESIS • Pharmaceuticals • Agrichemicals • Combinatorial Platforms • Competitor's Products • Intermediates • Analytical Standards • Metabolites

PROCESS DEVELOPMENT • Process Evaluation • New Route Development

SPECTROSCOPIC SERVICES • LCMS (APCI and API-ES) • NMR (300 MHz) • GCMS (EI)


numbers, astrology, never uttering theword “no-hitter” during a baseballgame, and even “the Curse of the Bam-bino” – let alone one for whom con-ventional medical treatments haveproven ineffective, and who is willingto clutch at any straw, however flimsy.

One can almost come away fromQuack, Quack, Quack with the sensethat quackery and sound medical prac-tice are separated by an enormous gulf,making them easily distinguishable.However, as with most things, there isa murky middle ground where distinc-tions are not so easily made, to whichHelfand devotes little attention, yetwhich raises interesting questions.

Does the use of “invented” diseasessuch as halitosis to sell products con-stitute quackery? What of the market-ing of legitimate drugs throughtelevision commercials that urge peo-ple to ask their physicians to prescribethem, without actually identifying theconditions they are meant to treat?What about complementary and alter-native medicine, such as acupuncture,aromatherapy, faith healing, the mind-body connection, defined by NIH’sNational Center For Complementaryand Alternative Medicine as “a groupof diverse medical and health care sys-tems, practices, and products that arenot presently considered to be part ofconventional medicine.” Are theirpractitioners to be considered quacksuntil a scientific basis for their ef ficacyis found? What of treatments likeacupuncture that produce beneficialeffects, even if their explanation (bal-ancing the qi or energy flow in a body)is nonsensical from a Western stand-point? What of hospitals and physi-cians who refer their patients toalternative practitioners? What aboutpharmaceutical manufacturers that

continue to promote drugs without dis-closing emerging evidence of seriousside effects?

These questions suggest that thebinary classification of quack—non-quack is oversimplified, and call tomind a distinction about sin from tradi-tional Catholic theology. Three criteriawere required for an act to be seriouslysinful. First, it must be intrinsicallywrong, second the person committingit must know that it is wrong, andfinally, the person must give full andfree assent to it. Related to quackery,the corresponding criteria might bethat a given treatment or medicationmust be ineffective, that the personadvocating or selling it know that it isineffective, and that the personnonetheless promote it (here, presum-ably, from a profit motive). Absenceof one or more criteria would be a mit-igating factor to help make finer dis-tinctions.

Whatever one’s opinion, however,Helfand’s book makes interesting andenjoyable reading to anyone interestedin medicine and pseudomedicine. ◆◆

Book ReviewContinued from page 15


member of the American ChemicalSociety, the North Shore Organ Soci-ety and the First Baptist Church inMelrose, MA.

Alex enjoyed travel around theworld, photography, and cooking, wasan avid collector of classical and jazzmusic, and loved attending symphonyconcerts. He is survived by a niece andnephew. MSS ◆◆

Historical NotesContinued from page 16

Mar 30Prof. Ronald Breslow (Columbia Univ.)Buchi Lecture in Organic ChemistryMIT, Room 6-120, 4:00 pmProf. Paul Champion (Northeastern Univ.Physics Dept.)“Experimental Studies of Structure, Functionand Coherent Oscillations in Heme Proteins”Northeastern Univ., 129 Hurtig Hall, 12 noon

Mar 31Prof. Gregory Hillhouse (Univ. of Chicago)“Unusual Reactivity of NR, PR, and CR2Complexes of Nickel”Dartmouth College, Room 006 Steele Hall,10:30 amProf. Ronald Breslow (Columbia Univ.)Buchi Lecture in Organic ChemistryMIT, Room 6-120, 4:00 pm ◆◆

CalendarContinued from page 24


For several decades, the media hasdevoted an inordinate amount of timein reporting on the poor outdoor airquality we breathe. In reality, we spendmost of our time at home, in cars, inmalls, in schools, or in churches.Therefore, the air quality we breatheindoors should be of even greater con-cern than the air we breathe outdoors.In both cases, various particles,pathogens, and chemicals affect the airquality. One of the major ways scien-tists can help improve air quality is bymaking people aware of the sources ofindoor pollution, their ef fects onhealth, and, what measures, if any,people can take to mitigate the delete-rious effect of the pollutants.

