Diversity of Microorganisms Isolated from the Soil Sample ... · teria and fungi was determined...

Int. J. Biol. Sci. 2011, 7

http://www.biolsci.org

209

IInntteerrnnaattiioonnaall JJoouurrnnaall ooff BBiioollooggiiccaall SScciieenncceess 2011; 7(2):209-220

Research Paper

Diversity of Microorganisms Isolated from the Soil Sample surround

Chroogomphus rutilus in the Beijing Region

Peng Wang1, 2, Yu Liu1, Yonggang Yin1, 3, Haojie Jin4, Shouxian Wang1, Feng Xu1,, Shuang Zhao1, Xiaoli Geng1

1. Institute of Plant and Environmental Protection, Beijing Academy of Agriculture and Forestry Science, Beijing 100097, China;

2. College of Life Sciences, Henan Agricultural University, Zhengzhou 450002, Henan, China; 3. College of Horticulture, Agricultural University of Hebei, Baoding 071001, Hebei, China; 4. Department of Molecular Biology, University of Aarhus, Aarhus C DK-8000, Denmark

Corresponding author: Feng Xu. Institute of Plant and Environmental Protection, Beijing Academy of Agriculture and Forestry Science, Beijing 100097, China. Tel: +86 10 51503432, Fax: +86 10 51503899, E-mail: [email protected].

© Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited.

Received: 2011.01.16; Accepted: 2011.02.27; Published: 2011.03.02

Abstract

Artificially cultivating Chroogomphus rutilus is too inefficient to be commercially feasible. Furthermore, isolating C. rutilus mycelia in the wild is difficult. Thus, it is important to de-termine the natural habitat of its fruiting body. This study focused on the ecology of the C. rutilus habitat to isolate and classify beneficial microorganisms that could affect its growth, which could be used in future research on artificial cultivation. In total, 342 isolates were isolated from soil samples collected around a C. rutilus colony in the Beijing region. Of these, 22 bacterial and 14 fungal isolates were selected for sequencing and phylogenetic analysis, based on their growth characteristics and colony morphology. Using 16S rRNA gene se-quence analysis, the bacterial isolates were divided into two monophyletic clusters which had significant hits to the genera Bacillus and Pseudomonas, respectively. Using internal transcribed spacer (ITS) sequence analysis, fungal isolates were divided into four monophyletic clusters: Penicillium, Trichoderma, Mortierella, and Bionectria. Moreover, the phylogenetic diversity of these isolates was analysed. The results indicated that numerous microorganisms were present in C. rutilus habitat. This was the first reported examination of the microbiological ecology of C. rutilus.

Key words: Chroogomphus rutilus, isolation, phylogenetic diversity, 16S rRNA, ITS

Introduction

Chroogomphus rutilus (Schaeff.) O.K. Mill. is a type species in the genus Chroogomphus. The com-mon names pine-spike and spike-cap are based on its shape and close growth association with pine trees. Based on records and our recent investigation, Chroo-gomphus spp. inhabit the northern hemi-sphere, including Asia, North America, and Europe [1]. C. rutilus is edible and especially flavourful when

dried. Furthermore, it has been investigated as a source of antibiotics and other potentially useful sec-ondary compounds. The fruiting body is economi-cally important for food or herbal medicine use [2].

Since artificially cultivating C. rutilus is difficult, making it too expensive to be a common commodity. There have been many attempts to find an efficient method of cultivating C. rutilus. Researchers have



210

attempted to imitate its natural habitat to promote mycelia growth, such as using soil collected near wild C. rutilus colonies and using pine tree tissue culture medium [3]. Pure mycelia cultures have been isolated; however, artificial cultivation is still inefficient and the fruiting body is difficult to obtain under artificial conditions [4]. Given the short time frame of research and lack of knowledge concerning the niche of C. ru-tilus in its ecosystem, it is not surprising that culti-vating C. rutilus artificially is difficult, even outdoors.

Artificial cultivation may have failed due to the complex habitat C. rutilus requires. C. rutilus may re-quire specific soil chemical composition and the pre-sents of certain plants and microbes in order to grow. Some researchers have examined the plants living in C. rutilus habitats [5]; however, little research has been done to investigate the microorganisms present. Be-cause no organism lives entirely isolated, soil micro-organisms could directly or indirectly affect spore germination and fruiting body formation [6]. Fur-thermore, organisms often establish biological inter-actions, such as symbiosis, competition, and autoe-cism. C. rutilus interacts with other fungi and bacteria in its habitat, and may affect each other’s growth or life cycles [7].

Based on the known requirements of casing-soil for the half artificial cultivation of Morchella, Shen et al. (2008) examined the bacterial community contained in the fruiting body of Morchella using a denaturing gradient gel electrophoresis (DGGE) technology. To some extent, the results of sequencing the 16S rRNA genes of 7 kinds of bacteria reflect the bacterial com-munity structure inside Morchella [8]. Shen et al. (2009) also reported that the investigation of fungal com-munities inhabiting Morchella growth soil using DGGE. Sequence analysis of 12 recovered dominant bands revealed the presence of 10 fungi whose growth may have been inhibited by the dominant Morchella [6]. All of the above studies suggest that co-occurring microbes play an important role in fungal growth.

