Proc. Natl. Acad. Sci. USAVol. 81, pp. 456-460, January 1984Cell Biology

Determinants for protein localization: /8-Lactamase signal sequencedirects globin across microsomal membranes

(gene fusion/hybrid protein secretion/transcription-linked, translation-coupled translocation/signal hypothesis)

VISHWANATH R. LINGAPPA*, JEFFERY CHAIDEZ*, C. SPENCER YOST*, AND JOE HEDGPETHtt§*Department of Physiology and Medicine and tHoward Hughes Medical Institute, Department of Biochemistry/Biophysics, University of California, SanFrancisco, CA 94143

Communicated by Richard J. Havel, September 15, 1983

ABSTRACT A hybrid gene containing 182 codons ofEscherichia coli 8-lactamase at the amino terminus of the cor-responding protein and 141 codons of a-globin at the carboxylterminus was generated by inserting chimpanzee a-globincDNA into the Pst I site of plasmid pBR322. RNA transcribedin vitro from this plasmid gave a corresponding hybrid proteinin a wheat germ cell-free translation system. The hybrid pro-tein was protected from tryptic digestion and the pre-1&lac-tamase signal peptide was removed when dog pancreas mem-brane vesicles were present during translation. A deletion mu-tant containing 23 codons of pre-,-lactamase signal sequenceand 5 codons of mature 13-lactamase fused to the a-globincDNA gave a shorter hybrid protein that behaved similarly.However, a mutation that removed essentially all of the pre-.&lactamase sequence gave a protein that was neither protectednor processed. Hence, at most, only the signal peptide and therst 5 amino acids of &ilactamase were necessary to convert a-globin (a cytoplasmic protein) into a secretory protein.

The process by which newly synthesized proteins are trans-ported to their correct subcellular location is a question ofcentral importance in cellular biology and has been the focusof considerable study in recent years (1, 2). Two experimen-tal approaches have been applied to this problem. Resultsfrom eukaryotic cell-free systems indicated that the translo-cation process begins during synthesis of the protein and fur-ther showed that essentially all secretory proteins are syn-thesized with an extra amino-terminal "signal" peptide thatis removed during the translocation process (3-5). Thesefindings led to the "signal hypothesis" (3, 6). Stated simply,the signal hypothesis proposes that the extra amino-terminalpeptide is responsible for initiating proper interaction of thenascent protein with the membrane so translocation can oc-cur. Recent evidence suggests other components also inter-act with the signal peptide to facilitate translocation (7, 8).

Bacterial systems, in which genetic manipulation can beused to advantage, demonstrated that the signal peptide was,indeed, necessary for translocation (9). Fusion of the amino-terminal region of a secretory protein gene with the carbox-yl-terminal region of a cytoplasmic protein gene resulted in ahybrid protein that was exported from the cytoplasm (10).Mutations in this hybrid gene that blocked the export pro-cess altered the signal sequence (11, 12). However, one fusionprotein containing all of a signal peptide and some aminoacids of the mature protein remained as a cytoplasmic pro-tein (13). The conclusions drawn from the bacterial systemssupported the signal hypothesis but suggested that informa-tion within the secretory protein in addition to the signal pep-tide was required for initiation of the secretory process.We have begun a series of experiments to exploit the

strengths of these two systems. First, we wished to use an in

vitro protein translocation system that can be subjected tobiochemical fractionation and analysis, thus allowing us toidentify components of the system involved in the varioussteps related to translocation. Second, we wanted to altergenes for secretory proteins in ways that would allow us toask what portions of the protein are critical for these translo-cation-related steps. Briefly, we decided to use genes clonedin bacterial plasmids as targets for in vitro mutagenesis, thenuse the mutated genes in the eukaryotic translation-translo-cation system.An Escherichia coli f3lactamase (a periplasmic protein)

can be synthesized in the eukaryotic system and translocat-ed into dog pancreas membrane vesicles with rather high ef-ficiency (14, 15). We found that a hybrid formed by insertingthe chimpanzee a-globin gene into the Pst I site of the f&lactamase gene of plasmid pBR322 produced a chimeric pro-tein with a p-lactamase sequence at its amino terminus andthe entire a-globin at its carboxyl terminus. This protein istranslocated into dog pancreas membrane vesicles in a man-ner similar to that of other secretory proteins. To identify theregion of the protein necessary for translocation, we generat-ed deletions in the hybrid gene, used mRNA from the result-ing mutant plasmids to program the translation-translocationsystem, and analyzed the ability of the mutant proteins to betranslocated.

