PAPER

TOXICOLOGY; PATHOLOGY/BIOLOGY

Laura N. Riccardi,1 Ph.D.; Rossana Lanzellotto,1 M.Sc.; Mirella Falconi,2 M.D.;Stefania Ceccardi,1 Ph.D.; Carla Bini,1 Ph.D.; and Susi Pelotti,1 M.D.

Development of a Tetraplex PCR Assay forCYP2D6 Genotyping in Degraded DNASamples

ABSTRACT: CYP2D6 polymorphism analysis is gaining increasing interest in forensic pharmacogenetics. Nevertheless, DNA recoveredfrom forensic samples could be of poor quality and not suitable for long polymerase chain reaction required to type CYP2D6 gene prior toSNaPshot minisequencing analysis performed to define alleles with different enzymatic activity. We developed and validated following theguidelines of the Scientific Working Group on DNA Analysis Methods a tetraplex PCR yielding four amplicons of 597, 803, 1142, and1659 bp encompassing the entire CYP2D6 gene to analyze eleven SNP positions by SNaPshot minisequencing. Concordance, sensitivity, andspecificity were assessed. The method, applied to thirty-two forensic samples failed to amplify with long PCR, allowed the amplification ofCYP2D6 gene in 62.5% of degraded samples. The new tetraplex PCR appears a suitable method for CYP2D6 analysis in forensic pharmacoge-netics.

KEYWORDS: forensic science, forensic pharmacogenetics, CYP2D6 polymorphism, single nucleotide polymorphism analysis, multiplexpolymerase chain reaction, internal validation

Pharmacogenetics provides predictive tools for preventingadverse drug reactions (ADRs) in clinical setting and postmor-tem pharmacogenetics could help forensic pathologists in eluci-dating the cause and manner of death in forensic investigationswhen not resolved by common autopsy practices (1,2).In pharmacogenetics studies, the central role of the cyto-

chrome P450 (CYP) superfamily in the metabolism of a vastarray of compounds including therapeutic drugs, drugs of abuse,toxins, and endogenous molecules has prompted searches forpolymorphisms in the main human P450 subfamilies. Within theCYP2D subfamily, the debrisoquine hydroxylase (CYP2D6) isthe most polymorphic CYP enzyme involved in the oxidation ofapproximately 20–25% of commonly used clinical drugs (3,4)encoded by the 4.3 kb gene located on chromosome 22q13.1.CYP2D6 genetic polymorphism accounts for a great number ofextensively studied variants associated with normal, increased,decreased, or absent enzyme activity. In addition, CYP2D6 geneis affected by major rearrangements including deletion, duplica-tion, and multiduplication also responsible for enzyme activityvariations (5).Different CYP2D6 genotypes result in four phenotypes,

namely extensive metabolizer (EM) with two functional alleles,poor metabolizer (PM) with two defective alleles, intermediatemetabolizer (IM) with one defective allele or two defective

alleles, and ultrarapid metabolizer (UM) bearing more than twoactive alleles (6).Nevertheless, the process of translating genotype into pheno-

type has not been standardized and to improve phenotype predic-tion the Activity Score (AS) system was proposed as aqualitative assessment of CYP2D6 phenotype (7).The geographic distribution of the highly represented alleles

(*2, *4, *10, *17, *29, *39, and *41), rare alleles (*3, *6 and*9) as well as whole gene deletion (*5) and duplication has beeninvestigated, showing that the frequency of PM phenotype is inup to 10% of Caucasians, while UM phenotype is frequentin Africa and Oceania and IM phenotype is mostly representedin East Asia, Africa, and Middle East (8,9).In the medicolegal field, CYP2D6 polymorphism may provide

informations in drug-related deaths where the interpretation ofthe toxicological results is not clear (1,10,11).Furthermore, CYP2D6 genotyping was analyzed in MDMA

(12), designer drug (13) (14), and codeine metabolism (15–17).In addition, in suicide cases or suicide attempters, a higher

frequency of individuals with multiduplication of CYP2D6 activegenes was reported (18,19), and even if the explanation for thisrelationship cannot yet be provided, insufficient drug efficacy ofantidepressant drugs or implication of CYP2D6 in endogenouscerebral neurotransmitters metabolism was hypothesized (20).In analyzing CYP2D6 polymorphism, a long polymerase chain

reaction (long PCR) is generally required to amplify the entiregene and avoid the interfering co-amplification of two highlyhomologous inactive pseudogenes, CYP2D7, and CYP2D8 (21).Actually, CYP2D6 polymorphism analysis methods, including

allele-specific PCR (22), single-strand conformation polymor-phism (SSCP) (23), restriction fragment length polymorphism

1Department of Medical and Surgical Sciences, Institute of Legal Medi-cine, University of Bologna, via Irnerio, 49, 40126 Bologna, Italy.