This study was initiated to investigate the diver-sity of microorganisms isolated from soil near a C. rutilus colony in the Beijing region. Bacteria and fungi were obtained selectively from soil samples collected around C. rutilus growing areas in the Beijing region based on their growth characteristics and colonial morphology. The 16S rRNA gene sequences of the bacteria isolates and the ITS gene sequences of the fungi isolates were amplified and sequenced respec-tively. The phylogenetic diversity of the isolated bac-teria and fungi was determined based on the 16S rRNA genes and ITS sequences, respectively. This was the first demonstration of the microbe sur-rounding C. rutilus.

Materials and Methods

Soil sample collection and microbe isolation

Soil samples about 10 cm under the fruiting body of a C. rutilus colony in the Beijing region of the Peo-ple’s Republic of China were collected at an attitude of 790 m. The GPS coordinate was N40 57.186 E116 29.923.The samples were immediately transported to the laboratory for gradient dilution using autoclaved water and aliquots were transferred to appropriate growth medium. Three consecutive propagations us-ing beef extract-peptone agar slants for bacteria and PDA media for fungi were conducted. After a 2-3-day incubation period at 28°C, single colony of per prop-agation was selected for observation. Out of the colo-nies owing the same growth characteristics and morphology, only one colony of each morpho-species was selected for further genetic sequencing. In this study, growth characteristics mainly included growth rate and colony morphologies of the isolated strains included size, color, diaphaneity of the colony, the degree of smoothness and so on. All strains in this

study (Table 1) were preserved at -80°C in their re-

spective liquid media with glycerol added to a final concentration of 15% (v/v).

Genomic DNA extraction from the isolates

Bacterial genomic DNA was extracted according to the methods described by Sambrook (1989) [9] for further 16S rRNA amplification. Fungal genomic DNA was extracted following the methods described by Doyle and Doyle (1987) [10], with some modifica-tions. These pure DNAs extracted from the isolates were then sequenced for phylogenetic analyses.

16S rRNA gene amplification, cloning, and se-quencing

The nearly complete 16S rRNA gene sequence, about 1,500-bp long, was amplified using the univer-sal forward primer P1 and the universal reverse pri-mer P6 [11] (Table 2). The PCR reactions were run using the methods described by Chouari et al. (2003, 2005) [12, 13]. In this study, we used high fidelity Ex taq polymerase (Takara, Japan). The 16S rRNA gene PCR products were purified following the Nucleic Acid Recycling and Purification Kit protocol (Tiangen Biotech, P. R. China). Purified nucleotide sequences and pGEM-T plasmid vectors (Promega, USA) were ligated overnight at 4°C. Recombined plasmids were transformed into Escherichia coli DH10B by electro-poration (BTX ECM830, USA) at 500 V for 17 ms and evaluated using blue-white screening. Plasmids con-taining 16S rRNA gene sequences were extracted and purified according to the method described by Sam-



211

brook (1989) [6]. In the present study, three positive clones were selected for sequencing by using the primers RV-M/M13-47 (Table 2) in both directions

with an ABI377 automatic sequencer (Applied Bio-systems, USA).

Table 1. Strains isolated in this study

Strain number Genus 16S rRNA sequences GenBank acces-sion number

ITS sequences GenBank accession number

I2X Bacillus sp. HQ727951 -



II2X Bacillus sp. HQ727954 -

II3X Bacillus sp. HQ844041 -

III1X Bacillus sp. HQ727955 -

III3X Bacillus sp. HQ727956 -

IV1X Bacillus sp. HQ727957 -

IV3X Bacillus sp. HQ727958 -

V1X Bacillus sp. HQ727959 -




VI2X Bacillus sp. HQ727963 -

VII1X Bacillus sp. HQ727964 -



II4X Pseudomonas sp. HQ727967 -

III4X Pseudomonas sp. HQ727968 -

IV2X Pseudomonas sp. HQ727969 -

VI3X Pseudomonas sp. HQ727970 -

I1X Pseudomonas sp. HQ844040 -

I1Z Penicillium sp. - HQ730121

I2Z Trichoderma sp. - HQ730122

II1Z Penicillium sp. - HQ730123

II2Z Bionectria sp. - HQ730124

II3Z Trichoderma sp. - HQ730125

III1Z Mortierella sp. - HQ730126

III2Z Penicillium sp. - HQ730127

V2Z Penicillium sp. - HQ730128

VI1Z Mortierella sp. - HQ730129

VI2Z Trichoderma sp. - HQ730130

VII1Z Trichoderma sp. - HQ730131

VII2Z Mortierella sp. - HQ730132

IV2Z Trichoderma sp. - HQ844042

V3Z Mortierella sp. - HQ844043

Table 2. Primers used in this study

Primers Sequence (5’→3’) Reference

16S P1 AGAGTTTGATCCTGGTCAGAACGCT Yanagi and Yamasato, 1993

16S P2 TACGGCTACCTTGTTACGACTTCACCCC Yanagi and Yamasato, 1993

ITS1 TCCGTAGGTGAACCTGCGG White et al, 1990

ITS4 TCCTCCGCTTATTGATATGC White et al, 1990

RV-M GAGCGGATAACAATTTCACACAGG Takara, Code No. D3880, Japan.

M13-47 CGCCAGGGTTTTCCCAGTCACGAC Takara, Code No. D3887, Japan.