MATERIALS AND METHODSPlasmid pMC18 was a generous gift from S. Liebhaber andK. Begley (16).

All restriction endonucleases, oligonucleotide linkers, nu-clease Bal 31, T4 DNA ligase, and Klenow fragment ofDNApolymerase were from New England BioLabs; staphylococ-cal protein A-Sepharose was from Pharmacia; rabbit anti-83-lactamase serum was a gift from Chung Nan Chang; rabbitanti-human globin serum was from Cappel Laboratories(Cochranville, PA). DNA sequences were determined by themethod of Maxam and Gilbert (17). Transcription-linkedtranslation was as described by Roberts et al. (14) with modi-fications described in the legend of Fig. 3. Isolation and useof dog pancreas microsomal membranes and post-transla-tional assays by proteolysis and sodium dodecyl sulfate/polyacrylamide gel electrophoresis were as previously de-scribed (3, 4).

RESULTSThe structure of the a-globin plasmid pMC18 is shown inFig. 1. The hybrid P-lactamase-a-globin gene is dia-grammed. This structure was confirmed by DNA sequenceanalysis and by analysis of the protein product (see below).We generated deletions in the ,B-lactamase portion of the hy-

Abbreviation: SRP, signal recognition particle.tPresent address: Codon, 430 Valley Drive, Brisbane, CA 94005.§To whom reprint requests should be addressed.

456

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci USA 81 (1984) 457

Ncol, Klenow Klenow,Eco 12 mer, T4 ligase, T4 ligaseEco RIT4 ligase

signal P-lactamase globinfragment

Ncolpltl BsEll PI'tl::::: .7 ...:::..:::.:::::::.....:::: -

*1 uaa

Xmnl/EBr, Bal 31,Ncol, Klenow,T4 ligase

E I1signal globin

pMlC18

pGM/NI

pGB14

i pGB8

FIG. 1. Structure of pMC18 and deletion plasmids. (A) Plasmid pMC18, showing the /3-lactamase gene (stippled bars) interrupted by chim-panzee a-globin cDNA sequences (white bars). Arrows on the plasmid diagrams indicate direction of transcription. The 3-lactamase signalsequence is indicated (black bars). Leftward arrows indicate the steps involved in constructing pGM/N1, in which all but the two amino-terminal codons of the /3-lactamase signal sequence are deleted. The EcoRI site was "filled-in" to generate an Xmn I site by sequential treatmentwith EcoRI DNA polymerase (Klenow fragment) plus dNTPs, then T4 ligase. The resultant plasmid, pG2, was linearized with Mbo II in thepresence of ethidium bromide (EBr) at 5 Mg/ml and treated with Nco I, which cuts at the start codon of the a-globin gene (see Fig. 4). Aftertreatment with DNA polymerase (Klenow fragment), the terminus generated at the Mbo II site following the first two codons of the 3-lactamasegene was fused to the Nco I-generated terminus at the start codons of globin with an intervening EcoRI 12-base-pair linker. The rightward arrowshows the scheme used to generate deletion plasmids such as pGB14 and pGB8. pMC18 was linearized by Xmn I in the presence of ethidiumbromide (5 ,ug/ml), treated with exonuclease Bal 31, and religated after treatment with DNA polymerase (Klenow fragment). The sequences ofpGM/N1 and pGB14 in the region of the 3-lactamase-globin fusion are shown in Fig. 4. (DNA sequences and restriction site location of otherrelevant regions are given in ref. 16 or 18.) (B) Representation of the proteins produced by the 3-lactamase-globin fusion genes (not to scale).The asterisk indicates the extra six amino acids preceding the normal globin start codon encoded by the first two codons of f-lactamase and theEcoRI linker. (C) Restriction map of the relevant region of pMC18 with deletions indicated by the lines below. The asterisk indicates theinsertion of the EcoRI linker. In pGM/N1, the EcoRI site was changd to an Xmn I site as described above. The UAA terminator codon forglobin is shown.

brid gene extending from the Nco I site, which spans thestart codon of the a-globin gene, toward the amino-terminalregion of the ,l3lactamase gene. These deletions fused thestart codon of a-globin to different portions of the 3-lacta-mase gene. In these manipulations, plasmid-containingtransformants were selected by virtue of their tetracylineresistance. This gene extends clockwise from a point just tothe right of the EcoRI site (18). Some mRNAs made by E.coli RNA polymerase using plasmid DNA as a template cansubsequently be translated in wheat germ or rabbit reticulo-cyte protein-synthesizing systems (14, 15). The coupling ofthese two reactions with dog pancreas membranes to obtaintranslocation and processing of ,B-lactamase has been de-scribed (15). Below we describe construction of the mutantplasmids, then analysis of their protein products in the tran-scription, translation-translocation system.