Professor John Spengler, Professorof Environmental Health and HumanHabitation at Harvard University foryears extensively studied the indoorenvironment and is credited withdeveloping the personal indoor airquality monitor used to study pollu-tion. He shared the 2003 Heinz Awardwith MIT Chemistry Professor Molina(1995 Nobel Prize winner) for thework on indoor pollution. In hisacceptance speech, Professor Spenglerstated that in the United States and indeveloping countries people might beconcerned with things like “radon,electromagnetic fields, or asbestos, orplasticizers, fire retardants … thosethings that modern life brings …toxicmolds.” He also stressed the fact thattwo billion people use fuels to heattheir homes and cook their food andthey use low-end fuel from animalwaste, crop residues, charcoal, andwood. In his speech, Professor Spen-

gler also told his audience that on theirvisit to Nepal, his daughters were sur-prised to learn that the smoke in theNepalese huts was so intense that whenpeople got up in the morning, they“hacked” to clear their lungs.

As the example Professor Spen-gler cited regarding Nepal shows, thepeople there are economically disad-vantaged as compared to those in theUnited States when it comes to choos-ing more environmentally benign alter-native fuels. In the United States, thechallenge is to make people aware ofthe inherent advantages in choosingsuperior available alternative fuels thatdo not expose us to dangerous pollu-tants. In its latest F AQ regardingindoor air pollution published on theofficial website, Harvard Universityurges their employees to treat amongothers the following chemicals/matteras sources of indoor pollution: particu-late matter (PM) (chemically active orinactive matter), volatile organic com-pounds (VOCs) (some of which areidentified later), carbon monoxide(CO), nitrogen oxides (Nox), sulfurdioxide (SO2), ozone (O3), lead, andhazardous air pollutants (a list of over180 toxic chemicals by the US Envi-ronmental Protection Agency (EPA)considered hazardous (HAP)). The listalso includes such chemicals as: ink,solvents, paints, coatings, and radioac-tive materials.

The same FAQ makes Harvardemployees aware that PM, VOC, CO,NOx, and SO2 emissions are the resultof combustion operations indoors andoutdoors. VOC emissions result fromthe work in the organic laboratoriesand cleaning and maintenance andfrom the use of volatile organic chemi-cals in the laboratory/ maintenanceoperations. O3 is formed in the atmos-phere from chemical reactions thatinvolve VOC and NOx. HAP emis-sions result from the use of certaintypes of volatile organic chemicals in

the laboratory and in maintenanceoperations as well as from the use ofradioactive materials in the laboratory.

Jonathan Levy, Assistant Professorof Environmental Health and RiskAssessment at the Harvard UniversitySchool of Public Health, whom I inter-viewed the other day, identified twoprimary sources for indoor pollution.“The first source is the air that comesfrom the outdoors into the homes,offices, restaurants, and workplaces,”he said. “The second source is the pol-lution created by the inhabitantsindoors.” Therefore, to obtain a goodestimate of indoor air quality all thesources of pollution (two or more)should be considered. Such an estimatewill show that, depending on indoorventilation and the source of indoorpollution, the total exposure to indoorpollution could in some cases be worsethan one would encounter outdoors.

According to Professor Levy, indi-viduals concerned about indoor pollu-tion need to be more aware of theunique deleterious chemical character-istics of each pollutant they areexposed to indoors as well as its con-centrations. They should also be awareof their total exposure time to certainchemicals and the location where theyspend their time. That’s because if anindividual spends a specific time in aparticular location where the pollutantis used or created he (she) might besubjected to a greater concentration ofthat pollutant in the first place than ifhe were to move to some other moreremote, but less polluted location. Inaddition, the individual should beaware of his sensitivity towards partic-ular pollutants – particularly, if theindividual is sensitive toward thosespecific chemicals.