212

ITS gene amplification, cloning, and sequencing

Recently, the ITS region of the ribosomal operon has become preferentially used for fungi classification instead of 18S ribosome RNA sequences [14]. The en-tire stretch of ITS1-5.8S-ITS2, approximately 750-bp long, was amplified using the universal forward pri-mer ITS1 and the universal reverse primer ITS4 [15]. Ex taq polymerase (Takara, Japan) was used. The pu-rification and sequencing procedures were the same as those described for the 16S rRNA sequences.

Sequence analysis and phylogenetic tree con-struction

The 16S rRNA and ITS gene sequences of the isolated strains were compared with sequences in DDBJ/EMBL/GenBank using the basic local align-ment search tool (BLAST) [16]. The isolates had sig-nificant hits to the genus which owed the lowest e-value in the results of BLAST. When more than one sequence had the same e-value, only the first sequence was selected. Further, sequences were aligned using the Clustal_X software [17]. The distances were cal-culated according to two-parameter method [18]. The phylogenetic tree was inferred using the neigh-bour-joining methods [19]. Bootstrap analysis was based on 1,000 re-samplings. The MEGA4.0 package [20] was used for all analyses. All 16S rRNA se-quences of the Bacillus and Pseudomonas type strains were obtained from the websites at http://www.bacterio.cict.fr/b/bacillus.html and http://www.bacterio.cict.fr/p/pseudomonas.html, respectively. The ITS sequences of the fungi type strains were obtained from DDBJ/EMBL/GenBank.

Results

Bacteria and fungi isolation from the soil samples

In total, 342 isolates were selectively obtained from soil samples collected near a C. rutilus colony in the Beijing region. Of these, 22 bacterial and 14 fungal isolates were selected out of 342 isolates based on the methods described in Materials and Methods.

Sequencing and phylogenetic analysis of the 16S rRNA gene sequences

The nearly complete 16S rRNA gene sequences of the 22 bacteria isolates were amplified using the universal primers for the 16S rRNA sequence shown

in Table 2 and sequenced. Comparing the 16S rRNA sequences with those in DDBJ/EMBL/GenBank, the strains labeled I2X, I3X, I4X, II2X, II3X, III1X, III3X, IV1X, IV3X, V1X, V2X, V3X, V4X, VI2X, VII1X, VII2X, and VII3X had significant hits to Bacillus spp. and those labeled I1X, II4X, III4X, IV2X, and VI3X had significant hits to Pseudomonas spp.. The 16S rRNA sequence GenBank accession numbers of these strains are indicated after the bacterial names in Table 1.

A phylogenetic tree based on the Bacillus spp. listed in the website http://www.bacterio.cict.fr/b/ bacillus.html and the 17 sequenced Bacillus isolates was established (data not shown). Based on genetic distances, Bacillus spp. that had high similarities with the isolates were selected to construct the phyloge-netic tree. The 17 Bacillus isolates formed three clus-ters (Fig. 1). Cluster I included eight isolates. The strains labeled V1X, VII1X, V4X, VII3X, and I3X were clustered with B. simplex, exhibiting 99.9, 99.9, 99.9, 100, and 100% 16S rRNA sequence similarity with B. simplex, respectively. Strains VI2X, V3X, and IV1X clustered with B. sp. LMG 20238, all exhibiting 99.9% 16S rRNA sequence similarity with B. sp. LMG 20238. Cluster II included strains II3X and III1X, which had 99.9% 16S rRNA sequence similarity with B. aryabhat-tai. Cluster III consisted of seven strains. Strains I2X, V2X, I4X, VII2X, II2X, and III3X were clustered with B. thuringiensis, exhibiting 99.9, 99.9, 100, 99.9, 100, and 100% 16S rRNA sequence similarity, respectively. Strain IV3X showed the highest 16S rRNA sequence similarity, 99.9%, with B. cereus.

The phylogenetic diversity of the Pseudomonas isolates was analyzed as described above for Bacillus. A phylogenetic tree was constructed based on the Pseudomonas spp. in the website (http://www.bacterio.cict.fr/p/pseudomonas.html) and the five isolates (data not shown). Using genetic distances, the Pseudomonas spp. which had high simi-larities with these five isolates were selected to con-struct the phylogenetic tree. The Pseudomonas isolates formed two clusters (Fig. 2). The Pseudomonas isolates labeled II4X, VI3X, IV2X, and III4X clustered with P. koreensis, exhibiting 99.8, 99.7, 99.8, and 99.8% 16S rRNA sequence similarity, respectively. In the other cluster, strain I1X had 99.8% similarities with P. um-songensis.



213

Fig. 1 Neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showing the distance of isolated strains with

the nearest species of the genus Bacillus. Pseudomonas agarici ATCC25941 was used as an out group. Bootstrap percentage

values as obtained from 1,000 resamplings of the date set are given at the nodes of the tree. Bar, 0.01 substitutions per

nucleotide position.

