COLOR PAGES FINAL FOR SEMINAR 30-08-2014highereducation.mp.gov.in/SeminarWorkshop/20nov14.pdfGovt....

3
I I N N V V I I T T A A T T I I O O N N We cordially invite you to participate in two days National Seminar on " Major environmental issues & its effects on flora & fauna along with water quality of river Narmada " sponsored by UGC CRO Bhopal and organised by Department of Botany, J.N Govt. Degree College, Barwaha. It would give us immense pleasure if you accept our invitation & grace the seminar. It will provide platform for interaction between officials for discussing major environmental issues. We welcome you all to participate with your paper/oral presentation/poster & provoking thoughts to make it grand success. Scientists, Professors, Research Scholars & P.G. students from all areas viz Biotech, Zoology, Botany, Chemistry, Life Sciences, Environmental Sciences are duly welcomed. T T h h e e m m e e s s & & o o b b j j e e c c t t o o f f S S e e m m i i n n a a r r The main objective of seminar is to concentrate on major environmental issues caused due to various anthropological activities & try to keep an check on them. Day by day our sacred rivers like Narmada is also getting polluted due to discharge of sewage & industrial waste & also due to leaching of fertilizers used in agriculture, urbanization, growing population & their devotional beliefs. Thus the time has reached now to think about this problem seriously. This seminar will be helpful in creating awareness at native level & also technical knowledge will be imparted & will provide common platform to Academicians, Professionals, Industrials, Environmentalists & all those who are serious about Environment for interaction & exchanging their views to enhance the knowledge to contribute effectively in the environmental protection. So the methodologies to conserve biodiversity will become approachable. T T h h e e M M a a j j o o r r T T h h r r u u s s t t a a r r e e a a s s o o f f t t h h e e S S e e m m i i n n a a r r Identification of rare, threatened, vulnerable and endangered species and ceasing its further degradation Sustainable use of biotic resources Conservation of biodiversity (in situ, ex situ including setting-up of biodiversity heritage sites). Development of Science and technology in environmental protection. Waste management Air, water and soil pollution Socio-economic development and Environment Public health and environment. Role of community in Environmental Protection Global Warming. Environmental Impact Assessment (EIA) Authors are requested to submit abstract on paper size A-4, 1.5 spacing and 2.5 margins in all the sides & should not be more then 250 words. Title (font size 14) should be bold followed by author name(s) and email id (italic & font size 10) of presenting author. The text should follow the title in single space with font size 12 in Times New Roman. Keyword should be placed in bottom. Abstracts should be submitted in the prescribed format either online or can be send in the form of hard copy .Authors are requested to submit full length manuscript (online) followed by intimation of acceptance of abstract in the following format: Abstract Introduction Experimental method Observation & Result discussion Conclusion References. Paper should be typed in double space A-4 size. Barwaha is municipality of Khargone district in the state of Madhya Pradesh, India. It is a beautiful town situated on the banks of the Narmada River. And is very well connected with other parts of the state. It is connected by road with Indore, Khandwa, Barwani, Dhamnod and Khargone. It is 60 km away from Indore and most easy conveyance for Barwaha is bus which is readily available from Indore. Pt J.N Govt. College, Barwaha is situated 2 kms away from the bank of Narmada called Kheri Ghat, on Omkareshwar Route. It was established in 1964 as a private institute by some renowned donors of the town and was taken over by the Govt in 1971. Since then this colleges is running various U.G courses in Science, Arts and Commerce and also have P.G courses in some subjects of Arts and Commerce along with M.S.W. In major tourist spots, CISF training campus on outskirts of Barwaha is the largest training camp in India. Jayanti Mata Temple is also a famous tourist attraction. Barwaha is also known for its Ghats on bank of river Narmada and Dada Darbar Ashram. Nageswar Temple, Dariya Mahal which is Asia’s biggest castle & attractive site. Omkareshwar which is hindu’s famous pilgrimage for Jyotirlinga is only 18 kms away from Barwaha. Abstract submission : : 31 October 2014 Acceptance of Abstract : 05 November 2014 Full paper submission : 01 November 2014 Last date of Registration : 15 November 2014 Correspondence Address : Prof. Sarika Tundele Trin . (07280-222861) Mob. +919893243346 Prof. Govind Waskel, Mob. +919826229079 Prof. Ravi Yoddha, Mob. +919826477743 Registration Form National Seminar Major environmental issues & its effects on flora & fauna along with water quality of river Narmada " 20th – 21 st November 2014 1. Name : …………………………………….. 2. Designation : …………………………………….. 3. Organization : …………………………………….. 4. Mailing Add : …………………………………….. 5. Qualification : …………………………………….. 6. Title of paper: …………………………………….. 7. E-Mail Add : …………………………………….. Registration Fee : - Teacher of University & Colleges : 700 Rs. on Spot – 800/- Research Scholars & Students : 500 Rs on Spot – 600/- 8. Details of payment :- Cash DD Multicity cheque D.D No. ……………… Dated……………. For Rs…………………… Drawn on……………………………………………… (Please draw bank draft in favour of Principal, J.N

