JOURNAL OF BACTERIOLOGY, Feb. 2008, p. 1190–1201 Vol. 190, No. 40021-9193/08/$08.00�0 doi:10.1128/JB.01748-07Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Clostridium perfringens Spore Germination: Characterization ofGerminants and Their Receptors�

Daniel Paredes-Sabja,1,2 J. Antonio Torres,2 Peter Setlow,4 and Mahfuzur R. Sarker1,3*Departments of Biomedical Sciences,1 Food Science and Technology,2 and Microbiology,3 Oregon State University,

Corvallis, Oregon 97331, and Department of Molecular, Microbial and Structural Biology,University of Connecticut Health Center, Farmington, Connecticut 060304

Received 31 October 2007/Accepted 27 November 2007

Clostridium perfringens food poisoning is caused by type A isolates carrying a chromosomal enterotoxin (cpe)gene (C-cpe), while C. perfringens-associated non-food-borne gastrointestinal (GI) diseases are caused byisolates carrying a plasmid-borne cpe gene (P-cpe). C. perfringens spores are thought to be the importantinfectious cell morphotype, and after inoculation into a suitable host, these spores must germinate and returnto active growth to cause GI disease. We have found differences in the germination of spores of C-cpe and P-cpeisolates in that (i) while a mixture of L-asparagine and KCl was a good germinant for spores of C-cpe and P-cpeisolates, KCl and, to a lesser extent, L-asparagine triggered spore germination in C-cpe isolates only; and (ii)L-alanine or L-valine induced significant germination of spores of P-cpe but not C-cpe isolates. Spores of a gerKmutant of a C-cpe isolate in which two of the proteins of a spore nutrient germinant receptor were absentgerminated slower than wild-type spores with KCl, did not germinate with L-asparagine, and germinated poorlycompared to wild-type spores with the nonnutrient germinants dodecylamine and a 1:1 chelate of Ca2� anddipicolinic acid. In contrast, spores of a gerAA mutant of a C-cpe isolate that lacked another component of anutrient germinant receptor germinated at the same rate as that of wild-type spores with high concentrationsof KCl, although they germinated slightly slower with a lower KCl concentration, suggesting an auxiliary rolefor GerAA in C. perfringens spore germination. In sum, this study identified nutrient germinants for spores ofboth C-cpe and P-cpe isolates of C. perfringens and provided evidence that proteins encoded by the gerK operonare required for both nutrient-induced and non-nutrient-induced spore germination.

Bacillus and Clostridium species have the ability to formmetabolically dormant spores that are extremely resistant toenvironmental stresses, such as heat, radiation, and toxicchemicals (41, 50). As a consequence of this resistance, sporesof a number of these species are significant agents of foodspoilage and food-borne gastrointestinal (GI) diseases (51).However, to cause deleterious effects, dormant spores mustfirst go through germination and then outgrowth to be con-verted to vegetative cells. Spore germination has been studiedmost extensively for Bacillus subtilis (31, 40, 49) and can beinitiated by a variety of chemicals, including nutrients, cationicsurfactants, and enzymes, as well as by hydrostatic pressure(37). Nutrient germinants for spores of Bacillus species includeL-alanine, a mixture of L-asparagine, D-glucose, D-fructose, andpotassium ions (AGFK), and inosine (8, 32, 49). These nutri-ent germinants interact with cognate receptors located in theinner spore membrane (20, 36), stimulating the release ofmonovalent cations (H�, Na�, and K�), divalent cations(Ca2�, Mg2�, and Mn2�), and the spore core’s large depot(�20% of core dry weight) of pyridine-2,6-dicarboxylic acid(dipicolinic acid [DPA]) (49), accompanied by an increase inthe water content of the spore core. DPA is released as a 1:1chelate with divalent cations, predominantly Ca2� (Ca-DPA),and Ca-DPA release triggers further events in spore germina-

tion. Most important among the latter is the hydrolysis of thespore’s peptidoglycan cortex by one or more spore cortex lyticenzymes (SCLEs), which allows the core to expand and to takeup even more water to the level found in growing cells. Thisevent, in turn, restores protein movement and enzyme actionin the spore core and leads to resumption of energy metabo-lism and macromolecular synthesis (11, 50).

Genetic evidence strongly suggests that orthologous proteinsbelonging to the GerA family form the nutrient germinantreceptors through which the spore senses the presence of nu-trients in the environment (32, 33, 40). In B. subtilis, the genesof the GerA family are expressed only during sporulation inthe developing forespore (14) and are carried in three tricis-tronic operons, termed gerA, gerB, and gerK (31, 33). Each ofthese operons appears to encode a single nutrient germinantreceptor which is a complex of the three proteins encoded byeach operon, and null mutation in any cistron within theoperon results in inactivation of the respective receptor (31,40). There is also genetic evidence suggesting that the threeproteins encoded by each operon physically interact to form areceptor (20, 39) and that these receptors interact with eachother to some degree (2, 5, 39). Hydropathy profiling indicatesthat two proteins (A and B) encoded by each operon areintegral membrane proteins, which is consistent with their be-ing receptors for environmental stimuli (31, 40). However, theC component is a relatively hydrophilic product that is likely tobe anchored to the membrane via a covalently attached di-acylglyceryl moiety (21, 22, 31).

Spore germination in Clostridium species is less well studiedthan that in Bacillus species. Limited studies have shown that

* Corresponding author. Mailing address: Department of Biomedi-cal Sciences, Oregon State University, 216 Dryden Hall, Corvallis, OR97331. Phone: (541) 737-6918. Fax: (541) 737-2730. E-mail: sarkerm@oregonstate.edu.

� Published ahead of print on 14 December 2007.

1190

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

spores of proteolytic Clostridium botulinum and Clostridiumsporogenes germinate in response to L-alanine but not toAGFK or inosine (4), but no such information is available forspores of Clostridium perfringens, an important human GIpathogen. C. perfringens food poisoning is caused by type Aisolates carrying a chromosomal enterotoxin (cpe) gene (C-cpe), while C. perfringens-associated non-food-borne GI dis-eases are caused by isolates carrying a plasmid-borne cpe gene(P-cpe) (28, 45). However, exceptions were reported in a re-cent study (26), which showed that P-cpe isolates can also be acommon cause of food poisoning. C. perfringens spores arethought to be the important infectious cell morphotype, andafter inoculation into a suitable host, these spores mustgerminate and return to active growth to cause GI disease(28). In this study, we investigated the germination of sporesof pathogenic C. perfringens C-cpe and P-cpe isolates. Weidentified nutrient germinants for C. perfringens spores andidentified differential germination responses in spores ofC-cpe and P-cpe isolates. In addition, through constructionof mutations in genes encoding nutrient germinant recep-tors, we investigated the roles of different receptors in sporegermination in response to a number of nutrient and non-nutrient germinants.

MATERIALS AND METHODS

Bacterial strains and plasmids. The C. perfringens strains and plasmids used inthis study are described in Table 1.

Spore preparation. Starter cultures (10 ml) of C. perfringens isolates wereprepared by overnight growth at 37°C in fluid thioglycolate (FTG; Difco) brothas described previously (25). Sporulating cultures of C. perfringens were preparedby inoculating 0.2 ml of an FTG starter culture into 10 ml of Duncan-Strongsporulation medium (13), which was incubated for 24 h at 37°C to form spores,as confirmed by phase-contrast microscopy. Spore preparations were preparedby scaling up the latter procedure. Spores were purified by repeated washing withsterile distilled water until they were �99% free of sporulating cells, cell debris,and germinated spores, were suspended in distilled water at an optical density at600 nm (OD600) of �6, and were stored at �20°C. Spores of B. subtilis strainJH642 were prepared by growth for �72 h at 37°C on agar plates (35), and thespores were purified as described previously (43, 47).

