Developmentally regulated expression of the regulator of G-protein

signaling gene 2 (Rgs2) in the embryonic mouse pituitary

L.D. Wilsona,b, S.A. Rossa, D.A. Leporea, T. Wadac, J.M. Penningerc, P.Q. Thomasa,*

aMurdoch Childrens Research Institute, Royal Childrens Hospital, Melbourne, Vic. 3052, AustraliabDepartment of Paediatrics, University of Melbourne, Melbourne, Vic. 3010, Australia

cInstitute of Molecular Biotechnology of the Austrian Academy of Sciences, Dr Bohrgasse 3-5, Vienna A-1030, Austria

Received 20 July 2004; received in revised form 22 October 2004; accepted 22 October 2004

Available online 8 December 2004

Abstract

During the development of the anterior pituitary gland, five distinct hormone-producing cell types emerge in a spatially and temporally

regulated pattern from an invagination of oral ectoderm termed Rathke’s Pouch. Evidence from mouse knockout and ectopic expression

studies indicates that 12.5 days post coitum (dpc) to 14.5 dpc is a critical period for the expansion of the progenitor cell pool and the

determination of most hormone-secreting cell types. While signaling proteins and transcription factors have been identified as having key

roles in pituitary cell differentiation, little is known about the identity and function of proteins that mediate signal transduction in progenitor

cells. To identify genes that are enriched in the embryonic pituitary gland, we compared gene expression in 14.5 dpc pituitary and 14.5 dpc

embryo minus pituitary tissues using the NIA 15K microarray. Analysis of the data using the R program revealed that the Regulator of G

Protein Signaling 2 (Rgs2) gene was 3.9-fold more abundant in the 14.5 dpc pituitary. In situ hybridisation confirmed this finding, and

showed that Rgs2 expression in midline tissues was restricted to the pituitary and discrete regions of the nervous system. Within the pituitary,

Rgs2 was expressed in undifferentiated cells, and was downregulated at the completion of the hormone cell differentiation. To investigate

Rgs2 function in the pituitary, we examined hormone cell differentiation in Rgs2 null neonate mice. Pituitary cell differentiation and

morphology appeared normal in the Rgs2 mutant animals, suggesting that other Rgs family members with similar activities may be present in

the developing pituitary.

q 2004 Elsevier B.V. All rights reserved.

Keywords: Rgs2; Pituitary; Wnt signaling; G protein; Microarray

The transformation of an embryo into a mature organism

requires massive expansion and directed differentiation of

progenitor/stem cell populations. Identification of genes that

control this process is one of the main objectives of

developmental biology. Many components of the genetic

program that direct organogenesis of the murine pituitary

have already been identified, and have been shown to have

evolutionarily conserved functions (Scully and Rosenfeld,

2002; Dattani and Robinson, 2000). These data provide a

framework for the understanding of additional genes that are

1567-133X/$ - see front matter q 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.modgep.2004.10.005

* Corresponding author. Address: Pituitary Research Unit, Murdoch

Childrens Research Institute, Royal Childrens Hospital, Melbourne, Vic.

3052, Australia. Tel.: C61 3 8341 6285; fax: C61 3 9348 1391.

E-mail address: paul.thomas@mcri.edu.au (P.Q. Thomas).

implicated in this process, and their possible involvement in

the aetiology of birth defects.

The pituitary gland controls a wide range of fundamental

bodily activities, including growth, reproduction, thyroid

function and the ability to cope with stress. These functions

are mediated by hormones secreted from five distinct cell

types, all of which differentiate during embryogenesis. The

anterior and intermediate lobes of the pituitary gland develop

from a midline invagination of oral ectoderm known as

Rathke’s Pouch (RP), which in murine embryos is formed

around 9.0 days post coitum (dpc). By 12.5 dpc, RP extends

dorsally and expands to form a flattened epithelium, which is

closely associated with the infundibular recess of the

diencephalon. At this time, many of the anterior pituitary

progenitor cell types are believed to be specified, in a process

that involves Wnt and other signaling proteins emanating

Gene Expression Patterns 5 (2005) 305–311

www.elsevier.com/locate/modgep

Fig. 1. RT-PCR validation of Pit and E-Pit samples. RT-PCR analysis of

E-Pit (lanes 1, 3 and 5) and Pit (lanes 2, 4 and 6) samples for expression of

the ubiquitous gene GAPDH (lanes 1 and 2), and the pituitary genes Hesx1

(lanes 3 and 4) and Prop1 (lanes 5 and 6). Note the absence of Hesx1 and

Prop1 PCR products in the E-Pit sample.