2Department of Biomedical and NeuroMotor Sciences, Unit of HumanAnatomy, University of Bologna, via Irnerio, 49, 40126 Bologna, Italy.

Received 20 July 2012; and in revised form 28 Jan. 2013; accepted 9 Feb.2013.

690 © 2013 American Academy of Forensic Sciences

J Forensic Sci, May 2014, Vol. 59, No. 3doi: 10.1111/1556-4029.12358

Available online at: onlinelibrary.wiley.com

(RFLP) (24), multiplexed amplification refractory mutation sys-tem (ARMS) (25), real-time PCR (26,27), SNaPshot minise-quencing (28), liquid chromatography electrospray ionizationmass spectrometry (29), and the high-resolution melting curve(HRM) technique (30), require the pre-amplification of a frag-ment ranging from 4.4 to 5.1 kb. Sequence analysis methodinvolves the amplification of a 9-kb fragment (31). The micro-array AmpliChip CYP450 test (Roche Molecular Diagnostics,Pleasanton, CA) requires the pre-amplification of two shorterfragments of 2.8 and 3.1 kb (32).In addition, to establish CYP2D6 phenotype testing gene dele-

tion an additional long PCR yielding a specific product of3.5 kb, together with the internal control fragment of 3.0 kb, isrequired (33). Similarly, the gene duplication is detected by a3.2-kb fragment and a 3.8-kb control fragment (34), even if theassay cannot reveal the exact copy number of the gene and othermethods based on quantitative real-time PCR have been devel-oped for this purpose (35,36).Instead, analysis methods using short DNA targets are based

on high-throughput technologies, such as pyrosequencing(37,38) and matrix-assisted laser desorption/ionization time-of-flight mass spectometry (MALDI-TOF MS) (39), but the spe-cial laboratory facilities needed (28) are not always available inforensic laboratories for the application in casework.In forensic pharmacogenetics, SNaPshot minisequencing is a

suitable method for CYP2D6 genotyping. It permits to identify,analyzing eleven SNP positions distributed along the entire gene,the specific SNP patterns corresponding to the most representedalleles (28), but the method requires the amplification of theentire CYP2D6 gene by long PCR before the minisequencing.Consequently, despite the promises of pharmacogenetics appli-

cations in the medicolegal context, in forensic laboratories,CYP2D6 genotyping is affected by the possible degradation ofDNA samples conditioning the results of long PCR and by theavailability of high-throughput technologies working with shortPCR fragments.It is well known that the template integrity is essential for the

reliable amplification of long PCR targets (40), and usuallywhole blood is used as starting material for genomic DNAextraction prior to CYP2D6 analysis. Even if 1 mL saliva sam-ples have been used successfully (26), DNA recovered from buc-cal cells collected by brushing or swabbing was considered notsuitable for generating a long PCR product (25,41). However,blood sampling may represent a barrier for recruiting a sufficientnumber of participants into genetic studies primarily in pediatricresearch (42) and requires particular storage conditions. Nonin-vasive sampling is often preferred especially on geographically

isolated groups where buccal swabs can be collected even undersuboptimal conditions and stored at room temperature for a vari-able period of time.Nevertheless, the quality of the DNA recovered from autopsy

samples depends on the variations in the time elapsed betweenthe occurrence of death and the collection of samples as well ason the degree of decomposition (18).Moreover, CYP2D6 genotyping is prone to failure in degraded

DNA derived from paraffin-embedded tissues that could be theonly available source in forensic cases or for retrospective stud-ies in the clinical pharmacogenetics field (39).To analyze CYP2D6 polymorphism also in degraded DNA

samples failed to amplify using long PCR, we designed a tetra-plex PCR assay generating four shorter fragments to be used astemplate for the analysis by minisequencing, containing the ele-ven SNP positions which define the most relevant alleles. Inter-nal validation of tetraplex PCR and applications on degradedforensic samples are reported.

Materials and Methods

Sample Collection and DNA Extraction

Fifty-three whole blood samples from unrelated individuals,previously typed for CYP2D6 gene, and thirty-two degradedforensic samples from a variety of sources, failed to amplifywith long PCR, were included in this study. The degraded sam-ples were assessed on 1% electrophoresis gels and were deter-mined to be a mixture of molecular weights as noted by thesmear pattern observed on the gel. The forensic samplesemployed were 8 postmortem saliva, 8 blood and 5 spleen sam-ples, 10 buccal swabs from a population study, and 1 paraffin-embedded tissue.Whole blood samples were extracted using the EUROGOLD

Blood DNA Mini Kit (Euroclone, Pero, Milan, Italy), and theQIAamp DNA Micro Kit (Qiagen, Hilden, Germany) wasemployed for forensic samples. DNA concentration was assessedwith a NanoDrop 2000c Spectrophotometer (Thermo Scientific,Wilmington, DE).

Primer Design

The tetraplex PCR assay generates four CYP2D6-specificproducts of 597, 803, 1142, and 1659 bp, respectively, using aCYP2D6-R primer previously designed by Lundqvist et al. (43)and seven newly designed primers listed in Table 1. The newprimers were designed using conventional standard criteria and

TABLE 1––Amplification primers used in the new tetraplex PCR and SNPs polymorphism in each fragment with related CYP2D6 alleles.

PCRFragments Sequence 5′-3′ Reference Length

Concentrationin the Tetraplex

PCR, lMAmpliconLength SNPs and Related Alleles

1 2D6-1F CCATTTGGTAGTGAGGCAGGT New design 21 0,6 1142 bp 100C>T1023C>T

*4, *10*172D6-1R GCTCGGACTACGGTCATCAC New design 20 0,6

2 2D6-2F CAAGGGAGCAAGGTGGATGCA New design 21 0,1 597 bp 1661G>C1707delT1846G>A

*2, *4, *10, *17, *29, *39, *41*6*4

2D6-2R CTCGCCCTGCAGAGACTCCT New design 20 0,1

3 2D6-3F CTGTACCTCCTATCCACGTCA New design 21 0,2 803 bp 2549delA2615delA2850C>T2988G>A

*3*9*2, *17, *29, *41*41

2D6-3R CCGGGTGTCCCAGCAAAGTT New design 20 0,2

4 2D6-4F CAAGAAGGAGTGTCAGGGCC New design 20 0,6 1659 bp 3183G>A4180G>C

*29*2, *4, *10, *17, *29, *39, *412D6-4R ACTGAGCCCTGGGAGGTAGGTA Lundqvist

et al. 4322 0,6

RICCARDI ET AL. . CYP2D6 GENOTYPING 691

the ClustalW (44) sequence alignment of CYP2D6 (GenBankaccession no. M33388), CYP2D7, and CYP2D8 (GenBank acces-sion no. M33387) to find CYP2D6-specific sites for primer posi-tioning.The oligonucleotide properties (melting temperature, GC con-

tent, potential hairpins, and self-annealing sites) were estimatedusing the oligonucleotide properties calculator Oligo Calc ver-sion 3.26 (45), whereas to check specificity, BLAST (46) andIn-Silico PCR (47) were used. Finally, potential primer–primerinteractions and hairpin formation were tested using AutodimerSoftware (48).

PCR Parameters

Initially, primer pairs were tested by singleplex reactions car-ried out using a basic protocol: 1 9 PCR Gold Buffer,0.2 mM each dNTPs, 2 mM MgCl2 solution, 1 U AmpliTaqGold� DNA polymerase, 0.4 lM of each primer, and theannealing temperature adjusted according to the oligonucleotideproperties.Tetraplex PCR was optimized following the step by step pro-

tocol proposed by Henegariu et al. (49), and the optimal anneal-ing temperature yielding a balance of specific products was58°C. The extension time was increased from 2 to 4 min at72°C to allow the complete synthesis of all the products.PCR components were adjusted lowering the PCR buffer to

0.9 9 to improve longer product amplification, DNA polymer-ase was increased to 2 U, and dNTP concentration was increasedstepwise from 0.2 mM to an optimum of 0.4 mM. Equimolarprimer concentrations of 0.4 lM were first used and conse-quently modified to obtain the correct balance between theamplicons to avoid the preferential amplification of short frag-ments.Tetraplex PCR was performed in a 25-lL reaction volume

containing 0.9 9 Gold Buffer; 0.4 mM each deoxynucleotidetriphosphate (dNTP); 2 mM MgCl2; 2 U Taq Gold polymerase;0.6 lM each of primer pairs 2D6-1F, 2D6-1R, 2D6-4F, and2D6-4R; 0.2 lM each of 2D6-3F and 2D6-3R together with0.1 lM each of 2D6-2F and 2D6-2R. The PCR cycling condi-tions were 95°C for 7 min, 35 cycles at 95°C for 30 s, 58°C for30 s and 72°C for 4 min, and a final extension at 72°C for5 min using a GeneAmp� 9700 thermal cycler (Life Technolo-gies, Carlsbad, CA). The PCR products were resolved on 2%agarose gel stained with GelRed (Biotium Inc, Hayward, CA).The assays included a positive control of high-quality DNA toverify the success of PCR.

Specificity

Specificity was investigated by sequencing each PCR productwith both forward and reverse primers using BigDye� Termina-tor v1.1 cycle sequencing kit (Life Technologies) according tothe manufacturer’s instructions on an ABI Prism 310 GeneticAnalyzer (Life Technologies).