Construction of .3-Lactamase-Globin Fusions. In plasmidpGM/N1, the Mbo II site at the second codon of the f3lacta-mase gene was fused to the Nco I site at the beginning of theglobin gene with an intervening dodecamer EcoRI linker.This manipulation produced a hybrid gene consisting of thefirst two codons of the l3-lactamase gene, then four codons oflinker followed by the globin gene (Fig. LA, leftward arrow).Note that pG2, the immediate parent of pGM/N1, is identi-cal to pMC18 except that the EcoRI site has been convertedto an Xmn I site by filling in the single-strand termini gener-ated by EcoRI (see legend to Fig. 1).To make shorter deletions of &3lactamase sequences, plas-

mid pMC18 was linearized with Xmn I in the presence ofethidium bromide, then digested with exonuclease Bal 31 for

increasing periods (Fig. 1, rightward arrow). Then the DNAswere treated with Nco I followed by DNA polymerase(Klenow fragment) in the presence of dNTPs and T4 DNAligase. This procedure should generate deletions extendingfrom the Nco I site at the beginning of the globin sequencestoward the amino terminus of the P-lactamase gene. TheDNA samples were used to transform strain JH172, andtetracycline-resistant transformants were selected. Wescreened the plasmid DNA from the resistant colonies for anEcoRI/BstEII fragment of appropriate size because thesetwo unique sites flank the area in which the deletions shouldoccur (see Fig. 1).Of the Bal 31-generated deletion plasmids, 22 were chosen

whose EcoRI/BstEII fragments were in the desired sizerange. Plasmid DNA from these were tested for productionof a fusion protein in the transcription-linked translation sys-tem. Nine produced proteins products consistent with dele-tions of 150-180 codons. These fusion proteins reacted withanti-globin serum, indicating that the proper reading framewas maintained between the 83-lactamase and globin se-quences.By comparing the size of the EcoRI/BstEII fragments

(Fig. 2) with the size of the resultant protein products (Fig. 3)in three representative mutants, one sees that as the size ofthe deletion increases, the size of the protein decreases.Also, as the size of the protein decreased, the immunoreac-tivity with anti-p-lactamase serum decreased, while the reac-tivity with anti-globin did not. Hence, while the hybrid pro-teins of pG2 and pGB8 react with both antisera, the proteinsproduced by pGB14 and pGB/N1 are immunoreactive only

A

Bglobin

EcF RI Mb1N Xnnl

C

Cell Biology: Lingappa et aL

i I~~~~~~~~~~~~~~

458 Cell Biology: Lingappa et al.

A B C D E F pG2 pGB8 pGB14 pcM/Ni

anti serum - n g g g g n

A B C ...;. E F G H I J K68 -

45 -

30 -

FIG. 2. Restriction endonuclease analysis of pMC18 and dele-tion mutants. Plasmid DNA (5 ug) purified as described (19) was

digested with BamHI and BstEII in a volume of 10 ,ul. Samples (1 01)were prepared and electrophoresed in a 5% polyacrylamide gel (19).Lane A, pG2; lane B, pGM/N1; lane C, pGB14; lane D, pGB8; laneE, pMC18; lane F, pBR322 digested with HinfI as size markers (18,19). kb, Kilobases.

with anti-globin. The composition of the mutant proteins andthe size of the deletion within the hybrid gene is shown (Fig.1B and C). The DNA sequences of plasmids pGH14 andpGM/N1 in the region of fusion between the 3-lactamasecoding sequences and the region encoding the amino termi-nus of globin show that only the signal sequence and fivecodons of the ,3lactamase sequence remain in pGH14, whileonly the first two codons of the signal sequence remain inpGM/N1 (Fig. 4). In pGB8, approximately 20 codons of /-

lactamase following the signal sequence remain (not shown).We tested the ability of the various hybrid proteins to be

translocated by microsomal membrane vesicles. The DNAswere used as templates in mRNA synthesis and the mRNAwas used to program protein synthesis in the presence orabsence of dog pancreas membranes (Fig. 5). The resultswith pG2, pGB14 (the largest deletant retaining the ,B-lacta-mase gene) are shown. The protein produced by pGB14 be-haves like that of pG2, as did all of the &3lactamase-globinhybrids we have examined that contain the signal sequenceof ,B-lactamase (Fig. 5, lanes F-L). When membranes were

present during protein synthesis, a significant proportion ofthe nascent protein chains were shortened (processed) by a

length consistent with the removal of the signal peptide, andonly such shortened chains were protected from protease di-gestion. When membranes were not present during protein