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311306

from the pituitary and neighbouring tissues (Treier et al.,

1998; Cha et al., 2004; Kioussi et al., 2002; Ericson et al.,

1998). Progenitor cell differentiation is also evident from this

stage, with the appearance of the alpha Glycoprotein Subunit

(aGSU)-positive rostral tip thyrotrophs in the ventro-anterior

region. At 14.5 dpc, the anterior pituitary primordium has

expanded further, and contains a mixture of Prop1-positive

progenitor cells and Pomc1-positive corticotrophs. Terminal

differentiation of the remaining hormone-secreting cells

occurs prior to birth and is marked by the expression of

luteinizing hormone (LH) and follicle-stimulating hormone

(FSH) in gonadotropes, growth hormone (GH) in somato-

trophs, and prolactin (PRL) in lactotrophs.

While the importance of signaling proteins for organo-

genesis is well established, in most cases little is known about

the molecular events that occur in response to receptor–

ligand interaction. One group of proteins, which mediate

signal transduction in a broad range of cellular contexts are

the Regulator of G Protein Signaling (RGS) family. The RGS

family consists of 25 members all of which share a common

domain implicating them in heterotrimeric GTP-binding

protein (G proteins) signal termination. Heterotrimeric G

proteins are intracellular signaling molecules that are

activated by seven transmembrane receptors (Hamm and

Gilchrist, 1996; Neer, 1995) and are composed of a, b and gsubunits. Many neurotransmitters and hormones exert their

effect on target tissues by activating receptors that are

coupled to G proteins (Bourne et al., 1990). Activation of

these receptors results in exchange of GTP for GDP on Gasubunits and the dissociation of GTP-bound active Gasubunits from the Gbg heterodimers, resulting in the

activation of downstream effector pathways. The function

of RGS family members is to promote the intrinsic GTPase

activity of the a subunit, resulting in the rapid deactivation

and reformation of the inactive Gabg heterotrimer (Druey

et al., 1996; Hunt et al., 1996; Watson et al., 1996). Given the

importance of signaling in many developmental processes,

including pituitary organogenesis, RGS proteins may also

function during development. However, to date, the

expression and function of RGS genes in the developing

pituitary had not been examined.

In this report, we use a microarray screening strategy to

identify genes that have enriched expression in the murine

pituitary. We show for the first time that Rgs2 is

developmentally regulated in the embryonic pituitary, and

is downregulated after birth. We also investigate the

function of Rgs2 in the pituitary using Rgs2 null animals.

1. Results

1.1. Identification of Rgs2 as a pituitary-enriched

transcript using microarray

A critical time-point for the commitment and differen-

tiation of murine pituitary progenitor cells is 14.5 dpc.

To identify genes that are selectively expressed in the

developing pituitary at this time, we used a microarray-

based screening strategy. Our approach was based on

the assumption that transcripts that are pituitary-specific

(or pituitary-enriched) will have greater relative abundance

in mRNA pools derived from 14.5 dpc pituitary tissue

versus 14.5 dpc whole embryos without pituitary tissue.

RNA was prepared from 14.5 dpc pituitary glands (Pit) and

14.5 dpc whole embryos from which the pituitary gland had

been removed (E-Pit). The integrity and authenticity of the

samples was established by RT-PCR analyses of the

pituitary genes Prop1 and Hesx1 (Fig. 1). To avoid

the possibility of identifying false positives due to non-

linear amplification of mRNA, we generated sufficient

mRNA from 14.5 dpc embryonic pituitary tissue for direct

labeling and hybridisation analysis. Fluorescently labeled

cDNA probes from each sample were cohybridised to the

mouse NIA 15K array (Kargul et al., 2001; Tanaka et al.,

2000), and relative expression calculated using the R

program. Of the 15,247 genes on the array, Rgs2 (Regulator

of G protein signaling 2) exhibited the greatest enrichment

score in the Pit sample (3.9-fold expression difference,

P!0.05, BZ12). In this report, we will focus on the

expression and function of the Rgs2 gene. Analyses of

other putative pituitary-enriched genes will be presented

elsewhere (manuscript in preparation).

1.2. Rgs2 is highly expressed and developmentally

regulated in the embryonic pituitary

To validate the results of the microarray experiment, we

performed in situ hybridisation analysis (ISH) of Rgs2 on

14.5 dpc whole embryo sagittal sections (Fig. 2). Rgs2

expression was most prominent in the developing pituitary

and discrete regions within the fronto-nasal mass and

hindbrain, confirming that Rgs2 is a pituitary-enriched

transcript (Fig. 2A). Within the anterior pituitary primor-

dium, Rgs2 expression was restricted to the ventro-posterior

Fig. 2. Rgs2 expression in the 14.5 dpc mouse embryo. (A) Sagittal section showing strong Rgs2 expression in the anterior lobe of the developing

pituitary (arrow). Expression is also evident in the dorsal hindbrain, hindbrain flexure and fronto-nasal mass (arrowheads). (B) Magnified view of the pituitary

shown in (A). (C) No signal is detected using an Rgs2 sense control probe.

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311 307

quadrant, and was expressed by most cells within this

domain, including those that line the residual lumen of

Rathke’s Pouch. Low-level Rgs2 expression was also

evident in the infundibulum (Fig. 2B). To further charac-

terise the Rgs2-positive cell population, we compared Rgs2

expression with the pituitary markers Prop1 and aGsu.

Prop1 is a progenitor cell marker and is expressed by the

dorsal periluminal lining cells and occasional cells in the

ventro-posterior quadrant. Conversely, aGsu is expressed in

differentiated cells of the thyrotrope and gonadotrope

lineages which occupy the ventro-anterior domain of the

anterior pituitary at 14.5 dpc. No significant overlap in the

expression domains of Rgs2 and aGsu was detected

(Fig. 3A,B), indicating that Rgs2 is not expressed in

differentiated cells. In contrast, the Prop1 and Rgs2 zones

of expression partially overlap, suggesting that a subset of

Fig. 3. Rgs2 expression in the pituitary is restricted to a subset of undifferentiat

to compare Rgs2 (A), aGSU (B) and Prop1 (C) expression domains. (A) Rgs2

(B) Expression of the differentiated cell marker aGSU is restricted to the antero-ve

of Rgs2 and the progenitor cell marker Prop1 is evident in the ventro-anterior

Orientation is indicated by the arrows in panel A. Abbreviations: Dor, dorsal; Po

Prop1 cells express Rgs2 (Fig. 3A,C). A notable exception

is the dorsal Prop1Cluminal lining cells, which clearly do

not express Rgs2. These data suggest that Rgs2 is most

active in cells at an early stage of differentiation and is

downregulated prior to the onset of hormone gene

expression.

To investigate the developmental regulation of Rgs2 in

the embryonic and post-natal pituitary, we examined its

expression in 10.5, 12.5, 14.5, 16.5 dpc embryos and in 3

day neonates. At 10.5 dpc, Rgs2 is expressed at low levels in

the infundibulum and no expression is evident in Rathke’s

Pouch (RP; Fig. 4A). By 12.5 dpc, Rgs2 expression

is activated in the presumptive anterior lobe, where it is

highest in the progenitor cells that occupy the ventral half of

the primordium (Fig. 4B). The aGSU-positive rostral tip

thyrotropes which first appear at this time are negative for

ed cells. In situ hybridisation of serial 14.5 dpc sagittal sections was used

expression is confined to the ventro-posterior quadrant of the pituitary.

ntral region, and does not overlap with Rgs2 expression. (C) Co-expression

domains and not in the dorsal Prop1-positive cells that line the lumen.

s, posterior; Ven, ventral; Ant, anterior.