Sensitivity

Different quantities (250, 200, 150, 100, 50, 25, and 12.5 ng)of a high-quality genomic DNA were quantified using a Nano-drop 2000c Spectrophotometer (Thermo Scientific) and amplifiedto establish tetraplex PCR sensitivity comparing it to that of longPCR, carried out as previously described (28) with slight modifi-cations (50).

SNPs Analysis

CYP2D6 SNP analysis was performed by minisequencing withthe SNaPshot Multiplex System (Life Technologies), at anneal-ing temperature of 50°C following manufacturer’s recommenda-tions, detecting 11 relevant SNP positions (100, 1023, 1661,1707, 1846, 2549, 2615, 2850, 2988, 3183, and 4180) for theidentification of highly represented, reduced, or null functionalleles in human populations as designed by Sistonen et al. (28).

Internal Validation

To verify concordance between the two methods, according tothe guidelines of the Scientific Working Group on DNA Analy-sis Methods (SWGDAM), the internal validation of the tetraplexPCR assay included fifty-three high molecular weight genomicDNA samples from whole blood previously typed by the longPCR protocol (28) with genotypes corresponding to the fourCYP2D6 phenotype classes.

Results

The tetraplex PCR yielded four CYP2D6-specific fragments of597, 803, 1142, and 1659 bp, as confirmed by the sequencingand shown in Fig. 1. Results obtained from 53 high molecularweight genomic DNA samples and from 32 degraded DNA sam-ples are summarized in Table 2. The 100% concordance ofresults was observed for the fifty-three high-quality DNA sam-ples.The four specific PCR products were obtained at all input

DNA dilutions and up to the lowest 12.5 ng concentration pro-duced in the following minisequencing reaction SNP peaks over400 relative fluorescent units (RFU). The same DNA concentra-tion tested with the long PCR protocol produced lower peakintensities.

Discussion

In “molecular autopsy” CYP2D6 genotyping can be used fordetermining cause and manner of death when common autopsypractices fail (51), especially in fatal drug intoxications(16,52,53). SNaPshot minisequencing, widely used in forensicgenetics, is a suitable method for the identification of the SNPpatterns associated with CYP2D6 alleles, but required the pre-amplification of a 5.1 kb amplicon (28), not always successfulin forensic applications.Indeed, DNA recovered from autopsy samples as well as from

paraffin-embedded tissues or from buccal swabs collected forpopulation studies under suboptimal conditions could be of poorquality and prone to amplification failure.As the amplification of shorter DNA fragments is more likely

to be successful in forensic applications of minisequencinganalysis on degraded DNA samples, we developed a new tetra-plex PCR to amplify the entire CYP2D6 gene when long PCRfails to work.The selection of amplicons of 597, 803, 1142, and 1659 bp,

even if still quite long, but containing the eleven SNPs usefulfor allele assignment, derived from a forced compromisebetween the choice of primer sequences avoiding secondarystructures and the specificity of their position in CYP2D6sequence, according to sequence alignment with CYP2D7 andCYP2D8 pseudogenes. The specificity of the tetraplex PCR frag-ments for CYP2D6 gene was then verify by sequencing of the

692 JOURNAL OF FORENSIC SCIENCES

amplicons that showed more than one mismatches with CYP2D7and CYP2D8 pseudogenes sequences.In our study, the results of tetraplex PCR on fifty-three high

molecular weight genomic DNA samples showed 100% concor-dance with those previously analyzed with the long PCR proto-col, displaying the reliability of our method.Furthermore, the sensitivity of the tetraplex PCR method per-

mitted to obtain in the following SNaPshot reaction unambigu-ous electropherograms compared with those derived from thelong PCR method, producing at low DNA concentration lowerpeak intensities prone to misinterpretation when close to back-ground noise.The reduced size amplicons allowed the recovery of CYP2D6

SNP pattern information from most of the analyzed degradedDNA samples (62.5%), but six samples were still not amplifiableand six samples lacked the longer molecular size fragment(1659 bp) likely due to a higher level of degradation.

However, the most studied alleles in pharmacogeneticsresearch are identified by the patterns defined by SNPs in theshorter three amplicons of the tetraplex PCR (see Table 1).Indeed, samples lacking the longer fragment missed only SNP

positions 3183 and 4180 consequently the SNP pattern did notallow the identification of the *29 and the *39 alleles, respec-tively.Nevertheless, considering that the full functional *2 allele dif-

fers from the reduced function *29 allele only for SNP 3183 andconsidering that CYP2D6*29 allele is predominantly restricted toAfrican populations, reaching frequency of 6.7% in sub-SaharanAfrica and only a minor frequency of 1% in the entire Centred’Etude du Polymorphisme Humain (CEPH) panel (8), theknowledge of the ethnic origin of the sample could be useful forthe result interpretation about the enzyme activity level.Similarly, the lack of SNP 4180 does not allow the discrimi-

nation between the two full functional *39 allele and the *1661

CYP2D6 CGGCGCCAACGCTGGGCTGC-ACGCTACCCACCAGGCCCCCTGCYP2D7 CGGCACCAACGCTGGGCTGC-ACGCTACCCGCCAGGTCCCCTGCYP2D8 CAGGCGAGGTGGTGGGCACCTGTAGTCCCAGCTACTTGGGAGG

