Development and Optimization of Bioconjugations to Probe ...
Transcript of Development and Optimization of Bioconjugations to Probe ...
![Page 1: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/1.jpg)
William & MaryW&M ScholarWorks
Undergraduate Honors Theses Theses, Dissertations, & Master Projects
12-2018
Development and Optimization ofBioconjugations to Probe and Modulate ProteinFunctionChristopher Travis
Follow this and additional works at: https://scholarworks.wm.edu/honorstheses
Part of the Amino Acids, Peptides, and Proteins Commons, Medicinal-PharmaceuticalChemistry Commons, and the Organic Chemistry Commons
This Honors Thesis is brought to you for free and open access by the Theses, Dissertations, & Master Projects at W&M ScholarWorks. It has beenaccepted for inclusion in Undergraduate Honors Theses by an authorized administrator of W&M ScholarWorks. For more information, please [email protected].
Recommended CitationTravis, Christopher, "Development and Optimization of Bioconjugations to Probe and Modulate Protein Function" (2018).Undergraduate Honors Theses. Paper 1265.https://scholarworks.wm.edu/honorstheses/1265
![Page 2: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/2.jpg)
![Page 3: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/3.jpg)
DEVELOPMENT AND OPTIMIZATION OF BIOCONJUGATIONS TO PROBE AND
MODULATE PROTEIN FUNCTION
Christopher Richard Travis
Chester Springs, Pennsylvania
A Thesis Presented at the College of William & Mary in Candidacy for Departmental Honors
Department of Chemistry
College of William & Mary
December, 2018
![Page 4: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/4.jpg)
ABSTRACT
Bioconjugate chemistry is a critical field with widespread applications to the visualization,
diagnosis, and treatment of various diseases. Thus, it is crucial to investigate and optimize present
bioconjugation methods, while continuing to develop novel bioconjugations to expand the scope
of the field and provide numerous chemical tools for various applications. This thesis describes
the development and optimization of bioconjugations using unnatural amino acid (UAA)
technology to prepare homogenous, well-defined macromolecular complexes. First, the utilization
of the Glaser-Hay bioconjugation to modulate protein function will be discussed. Next, an
investigation into the aqueous Glaser-Hay reaction mechanism and subsequent optimization of the
bioconjugation will be presented. A novel [2 + 2 + 2] cycloaddition bioconjugation reaction will
then be presented, followed by efforts to generate a multivalent bioconjugate. Finally, efforts to
assay and modulate the activity of Cas9 will be examined. This thesis aims to extend the chemical
toolbox to probe and control biological systems, with applications in the fields of medicine and
pharmaceuticals.
![Page 5: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/5.jpg)
i
TABLE OF CONTENTS
Acknowledgements iii
Table of Figure iv
Table of Tables vi
Chapter 1: Introduction to Bioconjugates and Unnatural Amino Acids…………………… 1
Bioconjugates…………………………………………………………………... 1
Unnatural Amino Acids………………………………………………………… 3
Conclusion…………………………………………………………………....... 9
References…………………………………………………………………........ 10
Chapter 2: Utilization of Alkyne Bioconjugations to Modulate Protein Function………… 14
Introduction…………………………………………………………………………….. 14
Incorporation of UAAs into the Chromophore of GFP…………………………… 15
Investigation of the Impact of Glaser-Hay Bioconjugations on the
Fluorescence Profile of GFP……………………………………………………… 18
Conclusion……………………………………………………………………………… 21
Materials and Methods……………………………………………………………….. 22
References……………………………………………………………………………… 23
Chapter 3: Mechanistic Investigation into the Aqueous Glaser-Hay Bioconjugation……... 27
Introduction…………………………………………………………………………….. 27
Investigating the Aqueous Mechanism of the Glaser-Hay Coupling……………. 28
Optimization of the Biological Glaser-Hay Coupling…………………………….. 35
Streamlining the Glaser-Hay Bioconjugation……………………………………… 37
Conclusion………………………………………………………………………………. 39
Materials and Methods………………………………………………………………... 40
References………………………………………………………………………………. 44
Chapter 4: Synthesis of a Novel Dipropargyl Amine UAA and Development of a
Novel [2 + 2 + 2] Cyclotrimerization Bioconjugation……………………….. 48
Introduction…………………………………………………………………………….. 48
Development of Physiologically Compatible [2 + 2 + 2] Cyclotrimerization… 50
Synthesis of UAA with Dipropargyl Functionality………………………………… 50
Site-Specific Incorporation of pDPrAF……………………………………………... 51
Development and Optimization of Biological [2 + 2 + 2] Cyclotrimerization... 52
Investigation of the Versatility of pDPrAF…………………………………………. 55
Conclusion………………………………………………………………………………. 57
Materials and Methods………………………………………………………………... 57
References………………………………………………………………………………. 62
![Page 6: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/6.jpg)
ii
Chapter 5: Towards the Development of Multivalent Bioconjugates……………………... 66
Introduction…………………………………………………………………………….. 66
Towards the Development of a Biological 1,3-Dipolar Cycloaddition
of an Azide and a Diyne…………………………………………………………….. 69
Towards the Development of a Terminal Alkyne Addition to a Diyne
in Biological Settings………………………………………………………………... 71
Towards the Use of a Biological Sonogashira Reaction to Prepare a
Multivalent Bioconjugate…………………………………………………………… 72
Conclusion………………………………………………………………………………. 74
Materials and Methods………………………………………………………………... 74
References………………………………………………………………………………. 79
Chapter 6: Utilization of Unnatural Amino Acids to Probe CRISPR/Cas9………………...81
Introduction…………………………………………………………………………….. 81
Previous Work………………………………………………………………………….. 86
Expression of Wild Type and Mutant Cas9 and dCas9…………………………… 87
Cleavage Assay………………………………………………………………………….89
Conclusion………………………………………………………………………………. 92
Materials and Methods………………………………………………………………... 92
References ………………………………………………………………………………. 95
![Page 7: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/7.jpg)
iii
ACKNOWLEDGEMENTS
I would first like to thank Dr. Doug Young for his mentorship and guidance over the past three
and a half years. Thank you for helping me develop as a scientist and figure out what I want to do
with the rest of my life. Thank you for always tolerating my negativity and for taking me to New
Orleans.
I am also grateful to Dr. Lisa Landino, Dr. Rob Hinkle, and Dr. Margaret Saha for serving on my
thesis committee and for teaching excellent courses.
I would also like to thank Johnathan Maza for teaching me my way around the lab when I was a
freshman and answering all of my terrible questions. I am also grateful to Zack Nimmo for his
friendship as well as his collaboration and leadership on several projects we worked on together.
Additionally, I would like to acknowledge the Young Lab as a whole for making my time in the
lab so memorable and full of good times. A special thank you to Gillian Gaunt, Lauren Mazur,
Christina Howard, and Emily Peairs for their collaboration on several of the projects detailed in
this thesis.
Thank you to Diya for always being there for me. You’re the GOAT.
![Page 8: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/8.jpg)
iv
TABLE OF FIGURES
1.1 Nonspecific conjugation between an antibody and a drug 2
1.2 The twenty canonical amino acids 4
2.1 Overview of site-specific UAA incorporation 5
2.2 Mechanism to incorporate UAA into polypeptide chain site-specifically 7
1.5 Evolution of specific aaRS through double sieve selection 8
1.6 Library of UAAs 9
2.1 Structures of UAAs and site of incorporation into GFP chromophore 16
2.2 SDS-PAGE of UAAs incorporated into GFP 17
2.3 Fluorescence profiles of GFP mutants 17
2.4 Structure of GFP chromophore with UAAs incorporated 18
2.5 Glaser-Hay bioconjugations performed at GFP chromophore 18
2.6 SDS-PAGE of Glaser-Hay bioconjugations 19
2.7 Fluorescence profiles of GFP after undergoing Glaser-Hay couplings 20
2.8 Comparison of Glaser-Hay and Cadiot-Chodkiewicz biocojugations 21
3.1 Glaser-Hay reaction 27
3.2 Biological Glaser-Hay coupling 28
3.3 Proposed mechanisms for Glaser-Hay reaction in organic solvents 29
3.4 Dimerization of propargyl alcohol via Glaser-Hay coupling 29
3.5 13C NMR of aqueous Glaser-Hay reaction time course 30
3.6 Effects of varying propargyl alcohol concentration in an aqueous
Glaser-Hay coupling 32
3.7 Effects of varying copper(I) iodide concentration in an aqueous
Glaser-Hay coupling 33
3.8 Effects of varying TMEDA concentration in an aqueous
Glaser-Hay coupling 34
3.9 UV/Vis spectrum of aqueous Glaser-Hay coupling 34
3.10 Structures of ligands employed in Glaser-Hay bioconjugations 36
3.11 SDS-PAGE of Glaser-Hay bioconjugations investigating catalase and ligands 37
3.12 Overview of various starting points for Glaser-Hay bioconjugation 38
3.13 SDS-PAGE of Glaser-Hay bioconjugations during protein purification
and on cell lysate 39
4.1 Antibody-drug conjugates 48
4.2 Example of current bioconjugation employed 48
4.3 Recently developed aqueous [2 + 2 + 2] cycloaddion 49
4.4 Structure of dicarboxylated biphenyl ligand employed in bioconjugations 50
4.5 Physiologically compatible [2 + 2 + 2] cycloaddition 50
4.6 Synthesis of pDPrAF UAA 50
4.7 SDS-PAGE of mutant GFP containing pDPrAF 51
4.8 [2 + 2 + 2] cyclotrimerization bioconjugation 53
4.9 Time course of [2 + 2 + 2] cyclotrimerization bioconjugation 54
4.10 Effects of temperature on [2 + 2 + 2] cyclotrimerization bioconjugation 55
![Page 9: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/9.jpg)
v
4.11 Effects of pH on [2 + 2 + 2] cyclotrimerization bioconjugation 56
4.12 SDS-PAGE demonstrating versatility of pDPrAF 56
5.1 Preparation of a multivalent bioconjugate 67
5.2 Potential reactivity of a biological 1,3-diyne 68
5.3 Published copper(I)-catalyzed reaction between an azide and a 1,3-diyne 69
5.4 Attempted copper(I)-catalyzed reaction between an azide and a 1,3-diyne 69
5.5 Glaser-Hay coupling to prepare a simple 1,3-diyne 70
5.6 Aqueous reaction between an azide and a 1,3-diyne with a
copper-iron catalyst system 70
5.7 Addition of terminal alkyne to internal alkyne via a copper-palladium
catalyst system in aqueous solution 71
5.8 Addition of terminal alkyne to a 1,3-diyne via a copper-palladium catalyst
system in aqueous solution 71
5.9 Biological addition of a terminal alkyne to a 1,3-diyne via a copper-palladium
catalyst system 72
5.10 Copper click reaction to afford bromotriazole-containing bioconjugate
and biological Sonogashira to generate a multivalent bioconjugate 73
6.1 Mechanism of CRISPR/Cas9 in bacteria 82
6.2 Crystal structure of Cas9 82
6.3 Structural depiction of clefts in Cas9 83
6.4 Mechanism to program Cas9 for site-specific endonuclease activity 84
6.5 Sites for site-specific mutagenesis for eventual UAA incorporation 86
6.6 Sequencing data of site-specific mutagenesis experiments 87
6.7 SDS-PAGE of wild type Cas9 and dCas9 expression 88
6.8 Structure of UAAs used for incorporation into Cas9 and dCas9 88
6.9 SDS-PAGE of mutant Cas9 containing pAzF in position 1265 88
6.10 Agarose gel of PCR amplification of EGFP-gRNA7 template DNA 90
6.11 Plasmid map of pIRG 90
6.12 Agarose gel of supercoiled and linearized pIRG 91
6.13 Agarose gel of wild type Cas9 cleavage assay 91
![Page 10: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/10.jpg)
vi
TABLE OF TABLES
5.1 Conditions tested in biological Sonogashira reactions 73
6.1 Rationale behind selection of sites for UAA incorporation in Cas9 86
6.2 Conditions tested in efforts to express mutant Cas9 and dCas9 89
![Page 11: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/11.jpg)
1
CHAPTER 1: INTRODUCTION TO BIOCONJUGATES AND UNNATURAL AMINO
ACIDS
Bioconjugates
Bioconjugate chemistry is a critical area of present research requiring the integration of
chemical tools into biological systems, with far-reaching applications in the fields of medicine,
pharmaceuticals, and materials. A bioconjugate is a covalent linkage between two molecules, at
least one of which is a biomolecule such as a protein, carbohydrate, or oligonucleotide.1,2 Most
often, these biomolecules are reacted with a fluorescent probe, surface, small molecule, or other
biomolecule to result in the bioconjugation product. This secondary reaction partner often confers
novel functionality to the biomolecule, such as fluorescence in instances of conjugation with a
fluorescent probe or potency towards inhibition of a target protein in instances of conjugation with
a small molecule drug. Biomolecules with enhanced properties through bioconjugation have
applications including therapeutics and diagnostics.3-7
Protein bioconjugates, in which at least one reaction partner is a protein, represent an
especially important class of bioconjugates, as they have been employed in a number of critical
applications, most notably for the preparation of antibody-drug conjugates.2 Antibody-drug
conjugates represent a key subset of current cancer treatments, as they combine the potency of a
small molecule inhibitor while utilizing the antibody’s specificity in helping to localize the drug
to its target for inhibition.8
The design and structure of a bioconjugate relate directly to its function.9,10 A variety of
methodologies are commonly employed to prepare bioconjugates. The naturally occurring
reactivity of thiol or amine functional groups in biomolecules are often utilized for bioconjugation
![Page 12: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/12.jpg)
2
reactions.10 In protein bioconjugates, the native nucleophilic characteristics of lysine, serine, or
cysteine are exploited for reaction with a second molecule.
Despite the stability of the covalent bonds
that link together the two components of
bioconjugates, it is difficult to regulate the
precise location on the biomolecule where the
bioconjugation reaction will take place.1,2 This
is due to the fact that multiple sites within the
same protein are often capable of reacting in the
same fashion. For example, multiple lysine, serine, or cysteine residues in a protein could react,
which would afford a heterogenous mixture of bioconjugation products (Figure 1.1). This is
particularly problematic when working to prepare antibody-drug conjugates. Immunoglobulin G
(IgG) is the most common type of antibody found in the human body, and it is often employed in
the preparation of bioconjugates through conjugation at native lysine or cysteine sites on IgG.11
However, this antibody contains 80 lysine residues and 14 cysteine disulfide pairs, meaning that
bioconjugation results in a highly heterogenous product mixture, with the number and location of
conjugated drug molecules varying tremendously. This means that the prepared antibody-drug
conjugate complexes would vary significantly in potency, stability, and solubility, leading to
inconsistent and potentially dangerous treatment for patients. Purifying a heterogenous mixture of
the IgG-drug bioconjugates to yield a specific complex is possible, but difficult and time-
consuming.
Thus, research to develop mechanisms to regulate the bioconjugation site for covalent
linkage is at the forefront of the field, as this generates well-defined conjugates. Such regulation
Figure 1.1. Utilization of the nucleophilicity of native
lysine, serine, or cysteine residues to prepare
bioconjugates often results in heterogenous product
mixtures.
![Page 13: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/13.jpg)
3
affords increased sample homogeneity, enhanced complex stability, and minimized perturbation
of biological function of the biomolecule.9,12-16 However, site-specific conjugations are often
difficult to achieve, as they require additional manipulation of the biomolecule. The conjugation
reaction must not only occur under physiological conditions (37°C, pH ~ 7), but also occur
bioorthogonally due to the wide range of chemical functionality of biomolecules, particularly
proteins.17 Bioorthogonal reactions are reactions that occur on biomolecules, but do not interfere
with biological processes. Additionally, the conjugation reaction must be site-specific, to ensure
that the site of the bioconjugation does not interfere with key sites on the biomolecule, such as the
active site of a protein. One excellent way to bioorthogonally prepare protein bioconjugates is to
utilize unnatural amino acid (UAA) technology, in which an UAA is incorporated site-specifically
into a protein.18 UAAs are not only site-specific, but also offer unique reactivity not found naturally
in proteins, as UAAs often introduce novel chemical moieties. This offers a unique, bioorthogonal
reactive site in proteins which can be utilized to prepare well-defined, homogenous, stable protein
bioconjugates. One commonly employed bioconjugation that utilizes the unique reactivity of
UAAs is the copper-catalyzed azide alkyne cycloaddition (CuAAC), or copper click reaction.10
Through this, a protein harboring an azide-containing UAA is reacted with an alkyne to generate
a bioconjugate.
Unnatural Amino Acids
Proteins are critical for cellular life, as they catalyze an incredible array of cellular
reactions.19 Aptly coined the workhorses of the cell, proteins are critical to cellular structure,
function, and regulation. Although there are many unique proteins catalyzing many unique
chemical reactions, the building blocks of all proteins are chemically simple. The twenty canonical
amino acids, which are those found naturally in cells, consist of just five different elements and
![Page 14: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/14.jpg)
4
have very limited chemical functionality. The 20 canonical amino acids all consist of the same
backbone, containing an amine group, a chiral carbon, and a carboxylic acid group. Thus, these
amino acids differ only in their R group (Figure 1.2). Beyond several acidic and basic amino acid
R groups, there is limited potential for chemical reactivity in the canonical amino acids.
Given the prevalence of protein reactions in cells, expansion of the reactivity of amino acid
R groups is valuable. Unnatural amino acids (UAAs) are synthetic analogs of amino acids, and
can afford novel chemical functionality outside the realm of the twenty natural amino acids.20,21
UAAs are encoded at the DNA level, and allow the researcher to site-specifically dictate the exact
location where the UAA is incorporated in the protein sequence (Figure 1.3). This ensures optimal
UAA placement with minimized detrimental alterations to the protein’s structure and function.
Given the simple two carbon backbone of amino acids, UAA synthesis is relatively simple,
as it involves protection of the carboxylic acid functional group and amine functional group,
Figure 1.2. There are 20 amino acids found naturally in cells, but they have very limited chemical
functionality. Adapted from Penn State Dept. of Biology.
![Page 15: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/15.jpg)
5
followed by reaction of one of the endogenous amino acids
to alter the R-group, thus forming an UAA. Through such
reactions, UAAs have been designed and synthesized to
contain a number of different functional groups, including
alkynes, azides, fluorophores, photocleavable groups,
cyanides, and a multitude of others.21
While these UAAs can be synthesized organically, their
incorporation into proteins proves more difficult. Ultimately,
UAAs can be site-specifically incorporated into proteins in
vivo, meaning that their incorporation must occur under
physiological conditions.20 The Central Dogma of biology
involves the transcription of DNA to form RNA, and the
translation of RNA to form proteins.19 DNA is the hereditary
material of the cell, and thus it contains the blueprints for each protein the cell synthesizes. DNA
has a double helix structure with two complementary strands, each of which contains a series of
nucleotides linked with phosphodiester bonds. There are four types of DNA nucleotides: adenine
(A), thymine (T), cytosine (C) and guanine (G). RNA nucleotides are the only differ in that Uracil
(U) replaces Thymine (T). RNA nucleotides are read and ultimately translated in groups of three,
with each codon (a unique set of three nucleotides) corresponding to a specific amino acid.19
Given that there are 64 possible codons, but only 20 endogenous amino acids, the genetic
codon is simultaneously specific and redundant. In this sense, each amino acid may be represented
by multiple codons (multiple sets of three RNA nucleotides), but each codon is specific to only
Figure 1.3. UAAs can be site-
specifically incorporated into proteins
co-translationally using a two plasmid
system and the cell’s endogenous
translational machinery.23
![Page 16: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/16.jpg)
6
one amino acid. The degeneracy of the genetic code can be exploited in order to site-specifically
incorporate UAAs.