7o15 -

i

FIG. 3. Protein products of ,B-lactamase-globin fusions. PlasmidDNA was transcribed by E. coli RNA polymerase (14) with humanplacental ribonuclease inhibitor (20) in a volume of 20 p1. A sample(4 1l) was added to translation reaction mixtures-(300% wheat germ

extract) containing 140 mM potassium acetate and 2mM magnesiumacetate supplemented with 12 ,uCi (1 Ci = 37 GBq) of [35S]methio-nine (1,100 Ci/mmol), other amino acids (nonradioactive), and an

energy-generating system (4). After 1 hr at 27°C, aliquots (5 /4) wereimmunoprecipitated with rabbit anti-human globin (g), rabbit anti-p-lactamase (1), or normal rabbit serum (n) and the immunoprecipitat-ed proteins were separated in 15% polyacrylamide gels (21). Molec-ular mass markers were bovine serum albumin [68 kilodaltons(kDa)], ovalbumin (45 kDa), carbonic anhydrase (30 kDa), and cyto-chrome c (15 kDa).

synthesis, there was neither processing nor protease protec-tion. We currently do not know if the processing cleavageoccurs at the proper site. However, processing of ,3-lacta-mase does occur at the same site in both the dog pancreas

vesicle system and bacteria (15).The protein encoded by pGM/N1, which lacks virtually all

of the signal sequence, is neither processed nor protectedfrom protease digestion by the microsomal membranes (Fig.5, lanes M-Q).We conclude from this experiment that the 3-lactamase-

globin fusion proteins that were made with a 3-lactamase sig-nal peptide were segregated into the microsomal membranevesicle during synthesis. During the segregation process, thesignal peptide was removed. This segregation occurred evenif only five amino acids of mature 3-lactamase were present.

Ala Ala Pte Cys leu Pro Val Phe Ala His Pro Glu Thr leu Met Val leu Ser PropGB14 ... GCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTCATGGTGCTGTCTCCT

-5

... a-lactamase signal

-1 1

0 -Iactamase

5

Globin

Met Ser Pro Asn Ser Gly Met Val Ieu Ser PropGM/Nl ATGAGCCGGAATTCCGGCATGGTGCTGTCTCCT

Eco RI Linker Globin

FIG. 4. Nucleotide and deduced amino acid sequences of pGB14 and pGM/N1 in the region of fusion between the ,B-lactamase and globinsequences. Nucleotide sequence analysis is described below. Only the relevant sequences are presented. The negative numbers refer to codonswithin the signal sequence; -23 corresponds to the initiating methionine codon. Positive numbers refer to mature P-lactamase codons, begin-ning with histidine following the cleavage site (arrow) (15, 19). The underlined portion represents globin sequences beginning with the sequence5'-C-A-T-G-G, which is the 5' terminus generated by Nco I cleavage that was fused to the /-lactamase sequences (see Fig. 1). The first twocodons of the pGM/N1 gene are those of ,B-lactamase; they are followed by the codons of the EcoRI linker. Plasmid DNA (10 Mg) was digestedwith EcoRI and Mbo II and treated with alkaline phosphatase, then T4 polynucleotide kinase in the presence of [Y-32P]ATP (15). The labeledDNAs were cut with Xmn I and BstEII (pGM/N1) or BstEII alone (pGB14) and the DNA fragments were separated by electrophoresis (6%polyacrylamide gel). Note that for pGM/N1 the EcoRI site was generated by the linker (asterisk, Fig. 1). For pGM/N1 both fragments labeledat the EcoRI termini were eluted and their sequences were determined. The fragment ofpGB14 labeled at the Mbo II terminus and extending tothe BstEII terminus within the globin cDNA was similarly eluted and its sequence was determined. See Fig. 1 for positions of restriction sites.