Fragment 1 Fragment 2

CYP2D6 TGGGTGGTGGATGGTGGGGCTAATGCCCYP2D7 TGGGTGGCGGAGGGTGGGGCCAAGGCCCYP2D8 TGGGCGGCGGAGGGCGGGGCCAAGGCC

Fragment 3

CYP2D6 CCCTGGGTCTACC-TGGAGATGGCTGGGGCCTGAGACTTGTCCACYP2D7 CCCTGGGTCTTCC-TGGAGATGGCTGGGGCCTGAGACTGGTCCACYP2D8 CCCTGGGTCTTCCCTGGAGGCAGCTGGGGCCTGAGACTGGTCCA

Fragment 4

CYP2D6 CAATGCCACCACACTGACTGTCCCCACTTGGGTCYP2D7 CAATGCCACCACACTGACTGTCCCCGCTTGGATCYP2D8 CAATGCCACCACATCGACTGTCCCAGCCTGGGT

FIG. 1––Partial electropherograms of tetraplex PCR fragments. Bold capital letters indicate mismatches between the CYP2D6 sequence and CYP2D7/CYP2D8 pseudogenes sequences.

TABLE 2––Success rates for CYP2D6 amplicons generated by long PCR and tetraplex PCR.

Blood Samples(N = 53)

Buccal SwabSamples (N = 10)

CadavericBlood Samples

(N = 8)

PostmortemSaliva

Samples (N = 8)

Paraffin-EmbeddedTissue Samples

(N = 1)

CadavericSpleen Samples

(N = 5)

Samples successfully analyzed with bothlong and tetraplex PCR

100% 0 0 0 0 0

Samples failed to amplify by long PCR butsuccessfully analyzed by tetraplex PCR

0 100% 37.5% (3/8) 37.5% (3/8) 100% 60.0% (3/5)

Samples failed to amplify for the longerfragment (1659 bp) by tetraplex PCR

0 0 25.0% (2/8) 25.0% (2/8) 0 40.0% (2/5)

Samples failed to amplify with both longand tetraplex PCR

0 0 37.5% (3/8) 37.5% (3/8) 0 0

Samples successfully analyzed by long PCRbut failed to amplify by tetraplex PCR

0 0 0 0 0 0

RICCARDI ET AL. . CYP2D6 GENOTYPING 693

allele, the latter showing a frequency of 15% in populations ofPapua New Guinea (54) and <1% in the CEPH panel.It should be considered that tetraplex PCR does not screen the

major rearrangements of the CYP2D6 gene, that is, deletion orduplication and the two additional long PCRs usually performedto verify gene deletion in homozygous samples and gene dupli-cation or multiduplication, even if do not define the exact genecopy number, could potentially fail for degraded DNA samples.Nevertheless, the evaluation of the minisequencing electrophero-gram can only provide ex post information to determine whichallele is actually duplicated.Certainly, the limitation of the tetraplex assay affects the iden-

tification of CYP2D6 ultrarapid metabolizer individuals carryinggene duplication and producing, when treated with opioid anal-gesics such as codeine, 50% up to 75% more morphine thanextensive metabolizers (55). Actually, unexpected death occurredin infants breastfed by mothers who were taking codeine(53,56,57) or in children prescribed codeine to relief postopera-tive pain (58,59) led to warnings issued by the US Food andDrug Administration (60).To overcome this problem and to resolve CYP2D6 rearrange-

ments, an alternative and rapid method that could be used com-bined with the tetraplex PCR assay has been proposed by Bodinet al. (36) who developed a real-time duplex PCR, using Taq-Man MGB probes, co-amplifying the CYP2D6 gene with theRNase P referent gene. Size of PCR product for CYP2D6 is of78 bp, suitable also for degraded DNA samples to correctlyassign the genotype and consequently the enzyme activity level.In conclusion, the new tetraplex PCR, validated following the

guidelines of SWGDAM, has proven effective in degraded DNAsamples. An increased amplification success rate and signal/noisediscrimination in minisequencing analysis, specificity and sensi-tivity make the tetraplex PCR a suitable method, combined withreal-time duplex PCR, for CYP2D6 genotyping and phenotypeassignments in forensic pharmacogenetics.

References

1. Sajantila A, Palo JU, Ojanper€a I, Davis C, Budowle B. Pharmacogeneticsin medico-legal context. Forensic Sci Int 2010;203(1–3):44–52.

