Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular...
-
Upload
lionel-johnston -
Category
Documents
-
view
214 -
download
0
Transcript of Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular...
![Page 1: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/1.jpg)
Company LOGO
Magnetic silica spheres with large nanopores for nucleic acid adsorptio
nand cellular uptake
Jian Liu, Bo Wang, Sandy Budi Hartono BiomaterialsUniversity of Queensland, Australia
![Page 2: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/2.jpg)
www.themegallery.com,
contents
Introduction Experimental Section Results and Discussion Conclusions
![Page 3: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/3.jpg)
www.themegallery.com,
IntroductionMesoporous materials Large specific surface area Large pore volume Uniform pore size distribution
Mesoporous silica nanoparticles (MSNs)
Biocompatibility Low toxicity
Catalysis
Imaging
Drug delivery
Biological application
![Page 4: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/4.jpg)
www.themegallery.com,
Introduction
Other properties that MSNs required for biological application
Large pore sizes Appropriate magnetic properties Appropriate functional surface
![Page 5: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/5.jpg)
www.themegallery.com,
Introduction1 、 Large pore size Large internal surface Large mesoporous volume
Cytochrom C 2.6×3.2×3.3 nm
a-L-arabinofuranosidase 3.9×9.7×14.4 nm
Suitable pore sizes for immobilisation of these proteins can vary from10 to 50 nm
![Page 6: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/6.jpg)
www.themegallery.com,
Introduction
2 、 Magnetic properties Bioseparation Cell sorting Diagnostic analysis Simultaneous imaging and drug delivery
![Page 7: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/7.jpg)
www.themegallery.com,
IntroductionPreparation methods : Large pore size mesoporous materials Templates : Pluronic P123 Swelling agent : 1,3,5-trimethyl benzene (TMB) or alkanes Condition : Strong acidic Magnetic mesoporous materials Templates : Brij56 micelles Condition : Basic
![Page 8: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/8.jpg)
www.themegallery.com,
Introduction3 、 Functional surface To delivery nucleic acids, the silica surface with posit
ive charge is needed to electrostatically bind DNA and RNA molecules
Methods : Functionalisation with amine-derivative group such as APTES Conjugations with cationic polymers such as PEI
![Page 9: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/9.jpg)
www.themegallery.com,
Introduction
Develop synthesis methods to prepare MSNLP Establish a surface functionalisation method to enabl
e adsorption and delivery of nucleic acids
![Page 10: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/10.jpg)
www.themegallery.com,
Experimental SectionSynthesis of monodisperse superparamagnetic Fe3O4 nanocrystals
Fe3+
1-octadecene
Iron stearic acid
1,2-hexadecanediol+
Static conditions at 250℃in a Teflon-lined autoclave for 6~12 h
The concentration of the magnetic nanocrystals is 10 or 30 mg/ mL and suspended in hexane
![Page 11: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/11.jpg)
www.themegallery.com,
Experimental Section Synthesis of magnetic silica nanospheres with large nanopores
30-glycidox-ypropyltrimethoxysilane (GOPS)
PLL
![Page 12: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/12.jpg)
www.themegallery.com,
Experimental Section
DNA adsorption CpG DNA 1826 (5‘ to 3‘, TCCATGACGTTCCTGACGTT ) Measuring A260 absorbance at 260 nm
Transfection of cells CyTM3-labeled miRNA Rat kidney epithelial cells (NRK-52E)
![Page 13: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/13.jpg)
www.themegallery.com,
Results and DiscussionSynthesis of magnetic silica nanospheres with large nanopores
![Page 14: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/14.jpg)
www.themegallery.com,
Results and Discussion
Fig. 1. SEM (a, c), TEM (b, d-f), and HRTEM (g, h) images of MSNLP synthesised with different amount of hexane: MSNLP-0-350 (a, b), MSNLP-10-350 (c, d), MSNLP-10-700 (e), MSNLP-10-1400 (f-h).
![Page 15: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/15.jpg)
www.themegallery.com,
Results and Discussion
![Page 16: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/16.jpg)
www.themegallery.com,
Results and Discussion
Brij56: polyoxyethylene 10 cetyl ether, C16H33EO10
N0I0 route
![Page 17: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/17.jpg)
www.themegallery.com,
Results and DiscussionMagnetic properties of magnetic silica nanospheres with large nanopores
![Page 18: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/18.jpg)
www.themegallery.com,
Results and Discussion
Fig. (A) Field-dependent magnetisation at 300 K of MSNLP with different amounts of magnetite: a) MSNLP-10-350, b) MSNLP-10-700, c) MSNLP-10-1400, and d) MSNLP-30-1400; and (B) the separation process of MSNLP-30-1400 nanospheres from solution by magnet (right picture) and their re-dispersion by as slight shake (left picture).
![Page 19: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/19.jpg)
www.themegallery.com,
Results and DiscussionComposition of PLL functionalised MSNLP
![Page 20: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/20.jpg)
www.themegallery.com,
Results and DiscussionAdsorption of DNA on PLL functionalisedmagnetic silica nanospheres with largenanopores
MSNLP-0-350-PLL qm=22.5μg/mg
MSNLP-10-350-PLL qm =15μg/mg
MSNLP-10-1400-PLL qm=10μg/mg
![Page 21: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/21.jpg)
www.themegallery.com,
Results and Discussion
Fig. Left panel a-d, cells transfected with fluorescent oligonucleotide only; middle panel e-h, cells transfected with nanoparticles alone; andright panel i-l, cells transfected with nanoparticles loaded with fluorescent oligonucleotide. From top to bottom: cy5 channel - images of fluorescence of CyTM3 labeled miRNA (red),F-actin - images of F-actin stained by FITC-Phalloidin (green), DAPI - images of nuclei stained with DAPI (blue), and merge - the merged picture.
![Page 22: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/22.jpg)
www.themegallery.com,
Conclusions
Magnetic silica nanospheres with large nanopores(13-20 nm) were synthesised for the first time
The saturation magnetisation values can be conveniently controlled by changing the amount of Fe3O4 magnetic nanocrystals encapsulated
After functionalisation with PLL, high adsorption capacity ranging from 10 to22.5 μg/mg for CpG DNA and efficient cellular delivery capability for miRNA were achieved
The materials synthesised in this study could find broad applications
![Page 23: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.](https://reader035.fdocuments.us/reader035/viewer/2022062714/56649d0a5503460f949dc793/html5/thumbnails/23.jpg)
www.themegallery.com,
Thank You