IV3X

VII2X

I2X

B. thuringiensis IAM 12077 16S ribosomal

I4X

II2X

III3X

B. cereus ATCC 14579 16s ribosome RNA

V2X

B. halmapalus DSM 8723 16S ribosomal RNA

B. luciferensis LMG 18422 16S rRNA

B. psychrosaccharolyticus ATCC23296 16S

V3X

B. sp. LMG 20238 LMG 20238 16S rRNA

VII3X

V4X

VI2X

I3X

IV1X

B. simplex DSM 1321T 16S rRNA

V1X

VII1X

B. flexus IFO15715 16S ribosomal RNA

B. megaterium IAM 13418 16S ribosomal RN

II3X

B. aryabhattai B8W22 16S ribosomal RNA

III1X

B. fumarioli LMG 17489 16S rRNA

B. nealsonii DSM 15077 16S ribosomal RNA

B. insolitus type strain: DSM 5T 16S rRN

B. psychrodurans DSM 11713 16S rRNA

B. psychrotolerans DSM 11706 16S rRNA

B. badius ATCC 14574 16S ribosomal RNA

B. fortis R-6514 16S ribosomal RNA

B. coagulans NBRC 12583 16S ribosomal RN

B. alveayuensis TM 1 16S ribosomal RNA

B. galactosidilyticus type strain: LMG 1

B. sp. CAU 348 CAU 348 16S ribosomal RNA

B. oleronius ATCC 700005 16S ribosomal R

B. isabeliae type strain: CVS-8 16S rRNA

B. licheniformis ATCC 14580 16S ribosome

B. subtilis DSM10 16S rRNA

B. axarquiensis LMG 22476 16S ribosomal

B. malacitensis LMG 22477 16S ribosomal

B. gelatini type strain: LMG 21880 16S r

B. macauensis ZFHKF-1 16S ribosomal RNA

B. decolorationis type strain: LMG 19507

B. agaradhaerens DSM 8721 16S ribosomal

B. saliphilus type strain: 6AG 16S rRNA

B. selenitireducens MLS10 MLS10 16S ribo

B. clarkii DSM 8720 16S ribosomal RNA

B. cellulosilyticus DSM 2522 N-4 16S rib

B. mannanilyticus AM-001 16S ribosomal R

B. murimartini LMG 21005 16S rRNA

B. plakortidis type strain: P203 16S rRN

B. gibsonii DSM 8722 16S ribosomal RNA

B. clausii DSM 8716 16S ribosomal RNA

B. alkalidiazotrophicus MS 6 16S ribosom

B. pseudofirmus DSM 8715 16S ribosomal R

B. halodurans DSM 497T 16S rRNA

B. hemicellulosilyticus C-11 16S ribosom

B. alcalophilus DSM 485 T 16S ribosomal

B. pseudalcaliphilus DSM 8725 16S riboso

B. thermantarcticus M1 16S rRNA

G. vulcani 3S-1 16S rRNA

B. thermocloaceae DSM 5250 16S ribosomal

B. edaphicus T7 16S Ribosomal RNA

B. edaphicus HSCC 1604T (VKPM 7517T) 16S

B. mucilaginosus 1480D 16S Ribosomal RNA

B. mucilaginosus VKPM B-7519 16S ribosom

B. thermoruber DSM 7064 16S ribosomal RN

B. centrosporus NRRL NRS-664 16S ribosom

B. formosus DSM 9885T 16S ribosomal RNA

B. agri DSM 6348T 16S ribosomal RNA

B. parabrevis IFO 12334T 16S ribosomal R

B. schlegelii ATCC 43741T 16S ribosomal

B. tusciae DSM 2912 IFO 15312T 16S ribos

Pseudomonas agarici ATCC 25941



214


the nearest species of the genus Pseudomonas. Bacillus subtilis NCDO 1769T was used as an out group. Bootstrap percentage