Three codons out of the 64 total are designated stop codons, meaning that they do not code
for the addition of an amino acid, but rather just signal the end of translation (the end of additional
amino acids being added to the polypeptide chain).19 Given the redundancy of the stop codon,
UAAs can be incorporated into proteins by hijacking the endogenous mechanism of protein
synthesis through the Schultz methodology. This process requires an orthogonal aminoacyl-tRNA
synthetase (aaRS), an orthogonal tRNA-codon pair, and an UAA.23,24
This methodology relies on the multiplicity of stop codons and the fact that they do not
code for a particular amino acid. In this, a particular stop codon (often the TAG codon) is
manipulated in order to encode for the UAA rather than the termination of translation. To do this
site-specifically, the DNA of the protein must be mutated to change a specific preexisting codon
to a stop codon at the exact location where the UAA is to be incorporated.23,25 However, for the
UAA to actually be incorporated at the suppressed stop codon, there must exist an aaRS/tRNA
pair that is capable of recognizing the suppressed codon and the UAA.
In cells, there are 20 aaRSs which are specific to each of the canonical 20 amino acids.
These aaRSs are responsible for the catalyzing the linkage of the specific amino acid to the
appropriate tRNA. There is no cross-reactivity between synthetases.19 Thus, if just the UAA was
added to cells, there would be no incorporation of the UAA into protein at the suppressed stop
codon, as there would be no aaRS/tRNA pair to recognize the UAA.23,25 In order to successfully
incorporate an UAA, an aaRS/tRNA pair must be imported and evolved from another organism,
in this case Methanocaldococcus jannaschii, an archaea.26 The exogenous orthogonal aaRS/tRNA
pair is analogous in structure and function but does not interfere with the endogenous mechanism,
![Page 17: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/17.jpg)
7
as there is no cross reactivity. Instead, this orthogonal pair allows for complete translational read-
through of the suppressed TAG stop codon (also known as the amber stop codon) and the
subsequent site-specific incorporation of the UAA (Figure 1.4).20,27
The process of generating and
evolving a specific aaRS to recognize and
ultimately aid in the incorporation of a
particular UAA is complex.28-30 However,
specificity can ultimately be achieved using
a double-sieve selection.29 In this, the
natural aaRS that recognizes tyrosine found
in M. jannaschii undergoes genetic
mutation to produce a library of around 106
– 107 mutant aaRSs, which differ in
particular amino acid residues in the site
where the amino acid binds. These mutations alter the chemical environment of the binding pocket
and thus affect the binding affinity of different amino acids to the aaRS. To determine which aaRS
from the library is most effective at incorporating a particular UAA, a positive selection is
performed first. This selection involves the co-transformation of the mutated aaRSs and a
chloramphenicol-resistant enzyme altered to contain a TAG mutation in E. coli. Cells are then
plated in the presence of chloramphenicol and the particular UAA. Those cells which did not
undergo successful transformation fail to grow as they do not produce a chloramphenicol-resistant
enzyme and do not degrade the chloramphenicol. Thus the corresponding aaRSs are eliminated
from the library.
Figure 1.4. Site-specific UAA incorporation allows for the
introduction of novel chemical functional groups into
proteins. The Schultz Methodology takes advantage of the
redundancy of the genetic code to incorporate the UAA via
hijacking the TAG stop codon.12
![Page 18: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/18.jpg)
8
However, cell growth at this stage does not indicate UAA incorporation, as it is possible
that the new aaRS binding site mutation has resulted in that its charging of a different canonical
amino acid to the suppressor tRNA.29 Thus, negative selection is performed to elucidate which
aaRSs selectively bind the UAA. This negative selection process begins with the isolation and
purification of plasmids from the cells grown during positive selection. These plasmids are then
co-transformed with the barnase gene, which is mutated to contain three TAG codons. Barnase is
a ribonuclease that degrades cellular RNA, thus preventing protein synthesis and causing cell
death.
Following growth of these transformed cells in the absence of UAA, some cells are seen
to still suppress the TAG codons in the barnase gene, thus producing the barnase protein and dying.
These cells must be suppressing the TAG codons through aaRSs that pair endogenous amino acids
to the suppressor tRNA. Therefore, the cells that do not die must contain aaRSs that do not pair
endogenous amino acids to the suppressor tRNA. These results coupled with the fact that these
aaRSs cleared the positive selection indicate that these synthetases specifically charge the UAA of
interest to the suppressor tRNA. Usually, multiple rounds of positive and negative selection are
Figure 1.5. A series of positive and negative selection steps results in the selection of a specific
aminoacyl-tRNA synthetase from a library of 106 -10
7 different mutations.
![Page 19: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/19.jpg)
9
performed to ensure that the optimum aaRS/tRNA pair is chosen to selectively incorporate the
UAA (Figure 1.5).
As described above, UAA technology is highly specific and the site-specific incorporation
of UAAs allows for the introduction of novel chemical functional groups into proteins in controlled
locations. Large libraries of UAAs with diverse chemical handles have been synthesized and
incorporated into proteins (Figure 1.6). Site-specific UAA incorporation has been successfully
employed in many studies of protein structure and function, as well as in studies which altered and
enhanced protein function. Furthermore, UAA incorporation has shown value in the development
of novel diagnostic tools and therapeutics.28
Conclusion
Unnatural amino acid technology is a critical tool used in the preparation of protein
bioconjugates. By site-specifically incorporating synthetic UAAs with unique chemical handles
not found elsewhere in the protein, bioorthogonal conjugation reactions can be achieved,
Figure 1.6. The wide variety of synthesized UAAs allow scientists to incorporate novel
chemical functionalities that are not found in the 20 canonical amino acids into proteins.
Adapted from Liu, et al. (2010).
![Page 20: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/20.jpg)
10
generating specific, homogenous bioconjugates. This thesis will describe the beneficial
applications of the recently developed Glaser-Hay bioconjugation, which utilizes an alkyne-
containing UAA. Then, the mechanism and kinetics of the aqueous Glaser-Hay reaction will be
investigated, and efforts made to optimize the bioconjugation to reduce protein oxidation. Next, a
novel bioconjugation reaction will be reported for the first time: a cyclotrimerization utilizing a
newly synthesized dipropargyl amine UAA. Then, first steps towards the preparation of
multivalent bioconjugates will be discussed. Lastly, work to probe the protein Cas9 with UAAs
will be discussed. All projects aim to provide advances in the fields of bioconjugate chemistry and
UAA technology, as work at the intersection of these fields has critical applications to therapeutics,
diagnostics, and more.
References
1. Hermanson, G.T. (2013). Bioconjugate Techniques. Academic press.
2. Lang, K. & Chin, J.W. (2014). Cellular incorporation of unnatural amino acids and
bioorthogonal labeling of proteins. Chem. Rev., 114, 4764-4806.
3. Pasut, G. & Veronese, F. M. (2006). PEGylation of proteins as tailored chemistry for
optimized bioconjugates. Polymer Therapeutics I Springer, Berlin, Heidelberg, 95-134.
4. Boeneman, K., Deschamps, J.R., Buckhout-White, S., Prasuhn, D.E., Blanco-Canosa, J.B.,
Dawson, P.E., Stewart, M.H., Susumu, K., Goldman, E.R., Ancona, M. & Medintz, I.L.
(2010). Quantum dot DNA bioconjugates: attachment chemistry strongly influences the
resulting composite architecture. ACS Nano, 4, 7253-7266.
![Page 21: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/21.jpg)
11
5. Thomas, K.J., Sherman, D.B., Amiss, T.J., Andaluz, S.A. & Pitner, J.B. (2006). A long-
wavelength fluorescent glucose biosensor based on bioconjugates of galactose/glucose
binding protein and Nile Red derivatives. Diabetes Technol. Ther., 8, 261-268.
6. Niemeyer, C.M. (2002). The developments of semisynthetic DNA–protein
conjugates. Trends Biotechnol., 20, 395-401.
7. Allen, T.M. (2002). Ligand-targeted therapeutics in anticancer therapy. Nat. Rev.
Cancer, 2, 750.
8. Agarwal, P. & Bertozzi, C.R. (2015). Site-specific antibody−drug conjugates: the nexus of
bioorthogonal chemistry, protein engineering, and drug development. Bioconj. Chem., 26,
176-192.
9. Stephanopoulos N. & Francis M.B. (2011). Choosing an effective protein bioconjugation
strategy. Nat Chem Biol., 7, 876-84.
10. Kalia, J., & Raines, R.T. (2010). Advances in bioconjugation. Curr. Org. Chem., 14, 138-
147.
11. McCombs, J.R. & Owen, S.C. (2015). Antibody drug conjugates: design and selection of
linker, payload, and conjugation chemistry. AAPS J., 17, 339-351.
12. Ghosh, S.S., Kao, P.M., McCue, A.W. & Chappelle, H.L. (1990). Use of maleimide-thiol
coupling chemistry for efficient syntheses of oligonucleotide-enzyme conjugate
hybridization probes. Bioconj. Chem., 1, 71-76.
13. Annunziato, M.E., Patel, U.S., Ranade, M. & Palumbo, P.S. (1993). p-Maleimidophenyl
isocyanate: a novel heterobifunctional linker for hydroxyl to thiol coupling. Bioconj.
Chem., 4, 212-218.
14. Johnson, I. (1998). Fluorescent probes for living cells. Histochem. J, 30, 123-140.
![Page 22: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/22.jpg)
12
15. Lo, K., Lau, J., Ng, D., Zhu, N. (2002) J. Chem. Soc., Dalton Trans., 1753.
16. Gauthier, M.A. & Klok, H.A. (2008). Peptide/protein–polymer conjugates: synthetic
strategies and design concepts. Chem. Commun., 23, 2591-2611.
17. Sletten, E.M. & Bertozzi, C.R. (2009). Bioorthogonal chemistry: fishing for selectivity in
a sea of functionality. Angew. Chem. Int. Ed., 48, 6974-6998.
18. Kim, C.H., Axup, J.Y., & Schultz, P.G. (2013). Protein conjugation with genetically
encoded unnatural amino acids. Curr. Opin. Chem. Biol., 17, 412-419.
19. McKee T., McKee J.R. (2014). Biochemistry: the molecular basis of life. Fifth Edition.
New York: Oxford University Press.
20. Young, T.S. & Schultz, PG. (2010). Beyond the canonical 20 amino acids: Expanding the
genetic lexicon. J. Biol. Chem., 285, 11039–11044.
21. Liu, C., & Schultz, P.G. (2010). Adding new chemistries to the genetic code. Annu. Rev.
Biochem., 79, 413-44.
22. Maza, J.C., Jacobs, T.H., Uthappa, D.M., & Young, D.D. (2016). Employing unnatural
amino acids in the preparation of bioconjugates. Synlett 27, A–I.
23. Cornish, V. & Schultz, P.G. (1995). Site directed mutagenesis with an expanded genetic
code. Annu. Rev. Biophys. Biomol. Struct., 24, 435-462.
24. Wang, L., Xie, J., and Schultz, P.G. (2006). Expanding the genetic code. Annu. Rev.
Biophys Biomol. Struct., 35, 225-249.
25. Martin, A. & Schultz, P.G. (1999). Opportunities at the interface of chemistry and biology.
Trends Cell Biol., 9, M24-M28.
26. Wang, L, Brock, A., Hererich, B., & Schultz, P.G. (2001). Expanding the genetic code of
E. coli. Science, 292, 498-500.
![Page 23: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/23.jpg)
13
27. Mehl, R., et al. (2003). Generation of a bacterium with a 21 amino acid genetic code. J. Am
Chem. Soc., 125, 935-939.
28. Young, D.D. & Schultz, P.G. (2018). Playing with the molecules of life. ACS Chem. Biol.,
13, 854-870.
29. Wang, L. & Schultz, P.G. (2001). A general approach for the generation of orthogonal
tRNAs. Chem. Biol., 8, 883-890.
30. Wang, Q., Parrish, A., and Wang, L. (2009). Expanding the genetic code for biological
studies. Chemistry and Biology, 16, 323-336.
![Page 24: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/24.jpg)
14
CHAPTER 2: UTILIZATION OF ALKYNE BIOCONJUGATIONS TO
MODULATE PROTEIN FUNCTION
Introduction
Protein engineering is a powerful tool for the development of new therapeutics, catalysts,
and biosensors.1-8 While many advances in the field have been made, designing novel protein
functionality is still a challenge, as it requires an intricate understanding of the subtle interplay
between protein structure and function. Current engineering techniques often focus on using
selections and screens to optimize or enhance existing protein functionality.2 While this method
has proved useful for optimizing existing function, generating new function where it does not exist
is still a hurdle.
By introducing novel chemical functionality to proteins, UAAs have allowed for the
development of unique protein function; however, the evolved proteins are often limited to a single
new function, depending on the UAA incorporated.2,9 In addition, the functionality is limited to
the UAA itself, which suffers from constraints, such as the requisite for an aminoacyl tRNA
synthetase capable of recognizing the UAA, the synthetic accessibility of the UAA, and the size
of the UAA which may preclude its uptake by a biological system.10 A more appealing strategy
would allow for the generation of a UAA-containing protein “template” upon which researchers
could synthetically introduce different chemical moieties that would in turn lead to altered protein
function depending on the moiety employed.
Bioorthogonal chemistry, which employs reactions that proceed to completion under
physiological conditions (pH ~7, 37C), offers a unique mechanism to add new chemical
functionality to proteins.11,12 Indeed, a variety of reactions have been developed that can add new
chemistry to living systems. In particular, the cycloaddition between azides and alkynes that is
![Page 25: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/25.jpg)
15
either copper(I) mediated or strain promoted, has become a widespread technique to introduce new
chemistry to proteins.13-16 More recently, our group has developed a biorthogonal variant of the
Glaser-Hay reaction, which brings together two terminal alkynes to form a diyne on a protein in
the presence of copper(I) under physiological conditions.17-21 The resulting stable diyne linkage
has a well-defined linear geometry, and due to the abundance of commercial available terminal
alkynes, a variety of chemical moieties can be reacted onto a protein using this technique. As such,
we sought to utilize the power of this new chemistry to generate new and different protein function
dependent upon the alkyne reaction partner and not purely the UAA.
Incorporation of UAAs into the Chromophore of GFP
Specifically, we designed a proof-of-concept experiment to alter the function of green
fluorescent protein (GFP) via reaction of different terminal alkynes, onto the GFP chromophore.
GFP is a 27 kDa protein isolated from Aequorea victoria with photochemical properties arising
from an internal chromophore composed of Ser65-Tyr66-Gly67.22-24 New chemical properties
afforded by UAA introduction in place of Tyr66 have already been documented to alter GFPs
fluorescence profile.25 All UAAs incorporated were found to blueshift the fluorescence profile of
GFP, with more highly conjugated UAAs exhibiting a greater degree of spectral shifting. Based
on these results, the ability to modulate the conjugation of GFPs fluorophore using UAA
mutagenesis is apparent, and represents a convenient means to rationally design new protein
function.25,26 However, this mutagenesis approach is limited by the size and complexity of the
UAA. An alternative approach involves exploiting the chemical functionality in pre-existing
UAAs to serve as functional handles for biorthogonal reactions, acting as a “template” for the
chemical derivatization of new protein function.
![Page 26: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/26.jpg)
16
This chemically
templated protein function
could be achieved via the
genetic incorporation of p-
propargyloxyphenyalanine
(pPrF, 1) or p-
ethynylphenylalanine (pEtF,
2) into residue 66 of GFP
(Figure 2.1).27 This provides a
terminal alkyne handle for
reaction with different
chemical moieties via the bioorthogonal Glaser-Hay reaction. The resulting diyne linkage is highly
conjugated and represents a prime candidate to introduce new photochemical properties into GFP’s
fluorophore without the need to evolve a new aaRS or express multiple versions of the protein
containing different UAAs. Moreover, the pEtF (2) is directly conjugated with the aromatic ring
of the UAA, allowing for a comparison of the conjugation between the different UAAs. We
hypothesized that the altered conjugation and chemical properties around the fluorophore will lead
to new photophysical properties, demonstrating the utility of a chemically programmable protein
engineering strategy. Herein we report our findings on utilizing the Glaser-Hay reaction on GFP’s
fluorophore to alter its fluorescent properties.
In order to obtain protein possessing an alkynyl moiety, a GFP plasmid harboring a TAG
mutation at position 66 was co-transformed with the polyspecific pCNF-aaRS/tRNA pair.28
Conveniently, this aaRS is capable of recognizing both 1 and 2 and for expression of an alkyne-
![Page 27: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/27.jpg)
17
containing GFP.20 Incorporation was also confirmed by SDS-PAGE analysis of protein expression
in the presence and absence of the various UAAs (Figure 2.2). As the alkynyl UAA is incorporated
into position 66 in GFP’s fluorophore, the extended conjugation afforded by the UAA alters the
spectral properties of GFP. To assess that pPrF-GFPTAG66 was successfully produced, spectra for
the GFP-variant were compared to the wild type. These spectra exhibited blue-shift, in agreement
with the literature precedent, in the pPrF variant relative to the wild type (Figure 2.3). A similar
expression was performed using the pCNF aaRS/tRNA pair and pEtF to produce a separate GFP
mutant with a bioconjugation handle. Conveniently, due to the modularity of this approach, only
a single protein expression is
necessary and all functional
modification can be achieved
synthetically. This is in contrast
to previous experiments, which
required an individual protein
expression for each UAA in
order to modify function.
![Page 28: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/28.jpg)
18
Investigation of Impact of Glaser-Hay Reactions on the Fluorescence Profile of GFP
With a pPrF-GFPTAG66 and pEtF-GFPTAG66 in hand,
we then sought to employ our previously reported
biorthogonal Glaser-Hay reaction to install new and varied
chemical functionality into the chromophore of GFP
(Figure 2.4). To investigate, we performed biorthogonal
Glaser-Hay reactions on the chromophore’s alkyne handle
to couple terminal alkyne-bearing aliphatic and aromatic
compounds with different chemical functionalities. Glaser-
Hay reactions were performed by using a working
concentration of 500 mM of CuI and TMEDA in the
presence of alkyne-UAA bearing GFPTAG66 and the cognate alkynyl partner (Figure 2.5). Reactions
proceeded for 4 hours at 4C and then purified via centrifugation with a molecular weight cut-off
column. The protein was
placed in phosphate-
buffered saline solution
(pH ~7.2) for analysis
using fluorescence
spectroscopy.