Spore germination. After heat activation (70°C for 30 min for B. subtilis, 75°Cfor 10 min for P-cpe isolates, and 80°C for 10 min for C-cpe isolates), spores werecooled to room temperature and incubated at 30°C for 10 min (unless notedotherwise) before the addition of germinants. Spores of C-cpe and P-cpe isolateswere heat activated at different temperatures because our preliminary germina-tion assay demonstrated that C-cpe isolates germinated better when heat acti-vated at 80°C for 10 min, whereas P-cpe isolates germinated better when heatactivated at 75°C for 10 min. Spore germination was routinely measured bymonitoring the OD600 of spore cultures (Smartspec 3000 spectrophotometer;Bio-Rad Laboratories, Hercules, CA), which falls �60% upon complete sporegermination, and levels of spore germination were confirmed by phase-contrastmicroscopy. Germination was routinely carried out aerobically, since no differ-

TABLE 1. Bacterial strains and plasmids used for this study

Strain or plasmid Relevant characteristic(s) Source orreference

StrainsB. subtilis strain

JH642 trpC2 pheAI 16C. perfringens strains

SM101 Electroporatable derivative of food poisoning type A isolate NCTC8798; carries achromosomal cpe gene

58

DPS101 gerKA::catP This studyDPS102 gerAA::intron This studyDPS103 �gerAA::catP This studyNCTC8239 Food poisoning type A isolate; carries chromosomal cpe gene 46E13 Food poisoning type A isolate; carries chromosomal cpe gene 46FD1041 Food poisoning type A isolate; carries chromosomal cpe gene 46NB16 Non-food-borne GI disease isolate; carries cpe gene on plasmid 46B40 Non-food-borne GI disease isolate; carries cpe gene on plasmid 46F5603 Non-food-borne GI disease isolate; carries cpe gene on plasmid 46

PlasmidspJIR418 C. perfringens/E. coli shuttle vector carrying chloramphenicol (Cmr) and erythromycin (Emr)

resistance cassettes3

pMRS99 650-bp PCR fragment containing catP in pCR-XL-TOPO M. R. SarkerpMRS104 No origin of replication for C. perfringens; Emr 19pJIR750ai C. perfringens/E. coli shuttle vector containing an L1.LtrB intron retargeted to the plc gene 6pDP9 �3.1-kb KpnI-SalI PCR fragment carrying gerK operon in pCR-XL-TOPO This studypDP10 �3.1-kb KpnI-XhoI fragment from pDP9 in pMRS104 This studypDP11 �1.3-kb NaeI-SmaI catP fragment from pJIR418, in the SpeI site in the gerKA ORF in

pDP10This study

pDP12 �350-bp PCR fragment from pJIR750ai, containing target sites for an intron to disruptgerAA in pCR-XL-TOPO

This study

pDP13 pJIR750ai with IBS, EBS1d, and EBS2 retargeted to insert in gerAA This studypDP18 �1.8-kb PCR fragment containing 1,670 bp upstream of and 186 bp of the N-terminal

coding region of gerAA in pCR-XL-TOPOThis study

pDP19 �2.0-kb PCR fragment containing 225 bp of the C-terminal coding region and 1,769 bpdownstream of gerAA in pCR-XL-TOPO

This study

pDP20 1,827-bp KpnI-SpeI fragment from pDP18 in pMRS99 This studypDP21 �2.0-kb PstI-XhoI fragment from pDP19 in pDP20 This studypDP22 �4.5-kb KpnI-XhoI fragment from pDP21 in pMRS104 This study

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1191

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ences in germination kinetics were detected under anaerobic conditions (datanot shown). The extent of spore germination was calculated by measuring thedecrease in OD600 and was expressed as a percentage of initial OD600. The rateof germination was expressed as the maximum rate of loss of OD600 of the sporesuspension relative to the initial value. To evaluate the effects of pH on the rateof germination, germination was carried out in 25 mM sodium phosphate buffer(pH 5.7 to 7.5) or 10 mM Tris-HCl buffer (pH 8.0 and 8.5) at 30°C. All valuesreported are averages for two experiments performed with two independentspore preparations, and individual values varied �15% from the average.

Construction of gerK mutant. To isolate a derivative of C. perfringens strainSM101 with an insertion of catP, giving chloramphenicol resistance (Cmr; 20�g/ml), in the gerK operon, a gerK mutator plasmid was constructed as follows.A 3,163-bp fragment carrying the gerK operon and 619 bp upstream of gerKA wasPCR amplified with primers CPP213 and CPP214, which had KpnI and SalIcleavage sites, respectively (Table 2). The �3.2-kb PCR fragment was clonedinto plasmid pCR-XL-TOPO (Invitrogen, Carlsbad, CA) in Escherichia coli,giving plasmid pDP9, and excised from this plasmid by digestion with KpnI andSalI, and the 3.2-kb fragment was ligated between the KpnI and SalI sites ofplasmid pMRS104, giving plasmid pDP10. The latter plasmid was digested withSpeI, which cuts only once within the gerKA open reading frame (ORF), the endswere filled, and an �1.3-kb SmaI-NaeI fragment containing the catP gene fromplasmid pJIR418 (3) was inserted, giving plasmid pDP11. The latter plasmidcontains an inactivated gerK operon and, since it contains no C. perfringens originof replication, cannot replicate in this host. Plasmid pDP11 was introduced intoC. perfringens strain SM101 by electroporation (12), and a gerK mutant, strainDPS101, was selected by allelic exchange as described previously (45). Thereplacement of the wild-type gerKA gene with the mutant allele in strain DPS101and the loss of the plasmid from this strain were confirmed by PCR and Southernblot analyses (data not shown).

Construction of gerAA mutants. A derivative of strain SM101 with an introninserted in the gerAA gene was constructed as follows. To target the L1.LtrBintron (6) to gerAA, the intron sequence in plasmid pJIR750ai was modifiedbased upon the sequences of predicted insertion sites in the gerAA gene, usingthe InGex intron prediction program (Sigma-Aldrich). For optimal gene inter-ruption and stable insertion, the insertion site in the antisense strand, betweenpositions 123 and 124 (score, 9.4; E value, 0.038) from the start codon, waschosen. Three short sequence elements from the intron RNA involved in basepairing with the DNA target site (6) were modified by PCR, using gerAA-specificprimers CPP235, CPP236, and CPP237 (Table 2) and the LtrBAsEBS2 universalprimer (CGAAATTAGAAACTTGCGTTCAGTAAAC) provided with the Tar-getron gene knockout system (Sigma-Aldrich Corporation, St. Louis, MO). The353-bp gerAA Targetron was then cloned into plasmid pCR-XL-TOPO, gener-ating plasmid pDP12, and a 353-bp HindIII-BsrGI fragment from pDP12 was

cloned between the HindIII and BsrGI sites of the pJIR750ai vector, givingplasmid pDP13. Plasmid pDP13 was electroporated into C. perfringens strainSM101 (12), and Cmr colonies were screened for the insertion of the Targetronby PCR using gerAA-specific primers CPP211 and CPP212 (Table 2). To cure theCmr coding vector, one Cmr Targetron-carrying clone was subcultured daily for2 days in FTG medium without Cm, and single colonies were patched onto brainheart infusion (BHI) agar, with or without Cm, giving strain DPS102.

To isolate a derivative of SM101 with a deletion of the entire gerAA gene, a�gerAA suicide vector was constructed as follows. A 1,856-bp DNA fragmentcarrying 186 bp from the N-terminal coding region and 1,670 bp upstream ofgerAA was PCR amplified using primers CPP257 and CPP258 (Table 2), whichhad KpnI and SpeI cleavage sites at the 5� ends of the forward and reverseprimers, respectively (Table 2). A 1,994-bp fragment carrying 225 bp from theC-terminal coding region and 1,769-bp downstream of gerAA was PCR amplifiedusing primers CPP259 and CPP260 (Table 2), which had PstI and XhoI cleavagesites, respectively. These PCR fragments were cloned into plasmid pCR-XL-TOPO, giving plasmids pDP18 and pDP19, respectively. A 1,856-bp KpnI-SpeIfragment from pDP18 was cloned upstream of catP in pMRS99 (M. R. Sarker,unpublished data), giving plasmid pDP20, and an �2.0-kb PstI-XhoI fragmentfrom pDP19 was cloned downstream of catP in pDP20, giving pDP21. Finally, an�4.5-kb fragment carrying �gerAA::catP was cloned into plasmid pMRS104,which cannot replicate in C. perfringens (19), giving plasmid pDP22. PlasmidpDP22 was introduced into C. perfringens strain SM101 by electroporation (12),and the gerAA deletion strain DPS103 was isolated by allelic exchange (45). Thepresence of the gerAA deletion in strain DPS103 was confirmed by PCR andSouthern blot analyses (data not shown).

RT-PCR analyses. C. perfringens strains were grown in either Duncan-Strongsporulation medium (13) or TGY (3% Trypticase, 2% glucose, 1% yeast extract,0.1% cysteine) vegetative medium (25) at 37°C for 4 h, and total RNA wasisolated as described previously (12, 18). The primer pairs CPP205 and CPP206,CPP207 and CPP208, and CPP283 and CPP284 (Table 2), which amplified 822-,873-, and 839-bp internal fragments from gerAA, gerKA, and gerKC, respectively,were used to detect gerAA-, gerKA-, and gerKC-specific mRNAs in RNA prepa-rations by reverse transcription-PCR (RT-PCR) analysis as described previously(18, 19).