P. mucidolens IAM12406 16S ribosomal RNA

P. synxantha IAM12356 16S ribosomal RNA

P. libanensis CIP 105460 16S ribosomal R

P. panacis CG20106 16S ribosomal RNA

P. proteolytica type strain: CMS 64 16S

P. gessardii CIP 105469 16S ribosomal RN

P. brenneri CFML 97-391T 16S ribosomal R

P. migulae CIP 105470 16S ribosomal RNA

P. orientalis CFML 96-170 16S ribosomal

P. cedrina subsp. fulgida type strain: D

P. cedrina CFML 96-198 16S ribosomal RNA

P. azotoformans IAM1603 16S ribosomal RN

P. salomonii CFBP 2022 16S ribosomal RNA

P. palleroniana CFBP 4389 16S ribosomal

P. tolaasii LMG 2342 T 16S ribosomal RNA

P. costantinii CFBP 5705 HAMBI 2444 16S

P. lurida type strain: DSM 15835 16S rRN

P. simiae type strain: OLi 16S rRNA

P. extremorientalis KMM 3447 16S ribosom

P. poae type strain: DSM 14936 LMG 21465

P. trivialis type strain: DSM 14937 LMG

P. antarctica type strain: CMS 35 16S rR

P. meridiana type strain: CMS 38 16S rRN

P. extremaustralis CT14-3 16S rRNA

P. veronii CIP 104663 16S ribosomal RNA

P. grimontii CFML 97-514T 16S ribosomal

P. rhodesiae CIP 104664 16S ribosomal RN

P. marginalis LMG 2210T (type strain pat

P. lini CFBP 5737 16S ribosomal RNA

P. mediterranea CFBP 5447 16S ribosomal

P. corrugata ATCC 29736 16S ribosomal RN

P. kilonensis 520-20 16S rRNA

P. thivervalensis SBK26 CFBP 11261T 16S

P. brassicacearum DBK11 CFBP 11706 16S r

P. sp. CIP 109457 CIP 109457 16S ribosom

P. chlororaphis DSM 50083T (type strain)

P. mandelii CIP 105273 16S ribosomal RNA

P. frederiksbergensis JAJ28 16S rRNA

P. cichorii LMG 2162T (type strain) 16S

P. viridiflava CECT 458 16S ribosomal RN

P. amygdali LMG 2123T (type strain) 16S

P. cannabina type strain: CFBP 2341 16S

P. caricapapayae ATCC33615 16S ribosomal

P. savastanoi ATCC 13522T 16S ribosomal

P. tremae type strain: CFBP 6111 16S rRN

P. ficuserectae JCM 2400T 16S ribosomal

P. congelans type strain: DSM 14939 LMG

P. syringae pv. syringae NCPPB 281 8511

P. taetrolens IAM1653 16S ribosomal RNA

P. lundensis ATCC 49968T 16S ribosomal R

P. fragi ATCC 4973 16S ribosomal RNA

P. psychrophila E-3 16S ribosomal RNA

P. abietaniphila type strain:ATCC 700689

P. rhizosphaerae IH5 16S ribosomal RNA

P. graminis DSM 11363 (type strain) 16S

P. lutea OK2 16S ribosomal RNA

P. agarici LMG 2112T (type strain) 16S r

VI3X

III4X

IV2X

II4X

P. koreensis Ps 9-14 16S ribosomal RNA

P. reinekei type strain: MT1 16S rRNA

P. jessenii CIP 105274 16S ribosomal RNA

P. vancouverensis type strain: DhA-51ATC

P. moorei type strain: RW10 16S rRNA

I1X

P. umsongensis Ps 3-10 16S ribosomal RNA

P. mohnii type strain: IpA-2 16S rRNA

Bacillus subtilis NCDO 1769



215

Fig. 3 Neighbour-joining phylogenetic tree based on ITS sequences showing the distance of isolated strains with the nearest

species of the genus Penicillium. Trichoderma viride ATCC20898 was used as an out group. Bootstrap percentage values as

obtained from 1,000 resamplings of the date set are given at the nodes of the tree. Bar, 0.005 substitutions per nucleotide

position.

P. canescens NRRL 35656 18S ribosomal RN

P. canescens TRT110

I1Z

P. janczewskii CV164 internal transcribe

P. sp. HM104 HM104

P. canescens QLF83

P. atrovenetum NRRL 2571 internal transc

P. coralligerum IBT 17894 18S rRNA+5.8S

P. novae-zeelandiae internal transcribed

P. raistrickii NRRL 2039 internal transc

P. swiecickii NRRL 918 internal transcri

P. soppii NRRL 2023 internal transcribed

P. sp. 0109CI39M4 0109CI39M4 18S rRNA+5.

P. crustosum ATCC 48910 18S ribosomal RN

P. venetum IBT 5464 18S rRNA+5.8S rRNA+2

P. concentricum P11.1

P. atramentosum NRRL 795 internal transc

P. madriti NRRL 3452 internal transcribe

u. fungus(3)

P. citreonigrum 276P

P. sp. Vega755 Vega755 internal transcri

P. toxicarium NRRL 35655 internal transc

P. cinerascens NRRL 748 internal transcr

P. restrictum olrim342

III2Z

II1Z

P. restrictum FRR 332 18S ribosomal RNA+

P. restrictum NRRL 25744 internal transc

P. raciborskii NRRL 2150 internal transc

P. corylophilum NRRL 802 internal transc

P. sp. F5 F5 18S ribosomal RNA+internal

P. funiculosum NRRL 6417 internal transc

V2Z

P. aculeatum wxm73

P. marneffei WM 04.467 18S rRNA+5.8S rRN

P. sp. 22-M-5 22-M-5

P. aculeatum 36-M-4a

P. aculeatum NRRL 2129 internal transcri

P. verruculosum MKH-7

P. sp. J-25 J-25

P. purpurogenum LP60

P. pinophilum BFM-L30

P. funiculosum NRRL 35431 internal trans

T. viride ATCC 20898 18S ribosomal RNA+i



216

Sequencing and phylogenetic analysis of the ITS

sequences

Because ITS sequences can accumulate muta-tions at a faster rate than the 5.8S, 18S, and 28S rRNA genes, the ITS region is typically most useful for mo-lecular systematics at the species or within species level [21, 22]. The ITS1-5.8S-ITS2 gene sequences of the 14 isolates were compared with sequences listed in DDBJ/EMBL/GenBank, indicating that they had significant hits to the genera Penicillium, Trichoderma, Mortierella and Bionectria. The strains labeled I1Z, II1Z, III2Z, and V2Z had significant hits to Penicillium. Strains I2Z, II3Z, IV2Z, VI2Z and VII1Z had signifi-cant hits to Trichoderma. Strains III1Z, V3Z, VI1Z and VII2Z had significant hits to Mortierella. Strain II2Z had significant hits to Bionectria. The ITS gene se-quence GenBank accession numbers of the isolated fungi are indicated in Table 1.

A phylogenetic tree using the Penicillium spp.

which had high similarities to the isolated fungi was constructed based on genetic distance (Fig. 3). The four Penicillium spp. isolates formed three clusters (Fig. 3). Cluster I consisted of strain I1Z, which exhib-ited 100% ITS sequence similarity with P. canescens. Cluster II contained strains II1Z and III2Z, which had the highest ITS sequence similarity to P. restrictum, 99.3% and 99.8%, respectively. Cluster III consisted of V2Z, with 100% similarity to P. aculeatum, and I1Z, with 100% similarity to P. canescens.