Gratifyingly, our initial
attempts with to couple the
terminal alkynes to the
fluorophore were
![Page 29: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/29.jpg)
19
successful. Furthermore, the different characteristics of the alkyne moieties installed successfully
shifted the fluorescence profile away from the parental alkynyl-GFPTAG66 spectra, each in a unique
way. While it might be expected that the requisite for the reaction to occur within the -barrel of
GFP may hinder this reaction from occurring, we hypothesize that the hydrophobic nature of
interior of GFP actually aided in the hydrophobic alkyne localization, thereby facilitating the
reaction by increasing effective concentration. Additionally, SDS-PAGE analysis with Coomassie
revealed that the Glaser-Hay reaction only minimally altered protein concentration suggesting only
minimal protein degradation (Figure 2.6).
We found that our initial
Glaser-Hay reactions on pPrF-
GFPTAG66 had different effects
on the fluorescent profile of GFP
(Figure 2.7, A). Reacting 1-
hexyne (3) on the chromophore
caused a general broadening and quasi-red shift of the fluorescent spectra. Reacting propargyl
amine (4) on the chromophore caused a slight band broadening, as well as potential increase in
fluorescence intensity, perhaps due to the increased polarity of the introduced amine group.
Interestingly, coupling with an aromatic alkyne resulted in a dramatic red-shift of the fluorescence
to above that of wild-type GFP. Both ethynylanisole (5) and ethynylaniline (6), resulted in
excitation spectra maxima above 540 nm, dramatically altering the fluorescence of GFP.
We next sought to explore the effects of reacting terminal alkynes in direct conjugation
with the aromatic ring of residue 66. This was feasible with the GFP mutant harboring 2.
Interestingly, this strategy resulted in an even greater blue shift of the pEtF-GFPTAG66 compared to
![Page 30: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/30.jpg)
20
both the pPrF and wild-type
variants, likely due to the
increased conjugation of the
direct attachment of that
terminal alkyne on the phenyl
ring. As a result of this shift, a
different excitation wavelength
was necessary, as 395 nm was
found to no longer excite the
pEtF-containing chromophore.
Based on absorption
experiments, we selected 280
nm as the wavelength to excite
the pEtF-GFPTAG66 and all its
Glaser-Hay derivatives. In the
same fashion as the pPrF, the
biorthogonal Glaser-Hay was
performed on pEtF-GFPTAG66 using the same reaction partners (Figure 2.7, B). Once again, 3 was
found to broaden the fluorescence spectra. Interestingly, 4 had a drastic red-shift relative to the
pEtF parent chromophore. We believe this helps validate our initial speculation that the polarity
of the amine has a drastic impact on the fluorescent properties of the chromophore, as in this
instance the whole system is in direct conjugation. Interestingly, when employing the aromatic
alkynes in the fluorophore modulation, a less dramatic effect was observed than with the pPrF
![Page 31: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/31.jpg)
21
mutants. Reaction with 5 only slightly red-shifted the spectra; however, 6 had a more significant
impact both on the intensity and the red-shifting of the fluorophore. Additionally, attempts to
repeat the experiments using the bromo-alkyne derivative of 2 under Cadiot-Chodkiewicz coupling
conditions resulted in the identical spectra, but were performed under more mild reaction
conditions (Figure 2.8). These results were expected as the final products of both the Glaser-Hay
or Cadiot-Chodkiewicz reactions are identical.20 This represents a viable alternative reaction to
these protein modification approaches.
Conclusion
In conclusion, we have extended our work on the biological Glaser-Hay to utilize the
biorthogonal chemistry to modulate protein function. Using two previously reported alkyne-
containing UAAs within the chromophore of GFP (position 66), we have successfully performed
the Glaser-Hay reaction on the chromophore of GFP. The resulting diyne linkage alters the
fluorescence profile of GFP depending on the moiety attached to the terminal alkyne. Our future
work seeks to extend the reaction to aromatic containing alkynes, which we hope will have a
greater impact on GFP fluorescence due to the increased conjugation found in an aromatic system.
![Page 32: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/32.jpg)
22
Our findings highlight the potential of biorthogonal chemistry, particularly diyne forming
chemistries, to modulate protein function without the need for tedious selections and screens.
Materials and Methods
General
Solvents and reagents were obtained from either Sigma-Aldrich or Fisher Scientific and used
without further purification, unless noted. Reactions were conducted under ambient atmosphere
with non-distilled solvents. Unnatural amino acids were prepared according to literature
protocols.20 NMR data was acquired on an Agilent 400 MHz. All GFP proteins were purified
according to manufacturer’s protocols using a Qiagen Ni-NTA Quik Spin Kit. Fluorescence data
was measured using a PerkinElmer LS 55 Luminescence Spectrometer.
General Biological Glaser-Hay Protocol
To 1.5 mL Eppendorf tube was added 3 µL of a 500 mM CuI solution in water and 3 µL 500 mM
TMEDA solution in water. This mixture was then incubated at 4oC for 10 mins. Following the
incubation, 1xPBS (22 µL) was added, followed by the alkyne containing GFPTAG66 (10 µL) in
PBS (~0.5mg/mL) and a 40 mM solution (4 µL) of the cognate alkyne in DMSO. The mixture was
allowed to react at 4°C for 4 hr.
Protocol for Fluorimetry Scans
After reacting for 4 hr, 10 µL of the reaction mixture was added to a quartz cuvette and diluted up
to 3 mL with PBS. This was then excited at either 395 nm (for the pPrF-containing chromophore)
or 280 nm (for the pEtF-containing chromophore) with a 10 nm slit width for the excitation and
![Page 33: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/33.jpg)
23
emission wavelengths. Slit widths were increased or decreased as necessary depending on the
intensity of the reaction product’s signal. The scan speed was set at 500 nm/min.
General Protocol for Biological Glaser-Hay with Aromatic Reaction Partners
To 1.5 mL Eppendorf tube was added 3 µL of a 500 mM CuI solution in water and 3 µL 500 mM
TMEDA solution in water. This mixture was then incubated at 4 oC for 10 mins. Following the
incubation, 1xPBS (22 µL) was added, followed by the alkyne containing GFPTAG66 (10 µL) in
PBS (~0.5mg/mL) and a 40 mM solution (4 µL) of the cognate alkyne in DMSO. The mixture was
allowed to react at 4°C for 4 hr. Following this, the unreacted aromatic alkyne was washed away
using a 10 MWCO spin column (Corning) and rinsing with 50 µL portions of PBS 8 times The
solution was then concentrated to ~25 µL, as indicated on the spin column. Of this cleaned
solution, 10 µL was placed into a quartz cuvette and diluted to 2 mL with PBS for fluorescence
analysis.
References
1. Wu A. & Senter P. (2005). Arming antibodies: prospects and challenges for
immunoconjugates. Nat Biotechnol., 23, 1137–1146.
2. Brustad E.M. & Arnold F.H. (2011). Optimizing non-natural protein function with directed
evolution. Curr Opin Chem Biol., 15, 201–210.
3. Zhu H. & Snyder M. (2003). Protein chip technology. Curr. Opin. Chem. Biol., 7, 55–63.
4. Tan W., Sabet L., Li Y., et al. (2008). Optical protein sensor for detecting cancer markers in
saliva. Biosens. Bioelectron., 24, 266–271.
![Page 34: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/34.jpg)
24
5. Link A.J., Mock M.L., & Tirrell D.A. (2003). Non-canonical amino acids in protein
engineering. Curr. Opin. Biotechnol., 14, 603–609.
6. Banghart M., Volgraf M., & Trauner D. (2006). Engineering light-gated ion channels.
Biochemistry, 45, 15129–15141.
7. Steen Redeker, E., Ta D.T., Cortens D., Billen B., Guedens W., & Adriaensens, P. (2013).
Protein engineering for directed immobilization. Bioconjug. Chem., 24, 1761– 1777.
8. Presta L. (2006). Engineering of therapeutic antibodies to minimize immunogenicity and
optimize function. Adv. Drug. Deliv. Rev., 58, 640–656.
9. Young T.S. & Schultz P.G. (2010). Beyond the canonical 20 amino acids: expanding the
genetic lexicon. J. Biol. Chem., 285, 11039–11044.
10. Liu C. & Schultz P.G. (2010). Adding new chemistries to the genetic code. Annu. Rev.
Biochem., 79, 413–444.
11. Sletten E.M. & Bertozzi C.R. (2009). Bioorthogonal chemistry: fishing for selectivity in a sea
of functionality. Angew. Chem. Int. Ed., 48, 6974–6998.
12. Maza J.C., Jacobs T.H., Uthappa D.M., Young D.D. (2016). Employing unnatural amino acids
in the preparation of bioconjugates. Synlett. 27, 805-813.
13. Rostovtsev V.V., Green L.G., Fokin V.V., & Sharpless K.B. (2002). A stepwise huisgen
cycloaddition process: copper(I)-catalyzed regioselective ‘‘ligation” of azides and terminal
alkynes. Angew. Chem. Int. Ed. Engl., 41, 2596–2599.
14. Wang Q., Chan T.R., Hilgraf R., Fokin V.V., Sharpless K.B., & Finn M.G. (2003).
Bioconjugation by copper(I)-catalyzed azide-alkyne [3+2] cycloaddition. J. Am. Chem. Soc.,
125, 3192–3193.
![Page 35: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/35.jpg)
25
15. Agard N.J., Prescher J.A., & Bertozzi, C.R. (2004). A strain-promoted [3+2] azide-alkyne
cycloaddition for covalent modification of biomolecules in living systems. J. Am. Chem. Soc.,
126, 15046–15047.
16. Baskin J.M., Prescher J.A., Laughlin S.T., et al. Copper-free click chemistry for dynamic in
vivo imaging. Proc. Natl. Acad. Sci. USA, 104, 16793–16797.
17. Glaser C. (1896). Ber. Dtsch. Chem. Ges., 2, 422–424.
18. Shi W. & Lei A. (2014). 1,3-Diyne chemistry: synthesis and derivations. Tet. Lett., 55, 2763–
2772.
19. Maza J.C., McKenna J.R., Raliski B.K., Freedman M.T., & Young D.D. (2015). Synthesis
and incorporation of unnatural amino acids to probe and optimize protein bioconjugations.
Bioconj. Chem., 26, 1884-1889.
20. Maza J.C., Nimmo Z.M., & Young D.D. (2016). Expanding the scope of alkyne-mediated
bioconjugations utilizing unnatural amino acids. Chem. Commun., 52, 88–91.
21. Lampkowski J.S., Villa J.K., Young T.S., & Young D.D. (2015). Development and
optimization of Glaser-Hay bioconjugations. Angew. Chem. Int. Ed., 54, 9343-9346.
22. Pakhomov A. & Martynov V. (2008). GFP family: structural insights into spectral tuning.
Chem. Biol., 15, 755–764.
23. Ormö M., Cubitt A.B., Kallio K., Gross L.A., Tsien R.Y., & Remington S.J. Crystal structure
of the Aequorea victoria green fluorescent protein. Science, 273, 1392–1395.
24. Craggs T. (2009). Green fluorescent protein: structure, folding and chromophore maturation.
Chem. Soc. Rev., 38, 2865–2875.
25. Young D.D., Jockush S., Turro N., Schultz P.G. (2011). Synthetase polyspecificity as a tool
to modulate protein function. Bioorg. Med. Chem. Lett., 21, 7502–7504.
![Page 36: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/36.jpg)
26
26. Maza J.C., Villa J.K., Landino L.M., Young D.D. (2016). Utilizing unnatural amino acids to
illustrate protein structure-function relationships: an experiment designed for an
undergraduate biochemistry laboratory. J. Chem. Edu., 93, 767–771.
27. Deiters A. & Schultz P.G. (2005). In vivo incorporation of an alkyne into proteins in
Escherichia coli. Bioorg. Med. Chem. Lett., 15, 1521–1524.
28. Young D.D., Young T.S., Jahnz M, Ahmad I, Spraggon G, Schultz P.G. (2011). An evolved
aminoacyl-tRNA synthetase with atypical polysubstrate specificity. Biochemistry, 50, 1894–
1900.
![Page 37: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/37.jpg)
27
CHAPTER 3: MECHANISTIC INVESTIGATION INTO THE AQUEOUS GLASER-
HAY BIOCONJUGATION
Introduction
As previously discussed, protein bioconjugates, in which a protein is conjugated to another
molecule, represent a critical area of research with widespread applications, most notably in the
development of strategies for site-specific drug delivery and improved cellular imaging
strategies.1-5 Unnatural amino acid (UAA) technology introduces novel chemical moieties into
proteins and allows for the preparation of well-defined, homogenous protein bioconjugates, which
have been demonstrated to have therapeutic advantages over the heterogenous bioconjugate
mixtures afforded through reactivity of native amino acid residues.6-10
The Glaser-Hay coupling
represents an attractive reaction
to develop as a bioconjugation, given its many chemical advantages, among them the formation of
a highly stable carbon-carbon bond in a well-defined linear 1,3 diyne as well as the tolerance of
the reaction to a wide range of functional groups.11 (Figure 3.1). Our previous work reported the
first successful biological Glaser-Hay coupling in a full-length protein under mild, aqueous
reaction conditions.12 This bioconjugation relies on the incorporation of an UAA containing a
terminal alkyne: p-propargyloxyphenylalanine (pPrF, 1) (Figure 3.2). The diyne product of the
Glaser-Hay reaction has many useful downstream applications, including its use as the starting
point for many cycloaddition reactions yielding multivalent carbo- and heterocycle products with
diverse biological, photochemical, and optoelectronic properties.13-17
+
Figure 3.1. The Glaser-Hay reaction generates a stable linear diyne and
is tolerant of many functional groups.
![Page 38: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/38.jpg)
28
While the biological Glaser-Hay coupling is effective, significant protein oxidation has
been observed after around 6 hours of reaction time.12 Our previous work reported two optimized
conditions for the Glaser-Hay bioconjugation, the use of the traditional TMEDA ligand in a pH
6.0 reaction to afford faster coupling as well as the use of a carboxylated biphenyl ligand in a pH
8.0 reaction to minimize protein degradation.18 Both optimized reactions were performed at room
temperature. Despite the utility of the Glaser-Hay bioconjugation and this previous work, we
hypothesized there was a potential for further optimization, which could be facilitated via an
enhanced understanding of the reaction mechanism in aqueous solution.
Investigating the Aqueous Mechanism of the Glaser-Hay coupling
The mechanism of the Glaser-Hay coupling in organic solution has been studied in detail.
In 1964, Bohlmann et al. reported the formation of a dicopper(II)-diacetylide complex as the rate-
limiting step in the observed second-order kinetics.19 Later work suggested that the mechanism
progresses through a dicopper(III) intermediate (Figure 3.3).20
Most recently, Vilhelmsen et al. reported the reaction as zero-order in the alkyne starting
material.21 This study utilized UV/Vis spectroscopy as well as 13C NMR to study reaction
![Page 39: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/39.jpg)
29
progression under various conditions. They reported that increased copper(I) and/or increased
TMEDA resulted in an increased reaction rate. However, they also notably reported that the
reaction changed to a slower zero-order kinetics reaction after some time, due to the buildup of
water in the reaction through its absorption from the air. Given the detrimental effects of water on
the rate of the organic Glaser-Hay coupling, we sought to investigate the kinetics of the aqueous
Glaser-Hay coupling, as the reaction pathway may proceed by a different reaction pathway in
water than previously observed organic solvents.
For this study, we employed UV/Vis
spectroscopy as well as both 13C and 1H NMR to monitor
the Glaser-Hay coupling of the dimerization of propargyl
alcohol in an aqueous solution (Figure 3.4). For NMR experiments, deuterated water (D2O) was
employed as the solvent in place of water to facilitate an NMR lock and for clarity of NMR spectra.
Notably, reaction progress was tracked via relative integration of 13C product and reactant peaks.
Although such a method for quantitative kinetics studies is abnormal, it has been proven effective
in quantitative analyses, specifically in kinetic studies of in vivo and in vitro processes.22-27 Further,
Vilhlemsen et al. successfully utilized integration of 13C NMR to track the kinetics Glaser-Hay
Figure 3.3. (A) Glaser-Hay mechanism progressing through a dicopper(II) diacetylide complex, as proposed by
Bohlmann.19
(B) Computationally determined Glaser-Hay mechanism progressing through a dicopper (III)
intermediate, as proposed by Fomina.20
B A
Figure 3.4. Dimerization of propargyl
alcohol via the Glaser-Hay coupling.
![Page 40: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/40.jpg)
30
coupling in organic solution.21 While poor signal to noise ratio and the effects of the nuclear
Overhauser effect are cited as pitfalls of integrating 13C NMR spectra, the strength of the 400 MHz
NMR instrument used coupled with the deuterated solvent used appears to be sufficient to
overcome these limitations.21
The reaction shown in Figure 3.4 was prepared in a vial and air was bubbled through the
solution for 10 minutes. The vial was then sealed and allowed to stir at 80°C. At specific
timepoints, a portion of the reaction was removed and added directly to a flame-dried NMR tube.
Following NMR acquisition, this volume was added back to the reaction mixture. The relatively
low equivalencies of copper(I) iodide (2.4 mol%) and TMEDA (4.0 mol%) were chosen as the
![Page 41: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/41.jpg)
31
baseline as a reflection of the low concentrations of catalyst and ligand when the reaction is
conducted on a biological system. Given these starting conditions, our results are applicable to the
previously developed Glaser-Hay bioconjugation.
In order to probe the reaction kinetics of the aqueous Glaser-Hay coupling, we varied the
concentrations of reaction components, including propargyl alcohol, copper(I) iodide, and
TMEDA. Each trial was then compared as a function of time for the rate of formation of a product
peak observed at 50 ppm in the 13C NMR relative to the corresponding starting material peak at
approximately 49.3 ppm for each set of reaction conditions (Figure 3.5). The 50 ppm peak
corresponds to the methylene peak in the diyne-containing product. The peak seen at
approximately 49.3 ppm corresponds to the methylene peak in the terminal alkyne-containing
starting material.
Under all reaction conditions tested, we observed the instantaneous disappearance of the
terminal alkyne peak in the 1H NMR along with the immediate formation of a triplet peak in the
13C NMR. This indicates the instantaneous formation of a copper acetylide intermediate during the
aqueous Glaser-Hay coupling.
Through varying the amount of propargyl alcohol in the reaction, we observed the reaction
did not increase in rate when levels of starting material were higher. Thus, relative integration
displays that a higher proportion of starting material is converted when smaller amounts of
propargyl alcohol are used. (Figure 3.6). In other terms, the reaction does not appear to progress
at a faster rate when more propargyl alcohol is added.
![Page 42: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/42.jpg)
32
Varying the amount of copper(I) iodide in the reaction yielded surprising results. We
observed that increases in the level of copper(I) in the reaction resulted in decreased reaction rates
and greater conversion of starting material to product, even at ten times (24 mol%) the original
copper (I) iodide amount (Figure 3.7). This finding is significant, as it suggests that the aqueous
Glaser-Hay coupling may not progress through a dicopper acetylide intermediate, as had been
reported as the mechanism of the reaction in organic solution. This is logical given the high
coordination of water as the solvent, as it will act as a ligand to bind copper, making it less likely
to form a dicopper complex. Instead, these results suggests that copper coordinates to just a single
alkyne at a time to generate a copper(I) acetylide, which has been reported to be fairly stable.28 We
hypothesize that the Glaser-Hay coupling occurs between a copper acetylide and a free alkyne.