Transcript of COLOR PAGES FINAL FOR SEMINAR 30-08-2014highereducation.mp.gov.in/SeminarWorkshop/20nov14.pdfGovt....

IINNVVIITTAATTIIOONN DDDDDDDDeeeeeeeeaaaaaaaarrrrrrrr DDDDDDDDeeeeeeeelllllllleeeeeeeeggggggggaaaaaaaatttttttteeeeeeeessssssss We cordially invite you to participate in two days National Seminar on

" Major environmental issues & its effects on flora & fauna along with

water quality of river Narmada " sponsored by UGC CRO Bhopal and

organised by Department of Botany, J.N Govt. Degree College,

Barwaha. It would give us immense pleasure if you accept our invitation

& grace the seminar. It will provide platform for interaction between

officials for discussing major environmental issues. We welcome you all

to participate with your paper/oral presentation/poster & provoking

thoughts to make it grand success. Scientists, Professors, Research

Scholars & P.G. students from all areas viz Biotech, Zoology, Botany,

Chemistry, Life Sciences, Environmental Sciences are duly welcomed.

TThheemmeess && oobbjjeecctt ooff SSeemmiinnaarr The main objective of seminar is to concentrate on major

environmental issues caused due to various anthropological activities &

try to keep an check on them. Day by day our sacred rivers like

Narmada is also getting polluted due to discharge of sewage &

industrial waste & also due to leaching of fertilizers used in agriculture,

urbanization, growing population & their devotional beliefs. Thus the

time has reached now to think about this problem seriously. This

seminar will be helpful in creating awareness at native level & also

technical knowledge will be imparted & will provide common platform

to Academicians, Professionals, Industrials, Environmentalists & all

those who are serious about Environment for interaction & exchanging

their views to enhance the knowledge to contribute effectively in the

environmental protection. So the methodologies to conserve biodiversity

will become approachable.

TThhee MMaajjoorr TThhrruusstt aarreeaass ooff tthhee SSeemmiinnaarr

■ Identification of rare, threatened, vulnerable and endangered species

and ceasing its further degradation

■ Sustainable use of biotic resources

■ Conservation of biodiversity (in situ, ex situ including setting-up of

biodiversity heritage sites).

■ Development of Science and technology in environmental protection.

■ Waste management

■ Air, water and soil pollution

■ Socio-economic development and Environment

■ Public health and environment.

■ Role of community in Environmental Protection

■ Global Warming.

■ Environmental Impact Assessment (EIA)

CCCCCCCCaaaaaaaallllllllllllllll ffffffffoooooooorrrrrrrr ppppppppaaaaaaaappppppppeeeeeeeerrrrrrrr ::::::::-------- Authors are requested to submit abstract on paper size A-4, 1.5 spacing

and 2.5 margins in all the sides & should not be more then 250 words.