Using the method described for Penicillium, strains I2Z, II3Z, VI2Z, and VII1Z had 100, 99.9, 100, and 100% similarity with Trichoderma koningiopsis, respectively (Fig. 4). Strain IV2Z had 99% similarity with T. atroviride (Fig. 4). The fungi labeled III1Z, VI1Z, VII2Z, and V3Z had 100, 100, 100 and 99.8% similarity with Mortierella alpina, respectively (Fig. 5). The fungus labeled II2Z had 100% similarities with B. ochroleuca (Fig. 6).


the nearest species of the genus Trichoderma. Aspergillus niger ATCC9642 was used as an out group. Bootstrap percentage



T. koningiopsis NG 04

T. koningiopsis JA14

I2Z

T. koningiopsis DAOM 233971

VII1Z

IV2Z

T. koningiopsis GJS 04-314 18S ribosomal

II3Z

T. gamsii UNISS 22-32

H. koningii ATCC 64262 18S rRNA+5.8S rRN

T. viride GJS 05-186 18S ribosomal RNA+i

H. vinosa GJS 94-9 18S rRNA+5.8S rRNA+28

T. sp. IBL 03181 649 18S ribosomal RNA+i

u. fungus(12)

H. lixii NRRL 13019 18S ribosomal RNA+in

H. lixii GJS 04-212 18S ribosomal RNA+in

VI2Z

T. atroviride T1 18S ribosomal RNA+inter

Aspergillus niger strain ATCC 9642



217


the nearest species of the genus Mortierella. Aspergillus niger ATCC9642 was used as an out group. Bootstrap percentage



V3Z

M. alpina ATCC 42430 internal transcribe

VI1Z

III1Z

VII2Z

u. fungus(13)

u. fungus(14)

M. alpina 2S16CB 18S ribosomal RNA+inter

M. alpina internal transcribed spacer 1+

u. Mortierella 18S rRNA+5.8S rRNA+28S rR

u. fungus(17)

M. globalpina NBRC 32282

u. fungus(38)

u. basal lineage fungus

u. soil fungus

u. soil fungus(2)

M. sp. QLF64 QLF64

M. alpina d27

u. soil fungus(10)

u. soil fungus(7)

M. alpina CBS 528.72 18S rRNA+5.8S rRNA+

M. alpina QLF27

u. soil fungus(4)

M. alpina xsd08339

M. alpina QLF48

u. fungus(31)

u. Mortierellales

u. fungus(36)

u. fungus(39)

u. Mortierella(2)

u. fungus(18)

M. alpina JZ-71

u. fungus(19)

M. alpina 39-M-a

M. alpina FKI-4905 18S ribosomal RNA+int

M. alpina CBS 224.37 18S rRNA+5.8S rRNA+

u. fungus(22)

u. fungus(20)

u. fungus(27)

u. fungus(26)

u. fungus(33)

u. fungus(25)

u. fungus(30)

A. niger ATCC 9642 18S ribosomal RNA+int



218


the nearest species of the genus Bionectria. Aspergillus niger ATCC9642 was used as an out group. Bootstrap percentage



Discussions

To date, the artificial cultivation of some edible wild fungi, including Chroogomphus spp., Morchella spp., and Matsutake spp., has not been successful. The slow mycelia growth rate on nutrient medium and the difficulty in fruiting body formation is due to the lack of information on the mechanisms of spore germina-tion and fruiting body formation. Fruiting body for-mation could be affected by factors within the mycelia or externally, in the environment. Many microorgan-isms secrete beneficial secondary metabolites, which could be important for spore germination or fruiting body formation in wild mushrooms [23]. Rainey et al. (1991) reported that casing was required for the in-

duction of fruiting body formation, which is caused by the presence of saprophytic bacteria in the casing medium [24]. Ntougias et al. (2004) reported that Gram-negative bacteria existed in spent mushroom compost and in mushroom cultivation substrate ana-lyzed immediately after pasteurisation and cooling. The biological properties of compost appear to be important for the induction of fruiting body formation [25]. The microorganisms that exist in proximity to C. rutilus require further detailed examination to deter-mine important interactions, which could advance the artificial cultivation of C. rutilus.

In the present study, 10 gram soil sample were resolved and serial diluted. Only a portion of the so-lution was spread on the appropriate media. Finally,

u. Bionectriaceae 2

u. Bionectriaceae 3

B. ochroleuca xsd08089

B. ochroleuca ATCC 48395 18S ribosomal R

II2Z

B. ochroleuca EXGF-1

B. ochroleuca XSD-79 18S ribosomal RNA+i

u. soil fungus 2

B. ochroleuca GCA-605-5 18S ribosomal RN



B. sp. EXMQ-9 EXMQ-9

B. ochroleuca HJ15

B. ochroleuca ATCC 46475 18S ribosomal R

u. fungus 5

B. sp. Vega618 Vega618 internal transcri

B. ochroleuca 18S ribosomal RNA+internal

B. ochroleuca E6709c

B. cf. ochroleuca CBS 113336 18S ribosom

f. endophyte sp. MS27 MS27

u. fungus 4

B. ochroleuca TU-GM4 18S ribosomal RNA+i

B. ochroleuca wxm112

B. ochroleuca FS-45 18S ribosomal RNA+in

B. ochroleuca FS-19 18S ribosomal RNA+in

Aspergillus niger strain ATCC 9642



219

36 isolates were obtained for further classification and phylogenetic analysis. Limited by the sample size, there was the chance that some key microbes needed for C. rutilus might be missed. Moreover, traditional cultural method exhibit its limitations in the phylo-genetic analysis, since only a small proportion of mi-crobe can be obtained in laboratory condition [26]. Culture-indepentdent methods, such as metagenomic approach, could overcome these difficulties and limi-tations [27]. To solve these existing problems, meta-genomic approach will be applied in the future study. Except of these, several important results from this investigation were summarized below.