As an example, the professor citedthe creation of nitrogen dioxideindoors. Outdoors, this particular com-pound comes from fuel combustion inautomobiles or power plants; indoors,

What Can Be Done About Improving Air Quality?By Martin Freier

Martin Freier is a consultant specializingin technical management, technical, andtraining strategies. He holds a BS inChemistry from Brooklyn College and anMS degree in Engineering and Manage-ment Science from Worcester PolytechnicInstitute. He is a member of the ACS,Northeastern Section.


this compound comes from the gasstove and the pilot light that is leftburning all day, even when the stove isnot in use. Other deleterious com-pounds could include carbon monoxideand formaldehyde. It would makemore sense not to spend less time in akitchen without proper ventilation, par-ticularly if one is suffering from respi-ratory disease or asthma. Or better,individuals suffering from any one ofthese similar types of diseases wouldbe better off buying an electric stove inthe first place. In the short term, anindividual without any similar healthissues may not be as much af fected bythose same compounds. Similarly,because of nitrogen oxide’s presence,if there is a smoker in the home, sec-ondary smoke in the house could affectthe health of non-smokers. Obviously,it would make sense for the smoker todo his smoking outside the premises,rather than expose the whole family tothe pollutants.

Professor Levy was also con-cerned about mothballs, some of whichmay contain 1,4-dichlorobenzene. Typ-ically, they are known to be carcino-genic. Some people just avoid thosetypes of mothballs or take alternativesteps to deal with the moths.

Other chemical compounds thatcause carcinogenic problems areformaldehyde and related aldehydes.Indoors, they are present whereverthere are building materials and suchitems as pressed wood and adhesives,but they are also produced from com-bustion of fuel and second-handsmoke. One way to reduce the depend-ence on formaldehydes and aldehydesis to make material substitutions thatdo not use those types of compounds.

“If you had to make the one singlerecommendation to the home ownerwhat would that be?” I asked ProfessorLevy.

“The majority of the pollutionproblems indoors are due to a lack ofair circulation and ventilation in thepresence of pollution sources,” Profes-sor Levy responded. “In the absence ofan indoor air exchange with the air

outdoors, there is likely to be a concen-tration and buildup of certain haz-ardous pollutants. As a result, indoors,the individuals could be exposed to anincreased dose of the specific pollu-tants emitted inside the home. In somecases, we may do better by eliminatingindoor sources of pollution by makingsubstitutions (when substitutes arereadily available). Also, for pollutantsfor which there are limited indoorsources, increasing air exchange canlead to higher exposures to those pollu-tants from the outdoors.”

A staff member at Harvard Uni-versity brought to my attention theeffectiveness of Air Purifiers, nowcommercially available. They useHEPA (High Efficiency ParticulatesAir) filters for removing particulatematter from the air, before it is allowedto re-circulate through the room. TheHEPA filter is made from fiberglass(silicon dioxide) sheets of variousdiameters that are pleated and mountedon a frame. By pleating the fiberglasssheets, one can squeeze in a lot offiberglass in a relatively small volume.The problem with most vacuum clean-ers is that as the room is vacuumed, theair is circulated through the vacuumcleaner. Because of the inadequacy ofthe ordinary filters used in most vac-uum cleaners, not all the particulatematter is in fact removed; some of it isjust re-circulated with the air throughthe room, thus aggravating the pollu-tion problem.

Some people I talked to believethat monitoring indoor air quality withmonitoring equipment could result inan improved awareness of the extent ofthe indoor pollution problem in specificareas. It could, therefore, also result inimproving the air quality indoors.

At this time, monitoring for airquality is not an option for controllingindoor pollution, so said ProfessorLevy. “The public can buy monitorsfor carbon monoxide, radon, and a fewothers.” But he added, “Although Har-vard University uses other pollutionmonitors for research studies, they areoften not practicable for the public’suse.”