Thus, increased copper in the aqueous reaction leads to much of the alkyne being tied up in copper
acetylide, leaving little free terminal alkyne starting material to react with the copper acetylide to
![Page 43: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/43.jpg)
33
form the dimer product. Further, the addition of more copper may lead to the formation of larger
copper acetylide clusters, which may limit reactivity of the catalyst in an aqueous solution.29
Varying the amount of TMEDA in the reaction demonstrated kinetics similar to those
found in organic solution. Increases in the amount of TMEDA led to increased reaction rates,
suggesting increases in nitrogenous ligand concentration help facilitate quicker reaction and more
efficient coupling (Figure 3.8). Results indicate that the reaction is approximately first order in
TMEDA.
UV/Vis spectroscopy indicated a shift in absorbance immediately after the addition of
propargyl alcohol to the catalyst mixture in aqueous solution. When just copper(I) iodide and
TMEDA were in an aqueous solution, the solution was blue and had a UV/Vis absorbance peak at
a wavelength just above 600 nm (Figure 3.9). When the propargyl alcohol was added to the
![Page 44: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/44.jpg)
34
reaction, the color nearly immediately changed to a green-yellow, and the UV/Vis absorbance peak
shifted to a wavelength of just above 400 nm. Taking specific timepoints throughout the reaction
showed that the maximum wavelength of absorption did not change over the course of the reaction.
![Page 45: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/45.jpg)
35
Optimization of the Biological Glaser-Hay coupling
With our newly improved understanding of the kinetics of the aqueous Glaser-Hay
coupling, we sought to further optimize the aqueous Glaser-Hay bioconjugation to reduce protein
oxidation and improve coupling efficiency. We previously reported that the addition of the radical
scavengers ascorbic acid, cysteine, and oleic acid did not afford better coupling additions and that
ascorbic acid actually increased protein oxidation and inhibited coupling.18
Taking these results along with aforementioned observations of the instantaneous
formation of the copper acetylide and the lack of formation of a dicopper intermediate, we
hypothesized that the oxidative damage to protein in the aqueous Glaser-Hay bioconjugation could
be due to damage from hydrogen peroxide (H2O2) generation, rather than free radicals.
This hypothesis is also supported by our previous report that ascorbic acid causes increased
protein oxidation and inhibits coupling. It has been reported that ascorbic acid can be cytotoxic
due to its production of hydrogen peroxide, which is a reactive oxidative species (ROS) that
damages proteins and other cellular components.30,31 Further, it has been demonstrated that the
presence of the enzyme catalase in cells can mitigate the cytotoxicity of ascorbic acid through the
breakdown of hydrogen peroxide. Given this, we sought to investigate whether catalase would
decrease protein oxidation and improve coupling efficiency in the Glaser-Hay bioconjugation.
Finally, it has also been reported that hydroxyl radicals, which directly damage proteins,
are generated through the interaction of Cu2+ ions and hydrogen peroxide in phosphate-buffered
solution, which is the solution in which the aqueous Glaser-Hay bioconjugation is conducted.29
Additionally, it has been suggested that the level of radical formation is at least partially dependent
on the ligand chelating Cu2+ in solution. Given this as well as our previous report of a carboxylated
biphenyl ligand affording better coupling than the originally reported TMEDA, we sought to
![Page 46: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/46.jpg)
36
investigate whether other ligands could be employed to minimize protein degradation in the
Glaser-Hay bioconjugation.18
In order to probe the effects of catalase and various nitrogenous ligands, we performed a
250 mL expression of GFP containing pPrF in position 151. Following purification, the protein
was buffer exchanged into PBS and concentrated to a standard concentration of 1.0 mg/mL to
remove variability in protein expression. With the GFP/pPrF in hand, we prepared a series of
reactions to test the effectiveness of catalase and different nitrogenous ligands in a coupling
reaction between the mutant protein and an Fluor-488 alkyne dye.
For the ligand, the traditionally
used 2 as well as the recently reported 3
were selected for investigation, along
with biquinoline (4), a dimethylated
bipyridyl (5) and terpyridine (6).
(Figure 3.10). In the interest of solubility,
for 2, a 500 mM solution was prepared in
H2O. For 3, the solution was prepared in
1 M NaOH. For 4, 5, and 6, the solutions were prepared in DMSO. When conducting the reaction
with 2, GFP/pPrF of pH = 6.0 was employed for 4 hours, based on the previously optimized
conditions.18 Similarly, in a reaction with 3, GFP/pPrF of pH = 8.0 was employed for 8 hours, in
accordance with previously optimized conditions. For reaction with 4, 5, and 6, the same reaction
conditions as 3 were employed due to similarities in ligand structure.
A total of ten reactions were prepared, as the effectiveness of each ligand was tested with
and without the addition of catalase. Gratifyingly, the addition of catalase improved coupling and
Figure 3.10. Nitrogenous ligands selected for investigation.
![Page 47: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/47.jpg)
37
reduced protein oxidation for each of the ligands examined (Figure 3.11). Reactions with ligands
2 and 4 demonstrated little protein oxidation. However, reaction with ligand 5 demonstrated
significantly more protein oxidation, especially in the absence of catalase. These results indicate a
likelihood that hydrogen peroxide is a byproduct of the Glaser-Hay coupling in aqueous solution.
This peroxide generation is likely the source of protein oxidation during the aqueous
bioconjugation. Here, we demonstrate that the addition of catalase as well as appropriate ligand
selection can greatly reduce protein degradation and improve coupling in the Glaser-Hay
bioconjugation.
Streamlining the Glaser-Hay Bioconjugation
Bioconjugation reactions such as the Glaser-Hay on proteins containing UAAs can be time-
consuming and involve multiple purification steps. We sought to streamline the process through
attempting the Glaser-Hay bioconjugation reaction on the lysate from purification as well as during
the protein purification process (Figure 3.12). Each of these two novel reaction pathways was
tested on ligands 2, 3, and 4 in Glaser-Hay bioconjugations with Fluor-488 alkyne dye. Preparation
of ligand solutions and duration of reaction time were the same as the aforementioned conditions.
![Page 48: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/48.jpg)
38
To prepare to test the Glaser-Hay bioconjugation during the protein purification process,
the protein was purified, with purification facilitated by the hexa-histidine tag present at the end
of the protein. Purification was performed using a Qiagen Ni-NTA Quik Spin Kit according to
manufacturer’s protocol up until the elution step. At this point, the GFP/pPrF was bound to the Ni-
NTA resin, and reactants were added in efforts to perform the Glaser-Hay bioconjugation with the
protein bound to the purification matrix.
To test the Glaser-Hay bioconjugation on cell lysate, protein expressions were spun down
and lysed using commercially available BugBuster for 20 minutes. After centrifugation, the lysate
was used directly in the Glaser-Hay bioconjugation.
![Page 49: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/49.jpg)
39
Both reaction preparation strategies were successful, as indicated by the presence of
fluorescence bands on the SDS-PAGE (Figure 3.13). Binding the mutant protein to the nickel
purification resin prior to conducting the Glaser-Hay bioconjugation afforded better coupling than
conducting the reaction on the lysate. Nevertheless, each of these approaches allows for increased
applicability of the Glaser-Hay bioconjugation through streamlining the reaction process and
rendering no need for additional purification steps.
Conclusion
Overall, our results suggest that the aqueous Glaser-Hay reaction does not progress through
a dicopper intermediate, which is mechanistically different from the organic Glaser-Hay reaction.
Furthermore, we successfully demonstrated that the addition of catalase to the Glaser-Hay
bioconjugation improves coupling and reduces protein degradation, suggesting that hydrogen
peroxide is formed as a byproduct of the aqueous Glaser-Hay reaction. Additionally, we further
investigated the impact of various nitrogenous ligands on the Glaser-Hay bioconjugation,
presenting biquinoline (4) as a promising ligand for future use. Finally, we demonstrated the
feasibility and applicability of a streamlined approach to conducting the Glaser-Hay
bioconjugation through carrying out the reaction on the cell lysate or during protein purification.
![Page 50: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/50.jpg)
40
Materials and Methods
General. Reactions were conducted under ambient atmosphere with non-distilled solvents. NMR
data was acquired on a Varian Gemini 400 MHz. All GFP proteins were purified according to
manufacturer’s protocols using a Qiagen Ni-NTA Quik Spin Kit.
Dimerization of Propargyl Alcohol
The following was used as the standard to monitor the aqueous Glaser-Hay coupling. Amounts of
Cu(I), TMEDA, and propargyl alcohol were varied to analyze the effect of each on the reaction
kinetics. To a flame-dried vial, 8 mg of copper(I) iodide (2.4 mol %) was added to 2 mL D2O,
along with 10 µL of TMEDA (4.0 mol %). Next, 100 µL of propargyl alcohol (1.717 mmol, 1 eq)
was added, and air was bubbled through the reaction for 10 minutes. The reaction vial was sealed
and was stirred at 80°C for 12 hours. Timepoints were taken at 1 hour, 3 hours, 6 hours, 8 hours,
10 hours, and 12 hours. At each timepoint, a sample was removed from the vial and directly added
to an NMR tube for 1H and 13C NMR analysis.
Synthesis of p-dipropargylaminophenylalanine (pPrF)
Synthesis of p-propargyloxyphenylalanine (pPrF): Boc-Tyrosine-OMe (114 mg, 2 eq, 0.385
mmol) was added to a flame-dried vial. Cesium carbonate (254 mg, 3 eq, 0.578 mmol) was then
added, followed by dry DMF (3 mL). This mixture was stirred at 100°C for 20 mins. 5- Bromo-1-
pentyne (20 µL, 1 eq, 0.193 mmol) was then added to the mixture, as well as a catalytic potassium
iodide. The reaction was stirred overnight at 100°C, then cooled to room temperature and extracted
with brine (10 mL) and diethyl ether (10 mL). The ether layer was then washed with brine (10 mL
x 3). The brine layer was then back-extracted with ether (10 mL). The organic layers were
![Page 51: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/51.jpg)
41
combined, dried with magnesium sulfate, filtered, and excess solvent was removed in vacuo.
Column chromatography (silica gel, 5:1 hexanes/ethyl acetate) was performed to yield the
protected product. This was then dissolved in 1,4-dioxane (2 mL). Then, 1 M lithium hydroxide
(2 mL) was added and the reaction was stirred at room temperature for 2 hours. 1,4-dioxane was
then removed in vacuo and the resulting water solution was acidified through the dropwise addition
of 6 M HCl. The reaction was then extracted into ethyl acetate and the organic layer dried with
magnesium sulfate and filtered. Excess solvent was removed in vacuo to yield a colorless oil. This
oil was dissolved in dichloromethane (DCM, 1.5 mL). Trifluoroacetic acid (TFA, 0.5 mL) was
added and the reaction was stirred at room temperature for 1 hour. Excess solvent was removed in
vacuo to yield pPrF as a white crystal (22 mg, 0.061 mmol, 31.6% yield). 1H NMR (400 MHz,
CDCl3): δ 7.02 (d, J = 12 Hz, 2 H), 6.82 (d, J = 12 Hz, 2 H), 4.95 (d, J = 8 Hz, 1 H), 4.53 (d, J = 8
Hz, 1 H), 4.03 (t, J = 4 Hz, 2 H), 3.71 (s, 3 H), 3.02 (m, J = 8 Hz, 1 H), 2.39 (t, J = 4 Hz, 2 H), 1.97
(m, J = 8 Hz, 2 H), 1.55 (s, 1 H), 1.41 (s, 9 H). 13C NMR (400 MHz, CDCl3): δ 172.4, 157.9, 130.3,
127.9, 114.5, 83.5, 79.9, 68.8, 66.0, 54.5, 52.2, 37.4, 28.3, 28.2, 21.1, 15.1.
Expression of pPrF-containing GFP-151
Escherichia coli BL21(DE3) cells were co-transformed with a pET-GFP-TAG-151 plasmid (2.0
µL) and a pEvol-pCNF plasmid (2.0 µL) using an Eppendorf electroporator. Cells were then plated
on LB-agar plates supplemented with ampicillin (50 mg/mL) and chloramphenicol (34 mg/mL)
and grown at 37°C. After 16 hours, a single colony was used to inoculate LB media (10 mL)
supplemented with ampicillin and chloramphenicol. The culture was grown to confluence at 37°C
over 16 hours. This culture was then used to begin an expression culture in LB media (250 mL) at
OD600 = 0.1, then incubated at 37°C until it reached an OD600 of between 0.7 and 0.8. At this point,
![Page 52: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/52.jpg)
42
mutant protein expression was induced through the addition of 1 M ITPG (250 µL) and 20%
arabinose (250 µL), as well as 100 mM pPrF (2.5 mL). Induced cells were grown for an additional
16 hours at 30°C, then harvested via centrifugation (10 mins, 5000 rpm). The media was decanted,
and the cell pellet was stored in a -80°C freezer for 20 minutes. Mutant GFP was then purified
using commercially available Ni-NTA spin columns according to the manufacturer’s protocol.
Protein yield and purity was then assessed via SDS-PAGE and spectrophotometrically via a
Nanodrop spectrophotometer. Protein was then transferred into phosphate buffered saline solution
(PBS) using 10k MWCO spin columns prior to use in bioconjugation reactions.
Glaser-Hay Bioconjugation Protocol
To a sterile 1.5 mL eppendorf tube, the following were added: 5 µL of a vigorously shaken solution
of CuI (500 mM in H2O) and 5 µL of nitrogenous ligand (500 mM). The two solutions were
thoroughly mixed by pipetting. Next, 30 µL of GFP containing a terminal alkyne UAA (GFP/
pPrF; pH = 8.0, 1.04 ± 0.03 mg/mL) and 20 µL of Fluor-488 Alkyne (1 mM in DMSO) were added
to the tube. Finally, 5 µL of catalase (10 mg/mL in H2O) was added to the tube. For control
reactions, 5 µL of PBS at the appropriate pH was added in place of catalase. The reaction was
incubated at room temperature (22°C) for the appropriate reaction duration. Excess reactants were
then removed by buffer exchange using 10k MWCO concentrator columns. The reaction was
washed with PBS (8 × 200 µL) to a final volume of 50 µL. The reaction was analyzed by SDS-
PAGE and imaged immediately to analyze fluorescence. Fluorescence intensity indicated the
effective coupling reaction as the GFP is denatured and no longer fluorescent, while the coupling
to the fluorophore re-establishes a fluorescent signal. The gel was then stained for 3 hours using
Coomassie Brilliant Blue, then destained overnight using a methanol solution (60% deionized
![Page 53: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/53.jpg)
43
H2O, 30% MeOH, 10% acetic acid). The gel was then analyzed again on the gel imager to indicate
protein presence and relative degradation.
Protocol for Glaser-Hay bioconjugation during protein purification
Expression of GFP/pPrF was spun down and cells were lysed using commercially available
BugBuster™. 250 µL of lysate was added to 100 µL of Ni-NTA resin and allowed to bind and was
washed according to manufacturer’s protocol. The resin was then washed with PBS (5 x 200 µL).
Then, 75 µL of PBS was added to wet the resin. Next, 10 µL of a premixed 1:1 solution of CuI
(500 mM in H2O) and nitrogenous ligand (500 mM) was added. Finally, 40 µL of Fluor-488
Alkyne (1 mM in DMSO) was added. The reaction was incubated at room temperature (22°C) for
the appropriate reaction duration. The nickel resin was then washed with PBS (8 x 200 µL) and
wash buffer (3 x 200 µL) and protein was eluted following manufacturer’s protocol. The reaction
was analyzed by SDS-PAGE and imaged immediately to analyze fluorescence. Fluorescence
intensity indicated the effective coupling reaction as the GFP is denatured and no longer
fluorescent, while the coupling to the fluorophore re-establishes a fluorescent signal. The gel was
then stained for 3 hours using Coomassie Brilliant Blue, then destained overnight using a methanol
solution (60% deionized H2O, 30% MeOH, 10% acetic acid). The gel was then analyzed again on
the gel imager to indicate protein presence and relative degradation.
Protocol for Glaser-Hay bioconjugation on cell lysate
Expression of GFP/pPrF was spun down and cells were lysed using commercially available
BugBuster. The lysed cells were centrifuged again and the lysate was decanted. 20 µL of a
premixed 1:1 solution of CuI (500 mM in H2O) and nitrogenous ligand (500 mM) was added to
![Page 54: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/54.jpg)
44
250 µL of lysate. Next, 40 µL of Fluor-488 Alkyne (1 mM in DMSO) was added. The reaction
was incubated at room temperature (22°C) for the appropriate reaction duration. The lysate was
then bound to Ni-NTA resin and protein was purified according to manufacturer’s protocol. The
reaction was analyzed by SDS-PAGE and imaged immediately to analyze fluorescence.
Fluorescence intensity indicated the effective coupling reaction as the GFP is denatured and no
longer fluorescent, while the coupling to the fluorophore re-establishes a fluorescent signal. The
gel was then stained for 3 hours using Coomassie Brilliant Blue, then destained overnight using a
methanol solution (60% deionized H2O, 30% MeOH, 10% acetic acid). The gel was then analyzed
again on the gel imager to indicate protein presence and relative degradation.
References
1. Hermanson, G.T. (2013). Bioconjugate Techniques. Academic press.
2. Lang, K. & Chin, J.W. (2014). Cellular incorporation of unnatural amino acids and
bioorthogonal labeling of proteins. Chem. Rev., 114, 4764-4806.
3. Sievers, E.L. & Senter, P.D. (2013). Antibody-drug conjugates in cancer therapy. Annu.
Rev. Med., 64, 15-29.
4. Jaiswal, J.K., Mattoussi, H., Mauro, J.M., & Simon, S.M. (2003). Long-term multiple
color imaging of live cells using quantum dot bioconjugates. Nat. Biotechnol., 21, 47-51.
5. Gao, X., Cui, Y., Levenson, R.M.., Chung, L.W., & Nie, S. (2004). In vivo cancer
targeting and imaging with semiconductor quantum dots. Nat. Biotechnol., 22, 969-976.
6. Agarwal, P. & Bertozzi, C.R. (2015). Site-specific antibody−drug conjugates: the nexus of
bioorthogonal chemistry, protein engineering, and drug development. Bioconj. Chem., 26,
176-192.
![Page 55: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/55.jpg)
45
7. Stephanopoulos N. & Francis M.B. (2011). Choosing an effective protein bioconjugation
strategy. Nat Chem Biol., 7, 876-884.
8. Young, T.S. & Schultz, PG. (2010). Beyond the canonical 20 amino acids: Expanding the
genetic lexicon. J. Biol. Chem., 285, 11039–11044.
9. Wang, L., Xie, J., and Schultz, P.G. (2006). Expanding the genetic code. Annu. Rev.
Biophys Biomol. Struct., 35, 225-249.
10. Liu, C., & Schultz, P.G. (2010). Adding new chemistries to the genetic code. Annu. Rev.
Biochem., 79, 413-44.