DPA release. DPA release during nutrient-triggered spore germination wasmeasured by heat activating a spore suspension (OD600 of 1.5) and incubating itat 40°C with 5 mM KCl to allow adequate measurement of DPA release. ForDPA release during dodecylamine germination, spores were incubated at 60°Cwith 1 mM dodecylamine and 25 mM Tris-HCl (pH 7.4). Aliquots (1 ml) ofgerminating cultures were centrifuged for 2 min in a microcentrifuge, and DPAin the supernatant fluid was measured by monitoring the OD270 as describedpreviously (5, 48).

TABLE 2. Primers used in this study

Primer name Primer sequence (5�–3�)a Gene Nucleotidepositionb Usec

CPP205 GACAGACAGCATTAATTTTAGAAG gerAA �304 to �328 PCRCPP206 CAAGTATTAATCCTCCAATAACAG gerAA �1102 to �1126 PCRCPP207 AGTGAGTACATAGTAAAACCATTGA gerKA �133 to �157 PCR, RTCPP208 ATCATTATTATCACCTCTGCTACTAT gerKA �980 to �1006 PCR, RTCPP211 CTTTAATGGGAATTATAGCA gerAA �264 to �244 PCRCPP212 CAACAAATTTTGATTATTCTTC gerAA �1430 to �1452 PCRCPP213 GGGTACCCTTAAATATAGGAAGAAGAAGTGT gerKA �619 to �595 MPCPP214 GCGTCGACAACTTATTTTAAAGTGTATTTCCT gerKA �2528 to �2544 MPCPP235 AAAAAAGCTTATAATTATCCTTAGCCACCATG

TATGTGCGCCCAGATAGGGTGgerAA IBS 123/124 MP

CPP236 CAGATTGTACAAATGTGGTGATAACAGATAAGTCATGTATTATAACTTACCTTTCTTTGT

gerAA EBS1d 123/124 MP

CPP237 TGAACGCAAGTTTCTAATTTCGATTGTGGCTCGATAGAGGAAAGTGTCT

gerAA EBS2 123/124 MP

CPP257 GGGTACCCAACTTATGTTATTCCAGCAG gerAA �1650 to �1670 MPCPP258 GACTAGTCTAAGGAAAAGAAGTCACTCA gerAA �166 to �186 MPCPP259 GCTGCAGCGAACTTAGCTATGCCTTAAA gerAA �1195 to �1226 MPCPP260 CCTCGAGGTGAATCAATGCTTTTAGAAT gerAA �3188 to �3208 MPCPP283 GTTCTAAGTATTGTTTTATTACTGCC gerKC �927 to �953 RTCPP284 GAAAATGAAGTGGGAAATATAGAC gerKC �114 to �138 RT

a Restriction sites are underlined.b Nucleotide numbering begins at the first base of the translation codon of the relevant gene.c PCR, PCR; MP, construction of mutator plasmid; RT, RT-PCR.

1192 PAREDES-SABJA ET AL. J. BACTERIOL.

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Measurement of spore core DPA content. Spores were germinated with andwithout heat activation, cooled to room temperature, diluted to an OD600 of 1.5,and incubated at 40°C with Ca-DPA (50 mM CaCl2, 50 mM DPA adjusted to pH8.0 with Tris base). At various times, aliquots (1 ml) were centrifuged for 2 minin a microcentrifuge, and the spore pellet was washed four times with 1 mldistilled water and suspended in 1 ml of distilled sterile water. The residual sporecore DPA content was determined by boiling samples for 60 min, centrifugingthem at 8,000 rpm in a microcentrifuge for 15 min, and measuring the OD270 ofthe supernatant fluid as described previously (5, 48). In B. subtilis, DPA com-prises �85% of the material absorbing at 270 nm that is released from spores byboiling (2, 5). The change in OD600 during spore germination by Ca-DPA wasalso measured as described above. However, since Ca-DPA promotes sporeclumping, spores were sonicated briefly to disrupt clumps before measuring theOD600.

Colony formation assay. To assess the colony-forming ability of spores ofstrains SM101, DPS101, and DPS103, spores at an OD600 of 1 (�108 spores/ml)were heat activated at 80°C for 10 min, aliquots of various dilutions were platedon BHI agar and incubated at 37°C anaerobically for 24 h, and colonies werecounted.

Statistical analyses. Student’s t test was used for specific comparisons.

RESULTS

Ability of various compounds to trigger C. perfringens sporegermination. Spores of B. subtilis 168 derivatives germinatedwell with either L-alanine, L-valine, or AGFK, although notwith the individual components of AGFK (Table 3), as ex-pected (39). In contrast, C. perfringens SM101 spores germi-nated only slightly with two single amino acids, L-alanine andL-asparagine, although they germinated well with AGFK (Ta-ble 3). However, much of the effect of AGFK appeared to bedue to the K� ions, as KCl alone gave a significant extent ofgermination of C. perfringens SM101 spores, glucose plus fruc-tose was ineffective, and asparagine plus KCl was effective,albeit to a lesser extent than AGFK (Table 3; Fig. 1). The rateof KCl-induced spore germination was dependent on the KClconcentration, with a maximum germination response at 100 to

200 mM (Fig. 2). In contrast to the stimulation of C. perfringensspore germination by KCl, NaCl was ineffective, while KI, KBr,and KH2PO4 were all effective (Table 3), as observed withspores of Bacillus megaterium QM B1551 (7, 44).

To examine whether KCl, with or without AGFK compo-nents, is a universal germinant for C. perfringens spores, ger-mination experiments were extended to spores of six additionalisolates of cpe� C. perfringens type A, three C-cpe isolates (E13,NCTC8239, and FD1041), and three P-cpe isolates (NB16,B40, and F5603) (9, 10). As observed with spores of C-cpeisolate SM101 (Table 3), spores of the C-cpe isolates exhibitedonly minimal germination with L-alanine or L-valine but somegermination with L-asparagine (Table 4). However, spores ofthese isolates germinated well with KCl (Table 4), suggestingthat KCl is a universal germinant for spores of C-cpe isolates.Interestingly, the germination of spores of the P-cpe isolatesdiffered from that of spores of the C-cpe isolates, in that KClalone did not induce significant germination of the P-cpespores. The P-cpe spores also germinated fairly well with L-alanine and L-valine, as well as with L-asparagine plus potas-sium (AK), but not with L-asparagine alone (Table 4).

TABLE 3. Germination of C. perfringens spores byvarious compounds

Germinanta

Mean % decrease ( SD) in OD600in 60 min at 30°Cb

JH642 SM101

Control 0 0.1 1 0.2L-Ala 41 0.5 11 1.6L-Val 39 0.1 6 1.1L-Asn 2 0.5 18 0.5L-His 0 0.5 4 0.7L-Lactate (50 mM) 1 0.2 5 2.2Inosine (5 mM) 0 0.3 6 0.3AGFK 38 0.9 60 0.8GFK 2 0.5 55 3.9AGF 13 1.8 16 5.5AK 1 0.1 51 0.9GF 20 0.2 6 1.3FK 0 0.5 50 1.8GK 1 0.7 50 2.4KCl 1 0.4 47 1.8NaCl 1 0.5 7 1.9KH2PO4 (pH 7.0) 1 0.2 39 1.3KI ND 41 1.4KBr ND 57 1.4

a All compounds, except for L-lactate and inosine, were used at 100 mM in 25mM sodium phosphate (pH 7.0).

b Values are averages for duplicate experiments with two different spore prep-arations. ND, not determined.

FIG. 1. Germination of C. perfringens spores with various germi-nants. Spores of strain SM101 (wild type) were heat activated andgerminated at 30°C in 25 mM sodium phosphate buffer (pH 7.0) withno germinant (‚) or with 100 mM L-alanine (�), L-asparagine (Œ),KCl (�), AK (f), or AGFK (F), and the OD600 was measured asdescribed in Materials and Methods.

FIG. 2. KCl concentration dependence of C. perfringens spore ger-mination. Heat-activated SM101 spores (wild type) were germinatedwith various KCl concentrations. The maximum rate of germinationwas calculated as described in Materials and Methods.

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1193

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Effects of pH and temperature on C. perfringens spore ger-mination. To define the optimal conditions for C. perfringensspore germination, the temperature and pH of germinationwere varied, using spores of SM101 (a C-cpe isolate) and NB16(a P-cpe isolate) and L-alanine, KCl, and AK as germinants(Fig. 3A to D). While the optimum temperature for germi-nation of SM101 and NB16 spores with all germinants testedwas �40°C, there were differences in the responses of sporegermination with different germinants to temperature. Inparticular, germination of SM101 spores with KCl was muchmore sensitive to higher temperatures than was germinationwith AK.