The professor continued, “Indoorpollution monitor technology is lag-

ging —primarily, because there are justtoo many chemicals to monitor for.”

Sounds like this could be the chal-lenge future chemical innovators, sci-entists, and entrepreneurs may belooking for.

Pollution monitors are not theonly things that are lacking, the profes-sor conceded. “Before such monitoringdevices can be developed we need toacquire a better understanding of whichpollutants are most significant contribu-tors to health risks, so we can focus ourefforts on the most appropriate targets.”

In response to this apparent voidin indoor pollution risk assessmentresearch, The American ChemistryCouncil, which is part of the AmericanChemistry Society, funded a study forThe Harvard School of Public Healthin order determine the effects of bothoutdoor and indoor pollution on indi-viduals as they go about their lives.Last spring, the Boston ExposureAssessment in Micro Environment(BEAM) Project, as this study isnamed, enrolled 42 individuals inBoston City proper and the surround-ing areas to participate in the study thatwould run from Summer 2003 throughWinter 2005.

I chose to interview Miranda Loh,a doctoral student in the Department ofEnvironmental Health, to tell us aboutthe BEAM because it shows the inter-disciplinary and complex aspectsinvolved in studying pollution.

“What’s so unique about BEAM?”I asked her.

“BEAM’s focus is on monitoringthe concentration of chemical pollu-tants, such as volatile aromatic com-pounds (VOCs) in different settings(called microenvironments), bothindoors and outdoors,” she responded.

In other words, the concentrationsof the VOCs are expected to be muchhigher near power plants, railroads,bus stations, in automobiles and buses,certain stores, malls, and certainhomes, than they would be near parksor baseball fields. The BEAM’s prem-ise is that on a given day an individualis exposed to different combinations ofindoor and outdoor pollution. In agiven day, most individuals are likely

Air QualityContinued from page 18



to visit different microenvironmentsindoors and outdoors, such as offices,shops, or different modes of trans-portation; each of them could havevarying concentrations of VOCs,depending on the locations. Therefore,all of the varying exposures and loca-tions must be considered in arriving ata good estimate for an individual’stotal daily exposure to specific chemi-cal compounds.

Loh continued, “The study alsotries to establish what kind of influ-ences the different microenvironmentshave on an individual’s total exposureto pollution. In addition, air exchangesbetween indoors and outdoors as wellas between different areas such as thebasement, garages, and hallways havean impact on VOC concentrationindoors. By monitoring air in dif ferentplaces away from the home as well asmeasuring the contribution to indoorair of factors such as air exchange,BEAM should be able to better iden-tify what might influence levels ofindoor pollution as well as overall per-sonal exposure.

According to Loh, in the study,samples are collected at selected out-door/indoor locations in Boston andsurroundings areas. Individuals carryportable backpack monitors as they goabout performing their tasks. In addi-tion, in the homes, stationary monitorsare set up indoors and outdoors.

At my request, Loh described thepersonal monitoring equipment beingused. From the outside, the backpacklooks like an ordinary backpack withyellow tubes protruding from the back-pack and connecting the pump to thesamplers used to collect the pollutantsamples. This whole setup is quiteportable. Each of the 42 participants isrequired to wear their backpacks for atotal of 48 hours.

“So what exactly is your role inthe study?” I asked. Loh helped withthe backpack design and air monitor-ing in non-residential locations. Thebackpack contains lightweight moni-toring equipment to trap air molecules.She also helped design the question-

naires that the participants need to fillout. In addition, she is part of the fieldstaff in the study and helps in trainingthe other staff in the use of the equip-ment.

In addition to Loh, Robin Dodsonis the coordinator of the project whileAssistant Professor Deborah Bennett isthe principal investigator and in chargeof the project.