11. Siemsen, P., Livingston, R.C., & Diederich, F. (2000). Acetylenic coupling: a powerful
tool in molecular construction. Angew. Chem. Int. Ed., 39, 2632-2657.
12. Lampkowski, J.S., Villa, J.K., Young, T.S., & Young, D.D. (2015). Development and
Optimization of Glaser–Hay Bioconjugations. Angew. Chem. Int. Ed., 54, 9343-9346.
13. Nizami, T. & Hua, R. (2013). Cycloaddition of 1,3-butadiynes: efficient synthesis of carbo-
and heterocycles. Molecules, 19, 13788-13802.
14. Sun, H., Wu, X., & Hua, R. (2011). Copper(I)-catalyzed reaction of diaryl buta-1,3-diynes
with cyclic amines: an atom-economic approach to amino-substitued naphthalene
derivatives. Tet. Lett., 52, 4408-4411.
15. Yang, L & Hua, R. (2013). Cycloaddition of 1,4-diaryl-1,3-butadiynes with nitriles: an
atom-economic one-pot approach to benzo[f]quinazolines. Chem. Lett., 42, 769-771.
16. Yu, D., de Azambuja, F., Gensch, T., Daniliuc, C., & Glorius, F. (2014). The C-H
activation/1,3-diyne strategy: highly selective direct synthesis of diverse bisheterocycles
by Rh-III catalysis. Angew. Chem. Int. Ed., 53, 9650-9654.
![Page 56: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/56.jpg)
46
17. Pigulski, B., Mecik, P., Cichos, J., & Szafert, S. (2017). Use of stable amine-capped
polyynes in the regioselective synthesis of push-pull thiophenes. J. Org. Chem., 82, 1487-
1498.
18. Nimmo, Z.M., Halonski, J.F., Chatkewitz, L.E., & Young, D.D. (2018). Development of
optimized conditions for Glaser-Hay bioconjugations. Bioorg. Chem., 76, 326-331.
19. Bohlmann, F., Schonowsky, H., Inhoffen, E., & Grau, G. (1964). Polyacetylenic
compounds. LII. The mechanism of oxidative dimerization of acetylene
compounds. Chem. Ber, 97, 794-800.
20. Fomina, L., Vazquez, B., Tkatchouk, E., & Fomine, S. (2002). The Glaser reaction
mechanism. A DFT study. Tetrahedron, 58, 6741-6747.
21. Vilhelmsen, M.H., Jensen, J., Tortzen, C.G., & Nielsen, M.B. (2013). The Glaser–Hay
Reaction: Optimization and Scope Based on 13C NMR Kinetics Experiments. Eur. J. Org.
Chemistry, 2013(4), 701-711.
22. Curley, J.M., Lenz, R.W., Fuller, R.C., Browne, S.E., Gabriell, C.B., & Panday, S.
(1997). 13C NMR spectroscopy in living cells of Pseudomonas oleo vorans. Polymer, 38,
5313-5319.
23. Medson, C., Smallridge, A.J., & Trewhella, M.A. (2001). Baker's yeast activity in an
organic solvent system. J. Mol. Catal. B Enzym., 11, 897-903.
24. Green, D.L., Jayasundara, S., Lam, Y.F., & Harris, M.T. (2003). Chemical reaction
kinetics leading to the first Stober silica nanoparticles–NMR and SAXS investigation. J.
Non-Cryst. Solids, 315, 166-179.
![Page 57: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/57.jpg)
47
25. Oh, J.S., Choi, M.H., & Yoon, S.C. (2005). In vivo 13C-NMR spectroscopic study of
polyhydroxyalkanoic acid degradation kinetics in bacteria. J Microbiol. Biotechnol., 15,
1330-1336.
26. Salon, M.C.B., Gerbaud, G., Abdelmouleh, M., Bruzzese, C., Boufi, S., & Belgacem,
M.N. (2007). Studies of interactions between silane coupling agents and cellulose fibers
with liquid and solid‐state NMR. Magn. Reson. Chem., 45, 473-483.
27. Ren, G., Cui, X., Yang, E., Yang, F., & Wu, Y. (2010). Study on the Heck reaction
promoted by carbene adduct of cyclopalladated ferrocenylimine and the related reaction
mechanism. Tetrahedron, 66, 4022-4028.
28. Hein, J.E. & Fokin, V.V. (2010). Copper-catalyzed azide–alkyne cycloaddition (CuAAC)
and beyond: new reactivity of copper (I) acetylides. Chem. Soc. Rev., 39, 1302-1315.
29. Makarem, A., Berg, R., Rominger, F., & Straub, B.F. (2015). A fluxional copper
acetylide cluster in CuAAC catalysis. Angew. Chem. Int. Ed., 54, 7431-7435.
30. Klingelhoeffer, C., Kämmerer, U., Koospal, M., Mühling, B., Schneider, M., Kapp, M.,
Kübler, A., Germer, C.T., & Otto, C. (2012). Natural resistance to ascorbic acid induced
oxidative stress is mainly mediated by catalase activity in human cancer cells and
catalase-silencing sensitizes to oxidative stress. BMC Complem. Altern. M., 12, 61.
31. Simpson, J.A., Cheeseman, K.H., Smith, S.E., & Dean, R.T. (1988). Free-radical
generation by copper ions and hydrogen peroxide. Stimulation by Hepes buffer. Biochem.
J., 254, 519-523.
![Page 58: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/58.jpg)
48
CHAPTER 4: SYNTHESIS OF A NOVEL DIPROPARGYL AMINE UAA AND
DEVELOPMENT OF A NOVEL CYCLOTRIMERIZATION BIOCONJUGATION
Introduction
A wide array of bioconjugation reactions are presently employed in the fields of medicine,
pharmaceuticals, and materials. 1-3 Protein bioconjugates are especially critical for drug delivery,
as targeted localization of drugs via the specificity of antibodies allows for reduced side effects in
chemotherapy patients, as lower doses can provide the same therapeutic effect as high quantities
of the unconjugated small molecule drug
alone.4-7
Unnatural amino acid (UAA)
technology represents a means to develop
bioorthogonal well-defined, homogenous
protein bioconjugate products, which have been
shown to have therapeutic advantages over
heterogenous bioconjugates.8-12 One common reaction employed to prepare a well-defined,
homogenous protein bioconjugate is the copper-catalyzed azide alkyne cycloaddition (CuAAC),
known as the “copper click” reaction, in which an UAA with an alkyne group is reacted with an
azide-containing reaction partner.9-11 However, there are a limited number of bioconjugation
reactions available for use with UAAs to generate protein bioconjugates (Figure 4.2).5 Thus, it is
![Page 59: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/59.jpg)
49
critical to develop novel bioconjugation reactions to provide numerous chemical tools for different
applications and expand the scope of bioconjugation reactions.
The [2 + 2 + 2] cyclotrimerization reaction can be catalyzed by a variety of transition metals
and relies on three terminal alkyne groups reacting to generate polycyclic compounds, in a fashion
similar to a Diels-Alder reaction.13 This cycloaddition is widely used and is a key organic
methodology to generate a stable, polysubstituted benzene ring.14 To the best of our knowledge, a
biological [2 + 2 + 2] cyclotrimerization has never been reported, despite the prominence of this
reaction in organic synthesis. Recently, Wang et al. reported the success of a rhodium-catalyzed
cyclotrimerization in aqueous conditions in air at 60°C, demonstrating the potential success of this
reaction under
milder conditions
that may be feasible
under physiological
environments (Figure 4.3).15 We sought to implement principles from this reaction into a biological
system to afford a novel bioconjugation reaction, adding to the chemical biology toolbox to assist
in probing diseases and improving drug delivery systems.
Herein, we report a novel cyclotrimerization bioconjugation utilizing a newly synthesized
and site-specifically incorporated dipropargyl amine UAA. This work has key applications
towards the preparation of specific, homogenous protein bioconjugates with applications in
medicine, pharmaceuticals, and materials.
![Page 60: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/60.jpg)
50
Development of Physiologically Compatible [2 + 2 + 2] Cyclotrimerization
Given the aqueous cycloaddition demonstrated by Wang and colleagues, we sought to test
whether this reaction could proceed successfully at temperatures lower than 60°C using the same
dicarboxylated biphenyl ligand that has previously been demonstrated
to provide effective chelation in the Glaser-Hay bioconjugation
(Figure 4.4).16 As a proof-of-concept experiment, we attempted to
dimerize propargyl ether under similar conditions as previously
reported (Figure 4.5). Gratifyingly, when performed at room temperature, product was able to be
detected by thin layer chromatography (TLC) and 1H NMR (29.8% yield).
Synthesis of UAA with Dipropargyl Functionality
In order for this reaction to be useful in an amino acid context, a dipropargyl functionality
is essential. Thus, we synthesized an UAA containing the dipropargyl amine functionality base on
a substituted phenylalanine backbone, 1, which we named pDPrAF. Para-amino-phenylalanine
was substituted with propargyl bromide in a similar fashion to the alkyne-containing UAA pPrF
synthesis (Figure 4.6). Though intending for addition of the alkyne-containing propargyl groups
to react solely at the amine, we also observed reaction at the unprotected carboxylic acid as well.
However, we realized that the standard deprotection protocol would convert the ester back to the
![Page 61: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/61.jpg)
51
desired carboxylic acid while retaining the desired dipropargylamine functionality. Thus, we chose
not to initially protect the carboxylic acid group to reduce the overall number of steps in the
synthesis.
Our two-step synthesis afforded the desired product 1 with an overall yield of 47.1%. The
first step, the SN2-like addition of three alkyne-containing propargyl groups to the molecule,
resulted in the formation of the intermediate with good yield (47.9%). The intermediate was then
deprotected in a series of acid/base reactions to afford the desired product in excellent yield (98%).
Site-specific Incorporation of pDPrAF
Following the synthesis of 1, the next requisite is the genetic encoding of the new UAA.
While this typically requires the previously described double-sieve selection, previous research
reports that several pre-existing aaRS/tRNA pairs demonstrate a degree of polyspecificity towards
multiple UAAs. Consequently, we attempted to identify an appropriate aaRS capable of both
recognizing 1 and charging it onto the appropriate tRNA. We first investigated several synthetases
for testing due to either known polyspecificity or due to their incorporation of structurally similar
UAAs.17 Plasmids encoding both the aaRS and tRNA were co-transformed into BL21(DE3) E.
coli with a pET-GFP-TAG-151
plasmid, harboring GFP with a
TAG codon at position 151.
Following protein expression, GFP
mutants were purified using a Ni-
NTA resin and analyzed by SDS-PAGE to determine incorporation of 1. Gratifyingly, the
promiscuous pCNF aaRS was shown to effectively incorporate 1 into GFP at position 151, in
similar yields to its incorporation of pPrF and pBrPrF, two commonly employed alkyne-containing
![Page 62: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/62.jpg)
52
UAAs (Figure 4.7). Thus, the previously evolved pCNF aaRS was utilized to express mutant GFP
harboring 1 at position 151.
Development and Optimization of Biological [2 + 2 + 2] Cyclotrimerization
Next, we moved to work to exploit the functionality of 1 in order to develop a biological
cyclotrimerization. As is the case in other bioconjugations, the amount of transition metal catalyst
added to the reaction should be minimized, as such metals can be cytotoxic and can negatively
impact biological systems. However, the toxicity of rhodium has been demonstrated to be lower
than that of other transition metals, including platinum, palladium, cadmium, nickel and
chromium.18 More specifically, in assays testing the impact of transition metals on oxidative
damage in epithelial cells, rhodium was demonstrated to be the least cytotoxic of the metals tested.
Further, rhodium complexes have also been integrated into proteins to generate a stable
organometallic protein containing rhodium.19 Thus, it is reasonable to attempt to employ rhodium
in bioconjugation reactions, provided low concentrations and relatively short reaction times.
To test the viability of this reaction, we sought to couple the pDPrAF mutant GFP with
Fluor 488 Alkyne (Figure 4.8). To do this, we mixed 5 µL of a rhodium (I) dimer complex,
[Rh(cod)Cl]2 (250 mM in DMSO), with 5 µL of carboxylated biphenyl ligand (500 mM in H2O).
Then, 30 µL of pDPrAF mutant GFP (pH = 7.4, ~1.0 g/mL) and 20 µL of Fluor-488 alkyne (1
mM in DMSO) were added. This aqueous reaction ran for 12 hours at 4°C. A lower temperature
than in the organic test of this aqueous coupling was employed in order to limit protein degradation
by rhodium. Gratifyingly, the reaction was successful, as indicated by the presence of a fluorescent
band on the SDS-PAGE gel at the appropriate molecular weight. Due to the denaturing gel, the
GFP protein should be denatured, and the fluorescent signal is the result of a direct conjugation
![Page 63: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/63.jpg)
53
between the protein and the fluorophore. Unfortunately, in initial reactions, significant levels of
protein oxidation were also observed.
We hypothesized that the observed protein oxidation was due to the formation of radicals
at some point in the reaction process. To test this hypothesis, we employed catalase and sodium
ascorbate as radical scavengers to reduce protein oxidation and minimize protein degradation. As
previously described in Chapter 3, our lab has previously employed catalase to reduce protein
degradation in the aqueous Glaser-Hay bioconjugation.20 Further, sodium ascorbate has a long
history of use reducing protein oxidation in bioconjugation reactions, namely in the copper click
reaction and in biological Sonogashira couplings.10,21 Both catalase and sodium ascorbate resulted
in significantly reduced protein degradation, suggesting that damaging radicals are likely formed
at some point in the reaction. The addition of sodium ascorbate was demonstrated to be the most
effective in preventing protein degradation. Overall, we successfully performed a novel
bioconjugation reaction between GFP harboring 1 in position 151 and Fluor 488 alkyne through a
[2 + 2 + 2] cyclotrimerization. The resulting product was confirmed via SDS-PAGE as described,
and samples have been sent to mass spectral analysis for validation of product formation.
![Page 64: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/64.jpg)
54
We then sought to further optimize the reaction. Initially, a time course was conducted,
investigating reaction times of 0 hours, 2 hours, 4 hours, 8 hours, 12 hours, and 24 hours with all
other conditions kept constant. It was elucidated that protein degradation increased fairly linearly
with time, and the maximum ratio of coupling to form the bioconjugate product occurred after a
reaction time of 2 hours (Figure 4.9).
Then, we sought to test the effect of temperature on the reaction, evaluating reaction
temperatures of 4°C, 22°C (room temperature), and 37°C. These reactions were conducted for 2
hours with all other conditions held constant. It was observed that the 22°C reaction afforded the
best coupling with no more protein degradation than was observed in the 4°C reaction. temperature
Reaction at 37°C led to significant protein degradation and reduced coupling (Figure 4.10).
![Page 65: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/65.jpg)
55
Finally, we sought to determine the effect of different pH solutions on the reaction. In our
original proof of concept, GFP harboring 1 in a phosphate-buffer solution with pH 7.4 was
employed. Consequently, the cyclotrimerization reaction was conducted for 2 hours at 4°C on
reactions containing protein in solution of pH 6.0, pH 7.4, and pH 8.0. While pH did not appear to
have an effect on coupling, it did have minor impact on protein degradation, with the pH 7.4
reaction affording the least protein degradation.
Investigation of the Versatility of pDPrAF
Finally, versatility of the novel UAA 1 was assessed through examining its reactivity in
alkyne/azide 1,3-dipolar bioconjugations as well as Glaser-Hay bioconjugations. For the
![Page 66: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/66.jpg)
56
alkyne/azide 1,3-dipolar
(copper click) bioconjugation,
the terminal alkyne groups of 1
within GFP were reacted with
an azide-containing
fluorophore to form the stable
triazole complex. For the
Glaser-Hay bioconjugation,
the terminal alkyne group in 1
in GFP was reacted with an
alkyne-containing fluorophore
in the presence of a
Cu(I)/TMEDA catalyst to
generate a linear, stable diyne functional group. For each of these reactions, we also hypothesized
that these reactions could occur on both terminal alkynes within the same protein, which would
afford a bioconjugate with two fluorophores attached to GFP at position 151. Gratifyingly, SDS-
PAGE demonstrated that 1 incorporated into proteins is capable of being employed in both copper
click and Glaser-Hay bioconjugations. Samples have been sent for mass spectrometry to confirm
these results and to determine whether attachment of two fluorophores is observed. Combined with
its use in our newly developed cyclotrimerization bioconjugation, there are at least three distinct
bioconjugation reactions in which pDPrAF can participate, making it a valuable amino acid
(Figure 4.12).
![Page 67: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/67.jpg)
57
Conclusion
Overall, we present the synthesis and incorporation of a novel, dipropargyl amine UAA
with unique functionality capable of undergoing both the alkyne/azide 1,3-dipolar cycloaddition
and Glaser-Hay bioconjugations. Further, this novel UAA was utilized in a novel
cyclotrimerization bioconjugation. This bioconjugation affords a highly stable, polysubstituted
benzene ring as part of the conjugate, generating a highly stable covalent linkage between the two
reaction partners. This novel biological reaction has applications in medicine, pharmaceuticals,
and materials.
Materials and Methods
General
Reactions were conducted under ambient atmosphere with non-distilled solvents. NMR data was
acquired on a Varian Gemini 400 MHz. All GFP proteins were purified according to
manufacturer’s protocols using a Qiagen Ni-NTA Quik Spin Kit.
Synthesis of p-dipropargylaminophenylalanine (pDPrAF)
p-Aminophenylalanine-OMe (0.500 g, 1 eq, 1.784 mmol) was added to a flame-dried vial.
Potassium carbonate (1.232 g, 5 eq, 8.918 mmol) was added, followed by DMF (7 mL). This
mixture was stirred at room temperature for 5 minutes. Propargyl bromide (0.781 mL, 5 eq, 8.918
mmol) was then added and the reaction was stirred at 80°C for 96 hours. The reaction was then
cooled to room temperature and extracted with DCM and brine. The organic layers were combined,
dried with magnesium sulfate, filtered, and excess solvent was removed in vacuo. The reaction
was purified via flash chromatography (silica gel, 3:1 hexanes:ethyl acetate) to yield the desired
![Page 68: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/68.jpg)
58
product as a yellow oil (0.337 g, 0.855 mmol, 47.9% yield). 1H NMR (400 MHz, CDCl3): δ 7.06
(d, J = 9 Hz, 2 H), 6.87 (d, J = 9 Hz, 2 H), 4.96 (d, J = 8 Hz, 1 H), 4.70 (q, J = 18 Hz, 2 H), 4.56
(d, J = 8 Hz, 1 H), 4.08 (s, 4 H), 3.02 (t, J = 8 Hz, 2 H), 2.51 (s, 1 H), 2.24 (s, 2 H), 1.41 (s, 9 H).
13C NMR (400 MHz, CDCl3): δ 171.4, 155.3, 147.0, 130.3, 126.8, 115.9, 80.1, 79.4, 75.6, 72.9,
54.5, 52.7, 40.6, 37.2, 28.5. M/Z = 395.3.