The pH dependences of germination of SM101 and NB16spores with AK were also similar, with a pH optimum of 7.0 to

7.5. The responses of KCl and L-alanine germination to pHwere also similar but were not optimal at pH 7.0 to 7.5, ratherexhibiting a gradual increase in germination rate as the pH waslowered to 5.7.

Identification of putative germination receptor homologuesin C. perfringens. Studies with B. cereus, B. anthracis, and B.subtilis have shown that the responses of spores of these spe-cies to nutrient germinants are mediated through nutrient ger-minant receptor proteins encoded by the gerA operon family(8, 23, 39). When the C. perfringens SM101 genome sequencewas subjected to BLASTP analyses to identify genes encodingGerA family nutrient germinant receptor protein homologues,four ORFs (CPR0614, CPR0615, CPR0616, and CPR1053)encoding proteins with high similarity (50 to 55%) to GerAfamily proteins from B. subtilis were identified (Fig. 4A and B).CPR1053 is predicted to encode a 473-residue protein with acentral region containing five transmembrane segments(TMS). Due to its high similarity with the “A” proteins of allthree B. subtilis GerA-type receptors, we termed CPR1053gerAA. The gerK locus in C. perfringens (34) comprises threeORFs, namely, CPR0614, CPR0615, and CPR0616. Based onamino acid sequence similarity (39 to 56%) to the orthologuesin B. subtilis, ORFs CPR0614, CPR0615, and CPE0616 weredesignated gerKB, gerKA, and gerKC, respectively (Fig. 4A andB). As in B. subtilis, gerKA and gerKC are adjacent, with gerKAbeing the first gene in a putative bicistronic operon, but unlikethe situation in B. subtilis, gerKB is transcribed in the oppositedirection from that of gerKAC and is 96 bp upstream of gerKA.GerKA is predicted to be a 473-residue protein with five TMS,and GerKC is predicted to be a 374-residue protein containing

TABLE 4. Germination of spores of C. perfringens isolates carryingcpe on the chromosome (C-cpe isolates) or a plasmid

(P-cpe isolates)

Germinanta

Mean % decrease ( SD) in OD600 in 60 min at 30°Cb

C-cpe isolates P-cpe isolates

E13 8239 FD1041 NB16 B40 F5603

None 9 0.1 5 0.5 5 4.4 4 3.2 5 0.5 2 0.3L-Ala 13 0.6 8 2.0 8 3.1 42 0.1 29 2.1 49 1.6L-Val 7 3.2 16 6.6 7 2.6 46 3.2 49 3.4 58 3.6L-Asn 17 0.1 19 0.4 20 0.2 7 1.1 3 0.6 8 2.5AK 58 0.1 52 0.1 50 0.4 50 0.8 54 0.5 65 0.8KCl 53 0.4 56 3.8 49 1.1 2 1.3 4 0.5 8 2.1

a All compounds were used at 100 mM in 25 mM sodium phosphate (pH 7.0).b Values are averages for duplicate experiments with two different spore prep-

arations.

FIG. 3. Effects of temperature (A and B) and pH (C and D) on germination of C. perfringens spores. Heat-activated spores of strains SM101(A and C) and NB16 (B and D) were germinated with 100 mM AK (F), 100 mM KCl (E), or 100 mM L-alanine (�). The maximum rate ofgermination was calculated as described in Materials and Methods.

1194 PAREDES-SABJA ET AL. J. BACTERIOL.

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

an N-terminal signal protein followed by a consensus sequencefor diacylglycerol addition to a cysteine residue. GerKB ispredicted to be a 362-residue protein with 10 TMS.

To assess the expression of gerAA, gerKA, and gerKC homo-logues in C. perfringens, we performed RT-PCR analysis. Asexpected, the 822-, 873-, and 839-bp RT-PCR products specificfor gerAA, gerKA, and gerKC, respectively, were detected inRNAs extracted from C. perfringens SM101 grown undersporulation conditions (Fig. 4C). The sizes of the RT-PCRamplification products matched the sizes of the products ob-tained in control PCRs (Fig. 4C). However, no gerAA-, gerKA-,or gerKC-specific RT-PCR products were detected in RNAsfrom SM101 vegetative cells (data not shown), indicating thatC. perfringens gerAA, gerKA, and gerKC are expressed onlyduring sporulation.

Effect of gerK mutation on nutrient germination of C. per-fringens spores. As noted above, there are many studies withBacillus species indicating that it is through nutrient germinantreceptors of the GerA family that nutrients trigger spore ger-mination. To assess whether the gerKA and gerKC gene prod-ucts have any role in C. perfringens spore germination, weconstructed an insertion mutation in gerKA, giving strainDPS101. No gerKA- or gerKC-specific transcripts were detectedin RNAs isolated from sporulating DPS101 cells (Fig. 4C),indicating that the disruption of gerKA had a polar effect on thedownstream gerKC gene. Strikingly, the germination level ofDPS101 spores with KCl, AK, or L-asparagine was well belowthat of the parental wild-type SM101 spores, in particular withL-asparagine, when spore germination was assessed by the

OD600 of spore cultures (Fig. 5A to C). These differences wereconfirmed by examining spore cultures by phase-contrast mi-croscopy (data not shown), which showed in particular thatafter incubation for 60 min with L-asparagine, �95% of SM101spores had germinated, while at most 5% of DPS101 sporeshad germinated.

Effect of gerAA mutation on nutrient germination of C. per-fringens spores. The only partial decrease in germination ofspores lacking GerKA and GerKC with KCl and AK suggestedthat GerAA might also contribute to C. perfringens spore ger-mination with these germinants. Initial analysis of spores of agerAA strain (DPS102) constructed using the Targetron geneknockout system (6) found no difference in the kinetics of KCl,AK, or L-asparagine germination of SM101 and DPS102 spores(data not shown). These results suggested that either GerAAhas no role in spore germination or intron insertion leads to aC-terminal fragment of GerAA that retains activity in sporegermination.

To more rigorously test the role of GerAA in spore germi-nation, we constructed a derivative of strain SM101 (strainDPS103) in which the entire gerAA gene was deleted. Germi-nation of DPS103 and SM101 spores in 100 mM KCl wassimilar, although it was slightly greater for the SM101 spores(Fig. 6A). However, the defect in the DPS103 spores was moreevident at a suboptimal KCl concentration (10 mM), in whichthe extent of DPS103 spore germination was �50% of that ofSM101 spores after 60 min of incubation (Fig. 6D). Althoughthe gerAA spores again showed no significant germination de-fect with 100 mM AK (Fig. 6B), at a lower AK concentration

FIG. 4. Analysis of genes encoding nutrient germinant receptors in C. perfringens. (A) Comparison of genes encoding nutrient germinantreceptor proteins in B. subtilis and C. perfringens. Data were obtained from the Entrez Genome website (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi?view1). (B) Percent amino acid sequence similarities between nutrient germinant receptor protein homologues from B. subtilis andC. perfringens. (C) RT-PCR analysis of C. perfringens genes encoding germinant receptor homologues. RNAs from sporulating cells of strainsSM101 (wild type) and DPS101 (gerK) were subjected to RT-PCR analysis using gerKA-, gerKC-, and gerAA-specific internal primers. Lanes labeled“wt-RT” and “mt-RT” contain RT-PCR products obtained from RNAs from strains SM101 and DPS101, respectively. Lanes labeled “PCR”contain PCR products obtained from SM101 DNA, using gerAA-, gerKA-, and gerKC-specific internal primers. The PCR- and RT-PCR-amplifiedproducts were analyzed by agarose (1%) gel electrophoresis and photographed under UV light. The presence of RT-PCR products cannot beexplained by amplification from contaminated DNA because no PCR product was obtained from RNA in the absence of reverse transcriptase (datanot shown).

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1195

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

(10 mM) the extent of germination of DPS103 spores wassignificantly lower (P � 0.01) than that of SM101 spores (Fig.6E). However, there were no significant differences in thegermination of SM101 and DPS103 spores with either high(100 mM) or low (10 mM) concentrations of L-asparagine (Fig.6C and F).