2. Madea B, Saukko P, Oliva A, Musshoff F. Molecular pathology in foren-sic medicine–Introduction. Forensic Sci Int 2010;203(1–3):3–14.

3. Eichelbaum M, Ingelman-Sundberg M, Evans WE. Pharmacogenomicsand individualized drug therapy. Annu Rev Med 2006;57:119–37.

4. Ingelman-Sundberg M. Genetic polymorphisms of cytochrome P4502D6(CYP2D6): Clinical consequences, evolutionary aspects and functionaldiversity. Pharmacogenomics J 2005;5(1):6–13.

5. http://www.imm.ki.se/cypalleles/cyp2d6.htm (accessed July 18, 2012).6. Teh LK, Bertilsson L. Pharmacogenomics of CYP2D6: molecular genet-

ics, interethnic differences and clinical importance. Drug Metab Pharma-cokinet 2012;27(1):55–67.

7. Gaedigk A, Simon SD, Pearce RE, Bradford LD, Kennedy MJ, LeederJS. The CYP2D6 activity score: translating genotype information into aqualitative measure of phenotype. Clin Pharmacol Ther 2008;83(2):234–42.

8. Sistonen J, Sajantila A, Lao O, Corander J, Barbujani G, Fuselli S.CYP2D6 worldwide genetic variation shows high frequency of alteredactivity variants and no continental structure. Pharmacogenet Genomics2007;17(2):93–101.

9. Daly AK, Brockm€oller J, Broly F, Eichelbaum M, Evans WE, GonzalezFJ, et al. Nomenclature for human CYP2D6 alleles. Pharmacogenetics1996;6(3):193–201.

10. Koski A, Sistonen J, Ojanper€a I, Gergov M, Vuori E, Sajantila A.CYP2D6 and CYP2C19 genotypes and amitriptyline metabolite ratios ina series of medicolegal autopsies. Forensic Sci Int 2006;158(2–3):177–83.

11. Levo A, Koski A, Ojanper€a I, Vuori E, Sajantila A. Post-mortem SNPanalysis of CYP2D6 gene reveals correlation between genotype and

opioid drug (tramadol) metabolite ratios in blood. Forensic Sci Int2003;135(1):9–15.

12. Cuy�as E, Verdejo-García A, Fagundo AB, Khymenets O, Rodríguez J,Cuenca A, et al. The influence of genetic and environmental factorsamong MDMA users in cognitive performance. PLoS ONE 2011;6(11):e27206.

13. Ewald AH, Maurer HH. 2,5-Dimethoxyamphetamine-derived designerdrugs: studies on the identification of cytochrome P450 (CYP) isoen-zymes involved in formation of their main metabolites and on their capa-bility to inhibit CYP2D6. Toxicol Lett 2008;183(1–3):52–7.

14. Pedersen AJ, Reitzel LA, Johansen SS, Linnet K. In vitro metabolismstudies on mephedrone and analysis of forensic cases. Drug Test Anal2013;5(6):430–8.

15. Chen ZR, Somogyi AA, Bochner F. Polymorphic O-demethylation ofcodeine. Lancet 1988;2(8616):914–5.

16. Gasche Y, Daali Y, Fathi M, Chiappe A, Cottini S, Dayer P, et al.Codeine intoxication associated with ultrarapid CYP2D6 metabolism. NEngl J Med 2004;351(27):2827–31. [Published erratum appears inN Engl J Med 2005;352(6):638].

17. Crews KR, Gaedigk A, Dunnenberger HM, Klein TE, Shen DD, Calla-ghan JT, et al. Clinical Pharmacogenetics Implementation Consortium.Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelinesfor codeine therapy in the context of cytochrome P450 2D6 (CYP2D6)genotype. Clin Pharmacol Ther 2012;91(2):321–6.

18. Zackrisson AL, Lindblom B, Ahlner J. High frequency of occurrence ofCYP2D6 gene duplication/multiduplication indicating ultrarapid metabo-lism among suicide cases. Clin Pharmacol Ther 2010;88(3):354–9.

19. Pe~nas-Lled�o EM, Blasco-Fontecilla H, Dorado P, Vaquero-Lorenzo C,Baca-García E, Llerena A. CYP2D6 and the severity of suicide attempts.Pharmacogenomics 2012;13(2):179–84.

20. Ferguson CS, Tyndale RF. Cytochrome P450 enzymes in the brain:emerging evidence of biological significance. Trends Pharmacol Sci2011;32(12):708–14.

21. Kimura S, Umeno M, Skoda RC, Meyert UA, Gonzalez FJ. The humandebrisoquine 4-hydroxylase (CYP2D) locus: sequence and identificationof the polymorphic CYP2D6 gene, a related gene, and a pseudogene.Am J Hum Genet 1989;45(6):889–904.