First, of the 22 bacteria strains, 17, or about 80%, were Bacillus spp. It was reported that Bacillus spp. are abundant and widely distributed in agro-ecosystem [28, 29]. This could be because these Bacillus strains form a thick outer spore coat increasing resistance to extreme conditions, such as heat, ultraviolet radiation, toxic chemicals, and desiccation. Effects of Bacillus sp. on growth on mushroom was reported by Bis’ko et al. (1995) [30].

Second, four Pseudomonas spp. were isolated from the soil sample. Reports indicated that the presence of saprophytic bacteria, such as Pseudomonas spp., in the casing medium could induce fruiting body formation [31]. Moreover, secondary products ex-creted by Pseudomonas, such as insecticides and ger-micides, could affect the growth of C. rutilus mycelia in its natural habitat. Kloepper et al. (2004) reported that Pseudomonas spp. were one of the familiar plant growth-promoting rhizobacteria (PGPR) [32]. This explained the isolation of Pseudomomas spp. in the soil sample in this study. Further research on Pseudomonas spp. and C. rutilus interactions should be conducted, because this interaction might be the key point to ar-tificial cultivation.

Third, we observed that some bacteria isolates could secrete much extracellular polysaccharides in the medium. Extracellular polysaccharides are im-portant in inter-microorganism signaling [33, 34] and are involved in selection recognition, which is im-portant for symbiosis [35]. In this study, the fact that soil samples were collected where C. rutilus grew im-plied that these extracellular polysaccharides could be important for recognition and signalling between bacteria and C. rutilus. By understanding the molecu-lar mechanisms of these hypothesized interactions, we could enhance the interactions and expand the use of these bacteria.

Finally, it is notable that the fungus strain la-beled II2Z had significant hits to the genus Bionectria. Bionectria are endophytic fungi that can colonize liv-ing, internal plant tissue without any immediate or

overt negative effects [36]. In fact, endophytic fungi were detected and reported in many plants. These fungi showed positive role to help protecting the plants against insects, nematodes, pathogens and so on [37, 38]. In the present study, Bionectria spp. was isolated from the soil sample together with the myce-lium of C. rutilus. It could be deduced that Bionectria spp. might interact with the organism nearby. The organism perhaps was the nearby pine tree or the mycelium of C. rutilus. Based on the results obtained in the present study, the detail interaction between C. rutilus and Bionectria sp. II2Z requires more research to determine if this strain played the role on the fruit body formation of C. rutilus.

In this study, microorganisms were isolated and classified in C. rutilus habitat. This laid the foundation of the artificial cultivation of C. rutilus. This report is the first reported examination of the microbiological ecology of C. rutilus. Based on the results of this study, we will examine the exact interactions between C. rutilus and these isolated microorganisms to reveal how these microorganisms assist in the artificial cul-tivation of C. rutilus. If this research path is successful, the applications of C. rutilus will broaden.

Acknowledgments

We thank the reviewers for the helpful com-ments and improvement of the text.

Conflict of Interests

The authors have declared that no conflict of in-terest exists.

References

1. Aime M, Miller OK. Proposal to conserve the name Chroogomphus against Brauniellula (Gomphidiaceae). Taxon. 2005; 55(1):227–228.

2. Li YC, Yang ZL, Tolgor B. Phylogenetic and biogeographic relationships of Chroogomphus species as inferred from molec-ular and morphological data. Fungal Divers. 2009; 38: 85-104

3. Yamada A, Ogura T, Ohmasa M. Cultivation of mushrooms of edible ectomycorrhizal fungi associated with Pinus densiflora by in vitro mycorrhizal synthesis. Mycorrhiza. 2001; 11 (2):59-66.

4. Dong HY, Hao C, Niu YR, et al.. The ecological elementary research of Chroogomphis rutillus. Chinese Agricultural Science Bulletin. 2010; 26 (7): 191-194.

5. Chen QJ, Cheng JH, Hao C, et al. Mycelium growth characters and culture medium formula screening of Comphidius rutilus. Chinese Agricultural Science Bulletin. 2010; 26 (3): 231-233.

6. Shen H, Wang H, Zhao YC, et al. Analysis of fungal communi-ties present in Morchella growth soil using denaturing gradient gel electrophoresis. Acta Edulis Fungi. 2009; 16 (2): 10-12.

7. Garbaye J, Churin JL, Duponnois R. Effects of substrate sterilization, fungicide treatment, and mycorrhization helper bacteria on ectomycorrhizal formation of pedunculate oak (Quercus robur) inoculated with Laccaria laccata in two peat bare-root nurseries. Biol Fertil Soils. 1992; 13:55-57.



220

8. Shen H, Chen MJ, Zhao YC, et al. PCR-DGGE identification of endophytes in Morels. Acta Agriculture Shanghai. 2008; 24 (2): 58-60.

9. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A la-boratory manual. US: Cold Harbor. 1989.

10. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987; 19: 11-15.

11. Yanagi M, Yamasato K. Phylogenetic analysis of the family Rhizobiaceae and related bacteria by sequencing of 16S rRNA gene using PCR and DNA sequencer. FEMS Microbiol Lett. 1993; 107 (1): 115-120.

12. Chouari R, Le Paslier D, Daegelen P, et al. Molecular evidence for novel planctomycete diversity in a municipal wastewater treatment plant. Appl Environ Microbiol. 2003; 69 (12):7354 - 7363.

13. Chouari R, Le Paslie D, Daegelen P, et al. Novel predominant archaeal and bacterial groups revealed by molecular analysis of an anaerobic sludge digester. Environ Microbiol. 2005; 7 (8):1104- 1115.

14. Druzhinina IS, Kopchinskiy AG, Komoń M, et al. An oligonu-cleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet Biol. 2005; 42 (10): 813-828.

15. Innis MA, Gelfand DH, Sninsky JJ, et al. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press Inc. 1990: 315-322.

16. Altschul SF, Gish W, Miller W, et al. Basic local alignment search tool. J Mol Biol. 1990; 215: 403-410.

17. Thompson JD, Gibson TJ, Plewniak F, et al. The clustal_X win-dows interface: flexible strategies for multiple sequence alignement aided by quality analysis tools. Nucleic Acid Res. 1997; 25: 4876-4882.

18. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980; 16: 111- 120.

19. Saitou N, Nei M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4: 406–425.

20. Tamura K, Dudley J, Nei M, et al. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0 . Mol Niol Evol. 2007; 24 ( 8): 1596-1599.

21. Baldwin BG. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: An example from the Compositaogy. Mol Phylogenet Evol. 1992; 1 (1): 3–16.

22. Schmidt O, Moreth U. Data bank of rDNA-ITS sequences from building-rot fungi for their identification. Wood Sci Technol. 2002; 36: 429-433.

23. Li CG, Li XM, Kong WD, et al.. Effect of monoculture soybean on soil microbial community in the Northeast China. Plant Soil. 2010; 330(1-2):423-433.

24. Rainey PB. Effect of Pseudomonas putida on hyphal growth of Agaricus bisporus. Mycol Res. 1991; 95: 699-704.

25. Ntougias S, Zervakis G, Kavroulakis N, et al. Bacterial diversity in spent mushroom compost assessed by amplified rDNA restriction analysis and sequencing of cultivated isolates. System Appl Microbiol. 2004; 27 (6): 746-754.

26. Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995; 59: 143-169.

27. Streit WR, Schmitz RA. Metagenomics – the key to the uncultured microbes. Curr Opin Microbiol. 2004; 7(5):492-498.

28. Ruussos S, Garcia JL, Rinaudo G. Distribution of heterotrophic aerobic microflora and specially denitrifying and free-living nitrogen-fixing bacteria in the rhizosphere of rice. Ann Microbiol. 1980; 131 (2): 197-207.

29. Choudhary DK, Johri BN. Interactions of Bacillus spp. and plants - with special reference to induced systemic resistance (ISR). Microbiol Res. 2009; 164(5): 493-513.

30. Bis’ko NA, Bilay VT. Effects of Bacillus macerans Fr. on growth of Pleurotus ostreatus (Jacq.:Fr.) Kumm. In: Elliott T.J., ed. Science and Cultivation of Edible Fungi. Rotterdam: Balkema. 1995: 843 - 846.

31. Kim MK, Math RK, Cho KM, et al.. Effect of Pseudomonas sp. P7014 on the growth of edible mushroom Pleurotus eryngii in bottle culture for commercial production. Bioresour Technol. 2008; 99 (8): 3306 - 3308.

32. Kloepper JW, Ryu CM, Zhang S. Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology. 2004; 94 (11):1259-1266.

33. Van Workum WAT, Cremers H, Wijfjes AHM, et al.. Role of exopolysaccharides of Rhizobium leguminosarum bv. viciae as host plant-specific molecules required for infection thread formation during nodulation of Vicia sativa. Mol Plant Microbe In. 1998;11 (12): 1233-1241.

34. Djordjevic SP, Chen H, Batley M. Nitrogen fixation ability of exopolysaccharide synthesis mutants of Rhizobium sp. strain NGR234 and Rhizobium trifolii is restored by the addition of homologous exopolysaccharides. J Bacteriol. 1987; 169 (1): 53-60.

35. Gaskins MH, Albrecht SL and Hubbell DH. Rhizosphere bacteria and their use to increase plant productivity: A review. Agr Ecosyst Environ. 1985; 12 (2): 99-116.

36. Hirsch GU, Braun U. Communities of parasitic microfungi. In: Winterhoff W, ed. Handbook of vegetation science: fungi in vegetation science, 19. Dordrecht: Kluwer Academic. 1992: 225 - 250.

37. Vega FE, Posada F, Aime MC, et al. Entomopathogenic fungal endophytes. Biol Control. 2008; 46: 72 - 82.

38. Zhou XW, Zhu HF, Liu L, et al.. A review: recent advances and future prospects of taxol-producing endophytic fungi. Appl Microbiol Biotechnol. 2010; 86 (6):1707 - 1717.

Diversity of Microorganisms Isolated from the Soil Sample ... · teria and fungi was determined...

Documents

Transcript of Diversity of Microorganisms Isolated from the Soil Sample ... · teria and fungi was determined...