According to Loh, 26 differenttypes of compound samples (antici-pated to contribute significantly toVOC health effects or those that areimportant for identifying pollutionsources) were collected in the two dif-ferent types of tubes - 16 volatileorganic compound (VOCs), 6 alkanes,two aldehydes, and two terpenes. TheVOCs being monitored are: Benzene,Toluene, Ethylbenzene, Styrene, twodifferent Xylenes, 1, 3 Butadiene, Car-bon Tetrachloride, Chloroform, 1,4Dichlorobenzene, 1,3 Dichloropropene,Methylene Chloride, MBTE, Tetra-chloroethylene, 1,1,1-Trichloroethane,Trichloroethylene. The Aldehydes beingmonitored include: Formaldehyde, andAcetaldehyde. The alkanes include: 2-Methylpentane, 2-Methylhexane, 3-Methylhexane, 2,3 Dimethylpentane,2,2,4 Trimethylpentane, Methylcyclo-hexane. In addition, the team also col-lects samples of Limonene and Pinene,compounds associated with citrus orpine scented products.

For the VOC sample collectionprocess thermal desorption tubes con-taining three different kinds of Carbon-based sorbents (from Supelco/PerkinElmer) are used. For the Aldehydessample collection process, Dinitro-Phenyl-Hydrazine (DNPH) coated sil-ica cartridges (a Waters companyproduct) are used. As air is drawnthrough the cartridge, the DNPH reactswith the carbonyl group of the aldehy-des, forming a stable compound.

After the samples are collected,they are sent to the laboratories forextraction. In the case of the VOCs, athermal desorption method is used todo the extraction and then the com-pounds are concentrated in a cold trap,before being sent to an analytical col-umn of the gas chromatograph. Com-pounds are then detected using a mass

spectrometer. For the aldehydes, theDNPH derivatives are eluted usingAcetonitrile. A portion is then sentthrough the high-pressure liquid chro-matograph. The separated compoundsare detected using UV detectors.

“The backpack you use in thestudy looks pretty simple and effective.Do you think it would be a good idea touse it in a typical home?” I asked. Lohanswered, “Well, if you can afford tobuy it sure.” She added, “Actually, notonly do you have to buy the equipmentand be trained in its use, but then youneed get the analysis done by a lab andyou have to hire a scientist to figureout the meaning of the data analyzed.”

As to her recommendation on howto deal with indoor pollution, Loh’sanswer could be summarized in twowords “Be aware.” Professor Levypretty much said the same thing. Inother words, when it comes to pollu-tion, there are no easy answers.

However, with these limitationsnotwithstanding, the consumers andregulators can still do more than theydo at this time. Rather than shifting theresponsibility to the companies and thegovernment regulators, “Buyerbeware!” could be a defensive and use-ful mantra for the consumer to adopt.That means the consumer needs to readlabels on the products, including warn-ings, and try to understand their mean-ings. The consumer should also lookfor less polluting alternatives. As indi-cated earlier, combustion in the oven isa major source of pollution; therefore,the consumer needs to make an effortto acquire ovens that are more effec-tive in reducing pollution and ventilateas often as possible. When less toxic,low VOC substitutes are available,they should be used. “New,” thesedays, does not necessarily mean better ,unless chemists in the laboratories domore extensive tests, not only for theireffect on animals but on people aswell. And yet, the consumer needs tobe wary of introducing something newand untried, especially when certainmembers in the household are moresensitive to specific chemicals.

But, ultimately, there is a definiteneed for more consumer educationregarding indoor pollution. ◆◆

Air QualityContinued from page 19

Japanese translations of scientific articles and patents by fully bilingualJapanese-American PhD. Over 20 years exper-ience. English-Japanese translations available.