22. St€uven T, Griese EU, Kroemer HK, Eichelbaum M, Zanger UM. Rapiddetection of CYP2D6 null alleles by long distance- and multiplex-polymerase chain reaction. Pharmacogenetics 1996;6(5):417–21.

23. Broly F, Marez D, Sabbagh N, Legrand M, Millecamps S, Lo GuidiceJM, et al. An efficient strategy for detection of known and new muta-tions of the CYP2D6 gene using single strand conformation polymor-phism analysis. Pharmacogenetics 1995;5(6):373–84.

24. Gaedigk A, Gotschall RR, Forbes NS, Simon SD, Kearns GL, LeederJS. Optimization of cytochrome P4502D6 (CYP2D6) phenotype assign-ment using a genotyping algorithm based on allele frequency data. Phar-macogenetics 1999;9(6):669–82.

25. Roberts R, Joyce P, Kennedy MA. Rapid and comprehensivedetermination of cytochrome P450 CYP2D6 poor metabolizer geno-types by multiplex polymerase chain reaction. Hum Mutat 2000;16(1):77–85.

26. Hiratsuka M, Agatsuma Y, Omori F, Narahara K, Inoue T, Kishikawa Y,et al. High throughput detection of drug-metabolizing enzyme polymor-phisms by allele-specific fluorogenic 5′ nuclease chain reaction assay.Biol Pharm Bull 2000;23(10):1131–5.

27. Stamer UM, Bayerer B, Wolf S, Hoeft A, St€uber F. Rapid and reliablemethod for cytochrome P450 2D6 genotyping. Clin Chem 2002;48(9):1412–7.

28. Sistonen J, Fuselli S, Levo A, Sajantila A. CYP2D6 genotyping by amultiplex primer extension reaction. Clin Chem 2005;51(7):1291–5.

29. Beer B, Erb R, Pitterl F, Niederst€atter H, Maro~nas O, Gesteira A, et al.CYP2D6 genotyping by liquid chromatography-electrospray ionizationmass spectrometry. Anal Bioanal Chem 2011;400(8):2361–70.

30. Pindurov�a E, Zourkov�a A, Zr�ustov�a J, Ju�rica J, Pavelka A. Alternativereliable method for cytochrome P450 2D6 poor metabolizers genotyping.Mol Biotechnol 2013;53(1):29–40.

31. Panserat S, Mura C, G�erard N, Vincent-Viry M, Galteau MM, Jacoz-Aigrain E, et al. An unequal cross-over event within the CYP2D genecluster generates a chimeric CYP2D7/CYP2D6 gene which is associatedwith the poor metabolizer phenotype. Br J Clin Pharmacol 1995;40(4):361–7.

32. Heller T, Kirchheiner J, Armstrong VW, Luthe H, Tzvetkov M,Brockm€oller J, et al. AmpliChip CYP450 GeneChip: a new gene chipthat allows rapid and accurate CYP2D6 genotyping. Ther Drug Monit2006;28(5):673–7.

694 JOURNAL OF FORENSIC SCIENCES

33. Steen VM, Andreassen OA, Daly AK, Tefre T, Børresen AL, Idle JR,et al. Detection of the poor metabolizer-associated CYP2D6(D) genedeletion allele by long-PCR technology. Pharmacogenetics 1995;5(4):215–23.

34. Løvlie R, Daly AK, Molven A, Idle JR, Steen VM. Ultrarapid metaboliz-ers of debrisoquine: characterization and PCR-based detection of alleleswith duplication of the CYP2D6 gene. FEBS Lett 1996;392(1):30–4.

35. Schaeffeler E, Schwab M, Eichelbaum M, Zanger UM. CYP2D6 geno-typing strategy based on gene copy number determination by TaqManreal-time PCR. Hum Mutat 2003;22(6):476–85.

36. Bodin L, Beaune PH, Loriot MA. Determination of cytochrome P4502D6 (CYP2D6) gene copy number by real-time quantitative PCR. J Bio-med Biotechnol 2005;2005(3):248–53.

37. Eriksson S, Berg LM, Wadelius M, Alderborn A. Cytochrome p450genotyping by multiplexed real-time DNA sequencing with pyrosequenc-ing technology. Assay Drug Dev Technol 2002;1(1 Pt 1):49–59.

38. Zackrisson AL, Lindblom B. Identification of CYP2D6 alleles by singlenucleotide polymorphism analysis using pyrosequencing. Eur J ClinPharmacol 2003;59(7):521–6.

39. Schroth W, Hamann U, Fasching PA, Dauser S, Winter S, EichelbaumM, et al. CYP2D6 polymorphisms as predictors of outcome in breastcancer patients treated with tamoxifen: expanded polymorphism coverageimproves risk stratification. Clin Cancer Res 2010;16(17):4468–77.