Fig. 4. Rgs2 is developmentally regulated throughout pituitary development and downregulated after birth. Rgs2 expression in midsagittal sections of the

developing pituitary at 10.5 dpc (A), 12.5 dpc (B), 14.5 dpc (C), 16.5 dpc (D) and post-natal day 3 (P3, E). (A) Rgs2 is not detected in Rathke’s pouch, and is

present at low levels in the infundibulum. (B) Rgs2 expression is highest to the ventral cells of Rathke’s Pouch. (C) Rgs2 is expressed in the undifferentiated

cells of the ventro-posterior domain. (D) At 16.5, Rgs2 expression is restricted to two patches of periluminal cells (arrows), which may correspond to residual

progenitor cells. (E) No expression of Rgs2 is evident at P3, indicating that Rgs2 is downregulated after birth. Sections are orientated as described for Fig. 3.

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311308

Rgs2 expression (data not shown). Rgs2 expression

continues in the ventral most part of the presumptive

anterior pituitary gland at 14.5 dpc, and by 16.5 dpc is most

abundant in the periluminal cells of the ventral and medial

regions (Fig. 4C,D). Three days after birth (P3), the pituitary

is fully differentiated, and contains all of the hormone-

secreting lineages (Scully and Rosenfeld, 2002). At this

time-point, Rgs2 was not detected, indicating that the

activity of this gene is restricted to the cell specification and

differentiation phase of pituitary development (Fig. 4E).

1.3. Rgs2 is not required for pituitary cell differentiation

To explore the function of Rgs2 in pituitary develop-

ment, we examined gland morphology and hormone-

secreting lineage differentiation in Rgs2 null neonate

mice (Oliveira-Dos-Santos et al., 2000). Corticotropes,

somatotropes and gonadotropes/thyrotropes were identified

by expression of Pomc1, GH and aGSU, respectively. Cells

belonging to each of these lineages were present in the

mutant pituitaries, and no difference in their number or

position was apparent when compared to wildtype or

heterozygous littermates (Fig. 5 and data not shown).

Pituitary gland morphology was also normal in the Rgs2

mutants. These data indicate that Rgs2 is not absolutely

required for pituitary cell differentiation.

2. Discussion

Microarray analysis has proven to be a powerful method

for the identification of genes which regulate their

expression in response to changing physiological circum-

stances and developmental contexts (Luo et al., 2003;

Ramalho-Santos et al., 2002; Buttitta et al., 2003). We have

used this technology to screen for genes, which are

developmentally regulated in the embryonic pituitary, by

comparing the transcriptional profiles of 14.5 dpc pituitary

versus 14.5 dpc embryo minus pituitary. Rgs2 exhibited

the highest fold-difference in relative gene expression and

was 3.9 times more abundant in the Pit mRNA sample.

Using ISH analysis, we show for the first time that Rgs2

expression in midline tissues is restricted to the 14.5 dpc

ventral pituitary, and a few additional sites including the

CNS and fronto-nasal mass. These expression data indicate

that the 3.9-fold expression difference indicated by the array

is probably a reasonable estimate of the relative abundance

of Rgs2 transcripts in the Pit versus E-Pit samples. We

therefore conclude that the screening strategy that we have

used is a useful method for identifying novel developmen-

tally regulated genes in the pituitary, and could be readily

applied to other embryonic tissues.

Rgs2 has previously been implicated as having a role in

the deactivation of the Gq family members but has limited

Fig. 5. Rgs2 is not required for pituitary hormone cell differentiation. In situ hybridisation of wild-type (A, C and E) and Rgs2 null (B, D, and F) neonate

transverse sections did not reveal any difference in number or location of the somatotropes (A, B), thyrotropes/gonadotropes (C, D) or corticotropes (E, F).