R.N. Arison88 Century Lane, Watchung, NJ 07069-6008

908-757-6812 [email protected]

Chemical Solutions for the Life Science Industry

� Custom Organic Synthesis

� Process Development

� Contract R & D

� Pharmaceutical Intermediates

� Medicinal Chemistry Support

� Biotechnology Specialty Reagents

� Solid Support Reactions

� Process Validation

� Gram to Multi-Kilogram Synthesis

PolyOrg Inc.10 Powers Street, Leominster, MA 01453

Phone: 978-466-7978 1-866-PolyOrgFax: 978-466-8084 [email protected]

www.polyorginc.com


SERVICESSERVICESSERVICES

B U S I N E S S D I R E C T O R Y

Cytokine Bioassay Services � Recombinant Cytokines � Monoclonal Antibodies �

Outsourcing Services

SBH Sciences, Inc. Dr. Raphael Nir, General [email protected] 508-650-6200 , x14 www.sbhsciences.com


SERVICESSERVICES


SERVICES

Phone 978-356-7133 Fax 978-356-7449

Email [email protected]

High Purity, Scalable Solutions

to Challenging Organic Synthesis

Starting Materials to Pre-clinical

Single to Multi-Step mg to Kgm

98% min. purity

WHEN QUALITY MATTERS

Custom Synthesis & Process Chemistry

Front Run OrganX,inc.

PROFESSOR - 03455Located in the Finger Lakes region of New York State, Cornell University is committed to creatinga more diverse and inclusive campus in which to work, study , teach and serve.The Department of Textiles and Apparel (http:/www.human.cornell.edu/txa/) invites outstandingcandidates to apply for a nine-month, tenure-track position with 70% research/30% teachingresponsibilities at the assistant or associate professor level (rank open). The successful candidatewill be expected to develop a prominent research program in fiber , textile, or apparel science,including obtaining outside funding, competing for center/program grants, training M.S. and Ph.D.level graduate students and mentoring postdoctoral associates. The research should be based in thenatural sciences or engineering with emphasis on multidisciplinary approach and on emerging topicssuch as innovative materials, biomedical materials, sustainable materials and practices, innovativefunctional apparel design, smart fabrics, or wearable computing. The candidate will teachundergraduate and graduate courses in line with department needs and be expected to take an activerole in the department, college and university.Qualifications: Ph.D. in the natural sciences, engineering, or an allied field with a strong emphasison fiber, textile, materials, apparel science, or related discipline required. Demonstrated success inobtaining outside funding and a strong publication record also required.Salary and rank are commensurate with qualifications with excellent fringe benefits. Starting dateis August 2005 (negotiable).Send curriculum vitae, statement of r esearch interests and goals, description of pr eviousteaching experience, selected publications, and names of three references to: Professor C.C. Chu,Search Committee Chair, Department of Textiles and Apparel, 239 Martha Van Rensselaer Hall,Cornell University, Ithaca, NY 14853-4401. Phone: (607)255-3141; e-mail: [email protected]

Application deadline is April 15, 2005 or when the position is filled.

Cornell University is an Affirmative Action/Equal OpportunityEmployer and Educator

http://chronicle.com/jobs/profiles/2377.htm


CAREER SERVICESCAREER SERVICES


SERVICES

Index of AdvertisersAm. Instrument Exchange...............22Boston College ................................23Chemir Analytical Services .............21Chemo Dynamics ............................17Cornell University ...........................23Desert Analytics Laboratory............23DuPont Analytical Solutions ...........21Eastern Scientific Co. ......................14Front Run Organx............................22Gateway Chemical Technology.......16HT Laboratories, Inc. ......................21Huffman Laboratories, Inc. .............22Impact Analytical, Div. of M.M.I. ...22J. S. T. ..............................................21Kopella Analytical Services ............22Mass-Vac, Inc. ...................................2Micron Inc. ......................................21NuMega Resonance Labs................21Organix, Inc.....................................22Organomed Corporation..................22PolyOrg Inc. ....................................21Prime Organics ................................22PrimeSyn Lab Inc. ...........................21Robertson Microlit Labs..................10SBH Sciences, Inc. ..........................22Schwarzkopf Microanalytical..........21Scientific Bindery............................21Tyger Scientific, Inc ........................22Waters Corporation..........................21