1.6 kb

0.5 kb

Proc. NatL Acad Sd USA 81 (1984)

Proc. Natl. Acad Sci. USA 81 (1984) 459

pG2 pCBI4 pGM/41membranes 4-

trypsin _

detergent

A B C a E FC H I I K L P

A A A

FIG. 5. Transmembrane translocation of f-lactamase-globin fu-sion proteins. Plasmid DNA (4 ug) was added to transcription reac-tion mixtures and aliquots of these were added to wheat germ trans-lation reactions (see Fig. 3). Some reaction mixtures contained dogpancreas membranes (280 A280 units/ml) (= + membranes). Thesame amount of membranes was added to the other reactions afterthe translation reaction. After the translation reaction, aliquots (5fd) were treated for 1 hr at 270C with trypsin at 0.1 mg/ml (+ tryp-sin) plus 10 mM CaC12, in some cases in the presence of 1% TritonX-100 (+ detergent). Trypsin digestion was stopped by addition ofTrasylol (1%) followed by phenylmethanesulfonyl fluoride (1 mM)and ice-cold trichloroacetic acid (15%). The reaction productsshown in lane K received no trichloroacetic acid and were immuno-precipitated with anti-globin serum. Reaction products in lanes G-Lwere washed with ethanol to remove trichloroacetic acid, then re-suspended and subjected to immunoprecipitation with anti-globinserum or with nonimmune rabbit serum (lane F) (ref. 20 and Fig. 3).Upward arrowheads refer to "processed" products of pG2 or pGB14found in the presence of membranes. Downward arrowheads referto the "unprocessed" forms seen without membranes or to thepGM/N1 product. The differences in migration between the "pro-cessed" and "unprocessed" proteins is consistent with a size changecorresponding to the loss of the 23 amino acid signal peptide.

By contrast, deletion of the signal sequence region gave aprotein that was neither segregated nor processed.

DISCUSSIONWe have tried to identify the minimal amount of informationnecessary for a protein to be distinguished as a secretoryprotein.The pancreas membrane vesicles recognize, process, and

segregate pre-,f3lactamase even though it is a bacterial pro-tein (15). Our experiments suggest that only the signal se-quence of pre-p-lactamase is necessary for these processesand that a cytoplasmic protein can be completely translocat-ed across the membrane when coupled to this signal se-quence. We cannot rule out a necessary role for the first fiveamino acids of mature P-lactamase. Nevertheless, these re-sults would appear to be inconsistent with other experi-ments, which suggest that more than a signal sequence isrequired for translocation of a secretory protein (13). In fact,some investigators suggested that a carboxyl-terminal regionof f-lactamase is required for transmembrane transport (22,23). It must be emphasized that these latter experimentswere done with bacterial systems and the results cannot bedirectly compared with those presented here. However, thepMC18 hybrid protein is translocated to the periplasm in abacterial minicell system (unpublished observation).

Recently, two cellular components that appear to be nec-essary for protein translocation have been isolated from dogpancreas membranes. The signal recognition particle (SRP)complex appears to coordinate synthesis and translocationof secretory proteins by interacting with the nascent secre-tory peptide and its ribosome to arrest protein synthesis (7).Another protein, a membrane component, is required to in-teract with the complex, overcome SRP-mediated arrest,and facilitate transmembrane transport of the new protein asit is synthesized (8, 24, 25). SRP does not interact with na-

scent globin chains exiting from globin-synthesizing ribo-somes (7). However, SRP does react with 3-lactamase-syn-thesizing ribosomes (15). Our experiments suggest that thesespecific interactions are limited at most to the signal peptideand first five amino acids of 13-lactamase. However, thismust be confirmed by testing the effect of purified SRP onthe synthesis and translocation of the pGB14 product in theappropriate membrane system.

Finally, fusion of only 28 amino acids of pre-,f3lactamaseto a cytoplasmic protein of 142 amino acids (globin) caused itto be translocated across the membranes. This would sug-gest that the bulk of a secretory protein can behave as a"passenger" and need not be specifically organized to facili-tate membrane transport, as was suggested by one model(26). This is not to imply that any amino acid sequence canbe translocated. In fact, specific sequences appear to be nec-essary to retain proteins in the membrane (27-29). As wehave shown, one of these sequences converts the f3-lacta-mase-globin fusion protein from a secreted protein to amembrane-bound protein (30). These findings support, butby no means prove, the notion that information for proteintopogenesis resides within discrete, relatively short aminoacid sequences rather than in the overall composition of theprotein.