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311 309

activity towards the other subunit family members

(Heximer et al., 1997a; Heximer et al., 1999). In vitro

studies also indicate that Rgs2 is able to regulate signaling

from different G protein Coupled Receptors in a variety of

cell types (Kehrl and Sinnarajah, 2002). Post-natally, Rgs2

is expressed in many tissues including the immune system,

brain and heart (Ingi and Aoki, 2002; Chen et al., 1997;

Heximer et al., 1997), suggesting that this gene may have a

functional role in multiple tissues. This is supported by the

phenotype of Rgs2 null mice, which exhibit impaired

function of hippocampal neurons, increased anxiety

responses, decreased aggression in males, impaired T-cell

function and hypertension (Olivera-dos-Santos et al., 2000;

Heximer et al., 2003; Tang et al., 2003). While these data

have established a role for Rgs2 in adult mice, little is

known about the possible developmental role of this gene.

We have shown that Rgs2 is expressed in the embryonic

pituitary gland and is downregulated post-natally,

suggesting that this gene may have a functional role in

pituitary organogenesis. Within the anterior pituitary

primordium, Rgs2 expression is restricted to a subset of

progenitor cells which appear, in some cases, not to express

Prop1, suggesting that they are at an early stage of

differentiation. These data suggest that in the pituitary,

Rgs2 may be involved in the regulation of signal

transduction pathways that modify progenitor cell behavior

in response to environmental cues. While is it not clear at

present which signal transduction pathways may be

regulated by Rgs2 in the pituitary, Xenopus microinjection

experiments performed by Wu et al. (2000) may provide a

clue. These authors showed that global overexpression of

RGS2 and rRgs4 in Xenopus results in marked inhibition of

trunk development, phenocopying the effects of dominant

negative Xwnt-8 or frzb microinjection. In addition, RGS4

was shown to block the ability of XWnt8 to induce axis

duplication and mesoderm ventralisation. These data

indicate that Rgs2/4 inhibit Wnt signaling, possibly by

promoting the GTPase activity of Gq proteins associated

with frizzled receptors. Interestingly, genes encoding Wnt

signaling components are expressed in the embryonic

pituitary, and functional studies in mice have demonstrated

the importance of this signaling pathway in pituitary

morphogenesis and differentiation of the hormone-secreting

lineages (Cha et al., 2004; Kioussi et al., 2002; Treier et al.,

1998). Taken together, these data suggest that Rgs2 may

play a role in developmental events that require Wnt

signaling in the pituitary.

To investigate the function of Rgs2 in the pituitary, we

analysed hormone cell differentiation in Rgs2 null neonates.

The somatotroph, gonadotroph, thyrotroph and corticotroph

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311310

lineages all appear to differentiate normally in the absence

of Rgs2, consistent with the normal growth and fertility of

these mutant mice (Olivera-dos-Santos et al., 2000). This

apparent lack of pituitary phenotype in the Rgs2 null mice

may be due to their genetic background, which has been

shown to modify the phenotypic penetrance of other

developmental genes (e.g. Dixon and Dixon, 2004). Another

possibility is that Rgs2 shares functional redundancy with

other RGS family members that are expressed in the

embryonic pituitary. To date, Rgs2 is the only RGS gene

that has been shown to be expressed in the pituitary.

However, many Rgs family members are expressed in the

adult mouse pituitary (Chen et al., 1997), including Rgs16

which has been identified in a 14.5 dpc pituitary library

(http://www.ncbi.nlm.nih.gov/UniGene/). Full understand-

ing of the developmental role of Rgs2 in the murine pituitary

will therefore require gain-of-function studies, including

ectopic and overexpression analysis in transgenic animals.

3. Experimental procedures

3.1. Mouse embryo dissection

Pituitary glands were dissected from 139 HSDola-Swiss

14.5 dpc mouse embryos, generated from the breeding

colony at Melbourne University, Australia. The embryo

minus pituitary RNA was prepared from a single 14.5 dpc

embryo from which the pituitary gland was removed. All

tissue samples were dissected under a microscope and were

processed immediately.

