CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1)...

9
273a Lecture 14, Fall 08, Batzoglou 273a Lecture 14, Fall 2008 Finding Conserved Elements (1) • Binomial method 25-bp window in the human genome Binomial distribution of k matches in N bases given the neutral probability of substitution

  • date post

    19-Dec-2015

  • Category

    Documents

  • view

    215

  • download

    0

TAGS:

Transcript of CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1)...

Page 1: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Finding Conserved Elements (1)

• Binomial method 25-bp window in the human genome Binomial distribution of k matches in N bases given the neutral

probability of substitution

Page 2: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Finding Conserved Elements (2)

• Parsimony Method Count minimum # of mutations explaining each column Assign a probability to this parsimony score given neutral model Multiply probabilities across 25-bp window of human genome

A

CAAG

Page 3: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Finding Conserved Elements

Page 4: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Finding Conserved Elements (3)

GERP

Page 5: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Phylo HMMs

HMM

Phylogenetic Tree Model

Phylo HMM

Page 6: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Finding Conserved Elements (3)

Page 7: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

How do the methods agree/disagree?

Page 8: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Statistical Power to Detect Constraint

L

N

C: cutoff # mutationsD: neutral mutation rate: constraint mutation rate relative to neutral

Page 9: CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method 25-bp window in the human genome

CS273a Lecture 14, Fall 08, BatzoglouCS273a Lecture 14, Fall 2008

Statistical Power to Detect Constraint

L

N

C: cutoff # mutationsD: neutral mutation rate: constraint mutation rate relative to neutral


CS273a Lecture 4, Autumn 08, Batzoglou DNA Sequencing.

CS273a Lecture 4, Autumn 08, Batzoglou DNA Sequencing.

DNA Sequencing. CS273a Lecture 3, Autumn 08, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.

DNA Sequencing. CS273a Lecture 3, Autumn 08, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.

CS262 Lecture 9, Win07, Batzoglou Gene Regulation and Microarrays.

CS262 Lecture 9, Win07, Batzoglou Gene Regulation and Microarrays.

DNA Sequencing. CS273a Lecture 3, Spring 07, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.

DNA Sequencing. CS273a Lecture 3, Spring 07, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.

CS273a Lecture 11, Aut 08, Batzoglou Multiple Sequence Alignment.

CS273a Lecture 11, Aut 08, Batzoglou Multiple Sequence Alignment.

CS262 Lecture 12, Win06, Batzoglou RNA Secondary Structure aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua.

CS262 Lecture 12, Win06, Batzoglou RNA Secondary Structure aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua.

CS262 Lecture 9, Win07, Batzoglou Conditional Random Fields A brief description.

CS262 Lecture 9, Win07, Batzoglou Conditional Random Fields A brief description.

Sequence Alignment (Courtesy of Dr. S. Batzoglou )

Sequence Alignment (Courtesy of Dr. S. Batzoglou )

Sequence Alignment Slides courtesy of Serafim Batzoglou, Stanford Univ.

Sequence Alignment Slides courtesy of Serafim Batzoglou, Stanford Univ.

A Zero-Knowledge Based Introduction to Biologyweb.stanford.edu/class/cs273a/presentations.aut09/CS273a... · 2018-01-09 · Gene Expression Regulation • When should each gene be

A Zero-Knowledge Based Introduction to Biologyweb.stanford.edu/class/cs273a/presentations.aut09/CS273a... · 2018-01-09 · Gene Expression Regulation • When should each gene be

CS262 Lecture 9, Win07, Batzoglou Gene Recognition.

CS262 Lecture 9, Win07, Batzoglou Gene Recognition.

CS273a Lecture 10, Aut 08, Batzoglou CS273a Lecture 10, Fall 2008 Local Alignments.

CS273a Lecture 10, Aut 08, Batzoglou CS273a Lecture 10, Fall 2008 Local Alignments.

CS262 Lecture 17, Win07, Batzoglou Gene Regulation and Microarrays.

CS262 Lecture 17, Win07, Batzoglou Gene Regulation and Microarrays.

CS273a Lecture 4, Autumn 08, Batzoglou Fragment Assembly (in whole-genome shotgun sequencing) CS273a Lecture 5.

CS273a Lecture 4, Autumn 08, Batzoglou Fragment Assembly (in whole-genome shotgun sequencing) CS273a Lecture 5.

Welcome to 03-60-558: Bioinformatics (Courtesy of Dr. S. Batzoglou )

Welcome to 03-60-558: Bioinformatics (Courtesy of Dr. S. Batzoglou )

CS273a, Spring 2007, Lecture 11 Whole-genome motif discovery.

CS273a, Spring 2007, Lecture 11 Whole-genome motif discovery.

CS262 Lecture 16, Win07, Batzoglou Gene Recognition Credits for slides: Serafim Batzoglou Marina Alexandersson Lior Pachter Serge Saxonov.

CS262 Lecture 16, Win07, Batzoglou Gene Recognition Credits for slides: Serafim Batzoglou Marina Alexandersson Lior Pachter Serge Saxonov.

CS273A The Human Genome Source Code

CS273A The Human Genome Source Code

CS273a Lecture 5, Win07, Batzoglou Quality of assemblies—mouse N50 contig length Terminology: N50 contig length If we sort contigs from largest to smallest,

CS273a Lecture 5, Win07, Batzoglou Quality of assemblies—mouse N50 contig length Terminology: N50 contig length If we sort contigs from largest to smallest,

CS273a Lecture 4, Autumn 08, Batzoglou Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector.

CS273a Lecture 4, Autumn 08, Batzoglou Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector.