ConstitutiveExpressionofRiceMicroRNA528 AltersPlant … · detected (Fig. 2C). Cloning and...

Constitutive Expression of RiceMicroRNA528 Alters PlantDevelopment and Enhances Tolerance to SalinityStress and Nitrogen Starvation inCreeping Bentgrass1[OPEN]

Shuangrong Yuan, Zhigang Li, Dayong Li2, Ning Yuan, Qian Hu, and Hong Luo*

Department of Genetics and Biochemistry, Clemson University, Clemson, South Carolina 29634

ORCID IDs: 0000-0002-2546-689X (S.Y.); 0000-0003-3823-9845 (Z.L.); 0000-0003-1573-4747 (D.L.); 0000-0003-1484-7010 (N.Y.);0000-0001-9223-1786 (H.L.).

MicroRNA528 (miR528) is a conserved monocot-specific small RNA that has the potential of mediating multiple stress responses.So far, however, experimental functional studies of miR528 are lacking. Here, we report that overexpression of a rice (Oryzasativa) miR528 (Osa-miR528) in transgenic creeping bentgrass (Agrostis stolonifera) alters plant development and improves plantsalt stress and nitrogen (N) deficiency tolerance. Morphologically, miR528-overexpressing transgenic plants display shortenedinternodes, increased tiller number, and upright growth. Improved salt stress resistance is associated with increased waterretention, cell membrane integrity, chlorophyll content, capacity for maintaining potassium homeostasis, CATALASE activity,and reduced ASCORBIC ACID OXIDASE (AAO) activity; while enhanced tolerance to N deficiency is associated with increasedbiomass, total N accumulation and chlorophyll synthesis, nitrite reductase activity, and reduced AAO activity. In addition,AsAAO and COPPER ION BINDING PROTEIN1 are identified as two putative targets of miR528 in creeping bentgrass. Both ofthem respond to salinity and N starvation and are significantly down-regulated in miR528-overexpressing transgenics. Our dataestablish a key role that miR528 plays in modulating plant growth and development and in the plant response to salinity andN deficiency and indicate the potential of manipulating miR528 in improving plant abiotic stress resistance.

Abiotic stresses, especially drought, salt, and nitro-gen (N) deficiency, are limiting factors for plant growth,development, and agricultural productivity. To copewith drought and salt stresses, plants have evolvedsimilar strategies of osmotic adjustment (Munns, 2002;Zhu, 2002). Plants also evolved salinity-specific ad-justments against ionic disequilibrium, which encom-pass excluding salt entry intoplants andcompartmentalizingions into vacuoles or old leaves (Munns, 1993; Yeo,1998). Another worldwide limiting factor for crop yields

is N deficiency, which triggers reduced leaf growth rateand photosynthetic rate (Chapin et al., 1988). Due to thesessile nature of plants, abiotic stresses are unavoidable.Therefore, it is critical to develop reliable procedures togenetically modify plants for improved performanceunder environmental stresses, thereby enhancing agri-cultural productivity tomeet the ever-growing demandsin food production.

Genetic engineering plays an increasingly importantrole in agronomic trait modifications in crop species.Currently, many genes encoding functional proteins,transcription factors, and proteins involved in signal-ing pathways have been identified as abiotic stress-responsive genes (Shinozaki and Yamaguchi-Shinozaki,2007; Masclaux-Daubresse et al., 2010; Turan et al., 2012).Constitutive expression of some of these genes in trans-genic plants has been demonstrated to lead to enhancedsalt or drought tolerance (Golldack et al., 2011; Kim et al.,2013; Lu et al., 2013; Li et al., 2014).However, details of theregulatory network in the plant stress response remainelusive. To improve plant performance under N defi-ciency conditions, substantial efforts have been concen-trated on understanding the physiological and molecularprocesses determining plant nitrogen use efficiency(NUE), including those involved in N uptake, assimila-tion, translocation, and remobilization. A number of cropplants have been genetically engineered to alter singlefunctional genes in these pathways with limited suc-cess, due to posttranscriptional regulation machineries

1 This work was supported by the U.S. Department of Agriculture(Biotechnology Risk Assessment Grant Program grant no. 2010–33522–21656 from the National Institute of Food and Agricultureand Cooperative State Research, Education, and Extension Servicegrant no. SC–1700450). This is Technical Contribution no. 6289 ofthe Clemson University Experiment Station.

2 Present address: State Key Laboratory of Plant Genomics and Na-tional Center for Plant Gene Research, Institute of Genetics and Devel-opmental Biology, Chinese Academy of Sciences, Beijing 100101, China.

* Address correspondence to [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Hong Luo ([email protected]).

S.Y., Z.L., and H.L. conceived the project, designed the experi-ments, and analyzed the data; S.Y., Z.L., D.L, N.Y., and Q.H. carriedout the experiments; S.Y. and H.L. wrote the article.

[OPEN] Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.15.00899

576 Plant Physiology�, September 2015, Vol. 169, pp. 576–593, www.plantphysiol.org � 2015 American Society of Plant Biologists. All Rights Reserved.

https://plantphysiol.orgDownloaded on May 22, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://orcid.org/0000-0002-2546-689X

http://orcid.org/0000-0003-3823-9845

http://orcid.org/0000-0003-1573-4747

http://orcid.org/0000-0003-1484-7010

http://orcid.org/0000-0001-9223-1786

mailto:[email protected]

http://www.plantphysiol.org

mailto:[email protected]

http://www.plantphysiol.org/cgi/doi/10.1104/pp.15.00899

https://plantphysiol.org

(Ferrario-Mery et al., 1998; Fraisier et al., 2000; Pathaket al., 2008). Abiotic stresses trigger a wide array ofplant morphological and physiological responses.Therefore, a comprehensive understanding of plantresponses to abiotic stresses and the knowledge of howto manipulate multiple genes concurrently to integratethe responses of plants at various levels under abioticstresses are keys to genetically improving plants forenhanced performance under adverse environmentalconditions.Since the discovery of microRNAs (miRNAs), the

important small regulatory molecules, 2 decades ago,the roles that some of their members play in the com-plex stress response network have been graduallyrecognized. Recently, an evolutionarily conservedmonocot-specific miRNA, miR528, was identified to respond tomultiple stresses, including salt, drought, low-temperature,submergence, nitrate starvation, and arsenite and ar-senate stresses in maize (Zea mays), sugarcane (Saccharumofficinarum), phalaenopsis orchid (Phalaenopsis aphrodite),and rice (Oryza sativa; Zhang et al., 2008; An et al., 2011;Xu et al., 2011; Ferreira et al., 2012; Nischal et al., 2012;Sharma et al., 2015). In addition, deep sequencing analysisshows that miR528 responds to diazotrophic bacteria inmaize and might be involved in cytoplasmic male ste-rility in rice anther (Thiebaut et al., 2014; Yan et al.,2015). The miR528 in many grass species, such as rice,maize, sugarcane, sorghum (Sorghum bicolor), and Bra-chypodium distachyon, has been shown to have identicalmature sequence (UGGAAGGGGCAUGCAGAGGAG;http://www.mirbase.org/; Kozomara and Griffiths-Jones, 2014), suggesting that miR528 in different mono-cot species may function similarly in regulating targetgene activity. Eleven putative targets of miR528 in ricehave been predicted using in silico analysis. Some ofthem are involved in oxidation-reduction processes(Dai and Zhao, 2011), implying that miR528 may func-tion as a multistress integrator. However, all the stress-responsive data ofmiR528 expression obtained so far havebeen from genome-wide large-scale analyses. Experi-mental evidence is still lacking.In this study, we analyzed the role of miR528 in

regulating the plant response to salinity and N starva-tion and the underlying physiological and molecularmechanisms using transgenic analysis in an importantperennial grass species, creeping bentgrass (Agrostisstolonifera). Using stem-loop reverse transcription-(RT)quantitative PCR (RT-qPCR), we first demonstratedthat, like its counterpart in annual species, miR528 increeping bentgrass is also responsive to salinity stressand water and N deficiency. We then generated trans-genic creeping bentgrass plants overexpressing riceprimary miR528 (pri-miR528) to evaluate the impact ofmiR528 on plant development and the response to en-vironmental stress. Our data indicate that transgenicplants exhibit altered growth and development andenhanced tolerance to salt stress and N deficiency. Im-proved salt stress resistance is associated with increasedwater retention, cell membrane integrity, chlorophyllcontent, capacity for maintaining potassium (K)

homeostasis, and CATALASE (CAT) activity and withreduced ASCORBIC ACID OXIDASE (AAO) activity;while enhanced tolerance to N starvation is associatedwith increased biomass, total N accumulation and chlo-rophyll synthesis, and NITRITE REDUCTASE (NiR) ac-tivity and with reduced AAO activity. Our findingshighlight a functional role for miR528 in modulatingionic equilibrium, NUE, and the oxidation-reductionprocess to mediate plant responses to salinity stressand N starvation. Additionally, we also identified twocreeping bentgrass miR528 targets, AsAAO and COP-PER ION BINDING PROTEIN1 (AsCBP1), which arehomologs of rice AAO and CBP1 and implicated in theoxidation-reduction process.We found that bothAsAAOand AsCBP1 respond to salinity stress and nitrogenstarvation and are significantly down-regulated inmiR528-overexpressing transgenic plants. Collectively,our data demonstrate the importance of miR528 in plantdevelopment and its key role as a multistress integratorcontrolling plant responses to salinity and N starvation,pointing to the potential of manipulating miR528 inimproving plant abiotic stress resistance.

RESULTS

miR528 Responds to Salt, Drought, andN Deficiency Stresses

miR528 has previously been implicated in plant re-sponses to drought, salt, and N deficiency in annualspecies (Ding et al., 2009; Xu et al., 2011; Ferreira et al.,2012; Nischal et al., 2012). To study its role in perennialgrass species, we first examined its expression in re-sponse to various abiotic stresses in creeping bentgrass.Stem-loop RT-qPCR analysis indicates that miR528 issignificantly induced by both drought and salt stressesbut suppressed under N starvation (Fig. 1). This sug-gests that miR528 is regulated by abiotic stress, con-sistent with observations in rice, maize, and sugarcane(Ding et al., 2009; Xu et al., 2011; Ferreira et al., 2012;Nischal et al., 2012).

Generation and Molecular Analysis of TransgenicCreeping Bentgrass Overexpressing Osa-miR528, a RicemiRNA Gene

To further study the role that miR528 plays in plantadaption to abiotic stress, we prepared a miR528 over-expression construct and introduced it into the genomeof wild-type creeping bentgrass through Agrobacteriumtumefaciens-mediated transformation. The rice comple-mentary DNA (cDNA) containing precursor miR528(pre-miR528; AK073820; Knowledge-Based Oryza Mo-lecular Biological Encyclopedia; http://cdna01.dna.affrc.go.jp/cDNA/; Kikuchi et al., 2003; Liu et al., 2005;Satoh et al., 2007) was amplified and then cloned into thebinary vector pZH01, generating the Osa-miR528 over-expression gene construct, p35S-Osa-miR528/p35S-Hyg.As shown in Figure 2A, theOsa-miR528 gene was under

Plant Physiol. Vol. 169, 2015 577

miR528 Regulates the Abiotic Stress Response


http://www.mirbase.org/

http://cdna01.dna.affrc.go.jp/cDNA/

http://cdna01.dna.affrc.go.jp/cDNA/


the control of the CaMV 35S promoter and linked to thehygromycin resistance gene, Hyg, driven by the CaMV35S promoter. To select positive transgenic plants con-taining miR528 overexpression constructs, we amplifiedtheHyg gene by PCRwith genomic DNA of regeneratedplants and identified a total of 13 transgenic lines (Fig.2B), whichweremorphologically indistinguishable fromeach other. Three transgenic lines, TG6, TG8, and TG13,were chosen for further characterization of the aspects ofplant development and stress response. To verify theOsa-miR528 expression in transgenic plants, we con-ducted RT-PCR analysis to amplify the cDNA contain-ing the Osa-miR528 stem-loop structure, comparing thelevels of primary Osa-miR528 transcripts between thewild-type control and three transgenic lines. Interest-ingly, besides a fragmentwith the expected size of 549 bp,two additional bands of 451 and 240 bp were alsodetected (Fig. 2C). Cloning and sequencing analysis ofthese DNA fragments revealed that alternative splicingmechanisms are responsible for the production of theadditional two bands of 451 and 240 bp (data notshown). The same splicing pattern of the pri-miR528observed in rice (Fig. 2C) suggests that molecularmechanisms governing pri-miR528 sequence process-ing are conserved in different plant species. An addi-tional pair of primers was then designed to amplify acommon region of the three alternatively spliced pri-miR528 transcripts in transgenic lines using semi-quantitative RT-PCR analysis. As demonstrated inFigure 2D for the five representative transgenic lines,the transcripts of pri-miR528 are significantly elevatedin transgenic lines compared with the wild-type con-trols (Fig. 2D). To determine whether pri-miR528 can besuccessfully processed into mature miRNA, we con-ducted stem-loop RT-qPCR analyses and found that theexpression levels of mature Osa-miR528 in three repre-sentative transgenic lines are significantly higher thanthat in the wild-type control (Fig. 2E), suggesting thatthe primary RNA sequence of Osa-miR528 from rice isproperly processed into mature miRNA in creepingbentgrass.

Overexpression of miR528 Alters Plant Development

To determine the involvement of miR528 in plantdevelopment, we analyzed wild-type and trans-genic plants initiated from a single tiller in puresand. Transgenic plants produced significantly more,but shorter, tillers than wild-type controls (Fig. 3, A,C, and J; Supplemental Fig. S1, A and B), especiallyat the later developmental stage (10 weeks old; Fig.3J). However, no significant difference in the totalnumbers of shoots, primary and secondary tillersfrom a crown, and internodes was observed be-tween transgenic and control plants at the later de-velopmental stages (60 and 90 d old; Fig. 3K). Thedevelopmental changes observed in transgenic plantswere further confirmed by comparing wild-type andOsa-miR528 transgenic plants grown in the samepot filled with soil (Fig. 3B). In addition, trans-genic plants exhibited more upright tiller growththan wild-type controls (Fig. 3B; SupplementalFig. S1C).

To further studywhat causes the reduced tiller lengthin transgenics, we analyzed the average length andnumber of internodes of the representative tillers fromwild-type and transgenic plants (Fig. 3D). We foundthat the total numbers of internodes in wild-type andtransgenic tillers are similar, whereas the average lengthof the internodes from each tiller in transgenic plants issignificantly reduced compared with wild-type controls(Fig. 3L).

Transgenic and wild-type leaves and stems were alsocompared at the cellular level via histological analysis(Fig. 3, E–G). Transgenic leaves were significantlythicker than wild-type leaves (Fig. 3H), and the num-ber of stem vascular bundles was significantly increasedin transgenics compared with that in wild-type controls(Fig. 3I).

The potential impact of miR528 on plant growth wasinvestigated by measuring the shoot and root biomassof 10-week-old wild-type and transgenic plants initi-ated from a single tiller and the weekly clipping weight

Figure 1. Stem-loop RT-qPCR analyses of miR528 expression profiles in response to salt, drought, and N deficiency in wild-typecreeping bentgrass leaves. Relative expression levels of the mature miR528 were determined in wild-type plants under salt (A),drought (B), and N deficiency (C) treatment. The relative changes of gene expression were calculated based on the comparativethreshold cycle method (Livak and Schmittgen, 2001). UBIQUITIN5 (AsUBQ5) was used as an endogenous control. Data arepresented as means of three biological replicates 3 three technical replicates, and error bars represent SE. Asterisks indicate asignificant difference of expression levels between untreated and each abiotic-stress treated wild-type plant: **, P , 0.01 and***, P , 0.001 by Student’s t test.

578 Plant Physiol. Vol. 169, 2015

Yuan et al.


http://www.plantphysiol.org/cgi/content/full/pp.15.00899/DC1




thereafter continuously for 4 weeks. Our statisticalanalyses revealed no significant difference in biomassaccumulation between transgenic and control plants(Supplemental Fig. S2).

Overexpression of miR528 Leads to Enhanced SaltTolerance in Transgenic Plants

To investigate the role that miR528 plays in theplant stress response, we examined transgenic andwild-type control plants under salinity stress usingfully developed plants (Fig. 4A). Figure 4, B and C,shows plants recovering for 8 d after a 9-d exposureto 200 mM NaCl. Salt-elicited tissue damage wassignificantly more pronounced in wild-type controlsthan in transgenic plants, suggesting an enhancedtolerance to salt stress in miR528-expressing trans-genic plants.

Osa-miR528 Transgenics Exhibit Better Water Retentionand Cell Membrane Integrity, and Higher Pro andChlorophyll Contents, Than Wild-Type Controls underSalt Stress

Salinity stress damages the plant cell membrane andturgidity. Therefore, the maintenance of cell mem-brane integrity and water status is considered a majorcomponent in plant salt stress tolerance. To investigatethe degree of cell membrane injury between wild-typeand transgenic plants, we measured their electrolyteleakage (EL). Under normal growth conditions, therewas no significant difference in EL between the wildtype and two transgenic lines. After a 9-d salt stresstreatment, the EL value of the wild type was signifi-cantly higher than that of transgenic plants (Fig. 4D),indicating that transgenic plants have a better capa-bility of maintaining cell membrane integrity thanwild-type controls under salt stress conditions. To

Figure 2. Generation and molecular analysis of transgenic creeping bentgrass overexpressing Osa-miR528. A, Schematic dia-gram of the Osa-miR528 gene overexpression construct, p35S-Osa-miR528/p35S-Hyg. Osa-miR528 is under the control of theCauliflower mosaic virus (CaMV) 35S promoter and linked to the hygromycin resistance gene, Hyg, driven by the CaMV 35Spromoter. LB, Left border; NOS, nopaline synthase terminator; RB, right border. B, PCR analysis to amplify the Hyg gene usinggenomic DNA of wild-type (WT) and transgenic creeping bentgrass to determine the integration of Osa-miR528 in the hostgenome. C, Pri-miR528 shows alternative splicing in wild-type rice and transgenic creeping bentgrass. The same splicing patternof pri-miR528 was observed in both rice and creeping bentgrass. Blue, red, and purple lines represent different splicing patterns.Yellow lines are the locations of pre-miR528. Black arrows indicate the position of mature miR528. D, An additional pair ofprimers was designed to amplify a common region of the three alternatively spliced pri-miR528 transcripts using semiquantitativeRT-PCR analysis to compare the expression levels of primary Osa-miR528 in wild-type and transgenic plants. E, Stem-loop RT-qPCR analysis to detect the expression of mature Osa-miR528 in transgenic and wild-type plants. Relative changes in geneexpression were calculated based on the comparative threshold cycle method (Livak and Schmittgen, 2001). ACTIN1 (AsACT1)was used as an endogenous control. Data are presented as means of three technical replicates, and error bars represent SE.Asterisks indicate a significant difference of expression levels between the wild type and each transgenic line: **, P , 0.01 and***, P , 0.001 by Student’s t test.






compare the water status in wild-type and transgenicplants, we measured the relative water content (RWC).Both transgenics and wild-type controls displayed sim-ilar RWC under normal growth conditions (Fig. 4E).However, when subjected to salinity stress for 9 d,transgenics had significantly higher RWC than wild-typecontrols (Fig. 4E), implying that transgenic plants haveimproved ability to retain water under salinity stress.

Pro is essential for plant primary metabolism undersalt stress. It functions as a molecular chaperone inbuffering the pH of the cytosolic redox status within thecell and in reactive oxygen species (ROS) scavenging(Ashraf and Foolad, 2007). Pro contents in both transgenics

and wild-type controls were similar before salt treatment(Fig. 4F). However, significantly higher Pro was accumu-lated in transgenics than in wild-type controls after the saltstress (Fig. 4F), suggesting an enhanced ROS detoxificationcapacity under osmotic stress in transgenic plants.

Leaf chlorophyll content is also affected under saltstress due to the destruction of the chlorophyllpigment-protein complex, the degradation of the chlo-rophyll enzyme chlorophyllase, and the interference inthe synthesis of chlorophyll structural components (RaoandRao, 1981; Ali et al., 2004). In this study, therewas nosignificant difference of chlorophyll contents betweenwild-type and transgenic plants under normal growth

Figure 3. Plant tillering and development. A, Ten-week-oldwild-type (WT) and transgenic (TG) plants initiated from a single tiller.Bar = 10 cm. B, Two-month-old wild-type and transgenic plants initiated from the same number of tillers were grown in the same6-inch pot. Bar = 10 cm. C, Closeup of the longest tillers from wild-type and transgenic plants, respectively. Bar = 5 cm. D, Allinternodes from the representative longest tiller were sliced from top to bottom and arranged from left to right. Bar = 5 cm. E, Topthree fully developed leaves from the representative tillers of wild-type and transgenic plants. Bar = 2 cm. F, Cross-section imagesof wild-type and transgenic leaves. Bar = 200 mm. G, Cross-section images of wild-type and transgenic stems. Bar = 100 mm. H,Statistical analysis of leaf thickness between representative wild-type and transgenic plants (n = 8). I, Statistical analysis of thenumber of vascular bundles between representative wild-type and transgenic stems (n = 8). J, Tiller number in wild-type andtransgenic plants 5 and 10 weeks after initiation from a single tiller (n = 5). K, Total shoot number including both tillers and lateralshoots in wild-type and transgenic plants at 30, 60, and 90 d after initiation from a single tiller (n = 5). L, Average length of the topeight internodes from wild-type and transgenic tillers (n = 6). Data are presented as means, and error bars represent SE. Asterisksindicate a significant difference between the wild type and each transgenic line: *, P, 0.05; **, P, 0.01; and ***, P, 0.001 byStudent’s t test. Tillers are grass shoots growing out from the crown at the base of the plants. Shoots include both tillers and lateralshoots growing out from the tillers.


Yuan et al.



conditions, whereas all three transgenic lines showedsignificantly higher chlorophyll contents than wild-typecontrols during salt treatment (Fig. 4, G–I), suggestingthe possible role the improved photosynthesis of thetransgenics plays in contributing to enhanced salt stressresistance.

Osa-miR528 Transgenic Plants Maintain Cellular K+

Homeostasis under Salt Stress

Salt stress imposes ionic imbalance and osmoticstress on plants due to elevated Na+ levels around plantroots. To compare the Na+ uptake inwild-type andOsa-miR528 transgenic plants, Na+ relative contents weremeasured.While there was no difference in Na+ contentin roots between transgenics and wild-type controls,the three transgenic lines accumulated significantlymore Na+ than wild-type controls in shoots before thesalt stress (Fig. 5A). After the salt treatment, wild-typeand transgenic plants had similar Na+ contents in bothshoots and roots (Fig. 5B). K plays an essential role indiverse physiological processes, including turgoradjustment, stomata movement, cell elongation, andactivation of more than 50 cytoplasmic enzymes(Marschner, 1995; Gambale andUozumi, 2006; Lebaudy

et al., 2007). Salinity also affects K+ homeostasis,because Na+ competes with K+ for binding sites duringenzymatic reactions and protein synthesis in the cyto-plasm, where K+ functions as a cofactor in these pro-cesses (Marschner, 1995). Our result showed that K+

relative contents in wild-type and transgenic shootswere similar or slightly higher in transgenic shootsbefore salt stress (Fig. 5C). After salinity treatment, in-terestingly, transgenics maintained their shoot K+ level,whereas the K+ levels in wild-type shoots droppeddramatically, becoming significantly lower than thosein transgenic shoots (Fig. 5D). Transgenics also containedhigher K+ in roots than wild-type plants, although thedifference was insignificant (Fig. 5, C and D). One of thekey elements in plant salinity tolerance is the capacity ofmaintaining a high K+:Na+ ratio. Under normal growthconditions, wild-type shoots had significantly a higherK+:Na+ ratio than transgenics due to their lower Na+

contents than transgenic shoots (Fig. 5E). After salt stresstreatment, however, K+:Na+ ratios of shoots and rootswere both significantly higher in transgenics than inwild-type controls (Fig. 5F). Figure 5G shows that, undersalt stress, transgenicswere capable ofmaintaining similarshoot K+ levels to nonstressed conditions compared withwild-type controls. However, K+ levels in both wild-typeand transgenic roots decreased dramatically, although

Figure 4. Responses of wild-type controls and transgenics to salinity treatment. A, Wild-type controls (WT) and two transgenic(TG) lines initiated from the same number of tillers were trimmed to the same height before the salt stress test. B, Fully developedwild-type and transgenic plants were subjected to 200 mM NaCl treatment. The performance of wild-type and transgenic plantsat 8 d after recovery from a 9-d salt treatment is shown. C, Closeup of representative wild-type and transgenic plants from B. D,Electrolyte leakage values were calculated before and after a 9-d salt treatment. E, Relative water contents were measuredbefore and after a 9-d salt treatment. F, Pro contents of wild-type and transgenic leaves measured before and after a 200 mM

NaCl treatment. G to I, Chlorophyll a content (G), chlorophyll b content (H), and total chlorophyll content (I) were measuredbefore and after a 9-d salt treatment. fw, Fresh weight. Data are presented as means (n = 5), and error bars represent SE. Asterisksindicate a significant differencebetween thewild type and each transgenic plant: *,P,0.05; **,P,0.01; and ***, P,0.001by Student’st test.





transgenic roots had higher K+ contents than wild-typecontrols under nonstressed conditions (Fig. 5H).

The Impact of miR528 on the Expression of the KTransporter Creeping Bentgrass High AffinityPotassium Transporter5

Differences in Na+ and K+ contents between wild-type and transgenic plants imply that miR528 might

mediate the concerted action of ion transport systems.To investigate the underlying mechanism of miR528-mediated ion transport, K transporter genes in creep-ing bentgrass were identified, and their expression wasanalyzed in transgenic and wild-type plants. Previousstudies indicate that there are mainly seven gene fam-ilies involved in K+ uptake (Mäser et al., 2001; Véry andSentenac, 2002, 2003), of which functionally character-ized genes encoding K-permeable channels and K

Figure 5. Na+ and K+ contents in wild-type and transgenic plants under normal and salt stress conditions. A, Na+ relative contents inshoot and root tissues of wild-type (WT) and transgenic (TG) plants before salinity treatment. B, Na+ relative contents in shoot and roottissues of wild-type and transgenic plants 9 d after salinity treatment. C, K+ relative contents in shoot and root tissues of wild-type andtransgenic plants under normal growth conditions. D, K+ relative contents in shoot and root tissues of wild-type and transgenic plants9 d after salinity treatment. E, K+:Na+ ratio in shoots and roots of wild-type and transgenic plants before a 200mMNaCl treatment. F, K+:Na+ ratio in shoots and roots of wild-type and transgenic plants 9 d after salt treatment. G, Shoot K+ relative contents in wild-type andtransgenic plants before and after salinity stress. H, Root K+ relative contents in wild-type and transgenic plants before and after salinitystress. Data are presented as means (n = 3), and error bars represent SE. Asterisks indicate significant differences in K+ content, Na+

content, or K+:Na+ ratio between thewild type and each transgenic line: *, P,0.05; **, P,0.01; and ***, P,0.001 by Student’s t test.


Yuan et al.



transporters were selected for further study. Creepingbentgrass High Affinity Potassium Transporter5 (AsHAK5;KR911825) from the K Uptake Permease/HAK/KTransporter family was successfully amplified in creep-ing bentgrass and found to be up-regulated in transgenicleaves and roots compared with wild-type controls(Fig. 6), suggesting that constitutive expression ofmiR528 leads to enhanced K transporter activity andcontributes to the increased K+ uptake and enhancedcapacity of maintaining K+ homeostasis in transgenicplants.

Overexpression of miR528 Results in Enhanced ROSScavenging Associated with Increased CAT Activity ButDecreased AAO Activity under Salt Stress in Transgenics

In addition to the impact on K homeostasis, salt stressalso causes the accumulation of ROS in plant cells.Plants evolve stress tolerance mechanism of ROS de-toxification via increasing antioxidant enzyme activity.Since the predicted targets ofOsa-miR528 contain manyantioxidant enzyme-encoding genes, this prompted usto examine how miR528 impacts antioxidant enzymeactivity. We first measured the activity of the zinc/copper (Zn/Cu) SUPEROXIDE DISMUTASE (SOD)enzyme encoded by a predicted miR528 target gene,but we observed no significant difference betweenwild-type and transgenic plants (Supplemental Fig.S3A). SOD catalyzes the dismutation of superoxideradical into oxygen or hydrogen peroxide (H2O2), andthe latter is further decomposed to water and oxygenby CAT. Therefore, we conducted a CAT assay andobserved that transgenic plants have significantlyhigher CAT activity than wild-type controls underboth normal and salt stress conditions, suggestingan increased capacity of ROS scavenging in miR528transgenic plants (Supplemental Fig. S3B). AnotherpredictedmiR528 target encodes AAO, which catalyzesthe reaction of ascorbate (AA) oxidation. Under saltstress, transgenic plants exhibited significantly lowerAAO activity than wild-type controls, indicatingthat transgenics maintain higher levels of AA underredox status, which contributes to a better elimina-tion of ROS than in wild-type controls (SupplementalFig. S3C).

miR528 Transgenics Exhibit an Enhanced NUE Associatedwith Up-Regulated Gene Expression and IncreasedEnzyme Activity of Nitrite Reductase

To examine the responses of wild-type and transgenicplants under different N supplies, we first determinedthe optimum N concentration for creeping bentgrass byapplying Murashige and Skoog (MS) nutrient solutioncontaining 2, 10, or 40mMN towild-type and transgenicplants. Fourweeks later,wild-type and transgenic plantshad the fastest and slowest growth rate, with 10 and2 mM N solution treatments, respectively (Fig. 7, B, E,and F). Thus, 10 mM is the optimum N concentration inour experiment and was used for further analysis. Theresult also shows that the excess N level of 40 mM re-duces plant growth (Fig. 7B) due to the decreased uptakeof other nutrient elements, such as phosphorus and K.When comparing plant growth between transgenicsand wild-type controls, no significant difference inshoot biomass was observed under the normal Nsupply of 10 mM. However, transgenics grew betterand produced significantly more shoot biomass thanwild-type controls under both N deficiency (2 mM) andoverfertilized (40 mM) conditions (Fig. 7, E and F).Moreover, transgenics also exhibited delayed leaf se-nescence compared with wild-type controls. Whilewild-type controls exhibited wilting leaf tips under allthree N fertilization treatments, transgenic plantsbarely had this symptom, suggesting a role thatmiR528 may play in plant leaf senescence and lon-gevity (Supplemental Fig. S4).

To further evaluate the impact of miR528 on the plantresponse to N nutrients, we measured plant leaf chlo-rophyll contents in both transgenic and wild-typeplants under N starvation and normal conditions. Incomparison with N-sufficient plants, plants underN deficiency conditions (0.4 and 2 mM) had reducedchlorophyll contents, especially under 0.4 mMN supply(Fig. 7, I–K). While transgenic plants were similarto wild-type controls in chlorophyll content underN-sufficient conditions, they had significantly higherchlorophyll than wild-type controls under N-starvedconditions (Fig. 7, I–K), suggesting a lower degree ofchlorophyll degradation and, therefore, likely a higherphotosynthetic capability in transgenic plants than inwild-type controls under N deficiency conditions.

N is an essential nutrient for plant biomass produc-tion. To investigate how different amounts of N uptakeresulted in distinct plant growth rates, we comparedthe total N contents in wild-type and transgenic plantsunder N-starved (2 mM), N-sufficient (10 mM), andN-excessive (40 mM) conditions. The result indicates thatthe higher the concentration of the N solution applied,the more total N that plants accumulated (Fig. 7G).When the total N content was measured as the per-centage of the biomass weight, there was no significantdifference between wild-type and transgenic plants.However, transgenic shoots accumulated significantlymore N than wild-type controls under N-starved andN-excessive conditions due to their higher shoot biomass

Figure 6. Expression levels of AsHAK5 in wild-type and transgenicplants by semiquantitative RT-PCR analysis. A, Expression levels ofAsHAK5 in leaf tissues of wild-type (WT) and transgenic (TG) plantsunder normal growth conditions. B, Expression levels ofAsHAK5 in roottissues of wild-type and transgenic plants under normal growth condi-tions. AsUBQ5 was used as the endogenous control.











under both conditions (Fig. 7, G and H; SupplementalFig. S5), suggesting an enhanced NUE in transgenicplants.

To investigate what causes the enhanced NUE, weexamined the transcript levels of the genes encoding keyenzymes in theN assimilation pathway inwild-type andtransgenic creeping bentgrass plants. The enzymes in-cludeNITRATEREDUCTASE (NR),NiR,GLUTAMINESYNTHETASE (GS), and GLUTAMATE SYNTHASE(GOGAT). As shown in Figure 8A, the expression ofAsNiR (KR911829), but not AsNR (KR911828), AsGS(KR911826), or AsGOGAT (KR911827), was significantlyup-regulated in transgenic plants in comparison withwild-type controls. Consistently, the enzyme activity ofNiR was also significantly higher in transgenic plantsthan in wild-type controls before and after N starvation

treatment (Fig. 8B). It should be noted that the NiR ac-tivity increased in both wild-type and transgenic plantsin response to N starvation (Fig. 8B).

Overexpression of miR528 Leads to Decreased AAOActivity under N Deficiency

N deprivation triggers redox changes and oxidativestress (Kandlbinder et al., 2004). The predicted miR528target AAO gene and its role in oxidative stress regu-lation have been discussed above. Therefore, we con-ducted a plantAAOassayunder normal andN starvationconditions. The result indicates that AAO activity in bothwild-type and transgenic plants increased dramaticallywhen subjected to N starvation, but the increase in

Figure 7. Responses of wild-type and transgenic plants under different concentrations of N solutions. A, Wild-type (WT) andtransgenic (TG) plants were trimmed to be uniform before applying N solutions. B, Performance of wild-type controls and threetransgenic lines on MS solutions containing 2, 10, or 40 mM N for 4 weeks. C and D, Closeup of wild-type and transgenic shootsunder 2mM (C) and 40mM (D) N solution treatment for 4 weeks. E and F, Shoot fresh weight (E) and dryweight (F) of wild-type andtransgenic plants after 4 weeks of growth with three different N solutions. G, Percentage of shoot total N content of wild-type andtransgenic plants measured 4 weeks after applying different N solutions. H, Weight of shoot total N was measured 4 weeks afterapplying differentN solutions. I to K, Plant chlorophyll contents, including chlorophyll a (I), chlorophyll b (J), and total chlorophyll(J), were measured 4 weeks after applying different concentrations of N solutions. fw, Fresh weight. Data are presented as means(n = 4), and error bars represent SE. Asterisks indicate significant differences of biomass value, total N weight, or chlorophyllcontents between wild-type and transgenic plants: *, P , 0.05; **, P , 0.01; and ***, P , 0.001 by Student’s t test.


Yuan et al.





transgenic plants was significantly less pronounced thanthat in wild-type controls (Supplemental Fig. S6). Thelower level of AAO in transgenics helps maintain rela-tively high levels of redox AA under N deprivation,thereby keeping the balance between ROS productionand its scavenging under oxidative stress.

Osa-miR528 Putative Target Identification and Responsesto Stresses

To understand the underlying molecular mecha-nisms of miR528-mediated plant responses to salinityand N deficiency, we sought to identify putative tar-gets of miR528 in creeping bentgrass. Currently, onlySsCBP1, a copper ion-binding domain-containing pro-tein, is experimentally confirmed as the target of miR528in sugarcane (Zanca et al., 2010). In rice, Os06g37150encoding AAO is validated as the target of miR528through a high-throughput degradome sequencing ap-proach (Wu et al., 2009b). To identify its targets increeping bentgrass, a plant small RNA target analysistool (psRNATarget) was applied to predict targets in therice genome (Dai and Zhao, 2011). Eleven putative tar-gets were recognized in rice, including one copper ion-binding protein (Os07g38290), one AAO (Os06g37150),one laccase precursor protein (Os01g44330), one Zn/CuSOD (Os08g44770), two plastocyanin-like domain-containing proteins (Os06g11310 and Os08g04310),one translation initiation factor (Os01g40150), one F-boxdomain-containing protein (Os06g06050), two multi-copper oxidase domain-containing proteins (Os01g03620and Os01g03640), and one unknown protein (Os09g33800),of which partial fragments of four genes were success-fully amplified in creeping bentgrass based on the se-quence similarity to rice (data not shown). GenesencodingAAO and CBP1 showed decreased expressionin transgenic plants (Fig. 9, A and B), indicating thatthey might be targets of miR528 in creeping bentgrass.The miR528 targeting site in AsCBP1 (KR911824)was detected in its open reading frame as described in

Figure 9C. Interestingly, the miR528 target site was notfound in the coding region of AsAAO; instead, it wasidentified, by RACE analysis, to be located in the 39 un-translated region from nucleotides 26 to 45 after thestop codon TGA (Fig. 9C). The descriptions, functions,and corresponding orthologs in rice and Arabidopsis(Arabidopsis thaliana) of AsAAO and AsCBP1 are listedin Figure 9D. AsAAO (KR911823) functions in oxida-tion reduction, suggesting its potentially importantrole in the plant abiotic stress response. AsCBP1 encodesa cupredoxin superfamily protein. Proteins from thisfamily function in oxidation homeostasis and electrontransfer reactions, which are involved in photosynthesis,respiration, cell signaling, and numerous reactions ofoxidases and reductases (Lu et al., 2004; Solomon et al.,2004; Dennison, 2005; Marshall et al., 2009).

To investigate whether AsAAO and AsCBP1 respondto salt and N deficiency stress, we conducted real-timeRT-PCR analysis to examine their expression profilesunder salt andN starvation treatments. Figure 10A showsthat the expression of AsAAO was significantly inducedin response to salt stress in both leaf (approximately30-fold at 6 h after treatment) and root (15-fold at 6 h aftertreatment) tissues. When plants were exposed to N defi-ciency, the expression ofAsAAOwas significantly induced(more than 2-fold) in leaves but reduced (approximately0.5-fold) in roots 5 d after N starvation (Fig. 10B). Whenplants were exposed to salt stress, AsCBP1 expression inleaf and root tissues was significantly induced (approxi-mately 2.5- and 3-fold, respectively, at 6 h after treatment;Fig. 10A). During N starvation, AsCBP1 was induced ap-proximately 4.5 times at 5 d after treatment and then de-clined in leaf tissues, while its expression declined 8 d aftertreatment in root tissues (Fig. 10B).

miR528 Has Cross Talk with Other Abiotic Stress-RelatedmiRNAs and Genes in Perennial Grasses

Although the importance of miRNAs in the complexstress response network is being gradually recognized,

Figure 8. AsNiR gene expression analysis and NiR enzyme assay in wild-type and transgenic plants. A, RT-qPCR analysis ofAsNiR transcript levels in wild-type plants (WT) and three transgenic (TG) lines under 10 mM N conditions. AsACT1was used asan endogenous control. Data are presented as means of three technical replicates and three biological replicates. B, NiR assay inwild-type controls and two transgenic lines before and 2weeks after N starvation. Data are presented as means of three biologicalreplicates. The error bars represent SE. Asterisks indicate significant differences of expression levels or enzyme activities betweenwild-type and transgenic plants: *, P , 0.05; **, P , 0.01; and ***, P , 0.001 by Student’s t test.






the molecular mechanisms of the miRNA-mediatedplant stress response are still largely unknown. It wouldbe interesting to know if different miRNAs have inter-actions in plant responses to abiotic stress. To this end,stem-loop RT-qPCR was conducted to analyze severalconserved miRNAs that are implicated in plant abioticstress responses, includingmiR396,miR156, andmiR172(Wu et al., 2009a; Gao et al., 2010; Hackenberg et al.,2012; Liang et al., 2012; Bhardwaj et al., 2014; Cui et al.,2014; Gupta et al., 2014; Pandey et al., 2014; Xie et al., 2015).Figure 11, A to C, shows that miR396, miR156, andmiR172 were all down-regulated in transgenic plantsoverexpressing Osa-miR528, suggesting a potentialcross talk of miR528 with other miRNAs in the regu-latory network to orchestrate the plant response to stress.It should be noted that, since these miRNAs are alsopredominantly involved in development, for example,

miR156 and miR172 control phase change and floweringtime (Huijser and Schmid, 2011) and miR396 functions incell development and proliferation in leaves (Rodriguezet al., 2010), it is possible that changes in these miRNAs inthe miR528 transgenic plants may reflect their cross talkwith miR528 to contribute to the changes in plant devel-opment, leading to the altered plant morphology ob-served in miR528 transgenic plants.

Besides its cross talk with other miRNAs, miR528was also examined for its potential impact on theexpression of other stress-related genes. NAC (forNAM [No Apical Meristems], ATAF [ArabidopsisTranscription Activation Factor], and CUC [Cup-ShapeCotyledon]) proteins play an important role in plantenvironmental stress tolerance (Koyama et al., 2010).ONAC60 (Os12g41680), one of the NAC family mem-bers in rice, is significantly up-regulated by high

Figure 9. Putative miR528 target iden-tification in creeping bentgrass. A and B,Expression levels of AsAAO (A) andAsCBP1 (B) in wild-type plants (WT) andthree transgenic (TG) lines examined viaRT-qPCR. AsUBQ5 was used as an en-dogenous control. Data are presented asmeans of three technical replicates, anderror bars represent SE. Asterisks indicatea significant difference of expressionlevels between the wild type and eachtransgenic line: *, P, 0.05; **, P, 0.01;and ***, P, 0.001 by Student’s t test. C,Comparison of miR528 target sites in theputative targets AAO and CBP1 betweenrice and creeping bentgrass. Asterisksindicate identical RNA sequences. D,Information about the orthologs of thetwo putative miR528 target genes in riceand Arabidopsis.

Figure 10. Expression patterns of the twomiR528 putative targets under salt andN deficiency conditions through real-timeRT-PCR analysis. A, Expression profiles ofAsAAO andAsCBP1 in wild-type leaf androot tissues under 200mMNaCl treatment(0–6 h). B, Expression profiles of AsAAOand AsCBP1 in wild-type leaf and roottissues under N starvation (0 mM N) from0 to 8 d. AsUBQ5 was used as an en-dogenous control. Data are presented asmeans of three technical replicates, anderror bars represent SE. Asterisks indicatesignificant differences of gene expressionlevels between untreated and stress-treatedleaf or root tissues: *, P , 0.05; **, P ,0.01; and ***, P, 0.001 by Student’s t test.


Yuan et al.



salinity (Nuruzzaman et al., 2010). We examined theexpression of AsNAC60, an ortholog of ONAC60 increeping bentgrass (Zhou et al., 2013). Figure 11Dshows that AsNAC60 was up-regulated in three trans-genic lines, suggesting that miR528 may indirectlyregulate AsNAC60 expression, which contributes to theconcerted plant response to stress.

DISCUSSION

miR528-Mediated Plant Development

The miRNAs play diverse roles in plant develop-ment. However, there has been no report so far demon-strating the involvement of miR528 in plant developmentat the vegetative stage. In this study, we show thattransgenic creeping bentgrass overexpressingOsa-miR528exhibits thicker leaves, more vascular bundles, more tillers,shorter internodes and tillers, and more upright growththan wild-type controls. Less vertical plant growth due toshortened internodes, resulting in a dwarf phenotype, isone of the desirable traits in turf grass. Increased tillernumber that results in denser,more attractive, anduniformcommunities is another desirable turf trait.Lignin contributes to the structural rigidity of the cell

wall, which is required to keep plants continuouslyerect. miR528-expressing transgenic creeping bentgrasshas more vascular bundles than wild-type controls,suggesting that miR528 transgenics might containmorelignin than wild-type controls. This is supported by themore upright growth of transgenic plants than wild-type controls (Supplemental Fig. S1C). Further study ofthe difference in lignin contents and cell wall structure

between wild-type and transgenic plants should pro-vide evidence for a better understanding of miR528-mediated alteration in plant development.

Lodging largely reduces crop yield and grain quality.Strong and short stems are essential in plant lodgingresistance. miR528 transgenic plants with increasedvascular bundles and probably higher lignin contentscontribute to the stronger stems than wild-type con-trols. It is likely that the stronger stems of the transgenicplants would lead to enhanced lodging resistance.Additionally, the shorter internodes and shorter tillerlength of the transgenics would also account for in-creased lodging resistance. To our knowledge, therehave been no studies showing miRNA-mediated plantlodging responses. Our data demonstrate the possibleinvolvement of miR528 in the plant response to lodgingstress via regulating plant architecture.

ROS Scavenging and Abiotic Stress Resistance

Antioxidants such as AA and glutathione, andROS-scavenging enzymes such as SOD, CAT, andASCORBATE PEROXIDASE, play important roles inprotecting plants against abiotic stresses (Rizhsky et al.,2004; Wang et al., 2005; Leshem et al., 2006; Koussevitzkyet al., 2008). Among the predicted targets of miR528 inrice, AAO, laccase precursor protein, andZn/Cu SODareinvolved in ROS detoxification, and CBP1 encodes aprotein belonging to the cupredoxin superfamily, whichfunctions in oxidation homeostasis and electron transferreactions, suggesting the critical role of miR528 in plantabiotic stress tolerance. In zinc-deficient sorghum,miR528is down-regulated in young leaves, while the gene

Figure 11. Expression levels of the abi-otic stress-relatedmiRNAs andAsNAC60in wild-type controls and Osa-miR528transgenic lines. A to C, Expression levelsof miR396 (A), miRl56 (B), and miR172(C) in wild-type (WT) and transgenic (TG)plants revealed through stem-loop RT-qPCR analysis. D, Expression levels ofAsNAC60 in the wild type and threetransgenic lines through RT-qPCR analy-sis. Three technical replicates were usedfor the RT-qPCR analysis. AsUBQ5 wasused as an endogenous control. The rel-ative changes of gene expression werecalculated based on the 22DDCT method(Livak and Schmittgen, 2001). The errorbars represent SE (n = 3). Asterisks indi-cate a significant difference of expressionlevels between the wild-type control andeach transgenic line: *, P, 0.05; **, P,0.01; and ***, P , 0.001 by Student’st test.






expression and the enzyme activity of Zn/Cu SOD areincreased (Li et al., 2013). In transgenic creeping bent-grass overexpressing miR528, the enzyme activity ofSOD does not show significant differences betweenwild-type and transgenic plants before and after salin-ity stress. Further studies by cloning and analyzinggenes encoding Zn/Cu SOD will provide informationfor a better understanding of the interaction betweenSOD and miR528 in creeping bentgrass.

CAT, mainly localized in peroxisomes, serves as anefficient ROS scavenger to remove excessive H2O2 toavoid oxidative damage (Mhamdi et al., 2010). In thisstudy, transgenic plants show increased CAT activity inboth normal and salinity conditions, indicating thatthey have an enhanced capacity of balancing betweenROS accumulation and scavenging compared withwild-type controls, thus leading to enhanced salinityresistance. Many CATs are regulated by developmentaland environmental oxidative stresses (Du et al., 2008;Chen et al., 2012). In Capsicum annuum, a CAT gene isinduced under NaCl treatment (Kwon and An, 2001).Among the predicted targets of miR528, however, thereis no gene encoding CAT. Presumably, other factorstriggered by miR528 overexpression cause the in-creased CAT activity and contribute to the increasedsalt tolerance.

Environmental stimuli trigger the oxidative burstmainly caused by changes in the redox state. AA is themajor redox buffer in plants, while AAO catalyzes theoxidation of AA to dehydroascorbic acid via dehy-droascorbate. Previous studies indicate that the redoxstate of the AA pool in plants is regulated by AAO(Pignocchi and Foyer, 2003; Pignocchi et al., 2003).Transgenic tobacco (Nicotiana tabacum) overexpressingAAO leads to increased ozone sensitivity due to theoxidized AApool in the apoplast, the first line of defenseagainst ROS (Pignocchi and Foyer, 2003; Sanmartin et al.,2003). In this study, AAO is predicted to be the directtarget of miR528. In addition, transgenic plants exhibitsignificantly lower AAO activity thanwild-type controlsunder salinity and N deficiency conditions (Fig. 9A),whichwould presumably result in an enhanced capacityof maintaining the AA redox state in transgenics andthereby enhancing plant oxidative stress resistance.

Leaf senescence is an age-dependent and a highlyregulated degenerative process. The accumulation ofROS with age is a signal to trigger leaf senescence. Inthis study, transgenic plants exhibit less wilting ofleaves than wild-type controls under normal growthconditions (Supplemental Fig. S4). Given that miR528plants show enhanced CAT activity and, consequently,increased capacity of ROS scavenging, it is plausiblethat the overexpression of miR528 delays the processof leaf senescence in transgenic plants. Although leafsenescence is a genetically programmed and tightly con-trolled process, it is also influenced by various environ-mental cues (Becker andApel, 1993; Buchanan-Wollastonet al., 2005). Under salinity and N deficiency, miR528plants display less wilting of leaves than wild-typecontrols, as observed in normal growth conditions,

indicating a decreased leaf senescence rate in transgenicplants. It is likely that the increased CAT activity andthe decreased AAO activity in transgenics lead to theenhanced ROS scavenging and, consequently, delayedleaf senescence.

K+:Na+ Ratio and High-Salinity Resistance

Elevated cellular Na+ contents result in the inhibitionof K+ absorption due to the physiochemical similaritybetween Na+ and K+ and, consequently, a lack of dis-crimination between them during cation-transportingand enzyme reactions (Maathuis and Amtmann,1999). As K+ participates in many important processesduring metabolism, growth, and the stress response, itis critical to maintain a high cytosolic K+:Na+ ratio. Inthis study, the K+:Na+ ratio is significantly increased inthree transgenic lines in comparison with wild-typecontrols under salinity stress, due to the increased ca-pacity of maintaining stable K+ acquisition and distri-bution (Fig. 5, F and H), which results in the enhancedsalt tolerance inmiR528 plants. Further gene expressionanalysis reveals that the stable K+ acquisition in trans-genics is associated with the increased expression ofHAK5, a high-affinity K+ transporter (Fig. 6). Similarresults were also reported in rice. The OsHAK5 knock-out mutant exhibits severely impaired K+ influx andtransport, decreased K+:Na+ ratio, and sensitivity to saltstress compared with wild-type rice, whereas OsHAK5overexpression leads to increased K+ uptake and K+:Na+

ratio and enhanced salt stress tolerance in transgenic riceplants (Yang et al., 2014).

Interestingly, miR528 transgenic leaves show signif-icantly higher Na+ contents than wild-type controlsunder normal growth conditions (Fig. 5A), whereas Na+

contents are similar in wild-type and transgenic plantsduring salt treatment (Fig. 5B). Similar phenomenahave also been observed previously in other plantspecies. A study based on more than 300 Arabidopsisaccessions shows that accessions growing in high-salinesoil have higher Na+ accumulation in leaves than others(Baxter et al., 2010). The elevated Na+ in leaves resultsfrom a weak allele of Arabidopsis High-Affinity Potas-sium Transporter1;1 (AtHKT1;1), which promotes theaccumulation of Na+ in leaves without Na+ toxicity(Baxter et al., 2010). Similarly, a transgenic barley(Hordeum vulgare) overexpressing HvHKT2;1 exhibitselevated shoot Na+ accumulation and enhanced saltstress tolerance (Mian et al., 2011).We speculate that theelevatedNa+ inmiR528 transgenic leaves is the result ofa salt inclusion mechanism for osmotic adjustmentduring salt stress. In this study, the similar accumulationof Na+ in wild-type and transgenic plants might accountfor the saturated Na+ environment under severe saltstress treatment. Further testing under moderate salt con-ditions and analysis of the main membrane transportersin transgenic plants overexpressingmiR528would allow abetter understanding ofmiR528-mediatedNa+ uptake anddistribution in plants.


Yuan et al.




N Assimilation and N Deficiency Tolerance

N is one of the most critical elements for crop pro-ductivity. Currently, 67% of N applied to soil is lost intothe environment (Abrol and Raghuram, 2007). Al-though the form and the amount of N available toplants can be improved via optimizing Nmanagement,the efficiency of N utilization has to be tackled biolog-ically. NUE mainly includes N uptake and N assimi-lation. Many attempts have been made so far towardmanipulating key genes in the process of these twosteps (Ferrario-Mery et al., 1998; Limami et al., 1999; Feiet al., 2003). However, success has been limited. Forexample, constitutive expression of NiR in Arabidopsisand tobacco leads to increased transcription of NiR butdecreased enzyme activity of NiR, due to the post-translational modification (Crété et al., 1997; Takahashiet al., 2001). In this study, miR528 transgenic plantsexhibit increased transcript levels of AsNiR (Fig. 8A)and enzyme activity (Fig. 8B), which might contributeto the increased N assimilation efficiency and betterNUE. The molecular mechanisms of miR528-mediatedAsNiR regulation remain elusive. It is hypothesized thatthe expression of AsNiR might be controlled by eitherthe targets of miR528, or some other factors triggeredby miR528, or directly by miR528 itself at the tran-scriptional, posttranscriptional, or posttranslationallevel. Interestingly, NiR activity in both wild-type andtransgenic plants increases under N starvation com-pared with normal conditions, suggesting the involve-ment of other factors in the regulation of NiR activity.Given the improved shoot biomass and total N con-

tent in transgenic plants in comparison with wild-typecontrols during N deficiency (Fig. 7H), it is likely thattransgenic plants have increased N uptake or assimi-lation or total NUE. The expression levels of genes en-coding the key enzymes NR, NiR, GS, and GOGAT inthe N assimilation pathway have been comparedbetween wild-type and transgenic plants. Furtherstudy characterizing important nitrate transportersin wild-type and miR528 transgenic plants will allowa better understanding of the enhanced tolerance toN deficiency.Excessive N limits the plant uptake of other nutri-

tional elements, such as K and phosphorus, and sub-sequently results in reduced biomass accumulationcompared with N-sufficient conditions, as observed inthis study (Fig. 7, B, E, and F). Interestingly, miR528transgenics display significantly higher shoot biomassand total N contents than wild-type controls underexcessive N supplies (Fig. 7, B, D–F, and H). Therefore,it is hypothesized that miR528 might be an importantregulator functioning in buffering the imbalanced min-eral elements. As discussed above, miR528 promotesAsHAK5, which functions in maintaining K acquisition.It is also likely that other factors impacted by miR528might be more directly involved in maintaining thehomeostasis of different nutritional elements duringN-excessive conditions and subsequently leading to theimproved biomass in transgenic plants.