![Page 69: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/69.jpg)
59
This product was then dissolved in 1,4-dioxane (2 mL). Then, 1 M lithium hydroxide (2 mL) was
added and the reaction was stirred at room temperature for 2 hours. 1,4-dioxane was then removed
in vacuo and the resulting water solution was acidified through the addition of 6 M HCl. The
reaction was then extracted into ethyl acetate and the organic layer dried with magnesium sulfate
and filtered. Excess solvent was removed in vacuo to yield a light brown oil. This oil was dissolved
in DCM (1.5 mL). Trifluoroacetic acid (TFA, 0.5 mL) was added and the reaction was stirred at
room temperature for 1 hour. Excess solvent was removed in vacuo to yield pDPrAF as a brown
solid (0.215 g, 0.840 mmol, 98% yield). 1H NMR (400 MHz, MeOD): δ 7.18 (d, J = 9 Hz, 2 H),
6.98 (d, J = 9 Hz, 2 H), 4.13 (s, 4 H), 3.30 (s, 1 H), 3.24 (dd, J = 9 Hz, 1 H), 3.07 (dd, J = 9 Hz, 1
H), 2.58 (s, 2 H). 13C NMR (400 MHz, MeOD): δ 147.6, 129.9, 124.6, 116.0, 78.9, 72.7, 39.8,
35.3. M/Z = 257.1. Overall yield 47.1%.
![Page 70: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/70.jpg)
60
Expression of pDPrAF-containing GFP-151
Escherichia coli BL21(DE3) cells were co-transformed with a pET-GFP-TAG-151 plasmid (2.0
µL) and a pEvol-pCNF plasmid (2.0 µL) using an Eppendorf electroporator. Cells were then plated
on LB-agar plates supplemented with ampicillin (50 mg/mL) and chloramphenicol (34 mg/mL)
and grown at 37°C. After 16 hours, a single colony was used to inoculate LB media (10 mL)
supplemented with ampicillin and chloramphenicol. The culture was grown to confluence at 37°C
over 16 hours. This culture was then used to begin an expression culture in LB media (20 mL) at
OD600 = 0.1, then incubated at 37°C until it reached an OD600 of between 0.7 and 0.8. At this point,
mutant protein expression was induced through the addition of 1 M ITPG (20 µL) and 20%
arabinose (20 µL), as well as 100 mM pDPrAF (200 µL). Induced cells were grown for an
additional 16 hours at 30°C, then harvested via centrifugation (10 mins, 5000 rpm). The media
was decanted, and the cell pellet was stored in a -80°C freezer for 20 minutes. Mutant GFP was
then purified using commercially available Ni-NTA spin columns according to the manufacturer’s
protocol. Protein yield and purity was then assessed via SDS-PAGE and spectrophotometrically
![Page 71: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/71.jpg)
61
via a Nanodrop spectrophotometer. Protein was then transferred into phosphate buffered saline
solution (PBS) using 10k MWCO spin columns prior to use in bioconjugation reactions.
Biological Cyclotrimerization protocol
To a sterile 1.5 mL Eppendorf tube, the following were added: 5 µL of [Rh(cod)Cl]2 (250 mM in
DMSO) and 5 µL of 2,2’-Bipyridine-4,4’-dicarboxylic acid (500 mM in DI H2O). The two
solutions were mixed thoroughly by pipetting until a dark red color was achieved. Next, 30 µL of
GFP containing pDPrAF at position 151 (GFP/pDPrAF; pH=7.4; ~1.0 mg/mL) and 20 µL of Fluor-
488 Alkyne (1 mM in DMSO) were added to the tube. Finally, 5 µL of sodium L-ascorbate (200
mM in DI H2O) was added to the tube. The reaction was incubated at 4°C. After 2 hours, excess
reactants were removed via buffer exchange using 10k MWCO spin columns. The reaction was
washed with phosphate buffered saline solution (pH 7.4 PBS, 8 x 200 µL) to a final volume of 50
µL. The reaction was analyzed by SDS-PAGE and imaged using a SYPRO Ruby scan to analyze
fluorescence. The gel was stained for 3 hours using Coomassie Brilliant Blue, then destained
overnight using a methanol solution (60% deionized water, 30% methanol, 10% glacial acetic
acid). The gel was then imaged using a Coomassie scan protocol.
Biological Glaser-Hay protocol
To a sterile 1.5 mL Eppendorf tube, the following were added: 5 µL of a vigorously shaken CuI
solution (500 mM in DI H2O) and 5 µL of tetramethylethylenediamine (500 mM in DI H2O). The
two solutions were thoroughly mixed by pipetting. Next, 30 µL of GFP containing pDPrAF at
position 151 (GFP151/pDPrAF; pH = 6; ~1.0 mg/mL) and 20 µL of Fluor-488 Alkyne (1 mM in
DMSO) were added to the tube. The reaction was incubated at room temperature (22°C). After 4
![Page 72: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/72.jpg)
62
hours, excess reactants were removed via buffer exchange using 10k MWCO concentrator
columns. The reaction was washed with phosphate buffered saline solution (pH 6 PBS, 8 x 200
µL) to a final volume of 50 µL. The reaction was analyzed by SDS-PAGE and imaged using a
SYPRO Ruby scan to analyze fluorescence. The gel was stained for 3 hours using Coomassie
Brilliant Blue, then destained overnight using a methanol solution (60% deionized water, 30%
methanol, 10% glacial acetic acid). The gel was then imaged using a Coomassie scan protocol.
Biological copper click protocol
To a sterile 1.5 mL Eppendorf tube, the following were added: 2 µL of CuSO4 solution (50 mM in
DI H2O) and 2 µL of TCEP (50 mM in DI H2O). The two solutions were thoroughly mixed by
pipetting. Next, 20 µL of GFP containing pDPrAF at position 151 (GFP151/pDPrAF; pH = 7.4;
~1.0 mg/mL) and 10 µL of Fluor-488 Azide (1 mM in DMSO) were added to the tube. Finally, 10
µL of TBTA (5 mM in DMSO) was added to the tube. The reaction was incubated at 4°C. After
16 hours, excess reactants were removed via buffer exchange using MWCO concentrator columns.
The reaction was washed with phosphate buffered saline solution (pH 7.4 PBS, 8 x 200 µL) to a
final volume of 50 µL. The reaction was analyzed by SDS-PAGE and imaged using a SYPRO
Ruby scan to analyze fluorescence. The gel was stained for 3 hours using Coomassie Brilliant
Blue, then destained overnight using a methanol solution (60% deionized water, 30% methanol,
10% glacial acetic acid). The gel was then imaged using a Coomassie scan protocol.
References
1. Kalia, J., & Raines, R.T. (2010). Advances in bioconjugation. Curr. Org. Chem., 14, 138-
147.
2. Hermanson, G.T. (2013). Bioconjugate Techniques. Academic press.
![Page 73: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/73.jpg)
63
3. Lang, K. & Chin, J.W. (2014). Cellular incorporation of unnatural amino acids and
bioorthogonal labeling of proteins. Chem. Rev., 114, 4764-4806.
4. Sievers, E.L. & Senter, P.D. (2013). Antibody-drug conjugates in cancer therapy. Annu.
Rev. Med., 64, 15-29.
5. Agarwal, P. & Bertozzi, C.R. (2015). Site-specific antibody−drug conjugates: the nexus
of bioorthogonal chemistry, protein engineering, and drug development. Bioconj. Chem.,
26, 176-192.
6. Jaiswal, J.K., Mattoussi, H., Mauro, J.M., & Simon, S.M. (2003). Long-term multiple
color imaging of live cells using quantum dot bioconjugates. Nat. Biotechnol., 21, 47.
7. Gao, X., Cui, Y., Levenson, R.M., Chung, L.W., & Nie, S. (2004). In vivo cancer
targeting and imaging with semiconductor quantum dots. Nat. Biotechnol., 22, 969.
8. Stephanopoulos, N. & Francis, M.B. (2011). Choosing an effective protein
bioconjugation strategy. Nat. Chem. Biol., 7, 876.
9. Sletten, E.M. & Bertozzi, C.R. (2009). Bioorthogonal chemistry: fishing for selectivity in
a sea of functionality. Angew. Chem. Int. Ed., 48, 6974-6998.
10. Young, D.D. & Schultz, P.G. (2018). Playing with the molecules of life. ACS Chem.
Biol., 13, 854-870.
11. Young, T.S. & Schultz, P.G. (2010). Beyond the canonical 20 amino acids: expanding the
genetic lexicon. J. Biol. Chem., 285, 11039-11044.
12. Hallam, T.J., Wold, E., Wahl, A., & Smider, V.V. (2015). Antibody conjugates with
unnatural amino acids. Mol. Pharm., 12, 1848-1862.
13. Kotha, S., Brahmachary, E., & Lahiri, K. (2005). Transition metal catalyzed [2+ 2+ 2]
cycloaddition and application in organic synthesis. Euro. JOC, 22, 4741-4767.
![Page 74: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/74.jpg)
64
14. Yamamoto, Y. (2005). Recent advances in intramolecular alkyne cyclotrimerization and
its applications. Curr. Org. Chem., 9, 503.
15. Wang, Y.H., Huang, S.H., Lin, T.C., & Tsai, F.Y. (2010). Rhodium (I)/cationic 2, 2′-
bipyridyl-catalyzed [2+ 2+ 2] cycloaddition of α, ω-diynes with alkynes in water under
air. Tetrahedron, 66, 7136-7141.
16. Nimmo, Z.M., Halonski, J.F., Chatkewitz, L.E., & Young, D.D. (2018). Development of
optimized conditions for Glaser-Hay bioconjugations. Bioorg. Chem., 76, 326-331.
17. Young, D.D., Young, T.S., Jahnz, M., Ahmad, I., Spraggon, G., Schultz, P.G. (2011).
Biochemistry, 50, 1894-1900.
18. Schmid, S., Zimmerman, S., Krug, H.F., & Sures, B. (2007). Influence of platinum,
palladium and rhodium as compared with cadmium, nickel and chromium on cell
viability and oxidative stress in human bronchial epithelial cells. Environ. Int., 33, 385-
390.
19. Satake, Y., Abe, S., Okazaki, S., Ban, N., Hikage, T., Ueno, T., Nakajima, H., Suzuki, A.,
Yamane, T., Nishiyama, H., & Watanabe, Y. (2007). Incorporation of a phebox rhodium
complex into apo-myoglobin affords a stable organometallic protein showing
unprecedented arrangement of the complex in the cavity. Organometallics, 26, 4904-
4908.
20. Travis, C.R., Mazur, L.E., Peairs, E.M., & Young, D.D. (2018). Mechanistic
investigation into the biological Glaser-Hay reaction. Org. Biomol. Chem. (in
preparation)
![Page 75: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/75.jpg)
65
21. Li, N., Lim, R., Edwardraja, S., and Lin, Q. (2011) Copper-Free Sonogashira Cross-
Coupling for Functionalization of Alkyne-Encoded Proteins in Aqueous Medium and in
Bacterial Cells. J. Am. Chem. Soc., 133, 15316−15319.
![Page 76: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/76.jpg)
66
CHAPTER 5: TOWARDS THE DEVELOPMENT OF MULTIVALENT
BIOCONJUGATES
Introduction
As previously described, bioconjugates have widespread applications in various fields,
including therapeutics, diagnostics, and materials.1 However, each of the bioconjugation reactions
previously discussed, as well as nearly all the bioconjugation reactions utilized employ just two
reaction partners to form a divalent complex.2,3 With only two reactants, the bioconjugate product
is essentially limited to containing two distinct functionalities. For instance, an antibody-drug
conjugate possesses the localization functionality of the antibody and the therapeutic functionality
of the small molecule drug. Despite the great value of divalent bioconjugates across nearly all
fields, the preparation of a multivalent bioconjugate, in which three or more reaction partners
(where at least one is a biomolecule) are conjugated, could provide even more powerful and
applicable bioconjugates. For instance, a fluorescent probe could be conjugated with both an
antibody and a drug. This antibody-drug-probe conjugate would be capable of localization,
therapeutic efficacy, and visualization of the delivery and treatment all from the same molecule.
As previously described, unnatural amino acid (UAA) technology has proved especially
valuable in the preparation of protein bioconjugates, as the presence of UAAs with unique
chemical functionality in the protein can ensure well-defined, homogenous products.4 This offers
particularly important advantages in the use of antibody-drug conjugates to treat cancer, as
homogenous bioconjugates have been shown to be more effective in treatment than heterogenous
mixtures of bioconjugates, where the number and location of addition of drug molecules to the
antibody vary.4
![Page 77: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/77.jpg)
67
Multivalent conjugates have been prepared via the incorporation of two distinct UAAs with
different reactivities into the same protein.5-7 Specifically, Wan et al. and Xiao et al. demonstrated
incorporation of two distinct UAAs into proteins via suppression of both the TAG (amber) stop
codon as well as the TAA (ochre) stop codon.5-6 This was accomplished via the introduction of
two separate orthogonal aminoacyl tRNA synthetase (aaRS)/tRNA pairs into cells. Xiao et al.
demonstrated successful preparation of a multivalent conjugate using this methodology through
the incorporation of a ketone-containing UAA (pAcF) and an azide containing UAA (AzK) into
an anti-HER2 IgG antibody. The distinct reactivities of these two groups was exploited to first
conjugate auristatin (nAF), a drug molecule, onto the ketone and then to conjugate a fluorophore
onto the azide via copper-free click chemistry
(Figure 5.1). The resulting trivalent
bioconjugate covalently linked an antibody, a
drug, and a fluorophore, offering three
distinct functionalities in a single
bioconjugate.
Neumann et al. took a different approach towards the preparation of multivalent protein
bioconjugates.7 This work demonstrated the potential to evolve a “quadruplet-decoding” ribosome
that successfully incorporates UAAs in response to quadruplet codons. Through this technology,
azide and alkyne UAAs were incorporated into specific sites into calmodulin, and an internal
copper click [copper(I)-catalyzed azide alkyne cycloaddition] was successfully executed to alter
protein function.
While these studies are incredible and have widespread value in the field of bioconjugate
chemistry, these processes are often tedious and complicated. Suppression of two stop codons with
![Page 78: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/78.jpg)
68
systems of multiple aaRS/tRNA pairs can become complicated, and the evolution of a ribosome
capable of reading quadruplets is quite difficult.
Our lab has sought to perform two bioconjugation reactions on the same unnatural amino
acid, which would yield a multivalent protein bioconjugate without the need for the incorporation
of multiple UAAs into the same protein or the evolution of a quadruplet-decoding ribosome. Given
the stability of the triazole complex formed in the azide-alkyne “click” cycloaddition, past efforts
have focused on exploiting the potential reactivity of the linear 1,3-diyne generated in the Glaser-
Hay bioconjugation as well as the Cadiot-Chodkiewicz bioconjugation.8 Thus, a variety of
reactions aiming to add a third conjugation partner to a divalent bioconjugate containing a 1,3-
diyne have previously been explored (Figure 5.2).
Many organic reactions between a 1,3-diyne and substituted tetrazines, azides, amines,
thiols, silyls, and nitriles have been reported under conditions which would not be compatible in
biological systems, due to the use of organic solvents as well as high reaction temperatures.9-15
Thus, the aim of this research is to translate these reactions to physiological settings for the
preparation of protein multivalent conjugates in aqueous solution. To do this, reactions were first
tested under the reported organic conditions to confirm the feasibility of literature procedures, and
![Page 79: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/79.jpg)
69
then investigated to find optimized conditions that would be compatible with biological
macromolecules.
Despite past efforts, all aforementioned approaches to react various functional groups with
a 1,3-diyne were unsuccessful in generating multivalent bioconjugates. Herein, I report on my
work in novel efforts to generate protein multivalent conjugates
Towards the Development of a Biological 1,3-Dipolar Cycloaddition of an Azide and a Diyne
First, the 1,3-dipolar cycloaddition and carbocyclization of an azide and a diyne to form a
napthotriazole was investigated (Figure 5.2, b). Mandadapu et al. previously reported successful
reaction of a 1,3-diyne and an azide in acetonitrile at 90°C in 2-4 days (Figure 5.3).14
Previous work
demonstrated the
feasibility of this
copper(I)-catalyzed
reaction in organic
solvents at 90°C to couple diphenyldiacetylene with benzyl azide to generate both the non-
carbocyclized and carbocyclized products (Figure 5.4). Despite the fact that those conditions were
not physiological, we hypothesized that the non-carbocyclized product could form at lower
temperatures in aqueous solvent. This would still form a trivalent protein complex, making it a
multivalent reaction. However, translation to biological conditions was unsuccessful.
![Page 80: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/80.jpg)
70
Consequently, research
returned to organic conditions in
efforts to explore the feasibility of
different catalyst systems performing
the same cycloaddition but in aqueous solution. To do so, a Glaser-Hay reaction to generate a
homodimer containing a 1,3-diyne (1) was performed (Figure 5.5). Compound 1 was then reacted
with benzyl azide, with a Cu and FeCl3 catalyst system in water at room temperature for 48 hours
(Figure 5.6). After extraction, thin layer chromatography and 1H NMR suggested potential
formation of either carbocyclized or non-carbocyclized product via the appearance of a new spot
and the shifting of aromatic peaks in the 1H NMR relative to the benzyl bromide starting material,
respectively. Encouraged by the potential success of this reaction in aqueous solution, but
cognizant of the 48 hours needed for reaction, attempts were made to translate the reaction to a
physiological setting.
Two different biological reactions were examined. First, a 1,3-diyne heterodimer of
GFP151/pPrF and Biotin Alkyne was reacted with Fluor-488 Alkyne at 4°C for 12 hours using a
Cu and FeCl3 catalyst system. A successful reaction could be visualized by a fluorescence band on
the SDS-PAGE gel at the appropriate molecular weight. However, the reaction was unsuccessful
and no such product was achieved. Second, a 1,3-diyne heterodimer of GFP151/pPrF and Fluor-
488 Alkyne was reacted with Biotin Alkyne under the same conditions. Biotin has been reported
to have high affinity for streptavidin resin, which can be exploited to identify functional
![Page 81: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/81.jpg)
71
multivalent conjugates.16 Thus, following reaction, the reaction as well as a control (in which no
catalyst was present) could be immobilized to a streptavidin resin and washed to remove non-
biotinylated protein. A successful reaction would be indicated by differences in fluorescence
between the reaction and the control. A differential was not seen as neither the reaction nor control
showed detectable fluorescence. This indicates that either the multivalent conjugation was
unsuccessful or afforded too low a yield for detection via immobilization on a streptavidin resin.
Towards the Development of a Terminal Alkyne Addition to a Diyne in Biological Settings
Efforts were then shifted to utilize a different reaction to prepare a trivalent bioconjugate.
Chen et al. reported the copper-palladium catalyzed addition of terminal alkynes to activated
alkynes in water at room temperature (Figure 5.7).17 We hypothesized that the presence of another
electron-rich
alkyne could
lead to the
diyne
possessing similar reactivity to the internal alkynes utilized by Chen. Thus, organic conditions
were tested to elucidate if a terminal alkyne could add to a 1,3-diyne under these conditions (Figure
5.8). Employing a copper-palladium catalyst system, 1 was reacted with phenylacetylene in water
at room temperature for 12 hours. Thin layer chromatography and 1H NMR indicated formation
of a novel product, through the appearance of a new spot and the shifting of aromatic 1H peaks
![Page 82: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/82.jpg)
72
relative to the phenylacetylene starting material. Based on these preliminary results, attempts were
made to employ this reaction in a biological environment.
Using catalyst working concentrations of 500 mM CuI and 20 mM PdCl2(PPh3)2, a 1,3-
diyne heterodimer of GFP151/pPrF and Biotin Alkyne with Fluor-488 Alkyne were reacted at
room temperature for 4 hours. A successful reaction could be visualized by a fluorescence band
on the SDS-PAGE gel at the appropriate molecular weight. However, the reaction was
unsuccessful and no such product was achieved. Then, a 1,3-diyne heterodimer of GFP151/pPrF
and Fluor-488
Alkyne was reacted
with Biotin Alkyne
under the same
conditions (Figure
5.9). However, the presence of fluorophore was not observed on the streptavidin resin, indicating
the multivalent conjugation was unsuccessful. SDS-PAGE showed significant levels of protein
degradation during this reaction. To counter this, the same two reactions were performed at 4°C
for 4 hours. Protein degradation was again observed. The reaction was then attempted with a
working concentration of 100 mM CuI, which resulted in decreased protein degradation; however,
no products were observed.
Towards the Use of a Biological Sonogashira Reaction to Prepare a Multivalent Conjugate
With approaches to utilize the reactivity of the 1,3-diyne biologically proving difficult,
different reactive sites found within bioconjugates were investigated. The triazole complex
generated by the copper click reaction is highly stable and unreactive.2 However, previous research
demonstrated the formation of a bromotriazole complex through 1,3-dipolar azide-bromoalkyne
![Page 83: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/83.jpg)
73
cycloaddition. Efforts were made to exploit the reactivity of this functional group through a
Sonogashira reaction to generate a trivalent bioconjugate (Figure 5.10). To do this, an array of
reactions between a bromotriazole-containing divalent bioconjugate and various groups containing
a terminal alkyne were performed under a variety of conditions (Table 5.1). Conditions for an
![Page 84: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/84.jpg)
74
aqueous, physiologically compatible Sonogashira reaction were derived from literature
conditions.18
None of the conditions investigated clearly confirmed the creation of the desired trivalent
bioconjugate. However, SDS-PAGE of 12 indicated potential attachment of the fluorophore, but
in extremely low yields. This result is now being further investigated. Additionally, efforts are
currently underway to perform this Sonogashira reaction using a single palladium catalyst with no
copper, as is reported to be successful in physiological conditions.19
Conclusion
Overall, three distinct approaches towards the preparation of a multivalent bioconjugate
have been explored, but none have been successful to this point. The preparation of a multivalent
conjugate through reacting a terminal alkyne with a bromotriazole via a Sonogashira reaction
presently appears most promising, and investigation into this area will continue.
Materials and Methods
Synthesis of 1
Propargyl alcohol (2.05 g, 36.54 mmol, 2.11 mL) was added to THF (24 mL) in a flame dried
round-bottom flask. Copper iodide (160 mg) was dissolved in TMEDA (240 μL) and THF (8 mL).
This mixture was then combined with the propargyl alcohol and stirred for 24 hours while bubbling
air through at 60°C. The reaction was then purified via column chromatography in 1:1 Hexanes:
Ethyl Acetate. 1H NMR (400 MHz, D2O): δ 4.19 (s, 4H) ppm.
![Page 85: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/85.jpg)
75
Organic 1,3-dipolar cycloaddition and carbocyclization of an azide and a diyne to form a
napthotriazole
To a flame-dried vial, 50 mg of 1 (0.455 mmol, 1 eq) wad added and dissolved in H2O. Next, 93
µL of benzyl azide was added, followed by a spatula tip each of granular copper (Cu) and iron(III)
chloride (FeCl3). The reaction was allowed to stir at room temperature for 48 hours. Formation of
products was evaluated by thin layer chromatography and crude 1H NMR spectroscopy.
Expression of Protein Containing Unnatural Amino Acid
A pET-GFP-TAG plasmid (0.5 μL, for GFP synthesis) was co-transformed with the polyspecific
pEVOL-pCNF aminoacyl tRNA synthetase plasmid (0.5 μL) into Escherichia coli BL21 (DE3)
competent cells using an Eppendorf Eporator electroporator. The cells were then plated (100 μL)
on LB agar supplemented with ampicillin (50 μg/mL) and chloramphenicol (34 μg/mL). The plates
were incubated 16 hours at 37°C. One colony was used to inoculate LB media (10 mL) containing
ampicillin (50 μg/mL) and chloramphenicol (34 μg/mL). The culture was shaken overnight at 37°C
and used to initiate an expression culture (250 mL media, ampicillin 50 μg/mL, chloramphenicol
34 μg/mL) at an OD600 = 0.1. The cultures were incubated at 37°C until OD600 = 0.6 was reached.
Protein expression was induced by addition of 20% arabinose (250 μL), 0.8 mM isopropyl-β-D-1-
thiogalactopyranoside (IPTG, 250 μL), and the unnatural amino acid (2.5 mL, 100 mM). Cultures
were incubated at 30°C overnight, then pelleted by centrifugation (5,000 rpm, 10 min). Pelleted
cells were stored at -80°C until purification. The cell pellet was resuspended with 500 μL of
Bugbuster (Novagen), and 200 μL of cell lysis buffer and incubated for 20 minutes at 37°C.
Cellular debris was pelleted out by centrifugation at 5,000 rpm for 10 minutes and the supernatant
was added to an equilibrated Ni-NTA resin (200 μL). GFP was purified according to
![Page 86: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/86.jpg)
76
manufacturer’s protocol before being analyzed by SDS-PAGE (BioRad 10% precast gels, 150 V,
1.5 hours). Gels were stained using Coomassie Brilliant Blue, and destained (60% H2O, 30%
MeOH, 10% acetic acid). The gel was analyzed using the Coomassie protocol on the gel imager.
Protein was used without further purification.
General Procedure for Biological Glaser-Hay Coupling
To a sterile 1.5 mL eppendorf tube, the following were added: 5 μL of a vigorously shaken solution
of CuI (500 mM in H2O) and 5 μL of bidentate nitrogenous ligand (TMEDA, 500 mM in H2O).
The two solutions were thoroughly mixed by pipetting. Next, reaction partners 1 and 2 were added
to the mixture and mixed by pipetting. Reaction partners consisted of GFP/pPrF (30 μL, ~1 mg/mL
in PBS), AlexaFluor 488 Alkyne (20 μL, 1 mM in DMSO), or biotin alkyne (20 μL, 1 mM in
DMSO). The reaction was incubated at room temperature for 4 hours. The reaction was stopped
by removing excess reactants via buffer exchange using 10k MWCO concentrator columns, and
then subsequently analyzing the products by SDS-PAGE. This reaction afforded heterodimers
containing 1,3-diynes.
Biological 1,3-dipolar cycloaddition and carbocyclization of an azide and a diyne to form a
napthotriazole
To a sterile 1.5 mL eppendorf tube, the following were added: 5 μL of a vigorously shaken solution
of Cu (500 mM in H2O) and 5 μL of iron(III) chloride (FeCl3, 500 mM in H2O). The two solutions
were thoroughly mixed by pipetting. Next, 30 μL of the 1,3-diyne heterodimer of GFP151/pPrF
and Biotin Alkyne was added. Finally, 20 μL of the AlexaFluor 488 Alkyne (1 mM in DMSO)
was added. Reaction partners consisted of GFP/pPrF (30 μL, ~1 mg/mL in PBS), AlexaFluor 488
![Page 87: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/87.jpg)
77
Alkyne (20 μL, 1 mM in DMSO), or biotin alkyne (20 μL, 1 mM in DMSO). The reaction was
incubated at 4°C for 12 hours. The reaction was stopped by removing excess reactants via buffer
exchange using 10k MWCO concentrator columns, and then subsequently analyzing the products
by SDS-PAGE. No multivalent conjugates were observed.
Organic Copper-Palladium catalyzed addition of a terminal alkyne to a 1,3-diyne
To a flame-dried vial, 60 mg of 1 (0.545 mmol, 1 eq) was added and dissolved in H2O. Next, 120
µL of phenylacetylene (1.091 mmol, 2 eq) was added, followed by 6 mg of CuI (5 mol%) and 2
mg of PdCl2(PPh3)2 (2.5 mol%). The reaction was allowed to stir at room temperature for 12
hours. Formation of products was evaluated by thin layer chromatography and crude 1H NMR.
Biological Copper-Palladium catalyzed addition of a terminal alkyne to a 1,3-diyne
To a sterile 1.5 μL Eppendorf tube, the following were added and mixed: 5 μL of palladium (II)
acetate (Pd(OAc)2, 20 mM in 1:1 H2O/DMSO) or bis(triphenylphosphine)palladium(II) dichloride
(PdCl2(PPh3)2, 20 mM in DMSO) and 5 μL of copper(I) iodide (CuI, 500 mM in H2O). Next, 30
μL of the 1,3-diyne heterodimer of GFP151/pPrF and Biotin Alkyne was added. Finally, 20 μL of
the AlexaFluor 488 Alkyne (1 mM in DMSO) was added. Reaction conditions varied as described
in the text. Following reaction, excess reactants were removed via buffer exchange using 10k
MWCO concentrator columns. The products were heated to 98°C for 10 minutes and analyzed by
SDS-PAGE. No multivalent product was detected.
![Page 88: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/88.jpg)
78
General Procedure for Biological 1,3-Dipolar Azide-(Bromo)alkyne Cycloaddition
To a sterile 1.5 mL eppendorf tube, the following were added: 2 μL of CuSO42 (50 mM in H2O),
2 μL of TCEP (50 mM in H2O). Next, reaction partners 1 and 2 were added to the mixture and
mixed by pipetting. Reaction partners consisted of GFP151 containing either azide or bromoalkyne
UAA (20 μL in PBS), Ub48/pAzF (15 μL in PBS), or AlexaFluor 488 Azide (10 μL, 1 mM in
DMSO). Lastly, 10 μL of TBTA (5 μM in DMSO) was added, followed by 20 μL PBS. In reactions
involving linkers, 5 μL of 100 μM linker dissolved in DMSO was added. The reaction was
incubated at 4°C for 16 hours. The reaction was stopped either by performing SDS-PAGE
immediately or by removing excess reactants via buffer exchange using Spin-X UF concentrator
columns, 73 and then subsequently analyzing the purified products by SDS-PAGE.
General Procedure for Biological Sonogashira Coupling Reaction18
To a sterile 1.5 μL Eppendorf tube, the following were added and mixed: 3 μL of palladium (II)
acetate (Pd(OAc)2, 20 mM in 1:1 H2O/DMSO) and 3 μL of triphenylphosphine-3,3′,3′′-trisulfonic
acid trisodium salt (TPPTS, 100 mM in H2O). Then, 2 μL of copper (II) triflate (CuOTf, 12 mM
in DMSO) was added. Next, 10 μL of a bromotriazole-containing dimer of GFP151/pBrPrF and
AlexaFluor 488 Azide. Next, 10 μL of the third reaction partner, consisting of either AlexaFluor
488 Alkyne (1 mM in DMSO), biotin alkyne (1 mM in DMSO), or AlexaFluor 680 Alkyne (1 mM
in DMSO), was added. Reaction time and temperature varied as shown in Table 5.1. Following
reaction, excess reactants were removed via buffer exchange using 10k MWCO concentrator
columns. The products were heated to 98°C for 10 minutes and analyzed by SDS-PAGE. No
multivalent product was detected.
![Page 89: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/89.jpg)
79
References
1. Hermanson, G.T. (2013). Bioconjugate Techniques. Academic press.
2. Sletten, E.M. & Bertozzi, C.R. (2009). Bioorthogonal chemistry: fishing for selectivity in
a sea of functionality. Angew. Chem. Int. Ed., 48, 6974-6998.
3. Lang, K. & Chin, J.W. (2014). Cellular incorporation of unnatural amino acids and
bioorthogonal labeling of proteins. Chem. Rev., 114, 4764-4806.
4. Agarwal, P. & Bertozzi, C.R. (2015). Site-specific antibody−drug conjugates: the nexus
of bioorthogonal chemistry, protein engineering, and drug development. Bioconj. Chem.,
26, 176-192.
5. Wan, W., et al. (2010). A facile system for genetic incorporation of two different
noncanonical amino acids into one protein in Escherichia coli. Angew. Chem. Int. Ed., 49,
3211-3214.
6. Xiao, H., et al. (2013). Genetic incorporation of multiple unnatural amino acids into
proteins in mammalian cells. Angew. Chem., 125, 14330-14333.
7. Neumann, H., et al. (2010). Encoding multiple unnatural amino acids via evolution of a
quadruplet-decoding ribosome. Nature, 464, 441.
8. Kolb, H.C. & Sharpless, K.B. (2003). The growing impact of click chemistry on drug
discovery. Drug Discov. Today, 8, 1128-1137.
9. Shi, W. & Lei, A. (2014). 1,3-Diyne chemistry: synthesis and derivations. Tetrahedron
Lett., 55, 2763-2772.
10. Yang, L. & Hua, R. (2013). Cycloaddition of 1,4-diaryl-1,3-butadiynes with nitriles: an
atom-economic approach to benzo[f]quinazolines. Chem. Lett., 42, 769-771.
![Page 90: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/90.jpg)
80
11. Nizami, T.A. & Hua, R. (2014). Cycloaddition of 1,3-butadiynes: efficient synthesis of
carbo- and heterocycles. Molecules, 19, 13788-13802.
12. Fairbanks, B.D., Scott, T.F., Kloxin, C.J., Anseth, K.S., & Bowman, C.N. (2008). Thiol-
yne photopolymerizations: novel mechanism, kinetics, and step-growth formation of
highly cross-linked networks. Macromolecules, 42, 211-217.
13. Sun, H., Wu, X., & Hua, R. (2011). Copper (I)-catalyzed reaction of diaryl buta-1,3-diynes
with cyclic amines: an atom-economic approach to amino-substituted naphthalene
derivatives. Tetrahedron Lett., 52, 4408-4411.
14. Mandadapu, A.K., et al. (2011). Unprecedented Cu-catalyzed coupling of internal 1,3-
diynes with azides: one-pot tandem cyclizations involving 1,3-dipolar cycloaddition and
carbocylization furnishing napthotriazoles. Org. Lett., 13, 3162-3165.
15. Blackman, M.L., Royzen, M., & Fox, J.M. (2008). Tetrazine ligation: fast bioconjugation
based on inverse-electron-demand Diels-Alder reactivity. J. Am. Chem. Soc., 130, 13518-
13519.
16. Weber, P.C., Ohlendorf, D.H., Wendoloski, J.J., & Salemme, F.R. (1989). Structural
origins of high-affinity biotin binding to streptavidin. Science, 243, 85-88.
17. Chen, L. & Li, C.J. (2004). Facile and selective copper–palladium catalyzed addition of
terminal alkynes to activated alkynes in water. Tet. Lett., 45, 2771-2774.
18. Kodama, K., et al. (2007). Site-specific functionalization of proteins by organopalladium
reactions. ChemBioChem, 8, 232-238.
19. Li, N., Lim, R.K., Edwardraja, S., & Lin, Q. (2011). Copper-free Sonogashira cross-
coupling for functionalization of alkyne-encoded proteins in aqueous medium and in
bacterial cells. J. Am. Chem. Soc., 133, 15316-15319.
![Page 91: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/91.jpg)
81
CHAPTER 6: UTILIZATION OF UNNATURAL AMINO ACIDS TO PROBE
CRISPR/CAS9
Introduction
CRISPR/Cas9 technology is a powerful and facile tool in genome engineering, due in large
part to its ability to selectively alter DNA by only targeting specific foreign strands entering the
bacteria without perturbing the host genome. CRISPR stands for clustered regularly interspersed
palindromic repeats and is an immune system that has evolved naturally in bacteria to protect them
from phage infections.1 This system relies on the activity of Cas9, which is an RNA-guided
endonuclease which detects and cleaves foreign viral DNA to prevent a virus from overtaking a
host cell. CRISPR/Cas9 is a revolutionary technique due to its incredible specificity, as it is capable
of recognizing and cleaving exact DNA sequences.2 Presently, researchers aim to exploit this
technology from bacteria to use in other systems to edit DNA segments containing harmful
mutations, thus ultimately restoring the DNA to its healthy state. Most notably, CRISPR/Cas9
research is underway to develop methods to genomically edit embryos to remove deleterious
genetic mutations.3
CRISPR/Cas9 acts quickly in a well-understood mechanism to target and destroy foreign
DNA in bacterial cells (Figure 6.1).3 Upon entering a cell, a virus releases double stranded DNA.
Nearly instantly, Cas9 reads the foreign DNA strand and creates a novel “spacer” into the CRISPR
locus of the bacterial genome.4 Transcription of the spacer in the CRISPR gene results in the
production of CRISPR-associated RNA (crRNA). The crRNA pairs with a tracrRNA to form a
complex, which binds both the Cas9 protein as well as the foreign viral DNA. This action brings
the Cas9 into the proper orientation and alignment to cleave the viral DNA. Following this, the
spacer remains the CRISPR gene, allowing for cleavage of the same foreign viral DNA if it again
![Page 92: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/92.jpg)
82
enters the bacterial cell. This means that CRISPR/Cas9 offers long-term immunity, as the CRISPR
locus can contain a library of crRNAs that recognize DNA from viruses that have previously
infected the bacteria.2
The CRISPR immune system has been shown to be both highly prevalent and highly
conserved, as it appears in 90% of archaea and 40% of bacteria.5 In several recent studies,
CRISPR/Cas9 has been demonstrated to possess the
capability to disable the genomes of Heptatits B
virus, human papilloma virus (HPV), and human
immunodeficiency virus (HIV).6 Thus, research to
study Cas9 and probe its function as a part of the
CRISPR/Cas system is critical towards future efforts
to cure and prevent diseases.