Effects of gerK and gerAA mutations on DPA release duringC. perfringens spore germination. With B. subtilis spores, bind-ing of nutrient germinants to specific receptors located in thespore’s inner membrane triggers the release of a variety ofcompounds from the spore core, most notably DPA, whichcomprises �20% of the spore core’s dry weight (38). Most ofthis DPA is released as Ca-DPA, and Ca-DPA release acti-

vates downstream germination events (49). Consequently, togain more insight into the roles of GerAA, GerKA, andGerKC in C. perfringens spore germination, we measured DPArelease during KCl- and L-asparagine-triggered germination(Fig. 7A and B). During germination with 5 mM KCl, SM101spores released nearly 67% of their DPA during the first 10min and 93% of their DPA after 60 min of incubation, with thelatter being expected for fully germinated spores. DPS103(gerAA) spores released slightly less DPA (P � 0.01) than thatreleased by SM101 spores after 60 min of incubation with 5mM KCl, although SM101 and DPS103 spores exhibited sim-ilar levels of DPA release with L-asparagine (Fig. 7A and B). Incontrast, DPS101 (gerK) spores released significantly less DPA

FIG. 5. Germination of C. perfringens wild-type and gerK spores with various germinants. Heat-activated spores of strains SM101 (wild type)(�) and DPS101 (gerK) (f) were germinated with 100 mM KCl (A), 100 mM L-asparagine plus 100 mM KCl (B), and 100 mM L-asparagine (C) asdescribed in Materials and Methods. The control germination (E) corresponds to heat-activated spores incubated in 25 mM sodium phosphatebuffer (pH 7.0); no difference between SM101 and DPS101 spores was seen.

FIG. 6. Germination of C. perfringens wild-type and gerAA spores with various germinants. Heat-activated spores of strains SM101 (wild type)(�) and DPS103 (gerAA) (Œ) were germinated with 100 mM KCl (A), 100 mM L-asparagine and 100 mM KCl (B), 100 mM L-asparagine (C), 10mM KCl (D), 10 mM L-asparagine and 10 mM KCl (E), and 10 mM L-asparagine (F) as described in Materials and Methods. The controlgermination (E) was heat-activated spores incubated in 25 mM sodium phosphate buffer (pH 7.0), and no difference between spores of SM101 andDPS103 was observed.

1196 PAREDES-SABJA ET AL. J. BACTERIOL.

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

during germination with either KCl or L-asparagine (Fig. 7Aand B). These results further support the hypothesis thatGerAA plays an auxiliary role in KCl but not L-asparaginegermination of C. perfringens spores, while the products of thegerK operon are involved in both KCl and L-asparagine germi-nation.

Effects of gerK and gerAA mutations on colony formation byC. perfringens spores. The germination defects observed inDPS101 and DPS103 spores suggested that these spores mighthave lower colony-forming efficiencies than that of SM101spores, as spores need to sense the availability of nutrients toinitiate germination and outgrowth. This hypothesis was testedby plating SM101, DPS101, and DPS103 spores on BHI agarand incubating them for 24 h at 37°C under anaerobic condi-tions. No significant differences in colony formation efficiencywere observed between SM101 (8.4 � 107 CFU/ml/OD600 unit[average for three experiments]) and DPS103 (8.3 � 107 CFU/ml/OD600 unit) spores, although DPS101 spores exhibited asignificantly lower colony-forming efficiency (1.6 � 106 CFU/ml/OD600 unit) than that of SM101 spores. No additional col-onies appeared from DPS101 spores when plates were incu-bated for up to 3 days. To evaluate whether the lower colonyformation efficiency of DPS101 spores was due to their poorergermination, we compared the germination of DPS101,DPS103, and SM101 spores in BHI broth. As expected,DPS101 spores exhibited significantly less (P � 0.01) germina-tion than did wild-type (SM101) spores, while there was only aminimal difference in germination between DPS103 andSM101 spores (Fig. 8). However, the germination difference inBHI broth between SM101 and DPS101 spores was nowherenear the 50-fold difference in colony formation. Therefore,spores of all three strains were germinated in BHI broth andexamined by phase-contrast microscopy after 1 and 18 h ofincubation. As expected, �65% of SM101 and DPS103 sporesand �30% of DPS101 spores were phase dark after 1 h ofincubation, in agreement with the results from measurementsof OD600 (Fig. 8). However, when spore suspensions wereincubated for 18 h at 40°C in BHI broth under aerobic condi-tions to prevent C. perfringens growth, �99% of SM101 andDPS103 spores were phase dark, and �90% of these phase-dark spores had released the nascent vegetative cell (data not

shown). Strikingly, while �70% of DPS101 spores were phasedark, �5% of the phase-dark spores seemed to release thenascent vegetative cell (data not shown), which is in clearagreement with the lower colony formation observed fromthese spores. These results suggest that the products of thegerK operon, but not that of gerAA, are essential not only forspore germination but also for completing germination andoutgrowth and thus for eventual colony formation in BHImedium.

Effects of gerK and gerAA mutations on Ca-DPA germinationof C. perfringens spores. Previous work (40) has shown that B.subtilis spores lacking all nutrient germinant receptors are stillable to germinate in the presence of exogenous Ca-DPA,which acts to promote cortex hydrolysis by activation of anSCLE (36). Similar, albeit not identical, SCLEs have also beenfound in other endospore-forming species, including C. perfrin-gens (15, 24, 27, 29, 30, 52). When spores of strains SM101,DPS101, and DPS103 without prior heat activation were incu-bated with Ca-DPA and germination was measured, therewere no significant changes in OD600 or spore refractility andno release of DPA (data not shown). However, heat-activated

FIG. 7. DPA release during germination of C. perfringens spores. Heat-activated spores of strains SM101 (wild type) (�), DPS101 (gerK) (f),and DPS103 (gerAA) (Œ) were germinated in 25 mM sodium phosphate buffer (pH 7.0) with 5 mM KCl (A) or 100 mM L-asparagine (B). At varioustimes, DPA release was measured as described in Materials and Methods.

FIG. 8. Germination of spores of C. perfringens strains in BHIbroth. Heat-activated spores of strains SM101 (wild type) (�), DPS101(gerK) (f), and DPS103 (gerAA) (Œ) were incubated at 40°C with BHIbroth, and the OD600 was measured as described in Materials andMethods.

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1197

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

SM101 and DPS103 spores germinated significantly, as mea-sured by both an OD600 decrease and DPA release (Fig. 9Aand B). These results were confirmed by phase-contrast mi-croscopy, as �80% of SM101 and DPS103 spores becamephase dark after 60 min of incubation with Ca-DPA (data notshown). In contrast, no significant OD600 decrease or DPArelease was observed with heat-activated spores of DPS101(gerK) incubated with Ca-DPA (Fig. 9A and B), and phase-contrast microscopy confirmed that after 60 min of incubationwith 50 mM Ca-DPA, �95% of the spores remained phasebright (data not shown). These results suggest that the putativegerK germinant receptor (but not the GerAA protein) plays acausal role in C. perfringens spore germination with Ca-DPA.

Effects of gerK and gerAA mutations on dodecylamine ger-mination of C. perfringens spores. Dodecylamine, a cationicsurfactant (48), can also germinate spores of many Bacillus andClostridium species, and in B. subtilis spores, dodecylaminemay act by triggering spore core DPA release, perhaps byopening a channel in the spore’s inner membrane (48, 54, 55).Indeed, B. subtilis spores lacking all three nutrient germinantreceptors release DPA in response to dodecylamine at a ratesimilar to that of wild-type spores (48). With spores of C.perfringens, wild-type (SM101) and gerAA (DPS103) sporesexhibited similar rates of DPA release in response to dode-cylamine (Fig. 10), indicating that GerAA is not required fordodecylamine germination. However, DPS101 (gerK) sporesincubated with dodecylamine released DPA at a significantlylower rate than did wild-type (SM101) spores (Fig. 10), sug-gesting that gerK-encoded proteins are also involved in dode-cylamine germination. Phase-contrast microscopy of sporesof all three strains after 60 min of incubation with dode-cylamine revealed that germinated spores were not as brightas dormant spores but not as dark as nutrient-germinatedspores. This is in agreement with results for B. subtilis sporesgerminated with dodecylamine, where some but not all ofthe refractility of dormant spores in the phase-contrast mi-croscope is lost (48).

DISCUSSION

While bacterial spores can remain dormant for many years,they can return to life in as little as 20 min via spore germina-tion and outgrowth if nutrients are added (for reviews, seereferences 29 and 46). There is much interest in these pro-cesses because (i) spores cause disease through germinationand outgrowth in foodstuffs or in the body and (ii) when sporesgerminate, they lose their resistance and are easy to kill. Thus,a detailed understanding of the mechanism(s) of spore germi-nation may lead to the design of either inhibitors of germina-tion or artificial germinants that could allow spore killing un-der mild conditions.