Molecular Mechanisms of miR528-Mediated Plant Salt andN Deficiency Resistance

The accumulation of miR528 is elevated during saltstress (Fig. 1A), which might cause reduced transcriptlevels of its predicted targets AsAAO and AsCBP1(Fig. 9). Both targets are suggested to mediate oxidationhomeostasis and, thus, prevent damage to cellularcomponents. Besides the direct targets of miR528, genesinvolved in other signaling pathways also contribute tothe enhanced salt stress tolerance. A high-affinity Ktransporter, AsHAK5, induced in transgenic creepingbentgrass overexpressing miR528 (Fig. 6), is critical formaintaining K+ homeostasis during normal and salinityconditions. Moreover, miR528 induces the activity ofCAT and, therefore, maintains ROS homeostasis underabiotic stress. In addition to functional proteins,miR528also positively regulatesAsNAC60 (Fig. 11D), which is acreeping bentgrass ortholog of a salt stress-inducedtranscription factor, suggesting the importance ofAsNAC60 in miR528-mediated salt stress tolerance increeping bentgrass. miR528 is gradually repressedduring N deficiency (Fig. 1C), therefore releasing theinhibition of its targets, which contribute to oxidationhomeostasis. AsNiR, a key enzyme in the process ofN assimilation, is positively regulated by miR528 (Fig.8B). The enhanced NUE is presumably attributed to theincreased AsNiR activity. miRNAs are suggested toserve as master regulators in the complex regulatorynetwork of plant responses to abiotic stress (Zhou andLuo, 2013). The impact of miR528 on the expression ofother stress-related miRNAs observed in this study

Figure 12. Hypothetical model of the molecular mechanisms ofmiR528-mediated plant abiotic stress response in creeping bentgrass.miR528 is induced during salinity stress but down-regulated underN deficiency. miR528 mediates plant abiotic stress responses throughdirectly repressing the expression of its targets AsAAO and AsCBP1,which regulate the oxidation homeostasis during abiotic stresses. Inaddition, miR528 positively regulates AsNAC60, AsHAK5, and AsNiRand the gene encoding the antioxidant enzyme CAT, which leads to theenhanced tolerance to salinity stress and N deficiency. Furthermore,expression levels of other stress-related miRNAs are negatively regulatedby miR528, suggesting that different miRNAs form a regulatory network tocoordinately integrate various signals in response to plant abiotic stress.





(Fig. 11, A–C) suggests the coordinated interactions ofmultiple stress regulators, thereby leading to enhancedsalt andN deficiency tolerance. The hypothetical modelof the miR528-mediated plant abiotic stress responsepathway (Fig. 12) provides information allowing thedevelopment of novel molecular strategies to geneti-cally engineer crop species for enhanced environmentalstress tolerance.

MATERIALS AND METHODS

Cloning of the miR528 Gene and Plasmid Construction

The 550-bp rice (Oryza sativa) cDNA (AK073820) containing theOsa-miR528stem-loop structure was isolated by PCR using the forward and reverse primerset 59-TCTAGAGATCAGCAGCAGCCACA-39 and 59-GTCGACGACCAAA-TAATGTGTTACTG-39, which contained XbaI and SalI restriction sites(underlined), respectively. PCR products were cloned into the binary vectorpZH01 (Xiao et al., 2003), generating the Osa-miR528 overexpression geneconstruct p35S-Osa-miR528/p35S-Hyg. The construct contains the CaMV 35Spromoter driving Osa-miR528 linked to the CaMV 35S promoter driving theHyg gene for hygromycin resistance as a selectable marker. For subsequentplant transformation, the construct was transferred into Agrobacterium tumefa-ciens strain LBA4404.

Plant Materials and Transformation

Creeping bentgrass (Agrostis stolonifera) ‘Penn A-4’ (supplied by HybriGene)was used for plant transformation. Transgenic plants constitutively expressingOsa-miR528 were produced via A. tumefaciens-mediated transformation ofembryonic callus induced from mature seeds as described previously (Luoet al., 2004).

Plant Propagation, Maintenance, and AbioticStress Treatments

The regenerated transgenic plants overexpressingOsa-miR528 andwild-typecontrols were clonally propagated from tillers and maintained as describedpreviously (Zhou et al., 2013).

For salt stress treatments, plants grown in cone-tainers were immersed in a200 mM NaCl solution supplemented with 0.2 g L21 water-soluble fertilizer.After 9-d salt treatments, shoots and roots were harvested for further physio-logical analysis. Replicates of the salt-treated plants were recovered from saltstress by watering with 0.2 g L21 water-soluble fertilizer every other day andwere photographed for documentation. For miR528 expression analysis, wild-type leaves were collected at 0, 1.5, 3, and 6 h after salt stress treatment.

To test the performance ofwild-type and transgenic plants under differentconcentrations of N, plants grown in cone-tainers were immersed in modi-fied MS nutrient solution of pH 5.7 containing 3 mM CaCl2∙2H2O, 1.5 mM

MgSO4∙7H2O, 1.25 mM KH2PO4, 0.1 mM H3BO3, 0.1 mM MnSO4∙4H2O, 0.1mM ZnSO4∙H2O, 0.5 mM potassium iodide, 0.56 mM NaMO4∙2H2O, 0.1 mM

CuSO4∙5H2O, 0.1 mM CoCl2∙6H2O, 0.1 mM FeSO4∙7H2O, and 0.1 mM

Na2EDTA∙2H2O, supplemented with N at different concentrations (0.4, 2,10, or 40 mM). N supplies include KNO3 and NH4NO3. Equivalent amountsof KCl were added to the nutrient solutions to maintain the osmotic potential andprevent K deficiency caused by low supplies of KNO3. For miR528 expressionanalysis, wild-type plantswere immersed inmodifiedMS nutrient solutionwithoutN.Wild-type leaveswere collected at 0, 2, 5, 8, and 12 d afterN starvation treatment.

Theexpressionprofile ofmiR528duringdrought stresswasanalyzed inwild-type creeping bentgrass leaves. Wild-type plants were grown hydroponicallywith 0.2 g L21 water-soluble fertilizer. Right before the drought treatment, theplants were taken out of the nutritional solution and dried with a paper towel.They were then laid on the bench for air drying. The leaf samples were collectedat 0, 1, 2, and 4 h after drought treatment.

Plant DNA and RNA Isolation and Expression Analysis

Plant genomic DNA was extracted from 30 mg of fresh leaves following theprotocol of Luo et al. (1995). Plant total RNA was isolated from 100 mg of fresh

leaves using Trizol reagent (Invitrogen) following the manufacturer’s protocol.First-strand cDNA was synthesized from 2 mg of RNA with SuperScript IIReverse Transcriptase (Invitrogen) and oligo(dT) or gene-specific primers.Semiquantitative RT-PCR was conducted on 24 to 30 cycles based on its ex-ponential phase. PCR products were separated by electrophoresis using a 0.8%(w/v) or 1.5% (w/v) agarose gel, visualized, and photographed with theBioDoc-It imaging system (Ultra-Violet Products).

RT-qPCR was performed with 12.5 mL of iQ SYBR-Green Supermix (Bio-RadLaboratories) per 25-mL reaction. The green fluorescence signal was monitoredon the Bio-Rad iQ5 real-time detection system using the iQ5 Optical SystemSoftware version 2.0 (Bio-Rad Laboratories). AsACT1 (JX644005) and AsUBQ5(JX570760) were used as endogenous controls. The relative changes in gene ex-pression were calculated based on the comparative threshold cycle method(Livak and Schmittgen, 2001).

Stem-loop RT-qPCR was performed according to the protocol of Varkonyi-Gasic et al. (2007). The Osa-miR528 stem-loop RT primer and PCR forwardprimer are 59-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA-TACGACCTCCTC-39 and 59-GCAGTGGAAGGGGCATGCA-39, respectively.

Measurement of Mineral Content

For Na+ and K+ content measurements, leaves and roots of wild-type andtransgenic plants were collected before and after a 9-d 200 mM NaCl solutiontreatment. For total N measurement, wild-type and transgenic plant leaveswere collected after 4 weeks of treatment with different concentrations of N: 0.4,2, 10, and 40 mM. A total of 0.2 g of each dried sample for total N measurementand 0.5 g of each dried sample for Na+ and K+ content measurements wereanalyzed to determine the mineral contents according to previous protocols(Haynes, 1980; Li et al., 2010).

Measurement of Leaf RWC, EL, Chlorophyll, andPro Content

Plant leaf RWC, EL, chlorophyll a and b, as well as Pro content were mea-sured following previous protocols (Bates et al., 1973; Li et al., 2010).

Antioxidant Enzyme Assay

A total of 0.1 g of leaveswasweighed andhomogenized immediately in 1mLof 0.05 M phosphate-buffered saline at pH 7.8 on ice and centrifuged at 14,000gfor 30 min at 4°C. Supernatant of each sample was transferred to a new 1.5-mLEppendorf tube and stored on ice for further enzyme assay. The activity of SOD(EC 1.15.1.1) was determined as described previously (Giannopolitis and Ries,1977). One unit of SOD activity was defined as the amount of enzyme requiredto inhibit a 50% (v/v) reduction of nitroblue tetrazolium chloride.

The activity of CAT (EC 1.11.7.6) was determined as described previously(Maehly and Chance, 1954). The decomposition of H2O2 was measured by thedecrease of the absorbance at the wavelength of 240 nm for 1 min. An enzymeunit was defined as the amount of enzyme necessary to decompose 1 mM H2O2at 25°C in 1 min.

NiR Assay

NiR (EC 1.7.2.1) activity was measured by a spectrophotometric assay asdescribed previously (Losada and Paneque, 1971). The nitrite content wascalculated from a KNO2 standard curve. NiR activity was determined by thereduction of nitrite that was catalyzed by the enzyme in 1 mg of soluble proteinper hour. Protein contents weremeasured according to the dye-bindingmethodof Bradford (1976).

AAO Assay

The activity of AAO (EC 1.10.3.3) was determined spectrophotometrically at25°C following the decrease in absorbance of ascorbic acid at 265 nm as de-scribed previously (Esaka et al., 1988). The activity of AAO was determined as:

Activity�U3mg2 1protein

� ¼ðDA265=minÞ3 23dilution factor=3 ðe3 0:053 total proteinÞ

where e = 13.386 mM-1 cm21 (an extinction coefficient for ascorbic acid at

265 nm), total volume = 2 mL, and enzyme volume = 0.05 mL.


Yuan et al.