Cas9 is a crescent-shaped protein with a
distinct bilobed architecture, containing a nuclease
lobe (Figure 6.2, colored) and an α-helical lobe
(Figure 6.2, gray).1 The two lobes are connected via
![Page 93: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/93.jpg)
83
two linking segments, one of which is formed by a region rich in arginine. The nuclease lobe
contains both the HNH and RuvC domains, each of which is responsible for the cleavage of one
strand of the double-stranded DNA target. The HNH domain consists of a two-stranded antiparallel
β-sheet with four neighboring α-helices, which are critical to its role to cleave the DNA
complementary to the guide crRNA:tracrRNA complex.7 The RuvC domain consists of a six-
stranded β-sheet surrounded by four α-helices, which all contribute to the nuclease domain’s active
site, which serves to cleave the noncomplementary strand. Cas9 has two prominent clefts on its
surface, which are ultimately critical in dictating its dual function: it is a DNA-binding protein as
well as an endonuclease (Figure 6.3, A).1 On the nuclease lobe, there is a deep, narrow groove
with the RuvC domain lying at the bottom. The α-helical lobe features a wider groove, which is
positively charged along its surface due to its arginine residues (Figure 6.3, B). This cleft binds
the crRNA:tracrRNA complex, through arginine residues 69, 70, 71, and 75. Binding of the RNA
complex to the α-helical lobe induces a conformational change in Cas9 such that the RuvC domain
![Page 94: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/94.jpg)
84
and the HNH are aligned exactly opposite each other in the cleft on the nuclease lobe, thus creating
a main channel where target DNA is aligned and cleaved.1
While bacterial CRISPR/Cas9 systems employ a crRNA:tracrRNA complex to bind target
viral DNA as well as Cas9, this approach is altered in molecular biology and gene editing
research.2,8 Instead, a chimeric single-guide RNA (sgRNA) is commonly used. The sgRNA is
prepared through the addition of a linker loop to fuse the 3’ crRNA sequence to the 5’ tracrRNA
sequence (Figure 6.4). Use of an RNA-guided wild-type Cas9 endonuclease results in a double-
stranded DNA cleavage. Mutated forms of Cas9 are also often employed in research, offering the
specific DNA binding of Cas9 without double-stranded DNA cleavage.2 Mutation of aspartic acid
to alanine at position 10 eliminates the activity of the RuvC domain while mutation of histidine to
alanine at position 840 eliminates the activity of the HNH domain. When both of these mutations
are present, catalytically dead Cas9 (dCas9) is generated. The dCas9 protein is capable of
interacting with RNA complexes to bind, target DNA sequences, but it is incapable of DNA
cleavage. Applications of dCas9 include the transcriptional activation or repression of genes as
well as the labeling of chromosomal loci.9-11 Further, dCas9 is capable of isolating DNA regions
and their associated proteins through the pull-down of specific genetic loci.12
![Page 95: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/95.jpg)
85
Many therapeutic applications of CRISPR/Cas9 have been developed, both to counter viral
infections as well as to edit out deleterious genetic mutations in cells and embryos. As previously
mentioned, CRISPR/Cas9 technology has been used to disable the genomes of Hepatitis B, HPV,
and HIV in vitro.6 In the case of HIV, SpyCas9 has shown the ability to both block de novo
infection by cleaving the viral intermediate prior to host genome integration and to eradicate pre-
existing infections by targeting sequences in the long terminal repeat of the virus. Further, in
intestinal stem cells, CRISPR/Cas9 has been demonstrated to correct a DNA mutation that causes
cystic fibrosis by eliminating CTFR gene function.13 Genome editing via this technique was shown
to restore gene function. Current research has sought to employ CRISPR/Cas9 technology to
correct genetic mutations on embryos. The capability of CRISPR/Cas9 to achieve precise gene
targeting in one-cell stage monkey embryos has been demonstrated, indicating its ability to remove
deleterious mutations without off-target mutation occurring.14 Despite its effectiveness in many
studies, the ethics of genomic editing via Cas9 remain heavily contentious, as some might wish to
use it to give offspring preferred genes, rather than just eliminating potentially harmful ones.2
Despite success in genomic approaches, much work remains to be done to probe the
function and activity of the Cas9 protein itself. Presently, only one study has studied the
incorporation of UAAs into Cas9, demonstrating the incorporation of a photocaged UAA to
eliminate function followed by ultraviolet irradiation to restore Cas9 endonuclease function.15
Further probing of Cas9 and dCas9 via the incorporation of UAAs has the potential to enhance
and refine control of the powerful CRISPR/Cas9 technology. Here, we seek to incorporate UAAs
into Cas9 and dCas9 to explore a variety of applications, among them the use of photosensitive
UAAs in Cas9 as well as the immobilization of dCas9 onto a solid support for DNA pull-down
applications.
![Page 96: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/96.jpg)
86
Previous Work
Previous work selected key sites for mutation within Cas9 and the inactive dCas9, choosing
sites near or in key sites of the protein, including the active sites for cleavage as well as the
arginine-rich region where the sgRNA is believed to bind (Figure 6.5, Table 6.1).
![Page 97: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/97.jpg)
87
Site-directed mutagenesis was performed on each of these sites in both Cas9 and dCas9
plasmids. For the Cas9 plasmid, sequencing results demonstrated successful insertion of the TAG
codon at all sites except the Y72 position (Figure 6.6). For the dCas9 plasmid, sequencing has not
yet been performed, but comparison to negative control reactions indicates successful insertion of
the TAG codon at all sites except the Y72 position.
Expression of Wild Type and Mutant Cas9 and dCas9
With wild type and mutant plasmids in hand, the expression of Cas9 and dCas9 with and
without UAA incorporation was attempted. Optimization of wild type expression was attempted
prior to attempting expression of mutant Cas9. Gratifyingly, we were successfully able to express
Cas9 and dCas9 in 100 mL expression cultures, which were induced at 18°C overnight and then
![Page 98: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/98.jpg)
88
purified via nickel resin-based affinity chromatography (Figure 6.7). Optimization of wild type
Cas9 and dCas9 expression demonstrated higher protein yield after a 48 hour induction period.
Expression of mutant, UAA-
containing Cas9 and dCas9 was
then attempted. Mutant plasmids
Cas9-D10TAG, Cas9-Y450TAG,
Cas9Y1131TAG, and Cas9-Y1265TAG were each co-transformed with a plasmid containing
pCNF, a polyspecific orthogonal aaRS/tRNA
capable of introducing a wide range of
tyrosine-derived UAAs in response to the
TAG codon. Expression was attempted with
the azide-containing UAA pAzF and the
alkyne-containing UAA pPrF (Figure 6.8).
Protein expression and purification were conducted in exactly the same manner as they
were for the wild type protein. However, expression trials under these conditions did not result in
the mutant Cas9 or dCas9 protein containing pAzF or pPrF at positions 10, 450, or 1131. However,
incorporation of pAzF at position 1265 in Cas9 was successful (Figure 6.9). A number of other
expression conditions were explored in painstaking fashion in efforts to express mutant Cas9 or
dCas9 protein
with UAA at
positions 10, 450,
or 1131 (Table
6.2). Additionally,
![Page 99: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/99.jpg)
89
a number of expression sizes were explored, ranging from 20 µL to 250 µL. Unfortunately, as seen
by SDS-PAGE, none of these attempts was successful.
Alterations in purification technique were also investigated. Neither the use of the
traditional nickel affinity resin nor the use of a cobalt affinity resin for purification yielded mutant
protein in the elutions. Altering the incubation time of the Cas9 or dCas9 with the resin also had
no effect. Performing purification steps in a refrigerated (4°C) centrifuge also had no effect.
A possible explanation for these results is that the UAAs cannot be incorporated into
positions 10, 450, and 1131 with high fidelity due to the position on the interior of the protein of
these residues, as well as their roles in post-translational processing and folding. Position 1265 is
a surface-exposed residue, which suggests why its expression was easier to achieve, as this residue
likely plays a lesser role in protein folding dynamics. The development of effective conditions to
generate Cas9 and dCas9 mutants at positions 10, 450, and 1131 is necessary.
Cleavage Assay
To test the nuclease function of our purified wild type Cas9 samples, we performed a
cleavage assay on a target DNA plasmid. This is important, as it is necessary to verify that our
![Page 100: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/100.jpg)
90
expressed Cas9 protein can indeed cleave DNA prior
to attempting to investigate the role of UAAs in photo-
caging or immobilization applications.
To assay the cleavage activity of Cas9, three
components are needed: an sgRNA strand, a target
DNA strand capable of hybridizing to the sgRNA, and
the WT Cas9 itself. A 121-base sgRNA (EGFP-
gRNA7) was designed based on a reported experiment
involving Cas9 in the literature.15 This sgRNA was
obtained as a single-stranded DNA oligomer, which was then amplified by PCR and analyzed by
agarose gel electrophoresis (Figure 6.10). The plasmid pIRG was selected for use as the target
DNA to be cleaved, as it is capable of hybridizing to the synthetic sgRNA (Figure 6.11). The
restriction enzyme XhoI was used to linearize the plasmid pIRG. While in plasmid form, pIRG
most likely takes on several unique supercoiled formations that appear as bands in different
locations (appear to be different sizes) when analyzed by agarose gel electrophoresis. After
successful linearization, pIRG appeared as a
single band of the correct molecular weight
(Figure 6.12).
With amplified sgRNA in DNA form,
linearized pIRG, and wild type Cas9 in hand,
cleavage reactions were performed to verify that
Cas9 would selectively cleave the DNA target.
First, the sgRNA was transcribed from DNA to
![Page 101: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/101.jpg)
91
RNA using an in vitro transcription kit (HiScribe T7
High Yield RNA Synthesis Kit) according to
manufacturer’s protocol, with the exception of the
DNase step. Using DNase to remove the DNA
template at the end of transcription is effective but
proved problematic as residual DNase degraded the
target DNA in the cleavage assay. Therefore, DNase
was not used at any point during transcription. Wild
type Cas9 or deionized water was added to the
sgRNA, followed by linearized or plasmid pIRG, and the reaction was incubated at 37°C
overnight. Successful cleavage of linearized pIRG by Cas9 would be confirmed by two bands on
the agarose gel, and cleaved plasmid
pIRG would appear as a single band
rather than a mixture of several
supercoiled plasmid bands.
Analysis by agarose gel
electrophoresis revealed total
degradation of linearized or plasmid
pIRG when Cas9 was present, likely
due to off-site and nonspecific
cleavage by Cas9 (Figure 6.13).
However, it is also possible that
impurities in the purified wild type
![Page 102: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/102.jpg)
92
Cas9 contain a DNase or other protein capable of DNA degradation. Present research is working
to evaluate the potential off-site cleavage by Cas9 through running the assay for a range of different
times and comparing results. If a shorter run time does not appear to have total degradation via
agarose gel electrophoresis, it would suggest that Cas9 is acting off-site and nonspecifically.
Further optimization may also include redesigning a new sgRNA to facilitate only specific
cleavage.
Conclusion
Overall, expression of UAA-containing Cas9 and dCas9 mutants has proven extremely
difficult, as has optimization of the assay for wild type Cas9. However, this project still has
excellent potential to probe Cas9 using UAAs to allow for photocontrol and immobilization
applications.
Materials and Methods
Optimized Expression of WT or UAA-containing Cas9 and dCas9
A plasmid containing WT or mutant protein sequences (pET-28b-Cas9-His or pET-dCas9-VP64-
6xHis or mutated plasmids, 2.0 µL) was co-transformed with a pEVOL-pCNF plasmid (2.0 µL)
into Escherichia coli BL21(DE3) cells using an Eppendorf eporator. The cells were then plated
and grown on LB agar in the presence of chloramphenicol (34 µg/mL) and, depending on plasmid-
encoded resistance, either kanamycin (100 µg/mL) or ampicillin (50 µg/mL) at 37°C overnight.
One colony was then used to inoculate 2xYT media (10 mL) containing both chloramphenicol
and, depending on plasmid resistance, kanamycin or ampicillin. The culture was incubated at 37°C
overnight and used to inoculate an expression culture (100 µL 2xYT media, 34 µg/mL
chloramphenicol and either 100 µg/mL kanamycin or 50 µg/mL ampicillin) at an OD600 = 0.1. The
![Page 103: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/103.jpg)
93
culture was incubated at 37°C until it reached an OD600 = 0.7. For expressions of UAA-containing
protein, expression was induced by the addition of UAA (1 mL, 100 mM in H2O) as well as 0.8
mM isopropyl β-D-1-thiogalactopyranoside (IPTG, 100 µL) and 20% arabinose (100 µL). The
cultures were incubated at 18°C for 48 hours and then centrifuged at 5,000 rpm for 20 minutes and
stored at -80°C. To purify the protein, the cell pellet was resuspended using 500 µL of Bugbuster
(Novagen) containing lysozyme and 200 µL lysis buffer and incubated at room temperature for 30
minutes. The solution was then centrifuged at 13,000 rpm for 10 mins. The supernatant was added
to an equilibrated spin column containing HisPur Nickel Resin (Thermo Fisher Scientific). The
initial incubation of supernatant and resin was performed for 1.5 hours on ice with shaking. Cas9
was then purified according to manufacturer’s protocol. Purified Cas9 was analyzed by SDS-
PAGE and employed without further purification.
Cleavage Assay
PCR Amplification
PCR amplification was performed in a Bio-Rad iCycler 96 well reaction module thermocycler.
The protocol was adapted from the KAPA HiFi Polymerase PCR amplification protocol. A 1x
master mix was created by adding 5 µL KAPA HiFi Buffer, 0.75 µL 10 mM dNTPs, 0.75 µL of
10 mM of T7 forward primer dissolved in sterile deionized water, 0.75 µL of 10 mM of T7 reverse
primer also dissolved in sterile deionized water, and 12.25 µL of sterile deionized water. To this
solution was added 1 ng EGFP-gRNA7 template DNA (5 µL of 0.2 ng/µL). The tubes was then
loaded into the thermocycler using the following protocol: 1) initial denaturation at 95°C for 3
mins; 2) 20 cycles of: denaturation at 98°C for 20 secs, annealing at 52.3° for 15 secs, and
extension at 72°C for 15 secs; 3) final extension at 72°C for 1 min; 4) the thermocycler completed
![Page 104: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/104.jpg)
94
the run by holding at 4°C. The samples were then PCR cleaned and concentrated (Zymo Research
DNA clean and Concentrator Kit) and eluted in 20 µL of sterile deionized water. The concentration
was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fischer Scientific), and the
sample 95 was also run on a 1.5% agarose gel to assess PCR amplification efficiency. Sequences
for the EGFP-gRNA7 template and PCR primers are displayed in the table below.15
Strand Sequence Tm (°C)
EGFP-gRNA7 5’-taatacgactcactatagggagatagctagtctaggtcgatgcgttttagagctaga
aatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgactggg
tgctt-3’
-
T7 forward
primer
5’-taatacgactcactataggg-3’ 47.5
T7 reverse
primer
5’-aaagcaccgactcggtgcca-3’ 62.1
Plasmid Linearization
To a PCR tube, the following was added: 1 µg of pIRG plasmid, 5 µL of 10X CutSmart Buffer
(New England BioLabs), and diH2O up to 49 µL. One microliter of restriction enzyme XhoI (New
England BioLabs) was added (for a 50 µL total reaction volume), and the solution was thoroughly
mixed by pipetting. The tube was incubated at 37°C for 1 hour and then at 65°C for 20 minutes to
inactivate the enzyme. The sample was then PCR cleaned and concentrated (Zymo Research DNA
Clean & Concentrator Kit) and eluted in 10 µL of Cas9 activity buffer (20 mM HEPES, 150 mM
KCl, 0.5 mM DTT, 0.1 mM EDTA, 10 mM MgCl2, pH 7.4). The product was run on a 1% agarose
gel containing ethidium bromide to assess linearization efficiency.
Cleavage Reactions
The EGFP-gRNA7 DNA template (100 ng) was transcribed to RNA using the HiScribe T7 high
Yield RNA Synthesis Kit (New England BioLabs) according to the manufacturer’s protocol,
![Page 105: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/105.jpg)
95
excluding the addition of DNase. The cleavage reactions were created by adding the following to
a PCR tube: 1 µL (12,000-16,000 ng) of unpurified synthetic gRNA, 2 µL of TAE/Mg2+ buffer
(40 mM tris-acetate, 1 mM EDTA, 12.5 mM magnesium acetate), and 40 µL WT Cas9. For control
reactions, WT Cas9 was replaced with diH2O. Next, 750 ng of target DNA (pIRG, 5 µL of 150
ng/µL, either linearized or supercoiled) in Cas9 activity buffer (20 mM HEPES, 150 mM KCl, 0.5
mM DTT, 0.1 mM EDTA, 10 mM MgCl2, pH 7.4) was added. The tubes were incubated at 37°C
for 16 hours, then at 72°C for 20 minutes to denature protein, and finally held at 4°C. The products
were run on a 0.8% agarose gel containing ethidium bromide to assess DNA cleavage.15
References
1. Jinek, M., et al. (2014). Structures of Cas9 endonucleases reveal RNA-mediated
conformational activation. Science, 343, 1247997.
2. Doudna, J. A., & Charpentier, E. (2014). The new frontier of genome engineering with
CRISPR-Cas9. Science, 346, 1258096.
3. Zhao, Y., Ying, Y., & Wang, Y. (2014). Developing CRISPR/Cas9 technologies for
research and medicine. MOJ Cell Sci. Report, 1, 6.
4. Mali, P., Esvelt, K. M., & Church, G. M. (2013). Cas9 as a versatile tool for engineering
biology. Nat. Methods, 10, 957.
5. Horvath, P. & Barrangou, R. (2010). CRISPR/Cas, the immune system of bacteria and
archaea. Science, 327, 167-170.
6. Kennedy, E. M., & Cullen, B. R. (2015). Bacterial CRISPR/Cas DNA endonucleases: A
revolutionary technology that could dramatically impact viral research and treatment.
Virology, 479, 213-220.
![Page 106: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/106.jpg)
96
7. Nishimasu, H., Ran, F.A., Hsu, P.D., Konermann, S., Shehata, S.I., Dohmae, N., Ishitani,
R., Zhang, F. and Nureki, O., 2014. Crystal structure of Cas9 in complex with guide RNA
and target DNA. Cell, 156(5), pp.935-949.
8. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012).
A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity.
Science, 1225829.
9. Tsui, C., et al. (2018). dCas9-targeted locus-specific protein isolation method identifies
histone gene regulators. Proc. Natl. Acad. Sci. U. S. A., 201718844.
10. Piatek, A., et al. (2015). RNA‐guided transcriptional regulation in planta via synthetic
dCas9‐based transcription factors. Plant Biotechnol. J., 13(4), 578-589.
11. Fujita, T., & Fujii, H. (2014). Identification of proteins associated with an IFNγresponsive
promoter by a retroviral expression system for enChIP using CRISPR. PLOS One, 9,
e103084.
12. Fujita, T., & Fujii, H. (2015). Isolation of specific genomic regions and identification of
associated molecules by engineered DNA-binding molecule-mediated chromatin
immunoprecipitation (enChIP) using CRISPR. Chromatin Protocols, 43-52.
13. . Schwank, G., et al. (2013). Functional repair of CFTR by CRISPR/Cas9 in intestinal stem
cell organoids of cystic fibrosis patients. Cell Stem Cell, 13, 653-658.
14. Niu, Y., Shen, B., Cui, Y., Chen, Y., Wang, J., Wang, L., Kang, Y., Zhao, X., Si, W., Li,
W., & Xiang, A.P. (2014). Generation of gene-modified cynomolgus monkey via
Cas9/RNA-mediated gene targeting in one-cell embryos. Cell, 156, 836-843.
15. Hemphill, J., Borchardt, E. K., Brown, K., Asokan, A., & Deiters, A. (2015). Optical
control of CRISPR/Cas9 gene editing. J. Am. Chem. Soc., 137, 5642-5645.
![Page 107: Development and Optimization of Bioconjugations to Probe ...](https://reader033.fdocuments.us/reader033/viewer/2022053005/6290c46903895e3aab5c1aa5/html5/thumbnails/107.jpg)
97
16. Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., & Liu, D.R. (2013). High-
throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease
specificity. Nature Biotechnol., 31, 839.