3.2. RNA isolation and RT-PCR

Total RNA was isolated from dissected tissues using a

Qiagen RNeasy Kit. RNA was quantified by A260/A280

absorbance ratios. Approximately 30 mg of total RNA was

isolated from the 139 embryos dissected, and the one whole

embryo minus the pituitary gland. The integrity of RNA

samples including the 18S and 28S ribosomal RNA

bands were assessed by agarose gel electrophoresis. RT-

PCR analysis was performed using Epicenter buffers and

the following primer sequences: Prop1 5 0gagctggggaga-

cctaagctttgcc, 5 0gctgggtgcaaggtggggtacca; Hesx1 5 0tttca-

gcctccgaaacacgctct, 5 0ctctgatgtcaatgccagggtagca; GAPDH

5 0acccagaagactgtggatgg, 5 0cttgctcagtgtccttgctg.

3.3. Probe preparation and microarray hybridisation

7.5 mg of total RNA was reverse-transcribed using

Superscript (( RT kit (Gibco-BRL, USA) and AncT primer

as instructed by the manufacturer. Indirect labeling of the

cDNA was performed by adding amine-modified amino

allyl dNTPs (dUTP containing allyl link; Sigma) during the

reverse transcription reaction. RNA was hydrolysed with

0.25 M NaOH (BDH) and 0.5 M EDTA at 65 8C for 15 min

followed by the addition of 0.2 M acetic acid (BDH) to stop

the hydrolysis. The cDNA was then purified using a

MiniElute column (Qiagen) according to manufacturer’s

directions and coupled to Cy3 or Cy5 reactive dye

(Amersham, UK) resuspended in 0.1 M sodium bicarbonate

buffer pH.9 (BDH) by incubation for 1 h in the dark. The

coupled cDNA samples were then purified on MiniElute

columns (Qiagen) and combined with 4 mg/ml tRNA

(Sigma), 10 mg/ml Cot-1 DNA (Invitrogen) and 8 mg/ml

Poly dA oligonucleotide (Geneworks, Australia). The

labeled probe was combined with 5! SSC, 50% deionised

formamide (Merck), 1.25% SDS and denatured at 95 8C for

5 min. The probe was then incubated for a further 30 min at

45 8C and put on ice for 30 s. The microarray slides were

pre-heated on a heat block for 2 min and placed back-to-

back. The labeled probe mix was then added to the edge of

the microarray slides, allowed to diffuse into the slides

and incubated at 42 8C for 16 h in a humidified chamber.

Post-hybridisation, slides were washed for 1 min in

0.5! SSC/0.01% SDS, 3 min in 0.5! SSC and 3 min in

0.06! SSC before being rinsed in sterilised water and spin

dried at 800 rpm in a 5810 R centrifuge (Eppendorf,

Germany) and scanned immediately. The experiment used

four microarrays in two dye-swap pairs. Since the slides

were printed in duplicate, each clone was represented eight

times in the analysis.

3.4. Data analysis

The microarrays were scanned with a GenePix 4000B

microarray scanner (Axon Instruments, Amersham Pharma-

cia Biotech) and the data analysed using the ‘R’ program, a

language and environment for statistical computing and

graphics, developed by John Chambers et al. at Bell

Laboratories (University of Toronto). The information

generated from the ‘R’ program analyses included the fold

change (M-value), the ordinary t-statistic, the moderated

t-statistic and the B-statistic for each gene. The data

generated was normalised using print-tip loess normal-

isation using the LIMMA package (Smyth, 2003). Print-tip

loess normalisation, normalises each M-value by subtract-

ing from it the corresponding value of the tip group loess

curve. This method corrects the M-values for both sub-array

spatial variation and for intensity-based trends. Between

arrays normalisation is a simple scaling of the M-values

from a series of arrays so that each array has the same

median absolute deviation (Smyth, 2003).