Title (font size 14) should be bold followed by author name(s) and email id

(italic & font size 10) of presenting author. The text should follow the title

in single space with font size 12 in Times New Roman. Keyword should be

placed in bottom. Abstracts should be submitted in the prescribed format

either online or can be send in the form of hard copy .Authors are

requested to submit full length manuscript (online) followed by intimation

of acceptance of abstract in the following format: ■ Abstract ■

Introduction ■ Experimental method ■ Observation & Result discussion

■ Conclusion ■ References. Paper should be typed in double space A-4

size. AAAAAAAAbbbbbbbboooooooouuuuuuuutttttttt uuuuuuuussssssss Barwaha is municipality of Khargone district in the state of Madhya

Pradesh, India. It is a beautiful town situated on the banks of

the Narmada River. And is very well connected with other parts of the

state. It is connected by road

with Indore, Khandwa, Barwani, Dhamnod and Khargone. It is 60 km

away from Indore and most easy conveyance for Barwaha is bus which is

readily available from Indore. Pt J.N Govt. College, Barwaha is situated 2

kms away from the bank of Narmada called Kheri Ghat, on

Omkareshwar Route. It was established in 1964 as a private institute by

some renowned donors of the town and was taken over by the Govt in

1971. Since then this colleges is running various U.G courses in Science,

Arts and Commerce and also have P.G courses in some subjects of Arts

and Commerce along with M.S.W. In major tourist spots, CISF training

campus on outskirts of Barwaha is the largest training camp in India.

Jayanti Mata Temple is also a famous tourist attraction. Barwaha is also

known for its Ghats on bank of river Narmada and Dada Darbar

Ashram. Nageswar Temple, Dariya Mahal which is Asia’s biggest castle &

attractive site. Omkareshwar which is hindu’s famous pilgrimage for

Jyotirlinga is only 18 kms away from Barwaha. KKKKKKKKeeeeeeeeyyyyyyyyddddddddaaaaaaaatttttttteeeeeeeessssssss ::::::::-------- Abstract submission : : 31 October 2014

Acceptance of Abstract : 05 November 2014

Full paper submission : 01 November 2014

Last date of Registration : 15 November 2014

Correspondence Address :

Prof. Sarika Tundele

Trin . (07280-222861) Mob. +919893243346

Prof. Govind Waskel, Mob. +919826229079

Prof. Ravi Yoddha, Mob. +919826477743

Registration Form

National Seminar

“Major environmental issues & its effects

on flora & fauna along with water

quality of river Narmada "

20th – 21st November 2014

1. Name : ……………………………………..

2. Designation : ……………………………………..

3. Organization : ……………………………………..

4. Mailing Add : ……………………………………..

5. Qualification : ……………………………………..

6. Title of paper: ……………………………………..

7. E-Mail Add : ……………………………………..

Registration Fee : -

Teacher of University & Colleges : 700 Rs. on Spot – 800/-

Research Scholars & Students : 500 Rs on Spot – 600/-

8. Details of payment :-

Cash □ DD □ Multicity cheque □

D.D No. ……………… Dated……………. For Rs……………………

Drawn on………………………………………………

(Please draw bank draft in favour of Principal, J.N

■ Major climatic changes and Natural Resources

■ Information technology and environment

■ Eco-friendly agriculture techniques involving a package of practices

based on biodegradable waste, biopesticide and biofertilizers.

■ Development of environmentally safe technologies for pollution

abatement, especially treatment of urban waste and industrial effluents.

■ Biodeterioration, Bioremediation and biodegradation of pollutants.

■ Establishment of a biodiversity & biotechnology network amongst

institutions and agencies

■ Forest Resource degradation and management

■ Approaches of Sustainable Development

■ Green Chemistry

■ Environmental Legislation and Enforcement

■ Environmental ethics

In view of above concerns through this national seminar scientist will

contribute significantly in the development of biological diversity and its

conservation in Madhya Pradesh.

Email–[email protected],[email protected]

[email protected], [email protected], AAAAAAAAccccccccccccccccoooooooommmmmmmmmmmmmmmmooooooooddddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn &&&&&&&& TTTTTTTTAAAAAAAA ::::::::-------- Organizing committee shall be providing accommodation to all

participants on there expenses they may forward their request to

Organizing Secretary by 30th Oct 2014 . Only below 45 years participants

can be considered for TA restricted to Sleeper Class only. PPPPPPPPuuuuuuuubbbbbbbblllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn :::::::: –––––––– Selected research paper will be published in a form of book or

international journal. The information of publication provided separately

to the Authors.