CAREER SERVICES

Check the NESACS Homepagefor late additions:http://www.NESACS.orgNote also the Chemistry Department webpages for travel directions and updates. Theseinclude:http://chemserv.bc.edu/seminar.htmlhttp://www.bu.edu/chemistry/events/http://www.chem.brandeis.edu/colloquium.shtmlwww.dartmouth.edu/~chem/Seminars/fall04.htmhttp://www-chem.harvard.edu/events/http://web.mit.edu/chemistry/www.chem.neu.edu/web/calendar/index.htmlhttp://chem.tufts.edu/seminars.htmlhttp://www.chem.umb.edu/http://www.umassd.edu/cas/chemistry/http://www.uml.edu/Dept/Chemistry/speakers.htmlhttp://www.unh.edu/chemistry/seminars.html

Mar 1Dr. James A. Wells (Sunesis Pharmaceuticals,Inc.)“Drug Discovery of Signalling Enzymes:Moving Targets”University Lectures in ChemistryBoston College, Merkert 127, 4:00 pm

Mar 2Dr. James A. Wells (Sunesis Pharmaceuticals,Inc.)“Drug Discovery at Protein: Protein Interfaces:Challenging Targets”University Lectures in ChemistryBoston College, Merkert 127, 4:00 pmProf. Charles G.Riordan (Univ. of Delaware)“Dioxygen Activation at Monovalent Nickel.”UMass Dartmouth, Science & EngineeringBuilding (Group II), Room 115, 4:00 pm

Mar 3Dr. James A. Wells (Sunesis Pharmaceuticals,Inc.)Roundtable Discussion: “Trials and Tribulationsof Starting a Biotech Company - Sunesis”University Lectures in ChemistryBoston College, Merkert 127, 4:00 pmProf. C. Austen Angell ( Arizona State Univ.)Harvard/MIT PChem SeminarMIT, Room 6-120, 5:00 pm - 6:00 pm

Mar 7Prof. William Roush (Univ. of Michigan) andProf. Hisashi Yamamoto (Univ. of Chicago andPfizer research scientist) Pfizer SymposiumHarvard Univ., Mallinckrodt Building, PfizerLecture Hall, 12 Oxford St., 2:30 pm

Mar 8Prof. Timothy Jamison (MIT)“Catalytic, Stereoselective Fragment CouplingReactions for Total Synthesis” Boston College, Merkert 127, 4:00 pmProf. Dr. Claudia Steinem (UniversitätRegensburg)“Artificial Membranes: Tools to AddressBiological Questions”Tufts Univ., Pearson Chemistry Building, 62Talbot Ave., Medford,Room P-106, 4:30 pmProf. Lawrence T. Scott (Boston College)“Fullerenes and Carbon Nanotubes: ChallengingTargets for Chemical Synthesis”UNH, Iddles L103, 11:10 am

Mar 9Prof. Sonya Franklin (Univ. of Iowa)Woodward Lecture Series in the ChemicalSciences/Harvard-MIT Inorganic Chem.SeminarHarvard Univ., Mallinckrodt Building, PfizerLecture Hall, 12 Oxford St. 4:00 pmProf. Anne English (Concordia Univ., Montreal)Northeastern Univ., 129 Hurtig Hall, 12 noonProf. Scott Handy (SUNY Binghamton)“A New Method for Treating AIDS and Cancer:Integrase Inhibitors Based on the Lamellarins”UMass Dartmouth, Science & EngineeringBuilding (Group II), Room 115, 4:00 pm