3.5. In situ hybridisation

Mouse embryos were fixed for 18 h at 4 8C in

paraformaldehyde (4% (w/v) in PBS) and then placed in

sucrose (20% (w/v) in PBS) until they sank. After

embedding in OCT (TissueTek), 16-mm cryostat frozen

sections were prepared and mounted onto Superfrost-Plus

slides. Gene expression was detected by hybridising

L.D. Wilson et al. / Gene Expression Patterns 5 (2005) 305–311 311

digoxigenin-labeled antisense riboprobes as described

previously (Dunwoodie et al., 1997). The Rgs2 riboprobe

spans nucleotides 1–1627 bp (Accession No. NM_009061),

and all other probes were described previously (Raetzmann

et al., 2004).

3.6. Rgs2 mutant analysis

Rgs2 null mice were genotyped as described previously

(Oliveira-Dos-Santos et al., 2000) and were maintained on a

C57BL/6J genetic background. A total of six null neonates

were sectioned and examined by in situ analysis.

Acknowledgements

We thank Ms Kelly Roeszler for technical assistance, and

Dr Katrina Bell and Mr Michael Hildebrand for assistance

with the microarray experiments. P.T. is an Australian

National Health and Medical Research Council R.D. Wright

Fellow.

References

Bourne, H.R., Sanders, D.A., McCormick, F., 1990. The GTPase

superfamily: a conserved switch for diverse cell functions. Nature

348, 125–132.

Buttitta, L., Tanaka, T.S., Chan, A.E., Ko, M.S.H., Fan, C.M., 2003.

Microarray analysis of somitogenesis reveals novel targets of different

WNT signaling pathways in the somitic mesoderm. Dev. Biol. 258,

91–104.

Cha, K.B., Douglas, K.R., Potok, M.A., Liang, H., Jones, S.N.,

Camper, S.A., 2004. WNT5A signaling affects pituitary gland shape.

Mech. Dev. 121, 183–194.

Chen, C., Zheng, B., Han, J., Lin, S.-C., 1997. Characterization of a novel

mammalian RGS protein that binds to Ga proteins and inhibits

pheromone signaling in yeast. J. Biol. Chem. 272, 8679–8685.

Dattani, M.T., Robinson, I.C.A.F., 2000. The molecular basis for

developmental disorders of the pituitary gland in man. Clin. Genet.

57, 337–346.

Dixon, J., Dixon, M.J., 2004. Genetic background has a major effect on the

penetrance and severity of craniofacial defects in mice heterozygous

for the gene encoding the nucleolar protein Treacle. Dev. Dyn. 229,

907–914.

Druey, K.M., Blumer, K.J., Kang, V.H., Kehrl, J.H., 1996. Inhibition of a G

protein-mediated MAP kinase activation by a new mammalian gene

family. Nature 379, 742–746.

Dunwoodie, S.L., Henrique, D., Harrison, S.M., Beddington, R.S., 1997.

Mouse Dll3: a novel divergent Delta gene which may complement the

function of other Delta homologues during early pattern formation in

the mouse embryo. Development 124, 3065–3076.

Ericson, J., Norlin, S., Jessell, T.M., Edlund, T., 1998. Intergrated FGF and

BMP signaling controls the progression of progenitor cell differen-

tiation and the emergence of pattern in the embryonic anterior pituitary.

Development 125, 1005–1015.

Hamm, H.E., Gilchrist, A., 1996. Heterotrimeric G proteins. Curr. Opin.

Cell Biol. 8, 189–196.

Heximer, S.P., Watson, N., Linder, M.E., Blumer, K.J., Hepler, J.R., 1997a.

RGS2/GOS8 is a selective inhibitor of Gqa function. PNAS 94,

14389–14393.

Heximer, S.P., Cristillo, A.D., Forsdyke, D.R., 1997b. mRNA expression of

two regulators of G-protein signaling, RGS1/BL34/1R20 and

RGS2/G0S8, in cultured human blood mononuclear cells. DNA Cell

Biol. 16, 589–598.

Heximer, S.P., Srinivasa, S.P., Bernstein, L.S., Bernard, J.L., Linder, M.E.,

Hepler, J.R., Blumer, K.J., 1999. G protein selectivity is a determinant

of RGS2 function. J. Biol. Chem. 274, 34253–34259.

Heximer, S.P., Knutsen, R.H., Sun, X., Kaltenbronn, K.M., Rhee, M.H.,

Peng, N., et al., 2003. Hypertension and prolonged vasoconstrictor

signaling in RGS2-deficient mice. J. Clin. Invest. 111, 445–452.

Hunt, T.W., Fields, T.A., Casey, P.J., Peralta, E.G., 1996. RGS10 is a

selective activator of Gxi GTPase activity. Nature 383, 175–177.

Ingi, T., Aoki, Y., 2002. Expression of RGS2, RGS4 AND RGS7 in the

developing postnatal brain. Eur. J. Neurosci. 15, 929–936.

Kargul, G.J., Dudekula, D.B., Qian, Y., Lim, M.K., Jardat, S.A.,

Tanaka, T.S., et al., 2001. Verification and initial annotation of the

NIA mouse 15K cDNA clone set. Nat. Genet. 27, 17–18.

Kehrl, J.H., Sinnarajah, S., 2002. RGS2: a multifunctional regulator of G-

protein signaling. Int. J. Biochem. Cell. Biol. 34, 432–438.

Kioussi, C., Briata, P., Baek, S.H., Rose, D.W., Hamblet, N.S., Herman, T.,

et al., 2002. Identification of a Wnt/Dvl/beta-Catenin/Pitx2 pathway

mediating cell-type-specific proliferation during development. Cell

111, 673–685.

Luo, J., Isaacs, W.B., Trent, J.M., Duggan, D.J., 2003. Looking beyond

morphology: cancer gene expression profiling using DNA microarrays.

Cancer Invest. 21, 937–949.

Neer, E.J., 1995. Heterotrimeric G proteins: organizers of transmembrane

signals. Cell 80, 249–257.

Oliveira-Dos-Santos, A.J., Matsumoto, G., Snow, B.E., Bai, D.,

Houston, F.P., Whishaw, I.Q., et al., 2000. Regulation of T cell

activation, anxiety, and male aggression by RGS2. Proc. Natl Acad. Sci.

USA 97, 12272–12277.

Raetzman, L.T., Ross, S.A., Cook, S., Dunwoodie, S.L., Camper, S.A.,

Thomas, P.Q., 2004. Developmental regulation of notch signaling

genes in the embryonic pituitary: Prop1 deficiency affects Notch2

expression. Dev. Biol. 265, 329–340.

Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R.C.,

Melton, D.A., 2002. Science 298, 597–600.

Scully, K.M., Rosenfeld, M.G., 2002. Pituitary development: regulatory

codes in mammalian organogenesis. Science 295, 2231–2235.

Smyth, G.K. (2003) LIMMA User’s Guide. Software manual available

from http://www.bioconductor.org

Tanaka, T.S., Saied, A.J., Lim, M.K., Kargul, G.J., Wang, X.,

Grahovac, M.J., et al., 2000. Genome-wide expression profiling of

mid-gestation placenta and embryo using a 15,000 mouse develop-

mental cDNA microarray. PNAS 97, 9127–9132.

Tang, M.K., Wang, G.R., Lu, P., Karas, R.H., Aronovitz, M.,

Heximer, S.P., et al., 2003. Regulator of G-protein signaling-2 mediates

vascular smooth muscle relaxation and blood pressure. Nat. Med. 9,

1506–1512.

Treier, M., Gleiberman, A.S., O’Connell, S.M., Szeto, D.P.,

McMahon, J.A., McMahon, A.P., Rosenfeld, M.G., 1998. Multistep

signaling requirements for pituitary organogenesis in vivo. Genes Dev.

12, 1691–1704.

Watson, N., Linder, M.E., Druey, K.M., Kehrl, J.H., Blumer, K.J., 1996.

RGS family members: GTPase activating proteins for a subunits of

heterotrimeric G proteins. Nature 382, 172–175.

Wu, C., Zeng, Q., Blumer, K.J., Muslin, A.J., 2000. RGS proteins inhibit

Xwnt-8 signaling in Xenopus embryonic development. Development

127, 2773–2784.