Plant Histology Analysis

The second and third internodes from the top tillers and the fully expandedleaves of wild-type and transgenic plants were collected and immersed informalin-acetic-alcohol fixation for 48 h at room temperature. After fixation,plant tissues were dehydratedwith a series of graded ethanol from 70% to 100%(v/v), followed by paraffin wax infiltration. Tissues were then embedded inparaffin blocks to process sections using a rotary microtome (RM 2165; Leica).Sections were stained using Toluidine Blue and observed with a stereomicro-scope (MEIJI EM-5). Photographs were taken using a 35-mm SLR camera body(Canon) connected to amicroscope. Scale barswere added to photographs usingImageJ (Abràmoff et al., 2004).

Sequence data from this article can be found in GenBank under accessionnumbers KR911823, KR911824, KR911825, KR911826, KR911827, KR911828,and KR911829.

Supplemental Data

The following supplemental materials are available.

Supplemental Figure S1. Development of wild-type and transgenic plants.

Supplemental Figure S2. Biomass measurement in wild-type and trans-genic plants.

Supplemental Figure S3. Antioxidant enzyme activity assay under normaland salt conditions.

Supplemental Figure S4. Wild-type plants exhibit wilting leaf tips com-pared with three transgenic lines.

Supplemental Figure S5. Biomass accumulation of wild-type and Osa-miR528 transgenic plants in response to different concentrations of Nsupplies.

Supplemental Figure S6. AAO activity measurement under normal and Ndeficiency conditions.

ACKNOWLEDGMENTS

We thank Dr. Julia Frugoli, Dr. Liangjiang Wang, Dr. William R. Marcotte,Dr. Halina Knap, and members of H.L.’s laboratory for useful discussions andDr. Lihuang Zhu for providing the binary vector pZH01.

Received June 15, 2015; accepted July 29, 2015; published July 29, 2015.

LITERATURE CITED

Abràmoff MD, Magalhães PJ, Ram SJ (2004) Image processing with Im-ageJ. Biophoton Int 11: 36–43

Abrol Y, Raghuram N (2007) Agricultural Nitrogen Use and Its EnvironmentalImplications. I.K. International Publishing House, New Dehli, India

Ali Y, Aslam Z, Ashraf M, Tahir G (2004) Effect of salinity on chlorophyllconcentration, leaf area, yield and yield components of rice genotypesgrown under saline environment. Int J Environ Sci Technol 1: 221–225

An FM, Hsiao SR, Chan MT (2011) Sequencing-based approaches reveallow ambient temperature-responsive and tissue-specific microRNAs inPhalaenopsis orchid. PLoS ONE 6: e18937

Ashraf M, Foolad M (2007) Roles of glycine betaine and proline in im-proving plant abiotic stress resistance. Environ Exp Bot 59: 206–216

Bates L, Waldren R, Teare I (1973) Rapid determination of free proline forwater-stress studies. Plant Soil 39: 205–207

Baxter I, Brazelton JN, Yu D, Huang YS, Lahner B, Yakubova E, Li Y,Bergelson J, Borevitz JO, Nordborg M, et al (2010) A coastal cline insodium accumulation in Arabidopsis thaliana is driven by natural varia-tion of the sodium transporter AtHKT1;1. PLoS Genet 6: e1001193

Becker W, Apel K (1993) Differences in gene expression between naturaland artificially induced leaf senescence. Planta 189: 74–79

Bhardwaj AR, Joshi G, Pandey R, Kukreja B, Goel S, Jagannath A, KumarA, Katiyar-Agarwal S, Agarwal M (2014) A genome-wide perspective ofmiRNAome in response to high temperature, salinity and droughtstresses in Brassica juncea (Czern) L. PLoS ONE 9: e92456

Bradford MM (1976) A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 72: 248–254

Buchanan-Wollaston V, Page T, Harrison E, Breeze E, Lim PO, Nam HG,Lin JF, Wu SH, Swidzinski J, Ishizaki K, et al (2005) Comparativetranscriptome analysis reveals significant differences in gene expressionand signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. Plant J 42: 567–585

Chapin FS III, Walter CH, Clarkson DT (1988) Growth response of barleyand tomato to nitrogen stress and its control by abscisic acid, waterrelations and photosynthesis. Planta 173: 352–366

Chen HJ, Wu SD, Huang GJ, Shen CY, Afiyanti M, Li WJ, Lin YH (2012)Expression of a cloned sweet potato catalase SPCAT1 alleviatesethephon-mediated leaf senescence and H2O2 elevation. J Plant Physiol169: 86–97

Crété P, Caboche M, Meyer C (1997) Nitrite reductase expression is reg-ulated at the post-transcriptional level by the nitrogen source in Nico-tiana plumbaginifolia and Arabidopsis thaliana. Plant J 11: 625–634

Cui LG, Shan JX, Shi M, Gao JP, Lin HX (2014) The miR156-SPL9-DFRpathway coordinates the relationship between development and abioticstress tolerance in plants. Plant J 80: 1108–1117

Dai X, Zhao PX (2011) psRNATarget: a plant small RNA target analysisserver. Nucleic Acids Res 39: W155–W159

Dennison C (2005) Investigating the structure and function of cupredoxins.Coord Chem Rev 249: 3025–3054

Ding D, Zhang L, Wang H, Liu Z, Zhang Z, Zheng Y (2009) Differentialexpression of miRNAs in response to salt stress in maize roots. Ann Bot(Lond) 103: 29–38

Du YY, Wang PC, Chen J, Song CP (2008) Comprehensive functionalanalysis of the catalase gene family in Arabidopsis thaliana. J Integr PlantBiol 50: 1318–1326

Esaka M, Imagi J, Suzuki K, Kubota K (1988) Formation of ascorbateoxidase in cultured pumpkin cells. Plant Cell Physiol 29: 231–235

Fei H, Chaillou S, Hirel B, Mahon JD, Vessey JK (2003) Overexpression ofa soybean cytosolic glutamine synthetase gene linked to organ-specificpromoters in pea plants grown in different concentrations of nitrate.Planta 216: 467–474

Ferrario-Mery S, Valadier MH, Foyer CH (1998) Overexpression of nitratereductase in tobacco delays drought-induced decreases in nitrate re-ductase activity and mRNA. Plant Physiol 117: 293–302

Ferreira TH, Gentile A, Vilela RD, Costa GGL, Dias LI, Endres L,Menossi M (2012) MicroRNAs associated with drought response in thebioenergy crop sugarcane (Saccharum spp.). PLoS ONE 7: e46703

Fraisier V, Gojon A, Tillard P, Daniel-Vedele F (2000) Constitutive ex-pression of a putative high-affinity nitrate transporter in Nicotianaplumbaginifolia: evidence for post-transcriptional regulation by a re-duced nitrogen source. Plant J 23: 489–496

Gambale F, Uozumi N (2006) Properties of shaker-type potassium channelsin higher plants. J Membr Biol 210: 1–19

Gao P, Bai X, Yang L, Lv D, Li Y, Cai H, Ji W, Guo D, Zhu Y (2010) Over-expression of osa-MIR396c decreases salt and alkali stress tolerance.Planta 231: 991–1001

Giannopolitis CN, Ries SK (1977) Superoxide dismutases. I. Occurrence inhigher plants. Plant Physiol 59: 309–314

Golldack D, Lüking I, Yang O (2011) Plant tolerance to drought andsalinity: stress regulating transcription factors and their functionalsignificance in the cellular transcriptional network. Plant Cell Rep 30:1383–1391

Gupta OP, Meena NL, Sharma I, Sharma P (2014) Differential regulation ofmicroRNAs in response to osmotic, salt and cold stresses in wheat. MolBiol Rep 41: 4623–4629

Hackenberg M, Shi BJ, Gustafson P, Langridge P (2012) A transgenictranscription factor (TaDREB3) in barley affects the expression of mi-croRNAs and other small non-coding RNAs. PLoS ONE 7: e42030

Haynes R (1980) A comparison of two modified Kjeldahl digestion tech-niques for multi‐element plant analysis with conventional wet and dryashing methods. Commun Soil Sci Plant Anal 11: 459–467

Huijser P, Schmid M (2011) The control of developmental phase transitionsin plants. Development 138: 4117–4129

Kandlbinder A, Finkemeier I, Wormuth D, Hanitzsch M, Dietz KJ (2004)The antioxidant status of photosynthesizing leaves under nutrient de-ficiency: redox regulation, gene expression and antioxidant activity inArabidopsis thaliana. Physiol Plant 120: 63–73











Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N,Yazaki J, Ishikawa M, Yamada H, Ooka H, et al (2003) Collection,mapping, and annotation of over 28,000 cDNA clones from japonica rice.Science 301: 376–379

Kim MH, Sato S, Sasaki K, Saburi W, Matsui H, Imai R (2013) COLDSHOCK DOMAIN PROTEIN 3 is involved in salt and drought stresstolerance in Arabidopsis. FEBS Open Bio 3: 438–442

Koussevitzky S, Suzuki N, Huntington S, Armijo L, Sha W, Cortes D,Shulaev V, Mittler R (2008) Ascorbate peroxidase 1 plays a key role inthe response of Arabidopsis thaliana to stress combination. J Biol Chem283: 34197–34203

Koyama T, Mitsuda N, Seki M, Shinozaki K, Ohme-Takagi M (2010) TCPtranscription factors regulate the activities of ASYMMETRIC LEAVES1and miR164, as well as the auxin response, during differentiation ofleaves in Arabidopsis. Plant Cell 22: 3574–3588

Kozomara A, Griffiths-Jones S (2014) miRBase: annotating high confidencemicroRNAs using deep sequencing data. Nucleic Acids Res 42: D68–D73

Kwon SI, An CS (2001) Molecular cloning, characterization and expressionanalysis of a catalase cDNA from hot pepper (Capsicum annuum L.).Plant Sci 160: 961–969

Lebaudy A, Véry AA, Sentenac H (2007) K+ channel activity in plants:genes, regulations and functions. FEBS Lett 581: 2357–2366

Leshem Y, Melamed-Book N, Cagnac O, Ronen G, Nishri Y, Solomon M,Cohen G, Levine A (2006) Suppression of Arabidopsis vesicle-SNAREexpression inhibited fusion of H2O2-containing vesicles with tonoplastand increased salt tolerance. Proc Natl Acad Sci USA 103: 18008–18013

Li C, Chang PP, Ghebremariam KM, Qin L, Liang Y (2014) Over-expression of tomato SpMPK3 gene in Arabidopsis enhances the osmotictolerance. Biochem Biophys Res Commun 443: 357–362

Li Y, Zhang Y, Shi D, Liu X, Qin J, Ge Q, Xu L, Pan X, Li W, Zhu Y, et al(2013) Spatial-temporal analysis of zinc homeostasis reveals the re-sponse mechanisms to acute zinc deficiency in Sorghum bicolor. NewPhytol 200: 1102–1115

Li Z, Baldwin CM, Hu Q, Liu H, Luo H (2010) Heterologous expression ofArabidopsis H+-pyrophosphatase enhances salt tolerance in transgeniccreeping bentgrass (Agrostis stolonifera L.). Plant Cell Environ 33: 272–289