Mar 10Dr. Christopher M. Reddy (Dept. of MarineChemistry and Geochemistry, Woods HoleOceanographic Inst.)“Isotopic-based studies on the sources ofhalogenated organic compounds in marinemammals”Dartmouth College, Room 006 Steele Hall,10:30 amProf. Tobin Sosnick (Univ. of Chicago)“Protein Folding Pathways Discerned Using -Analysis and Other Methods.” (WoodwardLecture Series in the ChemicalSciences/Physical Chem. Seminar.) HarvardUniv., Pfizer Lecture Hall, 12 Oxford St., 4:00pmProf. Brian Stoltz (CalTech)Organic Chemistry SeminarMIT, Room 6-120, 4:00 pmProf. Dr. Andreas Janshoff (Johannes Gutenberg-Universität, Mainz)“Biosensors on the Microscale: FromBiomimetic Surfaces to New Technologies”Tufts Univ., Pearson Chemistry Building, 62Talbot Ave., Medford, Room P-106, 4:30 pm

Mar 14Dr. Christopher T. Walsh (Harvard MedicalSchool)“Nature's Inventory of BiohalogenationCatalysts.”and Edward J. Delaney (Bristol-Myers Squibb)Bristol-Myers Squibb SymposiumHarvard Univ., Pfizer Lecture Hall, 12 Oxford St., 3:00 pm

Mar 16Jonathan Steckel (Bawendi Group)Inorganic SeminarMIT, Room 6-120, 4:00 pmDr. Erwin London (Brookhaven National Lab.)“The Organization of Lipids and Proteins withinBiological Membranes”Northeastern Univ., 129 Hurtig Hall, 12 noon

Mar 21 Prof. Mary J. Shultz (Tufts Univ.)“Water, Water at Every Surface” Brandeis Univ., Edison Lecks Building,Gerstenzang 122, 3:30 pm

Mar 22Prof. Justin Du Bois (Stanford Univ.) “C-H Bond Oxidation Reactions for FineChemical Synthesis” Brandeis Univ., Edison Lecks Building,Gerstenzang 122, 3:30 pmProf. Barry B. Snider (Brandeis Univ.)Organic ChemistryUMass Lowell, Olney Hall, Room 218, 5:30 pmProf. Mike Richmond (Univ. of North Texas)“Synthesis and Reactivity Studies of Os3(CO)10(diphosphine) Clusters: LigandIsomerization, Orthometalation and BenzyneFormation in Os3(CO)10(P-P) Clusters [note:the numbers are all to be subscripted]UNH, Iddles L103, 11:10 am

Mar 23Julien Bachmann (Nocera Group)“Expanding Redox Activity into theCoordination Sphere: Towards the Design ofMultielectron Reactivity Patterns.””MIT, Room 6-120, 4:00 pmDr. Jianhua Zhou (Univ. of MassachusettsMedical School, Worcester)“Functional Studies of SMN Protein in SpinalMuscular Atrophy.”UMass Dartmouth, Science & EngineeringBuilding (Group II), Room 115, 4:00 pm

Mar 24Prof. Barbara Imperiali (MIT) and Prof. T. RossKelly (Boston College)Organic Syntheses, Inc., LecturesMIT, Room 6-120, 4:00 pm

Mar 28Prof. Francis DiSalvo (Cornell Center forMaterials Research, Cornell Univ.)“Challenges and Opportunities in Nanoscience:Ordered IntermetallicCatalysts for Fuel CellApplications”Tufts Univ., Dept. of Chemical & BiologicalEngineering, Crane Room, Paige Hall,12 Upper Campus Road, Medford, 12 noon

Mar 29Dr. Adrian Whitty (Biogen Idec Inc)Tufts Univ., Pearson Chemistry Building, 62Talbot Ave., Medford,Room P-106, 4:30 pm

19 Mill R

oadH

arvard, MA

01451

NO

NPR

OFIT

OR

G.

U.S. PO

STAG

E PAID

NO

RTHEA

STERN

SEC

TION

AM

ERIC

AN

CH

EMIC

AL

SOC

IETY

Calendar


Dr. John Fetzer on - Welcome to NESACS - Home Page · Chikezie I. Eseonu Major: ... fic light onto...

Documents

Transcript of Dr. John Fetzer on - Welcome to NESACS - Home Page · Chikezie I. Eseonu Major: ... fic light onto...