Award – There shall award for best poster/paper in the seminar by the

young Scientists and students.

Govt. College, Barwaha, please mention your name ,

address and mobile no. on the back of DD or Multicity

Cheque)

9. Whether submitting : Only abstract □

Poster □

Full Paper □

Signature: Mobile:

(Note: Last date of submission of Registration Form &

Abstracts is 1st November 2014, Photocopy can be used)

Principal - Patron

Dr. D.K. Gupta

Convener / Organizing Secretary

Prof. R.K. Yoddha / Prof. Sarika Tundele

Organizing Committee

Dr. Mangla Thakur Dr. P. Tiwari

Dr. Arvind Shrivastava Dr. G.P Daware

Prof. R.B. Sawale Prof. S.L Gole

Dr. S.K Sharma Dr. A. Mungi

Dr. M.R Mahale Prof. S.C Jaiswal

Prof. R.K Pendharkar Prof. S.S Rawat

Prof.G. Waskale Prof. J.L Solanki

Prof. R.K Auchat Shri M.Choudhary

Advisory Committee

Dr. D.R Khanna(Uttrakhand)

Dr. Ganesh Wankhede(Amarawati)

Dr. R. Kanare(Indore)

Dr. Santosh Pathak(Mhow)

Dr. Kishore Pawar(Indore)

Dr. Anandkar (School of Stud, Indore)

Dr. Lata Bhattacharya (School of stud,Ujjain)

Dr. M.M. Shrivastava(Indore)

Dr. Ashok Sharma (Indore)

Dr. P.K. Sanghavi(Alirajpur)

Dr. B. Dubey(Indore)

Dr. R.K Mahore(Gwalior)

Dr. R.P. Singh(Morena)

Dr. C.S Shrivastava(Indore)

Dr. Aneesh Siddgue(Indore)

Dr. Sanchita Shrivastva (Indore)

Dr. Vipul Sharma (Indore)

Editorial Board

Pr. J.L. Solanki

Pr. Ramesh k. Auchat

Pr. Govind Waskale

NNAA

TTII OO

NNAA

LL SS

EEMM

II NNAA

RR

OONN

MM

AAJJOO

RR EE

NNVV

II RROO

NNMM

EENN

TTAA

LL II SS

SSUU

EESS

&& II TT

SS EE

FFFF

EECC

TTSS

OONN

FF

LLOO

RRAA

&& FF

AAUU

NNAA

AALL

OONN

GG WW

II TTHH

WWAA

TTEE

RR QQ

UUAA

LLII TT

YY OO

FF RR

II VVEE

RR NN

AARR

MMAA

DDAA

2200 -- 22

11 NN

oovveemm

bbee

rr 22001144

TToo

,,

…………

…………

…………

…………

…………

…………

……

…………

…………

…………

…………

…………

……

…………

…………

…………

…………

…………

…………

……

FFrr oo

mm :: DD

eepp

aarr tt mm

eenn

tt ooff BB

oott aa

nnyy

PPtt .. JJ

.. NN.. GG

oovvtt .. CC

ooll ll ee

ggee,, BB

aarr ww

aahh

aa

Mob

. 98

932433

46, em

ail : jnd

c. bota

nysem

inar2

014@

gm

ail.co

m

““NNaattiioonnaall SSeemmiinnaarr oonn

““MMaajjoorr EEnnvviirroonnmmeennttaall IIssssuueess && IIttss EEffffeeccttss oonn FFlloorraa && ffaauunnaa

aalloonngg wwiitthh wwaatteerr qquuaalliittyy ooff rriivveerr NNaarrmmaaddaa””

November 20 - 21, 2014

Sponsored by University Grant Commission CRO-Bhopal

Organized by DEPARTMENT OF BOTANY

Pt. Jawahar Lal Nehru Govt. College, Barwaha (M.P)

(NAAC ACCREDITED C GRADE)

Patron Convener / Org. Secretary Dr. D.K Gupta Prof. Prof.R.K.Yoddha / Sarika Tundele