In this respect, our current study offers several significantcontributions toward the understanding of the mechanism ofgermination of spores of C. perfringens, an anaerobic, toxigenicpathogen causing diseases in humans and animals (9, 10, 45,57). Our studies suggest that C. perfringens C-cpe and P-cpespores respond differently to germinants in that (i) while AK isa universal germinant for all surveyed C-cpe and P-cpe spores,KCl and, to a lesser extent, L-asparagine can initiate germina-tion of C-cpe but not P-cpe spores; and (ii) although L-alanineand L-valine are germinants for P-cpe spores, these amino acidsgive no significant germination of C-cpe spores. These differentresponses suggest that P-cpe but not C-cpe spores carry afunctional L-alanine receptor. The observation that L-alanine, agood germinant for spores of B. subtilis, B. cereus, and C.botulinum (1, 17, 40), was unable to trigger germination ofspores of C-cpe isolates, further suggests that the germinationresponse of C-cpe spores is different from that of B. subtilis, B.cereus, and C. botulinum spores, presumably due to differencesin the complement of nutrient germinant receptors in thesevarious species (34). Despite different germination responses,the optimum germination temperature for both C-cpe andP-cpe spores was �40°C, which is slightly higher than theoptimum growth temperature (37°C). The high optimum ger-mination temperature for C. perfringens spores was not unex-pected because the germination temperature optima for sporesof Clostridium bifermentans (56) and C. botulinum group IVtype G (53) are 37 to 53°C and 37 to 45°C, respectively, which

FIG. 9. Ca-DPA germination of spores of C. perfringens strains.Heat-activated spores of strains SM101 (wild type), DPS101 (gerK),and DPS103 (gerAA) were germinated with 50 mM Ca-DPA (pH 8.0)at 40°C for 60 min, and changes in the OD600 of the culture (A) and theamount of DPA remaining in the spores (B) were measured as de-scribed in Materials and Methods. The values shown are averages fortwo experiments with two independent spore preparations. Error barsshow 1 standard deviation from the mean.

FIG. 10. Dodecylamine germination of spores of C. perfringensstrains. Spores of strains SM101 (wild type) (�), DPS101 (gerK) (f),and DPS103 (gerAA) (Œ) were incubated at 60°C with 1 mM dode-cylamine (pH 7.4), and DPA release was measured as described inMaterials and Methods.

1198 PAREDES-SABJA ET AL. J. BACTERIOL.

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

are significantly higher than the temperature optima forgrowth of these strains.

The germination of spores of C-cpe isolates by salt alone wasa bit unexpected but is by no means unique, since spores of atleast some B. megaterium strains germinate well with saltsalone, with KI better than with KBr, which is better than KCl(7, 44). In addition, K� ions are essential for the germinationof B. subtilis spores with AGFK (44). Unfortunately, the pre-cise mechanism of spore germination by salts alone is notknown, nor is the potential advantage of this behavior.

Bacterial spores detect nutrient germinants through specificreceptors (32, 33), and three tricistronic operons, gerA, gerB,and gerK, have been identified in B. subtilis as encoding thethree functional receptors in this species (32, 33, 40). In con-trast, the C. perfringens SM101 genome carries only monocis-tronic gerA and gerKB operons and a bicistronic gerKA-gerKCoperon (34). The products of the gerK operon are required forL-asparagine germination, presumably by acting as a receptorfor L-asparagine. Since disruption of the gerK operon led topoorer spore germination and DPA release with KCl, thissuggests that GerKA and/or GerKC plays a significant role inC. perfringens spore germination by KCl. There also appears tobe some interaction between the L-asparagine and KCl germi-nation pathways, since gerK spores germinated more poorlywith AK than with KCl. The responses of AK and KCl germi-nation to pH and temperatures also suggest that L-asparagineinteracts with a different receptor or different active site on thesame receptor than does KCl, especially since AK allows sig-nificant germination at rather extreme temperatures (60°C).The possibility that individual nutrient germinant receptorsand perhaps even individual germinant receptor proteins havemultiple binding sites that recognize different germinants hasbeen suggested previously from work on B. subtilis spore ger-mination and, more recently, B. megaterium spores (7).

Interestingly, the absence of GerAA slightly affected KClgermination and KCl-induced DPA release. An essential func-tion of GerAA in the recognition of germinants, in particularKCl, seems unlikely, since the maximum germination rate ofgerAA spores with an optimal concentration of KCl was similarto that of wild-type spores. However, the lower rate of inducingDPA release from gerAA spores at a suboptimal KCl concen-tration suggests that GerAA may be involved in a peripheral orauxiliary fashion in KCl germination. However, this appearsnot to be the case when DPA release is induced by exogenousCa-DPA or dodecylamine, where the gerAA mutation has noeffect.

The lower colony-forming ability of gerK spores in rich BHImedium compared to that of SM101 spores suggests thatGerKA and/or GerKC is responsible for spore germination inthis medium, and this was consistent with the slower germina-tion of gerK spores in BHI medium. Interestingly, GerKAand/or GerKC also appears to be involved in the release of thenascent vegetative cell in germinated spores; perhaps theseproteins are responsible for the activation of either a cortexlytic enzyme to allow completion of germination or some otherenzyme that allows the nascent vegetative cell to be releasedfrom the coat/exosporium. The relatively high colony-formingability of the gerK spores was not due to gerK reversion, be-cause PCR did not detect the wild-type gerKA-gerKC operon incolonies obtained from gerK spores. While gerK spores had an

�50-fold lower colony-forming ability than did wild-typespores on BHI medium, this is much less of a decrease thanthat observed with B. subtilis spores lacking all functional ger-minant receptors, in which colony-forming ability was reducedto �0.1% of that of wild-type spores (40). However, the colony-forming ability of C. perfringens gerK spores was significantlylower than that obtained with B. subtilis gerA, gerB, or gerKsingle mutant spores (40). The relatively high level of germi-nation of C. perfringens gerK spores may be due to (i) contri-butions of remaining germinant receptor proteins, such asGerAA and GerKB, even though no obvious “C” protein ho-mologue remains; (ii) the presence of germinant receptor pro-teins with significantly different sequences from those of theGerA family; and (iii) stochastic activation of germinationcomponents downstream of the nutrient germinant receptors,such as SpoVA proteins, which may comprise a channel in-volved in DPA release (55), or an SCLE (49). Analysis of astrain with mutations in not only gerKA-gerKC but also gerAAand gerKB may help in deciding between these alternatives.

In addition to nutrients, many nonnutrients also triggerspore germination (42, 48). We obtained several results fornonnutrient germination of gerK C. perfringens spores that werein contrast to results for B. subtilis spores that lack all nutrientgerminant receptors (36, 40). First, C. perfringens gerK sporesgerminated extremely poorly with exogenous Ca-DPA, whichin B. subtilis spores acts to promote cortex hydrolysis by acti-vation of SCLEs (34), suggesting that products of the gerKoperon are involved in Ca-DPA germination of C. perfringensspores. However, since the predicted amino acid sequences ofGerKA and GerKC suggest that they are inner membraneproteins (in agreement with other GerA family proteins), it isunlikely, although not impossible, that they physically interactwith the C. perfringens SCLEs, SleC and SleM, that are locatedwithin and at the outer boundary of the cortex (29, 52). Thefollowing two possibilities can be envisioned: (i) whether or notthe cortex is degraded by SCLEs that are activated by exoge-nous Ca-DPA, the GerKA and GerKC proteins are essentialfor the opening of an inner membrane Ca-DPA channel, per-haps composed of SpoVA proteins, as is thought to be the casefor B. subtilis spores (55); or (ii) there is indeed some physicalinteraction, either direct or indirect, between gerK-encodedproteins and SCLEs, and this is required for efficient SCLEactivation. Genes encoding SCLEs as well as SpoVA proteinsare indeed present in the C. perfringens genome (34), andstudies examining the roles of these proteins in C. perfringensspore germination seem likely to be rewarding. Second, C.perfringens gerK spores released DPA at a significantly lowerrate than did wild-type spores with dodecylamine, again incontrast to results for B. subtilis spores lacking all nutrientgerminant receptors (48). These findings indicate that thegerK-encoded proteins are also involved in Ca-DPA releasetriggered by dodecylamine, perhaps (i) directly by interactingwith and opening some Ca-DPA channel composed of SpoVAproteins or (ii) indirectly by interacting with GerKA and/orGerKC and activating these proteins (perhaps together withGerKB), which in turn would result in Ca-DPA release, whichwould then activate downstream germination events. Again,analysis of C. perfringens spores with mutations in genes en-coding all germinant receptor proteins, as well as SpoVA pro-

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1199

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

teins and SCLEs, should allow decisions between these alter-native explanations.