Liang G, He H, Yu D (2012) Identification of nitrogen starvation-responsivemicroRNAs in Arabidopsis thaliana. PloS One 7: e48951

Limami A, Phillipson B, Ameziane R, Pernollet N, Jiang Q, Roy R,Deleens E, Chaumont-Bonnet M, Gresshoff PM, Hirel B (1999) Doesroot glutamine synthetase control plant biomass production in Lotusjaponicus L.? Planta 209: 495–502

Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X (2005) Loss of function ofOsDCL1 affects microRNA accumulation and causes developmentaldefects in rice. Plant Physiol 139: 296–305

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression datausing real-time quantitative PCR and the 22DDCT method. Methods 25:402–408

Losada M, Paneque A (1971) Nitrite reductase. Methods Enzymol 23: 487–491Lu Y (2003) Cupredoxins. In J McCleverty, TJ Meyer, eds, Comprehensive

Coordination Chemistry II: From Biology to Nanotechnology, Vol 8.Elsevier, Oxford, pp 91–122

Lu Y, Li Y, Zhang J, Xiao Y, Yue Y, Duan L, Zhang M, Li Z (2013) Over-expression of Arabidopsis molybdenum cofactor sulfurase gene confersdrought tolerance in maize (Zea mays L.). PLoS One 8: e52126

Luo H, Hu Q, Nelson K, Longo C, Kausch AP, Chandlee JM, Wipff JK,Fricker CR (2004) Agrobacterium tumefaciens-mediated creeping bent-grass (Agrostis stolonifera L.) transformation using phosphinothricin se-lection results in a high frequency of single-copy transgene integration.Plant Cell Rep 22: 645–652

Luo H, Van Coppenolle B, Seguin M, Boutry M (1995) MitochondrialDNA polymorphism and phylogenetic relationships in Hevea brasiliensis.Mol Breed 1: 51–63

Maathuis FJ, Amtmann A (1999) K nutrition and Na toxicity: the basis ofcellular K/Na ratios. Ann Bot (Lond) 84: 123–133

Maehly AC, Chance B (1954) The assay of catalases and peroxidases.Methods Biochem Anal 1: 357–424

Marschner H (1995) Functions of mineral nutrients: macronutrients. In HMarschner, ed, Mineral Nutrition of Higher Plants. Academic Press,New York, pp 299–312

Marshall NM, Garner DK, Wilson TD, Gao YG, Robinson H, Nilges MJ,Lu Y (2009) Rationally tuning the reduction potential of a single cu-predoxin beyond the natural range. Nature 462: 113–116

Masclaux-Daubresse C, Daniel-Vedele F, Dechorgnat J, Chardon F,Gaufichon L, Suzuki A (2010) Nitrogen uptake, assimilation and re-mobilization in plants: challenges for sustainable and productive agri-culture. Ann Bot (Lond) 105: 1141–1157

Mäser P, Thomine S, Schroeder JI, Ward JM, Hirschi K, Sze H, Talke IN,Amtmann A, Maathuis FJ, Sanders D, et al (2001) Phylogenetic rela-tionships within cation transporter families of Arabidopsis. PlantPhysiol 126: 1646–1667

Mhamdi A, Queval G, Chaouch S, Vanderauwera S, Van Breusegem F,Noctor G (2010) Catalase function in plants: a focus on Arabidopsismutants as stress-mimic models. J Exp Bot 61: 4197–4220

Mian A, Oomen RJ, Isayenkov S, Sentenac H, Maathuis FJ, Véry AA(2011) Over-expression of an Na+-and K+-permeable HKT transporter inbarley improves salt tolerance. Plant J 68: 468–479

Munns R (1993) Physiological processes limiting plant growth in salinesoils: some dogmas and hypotheses. Plant Cell Environ 16: 15–24

Munns R (2002) Comparative physiology of salt and water stress. PlantCell Environ 25: 239–250

Nischal L, Mohsin M, Khan I, Kardam H, Wadhwa A, Abrol YP, Iqbal M,Ahmad A (2012) Identification and comparative analysis of microRNAsassociated with low-N tolerance in rice genotypes. PLoS ONE 7: e50261

Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, OokaH, Kikuchi S (2010) Genome-wide analysis of NAC transcription factorfamily in rice. Gene 465: 30–44

Pandey R, Joshi G, Bhardwaj AR, Agarwal M, Katiyar-Agarwal S (2014) Acomprehensive genome-wide study on tissue-specific and abiotic stress-specific miRNAs in Triticum aestivum. PLoS ONE 9: e95800

Pathak RR, Ahmad A, Lochab S, Raghuram N (2008) Molecular physiol-ogy of plant nitrogen use efficiency and biotechnological options for itsenhancement. Current Science Bangalore 94: 1394

Pignocchi C, Fletcher JM, Wilkinson JE, Barnes JD, Foyer CH (2003) Thefunction of ascorbate oxidase in tobacco. Plant Physiol 132: 1631–1641

Pignocchi C, Foyer CH (2003) Apoplastic ascorbate metabolism and its rolein the regulation of cell signalling. Curr Opin Plant Biol 6: 379–389

Rao G, Rao GR (1981) Pigment composition and chlorophyllase activity inpigeon pea (Cajanus indicus Spreng) and gingelley (Sesamum indicum L.)under NaCl salinity. Indian J Exp Biol 19: 768–770

Rizhsky L, Liang H, Shuman J, Shulaev V, Davletova S, Mittler R (2004)When defense pathways collide: the response of Arabidopsis to acombination of drought and heat stress. Plant Physiol 134: 1683–1696

Rodriguez RE, Mecchia MA, Debernardi JM, Schommer C, Weigel D,Palatnik JF (2010) Control of cell proliferation in Arabidopsis thaliana bymicroRNA miR396. Development 137: 103–112

Sanmartin M, Drogoudi PA, Lyons T, Pateraki I, Barnes J, Kanellis AK(2003) Over-expression of ascorbate oxidase in the apoplast of transgenictobacco results in altered ascorbate and glutathione redox states andincreased sensitivity to ozone. Planta 216: 918–928

Satoh K, Doi K, Nagata T, Kishimoto N, Suzuki K, Otomo Y, Kawai J,Nakamura M, Hirozane-Kishikawa T, Kanagawa S, et al (2007) Geneorganization in rice revealed by full-length cDNA mapping and geneexpression analysis through microarray. PLoS ONE 2: e1235

Sharma D, Tiwari M, Lakhwani D, Tripathi RD, Trivedi PK (2015) Dif-ferential expression of microRNAs by arsenate and arsenite stress innatural accessions of rice. Metallomics 7: 174–187

Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks involved indrought stress response and tolerance. J Exp Bot 58: 221–227

Solomon EI, Szilagyi RK, DeBeer George S, Basumallick L (2004) Elec-tronic structures of metal sites in proteins and models: contributions tofunction in blue copper proteins. Chem Rev 104: 419–458

Takahashi M, Sasaki Y, Ida S, Morikawa H (2001) Nitrite reductase geneenrichment improves assimilation of NO2 in Arabidopsis. Plant Physiol126: 731–741

Thiebaut F, Rojas CA, Grativol C, Motta MR, Vieira T, Regulski M,Martienssen RA, Farinelli L, Hemerly AS, Ferreira PC (2014) Genome-wide identification of microRNA and siRNA responsive to endophyticbeneficial diazotrophic bacteria in maize. BMC Genomics 15: 766

Turan S, Cornish K, Kumar S (2012) Salinity tolerance in plants: breedingand genetic engineering. Aust J Crop Sci 6: 1337–1348

Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP (2007) Proto-col: a highly sensitive RT-PCR method for detection and quantificationof microRNAs. Plant Methods 3: 12

Véry AA, Sentenac H (2002) Cation channels in the Arabidopsis plasmamembrane. Trends Plant Sci 7: 168–175


Yuan et al.



Véry AA, Sentenac H (2003) Molecular mechanisms and regulation of K+

transport in higher plants. Annu Rev Plant Biol 54: 575–603Wang FZ, Wang QB, Kwon SY, Kwak SS, Su WA (2005) Enhanced

drought tolerance of transgenic rice plants expressing a pea manganesesuperoxide dismutase. J Plant Physiol 162: 465–472

Wu G, Park MY, Conway SR, Wang JW, Weigel D, Poethig RS (2009a) Thesequential action of miR156 and miR172 regulates developmental timingin Arabidopsis. Cell 138: 750–759

Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y (2009b) Rice microRNA effectorcomplexes and targets. Plant Cell 21: 3421–3435

Xiao H, Wang Y, Liu D, Wang W, Li X, Zhao X, Xu J, Zhai W, Zhu L (2003)Functional analysis of the rice AP3 homologue OsMADS16 by RNAinterference. Plant Mol Biol 52: 957–966

Xie F, Wang Q, Sun R, Zhang B (2015) Deep sequencing reveals importantroles of microRNAs in response to drought and salinity stress in cotton. JExp Bot 66: 789–804

Xu Z, Zhong S, Li X, Li W, Rothstein SJ, Zhang S, Bi Y, Xie C (2011)Genome-wide identification of microRNAs in response to low nitrateavailability in maize leaves and roots. PLoS ONE 6: e28009

Yan J, Zhang H, Zheng Y, Ding Y (2015) Comparative expression profilingof miRNAs between the cytoplasmic male sterile line MeixiangA and itsmaintainer line MeixiangB during rice anther development. Planta 241:109–123

Yang T, Zhang S, Hu Y, Wu F, Hu Q, Chen G, Cai J, Wu T, Moran N, Yu L,et al (2014) The role of a potassium transporter OsHAK5 in potassiumacquisition and transport from roots to shoots in rice at low potassiumsupply levels. Plant Physiol 166: 945–959

Yeo A (1998) Molecular biology of salt tolerance in the context of whole-plant physiology. J Exp Bot 49: 915–929

Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ,Vincentz M, Nogueira FT (2010) Identification and expression analysisof microRNAs and targets in the biofuel crop sugarcane. BMC Plant Biol10: 260

Zhang Z, Wei L, Zou X, Tao Y, Liu Z, Zheng Y (2008) Submergence-responsive microRNAs are potentially involved in the regulation ofmorphological and metabolic adaptations in maize root cells. Ann Bot(Lond) 102: 509–519

Zhou M, Li D, Li Z, Hu Q, Yang C, Zhu L, Luo H (2013) Constitutiveexpression of a miR319 gene alters plant development and enhances saltand drought tolerance in transgenic creeping bentgrass. Plant Physiol161: 1375–1391

Zhou M, Luo H (2013) MicroRNA-mediated gene regulation: potentialapplications for plant genetic engineering. Plant Mol Biol 83: 59–75

Zhu JK (2002) Salt and drought stress signal transduction in plants. AnnuRev Plant Biol 53: 247–273





ConstitutiveExpressionofRiceMicroRNA528 AltersPlant … · detected (Fig. 2C). Cloning and...

Documents

Transcript of ConstitutiveExpressionofRiceMicroRNA528 AltersPlant … · detected (Fig. 2C). Cloning and...