40. Cheng S, Chang SY, Gravitt P, Respess R. Long PCR. Nature 1994;369(6482): 684–5.

41. King IB, Satia-Abouta J, Thornquist MD, Bigler J, Patterson RE, KristalAR, et al. Buccal cell DNA yield, quality, and collection costs: compari-son of methods for large-scale studies. Cancer Epidemiol BiomarkersPrev 2002;11(11):1511]. Cancer Epidemiol Biomarkers Prev 2002;11(10 Pt 1):1130-3.

42. Dlugos DJ, Scattergood TM, Ferraro TN, Berrettinni WH, Buono RJ.Recruitment rates and fear of phlebotomy in pediatric patients in agenetic study of epilepsy. Epilepsy Behav 2005;6(3):444–6.

43. Lundqvist E, Johansson I, Ingelman-Sundberg M. Genetic mechanismsfor duplication and multiduplication of the human CYP2D6 gene andmethods for detection of duplicated CYP2D6 genes. Gene1999;226(2):327–38.

44. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics2007;23(21):2947–8.

45. Kibbe WA. OligoCalc: an online oligonucleotide properties calculator.Nucleic Acids Res 2007;35(Web Server issue):W43–6.

46. http://blast.ncbi.nlm.nih.gov/ (accessed June 01, 2012).47. Fujita PA, Rhead B, Zweig AS, Hinrichs AS, Karolchik D, Cline MS,

et al. The UCSC Genome Browser database: update 2011. Nucleic AcidsRes 2011;39(Database issue):D876–82.

48. Vallone PM, Butler JM. AutoDimer: a screening tool for primer-dimerand hairpin structures. Biotechniques 2004;37(2):226–31.

49. Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH. MultiplexPCR: critical parameters and step-by-step protocol. Biotechniques 1997;23(3):504–11.

50. Riccardi LN, Lanzellotto R, Luiselli D, Ceccardi S, Falconi M, Bini C, et al.CYP2D6 genotyping in natives and immigrants from the Emilia-RomagnaRegion (Italy). Genet Test Mol Biomarkers 2011;15(11):801–6.

51. Karch SB. Changing times: DNA resequencing and the “nearly normalautopsy”. J Forensic Leg Med 2007;14(7):389–97.

52. Sallee FR, DeVane CL, Ferrell RE. Fluoxetine-related death in a childwith cytochrome P-450 2D6 genetic deficiency. J Child Adolesc Psycho-pharmacol 2000;10(1):27–34.

53. Koren G, Cairns J, Chitayat D, Gaedigk A, Leeder SJ. Pharmacogeneticsof morphine poisoning in a breastfed neonate of a codeine-prescribedmother. Lancet 2006;368(9536):704.

54. von Ahsen N, Tzvetkov M, Karunajeewa HA, Gomorrai S, Ura A,Brockm€oller J, et al. CYP2D6 and CYP2C19 in Papua New Guinea:high frequency of previously uncharacterized CYP2D6 alleles andheterozygote excess. Int J Mol Epidemiol Genet 2010;1(4):310–9.

55. Kirchheiner J, Schmidt H, Tzvetkov M, Keulen JT, L€otsch J, Roots I,et al. Pharmacokinetics of codeine and its metabolite morphine in ultra-rapid metabolizers due to CYP2D6 duplication. Pharmacogenomics J2006;7(4):257–65.

56. Madadi P, Ross CJ, Hayden MR, Carleton BC, Gaedigk A, Leeder JS,et al. Pharmacogenetics of neonatal opioid toxicity following maternaluse of codeine during breastfeeding: a case-control study. Clin PharmacolTher 2009;85(1):31–5.

57. Madadi P, Koren G, Cairns J, Chitayat D, Gaedigk A, Leeder JS, et al.Safety of codeine during breastfeeding: fatal morphine poisoning in thebreastfed neonate of a mother prescribed codeine. Can Fam Physician2007;53(1):33–5.

58. Kelly LE, Rieder M, van den Anker J, Malkin B, Ross C, Neely MN,et al. More codeine fatalities after tonsillectomy in North American chil-dren. Pediatrics 2012;129(5):e1343–7.

59. Ciszkowski C, Madadi P, Phillips MS, Lauwers AE, Koren G. Codeine,ultrarapid-metabolism genotype, and postoperative death. N Engl J Med2009;361(8):827–8.

60. http://www.fda.gov/ForConsumers/ConsumerUpdates/ucm054717.htm(accessed January 17, 2013).

Additional information and reprint requests:Susi Pelotti, M.D.Department of Medical and Surgical SciencesInstitute of Legal MedicineUniversity of Bolognavia Irnerio, 4940126 BolognaItalyE-mail: susi.pelotti@unibo.it

RICCARDI ET AL. . CYP2D6 GENOTYPING 695