In summary, the work reported in this communication allowsus to propose a tentative working model to explain the effectsof nutrient and nonnutrient germinants on C. perfringens sporegermination (Fig. 11), as follows: (i) some germinants (i.e.,L-asparagine and KCl) bind to germinant receptors, promotingthe release of Ca-DPA, possibly through a channel composedat least in part of SpoVA proteins; (ii) exogenous Ca-DPArequires the presence of GerKA and GerKC proteins for ac-tivation of SCLEs, which in turn degrade the spore cortex,allowing completion of spore germination; and (iii) dode-cylamine germination also requires the presence of the GerKAand GerKC proteins for proper Ca-DPA release through aninner membrane channel, and the released Ca-DPA activatesSCLEs, allowing cortex hydrolysis and, again, the completionof germination. Ongoing work is oriented toward understand-ing the important interactions between gerK-encoded proteins,SpoVA proteins, and SCLEs and the role(s) these variouscomponents play in the germination of spores of pathogenic C.perfringens. This understanding may well have applied impli-cations in the areas of food safety and food preservation.

ACKNOWLEDGMENTS

This research was supported by a fellowship from MIDEPLAN(Chile) to D. Paredes-Sabja and by grants from the U.S. Department

of Agriculture (2002-35201-12643) and the National Institutes ofHealth (GM19698) to M. R. Sarker and P. Setlow, respectively.

We thank Roberto Grau (Universidad Nacional de Rosario, Argen-tina) for technical advice during some initial germination assays. Wealso thank Nahid Sarker for technical assistance and Denny Weber foreditorial comments.

REFERENCES

1. Alberto, F., V. Broussolle, D. R. Mason, F. Carlin, and M. W. Peck. 2003.Variability in spore germination response by strains of proteolytic Clostrid-ium botulinum types A, B and F. Lett. Appl. Microbiol. 36:41–45.

2. Atluri, S., K. Ragkousi, D. E. Cortezzo, and P. Setlow. 2006. Cooperativitybetween different nutrient receptors in germination of spores of Bacillussubtilis and reduction of this cooperativity by alterations in the GerB recep-tor. J. Bacteriol. 188:28–36.

3. Bannam, T. L., and J. I. Rood. 1993. Clostridium perfringens-Escherichia colishuttle vectors that carry single antibiotic resistance determinants. Plasmid29:233–235.

4. Broussolle, V., F. Alberto, C. A. Shearman, D. R. Mason, L. Botella, C.Nguyen-The, M. W. Peck, and F. Carlin. 2002. Molecular and physiologicalcharacterization of spore germination in Clostridium botulinum and C. sporo-genes. Anaerobe 8:89–100.

5. Cabrera-Martinez, R. M., F. Tovar-Rojo, V. R. Vepachedu, and P. Setlow.2003. Effects of overexpression of nutrient receptors on germination ofspores of Bacillus subtilis. J. Bacteriol. 185:2457–2464.

6. Chen, Y., B. A. McClane, D. J. Fisher, J. I. Rood, and P. Gupta. 2005.Construction of an alpha toxin gene knockout mutant of Clostridium perfrin-gens type A by use of a mobile group II intron. Appl. Environ. Microbiol.71:7542–7547.

7. Christie, G., and C. R. Lowe. 2007. Role of chromosomal and plasmid-bornereceptor homologues in the response of Bacillus megaterium QM B1551spores to germinants. J. Bacteriol. 189:4375–4383.

8. Clements, M. O., and A. Moir. 1998. Role of the gerI operon of Bacilluscereus 569 in the response of spores to germinants. J. Bacteriol. 180:6729–6735.

9. Collie, R. E., J. F. Kokai-Kun, and B. A. McClane. 1998. Phenotypic char-acterization of enterotoxigenic Clostridium perfringens isolates from non-foodborne human gastrointestinal diseases. Anaerobe 4:69–79.

10. Collie, R. E., and B. A. McClane. 1998. Evidence that the enterotoxin genecan be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal diseases. J. Clin. Microbiol. 36:30–36.

11. Cowan, A. E., D. E. Koppel, B. Setlow, and P. Setlow. 2003. A soluble proteinis immobile in dormant spores of Bacillus subtilis but is mobile in germinatedspores: implications for spore dormancy. Proc. Natl. Acad. Sci. USA 100:4209–4214.

12. Czeczulin, J. R., R. E. Collie, and B. A. McClane. 1996. Regulated expressionof Clostridium perfringens enterotoxin in naturally cpe-negative type A, B,and C isolates of C. perfringens. Infect. Immun. 64:3301–3309.

13. Duncan, C. L., and D. H. Strong. 1968. Improved medium for sporulation ofClostridium perfringens. Appl. Microbiol. 16:82–89.

14. Feavers, I. M., J. Foulkes, B. Setlow, D. Sun, W. Nicholson, P. Setlow, andA. Moir. 1990. The regulation of transcription of the gerA spore germinationoperon of Bacillus subtilis. Mol. Microbiol. 4:275–282.

15. Foster, S. J., and K. Johnstone. 1987. Purification and properties of agermination-specific cortex-lytic enzyme from spores of Bacillus megateriumKM. Biochem. J. 242:573–579.

16. Hoch, J. A., and J. L. Mathews. 1973. Chromosomal location of pleiotropicnegative sporulation mutations in Bacillus subtilis. Genetics 73:215–228.

17. Hornstra, L. M., Y. P. de Vries, M. H. Wells-Bennik, W. M. de Vos, and T.Abee. 2006. Characterization of germination receptors of Bacillus cereusATCC 14579. Appl. Environ. Microbiol. 72:44–53.

18. Huang, I. H., and M. R. Sarker. 2006. Complementation of a Clostridiumperfringens spo0A mutant with wild-type spo0A from other Clostridium spe-cies. Appl. Environ. Microbiol. 72:6388–6393.

19. Huang, I. H., M. Waters, R. R. Grau, and M. R. Sarker. 2004. Disruption ofthe gene (spo0A) encoding sporulation transcription factor blocks endosporeformation and enterotoxin production in enterotoxigenic Clostridium perfrin-gens type A. FEMS Microbiol. Lett. 233:233–240.

20. Hudson, K. D., B. M. Corfe, E. H. Kemp, I. M. Feavers, P. J. Coote, and A.Moir. 2001. Localization of GerAA and GerAC germination proteins in theBacillus subtilis spore. J. Bacteriol. 183:4317–4322.

21. Igarashi, T., B. Setlow, M. Paidhungat, and P. Setlow. 2004. Effects of a gerF(lgt) mutation on the germination of spores of Bacillus subtilis. J. Bacteriol.186:2984–2991.

22. Igarashi, T., and P. Setlow. 2005. Interaction between individual proteincomponents of the GerA and GerB nutrient receptors that trigger germina-tion of Bacillus subtilis spores. J. Bacteriol. 187:2513–2518.

23. Ireland, J. A., and P. C. Hanna. 2002. Amino acid- and purine ribonucleo-side-induced germination of Bacillus anthracis DeltaSterne endospores: gerSmediates responses to aromatic ring structures. J. Bacteriol. 184:1296–1303.

24. Ishikawa, S., K. Yamane, and J. Sekiguchi. 1998. Regulation and character-

FIG. 11. Putative model for nutrient and nonnutrient germinationof C. perfringens spores. Nutrients activate germinant receptors, result-ing in Ca-DPA release from the core, which triggers activation ofSCLEs. External Ca-DPA induces germination through a mechanismthat requires the GerK receptor to fully activate downstream germi-nation events. Dodecylamine triggers DPA release by ultimately open-ing a DPA channel (composed of SpoVA proteins, by analogy with B.subtilis spores) in the spore’s inner membrane. Since dodecylaminegermination is unaffected by gerAA mutation but is reduced by loss ofGerKA and GerKC, dodecylamine presumably acts on both the GerKreceptor, to indirectly open a DPA channel, and the DPA channelitself. SCLEs are then activated by the Ca-DPA release triggered bydodecylamine, and SCLEs then promote cortex hydrolysis and com-pletion of spore germination.

1200 PAREDES-SABJA ET AL. J. BACTERIOL.

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ization of a newly deduced cell wall hydrolase gene (cwlJ) which affectsgermination of Bacillus subtilis spores. J. Bacteriol. 180:1375–1380.

25. Kokai-Kun, J. F., J. G. Songer, J. R. Czeczulin, F. Chen, and B. A. McClane.1994. Comparison of Western immunoblots and gene detection assays foridentification of potentially enterotoxigenic isolates of Clostridium perfrin-gens. J. Clin. Microbiol. 32:2533–2539.