We thank the following for their help; S. Leibhaber and K. Begleyfor pMC18 and DNA sequence data, C. N. Chang for antiserum,and J. Serrano and J. Freeland for preparing the manuscript. Thiswork was supported by National Institutes of Health Grants1M31626-01 and GM27472 to V.R.L. and J.H., respectively. V.R.L.was supported by funds from the University of California, San Fran-cisco, Academic Senate Committee on Research and a HartfordFoundation award. C.S.Y. was the recipient of a President's Under-graduate Research Fellowship from the University of California,San Francisco, School of Medicine.

1. Kriel, G. (1981) Annu. Rev. Biochem. 50, 317-348.2. Silhavy, T. J., Benson, S. A. & Emr, S. D. (1983) Microbiol.

Rev. 47, 313-344.3. Blobel, G. & Dobberstein, B. (1975) J. Cell Biol. 67, 852-862.4. Dobberstein, B. & Blobel, G. (1977) Biochem. Biophys. Res.

Commun. 74, 1675-1678.5. Blobel G., Walter, P., Chang, L. N., Goldman, B., Eubson,

A. H. & Lingappa, V. R. (1979) Symp. Soc. Exp. Biol. 33, 9-36.

6. Blobel, G. (1980) Proc. Nati. Acad. Sci. USA 77, 1496-1500.7. Walter, P., Ibrahimi, I. & Blobel, G. (1981) J. Cell Biol. 91,

551-556.8. Meyer, P. I., Krause, E. & Dobberstein, B. (1982) Nature

(London) 297, 647-650.9. Bassford, P. J., Jr., Emr, S. D., Silhavy, T. J., Beckwith, J.,

Bedoulle, H., Clement, J. M., Hedgpeth, J. & Hofnung, M.(1981) Methods Cell Biol. 23, 27-28.

10. Silhavy, T. J., Shuman, H. A., Beckwith, J. & Schwartz, M.(1977) Proc. Natl. Acad. Sci. USA 74, 5411-5415.

11. Emr, S. D., Hedgpeth, J., Clement, J. M., Silhavy, T. J. &Hofnung, M. (1980) Nature (London) 285, 82-85.

12. Bedoulle, H., Bassford, P., Fowler, A., Zabin, I., Beckwith, J.& Hofnung, M. (1980) Nature (London) 285, 78-81.

13. Moreno, F., Fowler, A., Hall, M., Silhavy, T., Zabin, I. &Schwartz, M. (1980) Nature (London) 286, 356-358.

14. Roberts, B. E., Gorecki, M., Mulligan, R. C., Danna, K. J.,Rosenblatt, S. & Rich, A. (1978) Proc. Natl. Acad. Sci. USA75, 1485-1489.

15. Muller, M., Ibrahimi, I., Chang, C. N., Walter, P. & Blobel,G. (1982) J. Biol. Chem. 257, 11860-11863.

16. Liebhaber, S. & Begley, K. (1984) Nucleic Acids Res., inpress.

17. Maxam, A. & Gilbert, W. (1980) Methods Enzymol. 65, 499-560.

18. Sutcliff, G. (1978) Cold Spring Harbor Symp. Quant. Biol. 43,77-90.

19. Clement, J. M., Perrin, D. & Hedgpeth, J. (1982) Mol. Gen.Genet. 185, 302-310.

Cell Biology: Lingappa et aL

460 Cell Biology: Lingappa et al.

20. Lingappa, J. R., Prasad, R., Ebuer, K. & Blobel, G. (1978)Proc. Natl. Acad. Sci. USA 75, 2338-2342.

21. Scheele, G. & Blackburn, P. (1979) Proc. Natl. Acad. Sci.USA 76, 4898-4902.

22. Koshland, D. & Botstein, D. (1980) Cell 20, 749-760.23. Koshland, D. & Botstein, D. (1982) Cell 30, 893-902.24. Walter, P. & Blobel, G. (1981) J. Cell. Biol. 91, 557-561.25. Gilmore, R., Blobel, G. & Walter, P. (1982) J. Cell. Biol. 95,

463469.

Proc. Natl. Acad. Sci. USA 81 (1984)

26. Engleman, W. M. & Steitz, T. A. (1981) Cell 23, 411422.27. Rogers, J., Early, P., Carter, C., Calme, K., Bond, M., Wall,

R. & Hood, L. (1980) Cell 20, 313-319.28. Boche, J. & Model, P. (1982) Proc. Natl. Acad. Sci. USA 79,

5200-5204.29. Gething, M. J. & Sambrook, J. (1982) Nature (London) 300,

598-603.30. Yost, C. S., Hedgpeth, J. & Lingappa, V. R. (1983) Cell 34,

759-766.