26. Lahti, P., A. Heikinheimo, T. Johansson, and H. Korkeala. 14 November2007. Clostridium perfringens type A isolates carrying the plasmid-borneenterotoxin gene (genotypes IS1151-cpe or IS1470-like-cpe) are a commoncause of food poisonings. J. Clin. Microbiol. doi:10.1128/JCM.01650-07.

27. Makino, S., N. Ito, T. Inoue, S. Miyata, and R. Moriyama. 1994. A spore-lyticenzyme released from Bacillus cereus spores during germination. Microbiol-ogy 140:1403–1410.

28. McClane, B. A. 2007. Clostridium perfringens, p. 423–444. In M. P. Doyle andL. R. Beuchat (ed.), Food microbiology: fundamentals and frontiers, 3rd ed.ASM Press, Washington, DC.

29. Miyata, S., S. Kozuka, Y. Yasuda, Y. Chen, R. Moriyama, K. Tochikubo, andS. Makino. 1997. Localization of germination-specific spore-lytic enzymes inClostridium perfringens S40 spores detected by immunoelectron microscopy.FEMS Microbiol. Lett. 152:243–247.

30. Miyata, S., R. Moriyama, K. Sugimoto, and S. Makino. 1995. Purificationand partial characterization of a spore cortex-lytic enzyme of Clostridiumperfringens S40 spores. Biosci. Biotechnol. Biochem. 59:514–515.

31. Moir, A., B. M. Corfe, and J. Behravan. 2002. Spore germination. Cell. Mol.Life Sci. 59:403–409.

32. Moir, A., E. H. Kemp, C. Robinson, and B. M. Corfe. 1994. The geneticanalysis of bacterial spore germination. Soc. Appl. Bacteriol. Symp. Ser.23:9S–16S.

33. Moir, A., and D. A. Smith. 1990. The genetics of bacterial spore germination.Annu. Rev. Microbiol. 44:531–553.

34. Myers, G. S., D. A. Rasko, J. K. Cheung, J. Ravel, R. Seshadri, R. T. DeBoy,Q. Ren, J. Varga, M. M. Awad, L. M. Brinkac, S. C. Daugherty, D. H. Haft,R. J. Dodson, R. Madupu, W. C. Nelson, M. J. Rosovitz, S. A. Sullivan, H.Khouri, G. I. Dimitrov, K. L. Watkins, S. Mulligan, J. Benton, D. Radune,D. J. Fisher, H. S. Atkins, T. Hiscox, B. H. Jost, S. J. Billington, J. G. Songer,B. A. McClane, R. W. Titball, J. I. Rood, S. B. Melville, and I. T. Paulsen.2006. Skewed genomic variability in strains of the toxigenic bacterial patho-gen, Clostridium perfringens. Genome Res. 16:1031–1040.

35. Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination and out-growth, p. 391–450. In C. R. Harwood and S. M. Cutting (ed.), Molecularbiological methods for Bacillus. John Wiley and Sons, Chichester, UnitedKingdom.

36. Paidhungat, M., K. Ragkousi, and P. Setlow. 2001. Genetic requirements forinduction of germination of spores of Bacillus subtilis by Ca(2�)-dipicoli-nate. J. Bacteriol. 183:4886–4893.

37. Paidhungat, M., B. Setlow, W. B. Daniels, D. Hoover, E. Papafragkou, andP. Setlow. 2002. Mechanisms of induction of germination of Bacillus subtilisspores by high pressure. Appl. Environ. Microbiol. 68:3172–3175.

38. Paidhungat, M., B. Setlow, A. Driks, and P. Setlow. 2000. Characterizationof spores of Bacillus subtilis which lack dipicolinic acid. J. Bacteriol. 182:5505–5512.

39. Paidhungat, M., and P. Setlow. 1999. Isolation and characterization of mu-tations in Bacillus subtilis that allow spore germination in the novel germi-nant D-alanine. J. Bacteriol. 181:3341–3350.

40. Paidhungat, M., and P. Setlow. 2000. Role of ger proteins in nutrient and

nonnutrient triggering of spore germination in Bacillus subtilis. J. Bacteriol.182:2513–2519.

41. Raju, D., P. Setlow, and M. R. Sarker. 2007. Antisense-RNA-mediateddecreased synthesis of small, acid-soluble spore proteins leads to decreasedresistance of Clostridium perfringens spores to moist heat and UV radiation.Appl. Environ. Microbiol. 73:2048–2053.

42. Riemann, H., and Z. J. Ordal. 1961. Germination of bacterial endosporeswith calcium and dipicolinic acid. Science 133:1703–1704.

43. Riesenman, P. J., and W. L. Nicholson. 2000. Role of the spore coat layersin Bacillus subtilis spore resistance to hydrogen peroxide, artificial UV-C,UV-B, and solar UV radiation. Appl. Environ. Microbiol. 66:620–626.

44. Rode, L. J., and J. W. Foster. 1962. Ionic germination of spores of Bacillusmegaterium QM B 1551. Arch. Mikrobiol. 43:183–200.

45. Sarker, M. R., R. J. Carman, and B. A. McClane. 1999. Inactivation of thegene (cpe) encoding Clostridium perfringens enterotoxin eliminates the abilityof two cpe-positive C. perfringens type A human gastrointestinal diseaseisolates to affect rabbit ileal loops. Mol. Microbiol. 33:946–958.

46. Sarker, M. R., R. P. Shivers, S. G. Sparks, V. K. Juneja, and B. A. McClane.2000. Comparative experiments to examine the effects of heating on vege-tative cells and spores of Clostridium perfringens isolates carrying plasmidgenes versus chromosomal enterotoxin genes. Appl. Environ. Microbiol.66:3234–3240.

47. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolic repression ofbacterial sporulation. Proc. Natl. Acad. Sci. USA 54:704–711.

48. Setlow, B., A. E. Cowan, and P. Setlow. 2003. Germination of spores ofBacillus subtilis with dodecylamine. J. Appl. Microbiol. 95:637–648.

49. Setlow, P. 2003. Spore germination. Curr. Opin. Microbiol. 6:550–556.50. Setlow, P. 2006. Spores of Bacillus subtilis: their resistance to and killing by

radiation, heat and chemicals. J. Appl. Microbiol. 101:514–525.51. Setlow, P., and E. A. Johnson. 2007. Spores and their significance, p. 35–68.

In M. P. Doyle and L. R. Beuchat (ed.), Food microbiology: fundamentalsand frontiers, 3rd ed. American Society for Microbiology, Washington, DC.

52. Shimamoto, S., R. Moriyama, K. Sugimoto, S. Miyata, and S. Makino. 2001.Partial characterization of an enzyme fraction with protease activity whichconverts the spore peptidoglycan hydrolase (SleC) precursor to an activeenzyme during germination of Clostridium perfringens S40 spores and anal-ysis of a gene cluster involved in the activity. J. Bacteriol. 183:3742–3751.

53. Takeshi, K., Y. Ando, and K. Oguma. 1988. Germination of spores of Clos-tridium botulinum type G. J. Food Prot. 51:37–38.

54. Vepachedu, V. R., and P. Setlow. 2005. Localization of SpoVAD to the innermembrane of spores of Bacillus subtilis. J. Bacteriol. 187:5677–5682.

55. Vepachedu, V. R., and P. Setlow. 2007. Role of SpoVA proteins in release ofdipicolinic acid during germination of Bacillus subtilis spores triggered bydodecylamine or lysozyme. J. Bacteriol. 189:1565–1572.

56. Waites, W. M., and L. R. Wyatt. 1974. The effect of pH, germinants andtemperature on the germination of spores of Clostridium bifermentans.J. Gen. Microbiol. 80:253–258.

57. Waters, M., A. Savoie, H. S. Garmory, D. Bueschel, M. R. Popoff, J. G.Songer, R. W. Titball, B. A. McClane, and M. R. Sarker. 2003. Genotypingand phenotyping of beta2-toxigenic Clostridium perfringens fecal isolates as-sociated with gastrointestinal diseases in piglets. J. Clin. Microbiol. 41:3584–3591.

58. Zhao, Y., and S. B. Melville. 1998. Identification and characterization ofsporulation-dependent promoters upstream of the enterotoxin gene (cpe) ofClostridium perfringens. J. Bacteriol. 180:136–142.

VOL. 190, 2008 GERMINATION OF C. PERFRINGENS SPORES 1201

on Decem

ber 7, 2020 by guesthttp://jb.asm

.org/D

ownloaded from