INFECTION AND IMMUNITY, Dec. 1994, p. 5550-55580019-9567/94/$04.00+0Copyright © 1994, American Society for Microbiology

Expression from the Clostridium perfringens cpe Promoterin C. perfringens and Bacillus subtilis

STEPHEN B. MELVILLE,1 RONALD LABBE,2 AND ABRAHAM L. SONENSHEINl*

Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts02111,1 and Department of Food Science, University of Massachusetts, Amherst, Massachusetts 010032

Received 29 July 1994/Returned for modification 13 September 1994/Accepted 27 September 1994

Clostridium perfringens is a source of food poisoning in humans and animals because of production of a

potent enterotoxin (CPE). To study the regulation of the cpe gene in C. perfringens, we cloned and sequencedthe cpe promoter regions and N-terminal domains from three strains. The cpe promoter region from one straincontained a 45-bp insertion compared with previously published sequences. This insertion was also found intwo (of five) other Cpe+ strains. cpe gene expression in C. perfingens was measured by using translationalfusions of each promoter type to the Escherichia coli gusA gene, which codes for ,-glucuronidase. For eitherpromoter type, cpe-gusA expression was undetectable throughout exponential growth but increased dramati-cally at the beginning of the stationary phase. To measure cpe expression in BaciUlus subtilis, cpe-gusA fusionswere integrated into the B. subtilis chromosome. Both types of promoter exhibited moderate expression duringexponential growth; cpe expression increased threefold at the beginning of the stationary phase. Transcrip-tional start sites were determined by primer extension and in vitro transcription assays. For C. perfringens, bothtypes of promoter gave the same 5' end, 197 bp upstream of the translation start (50 bp downstream of the45-bp insertion). In B. subtilis, however, the 5' end was internal to the 45-bp insertion, suggesting the use of adifferent promoter than that utilized by C. perfringens.

Clostridium perfringens is one of the most common agents offood poisoning, trailing only salmonella and staphylococcus infrequency of food-related diseases of known etiology in theUnited States (19). The symptoms associated with C. perfirn-gens food poisoning are caused by an enterotoxin (CPE)composed of a single polypeptide of 36 kDa (for a review, seereference 31). The CPE protein binds to a receptor located onthe surface of mammalian epithelial cells and becomes in-serted into the membrane (39). There, in association with 70-and 50-kDa mammalian membrane polypeptides, the toxinforms a channel (39). As a result, the membrane becomespermeable to electrolytes, leading to cell death and the symp-toms of enterotoxemia, intestinal cramping, and diarrhea (16,25).The production of CPE protein has been temporally and

genetically linked to spore formation. Early studies indicatedthat only sporulating cells produce detectable quantities ofCPE (9). During the course of sporulation, toxin was firstdetectable concomitant with the appearance of heat-resistantspores (20). These correlations were consistent with the mu-tation studies of Duncan et al. (10). Mutants that failed tosporulate and were blocked at stage 0 failed to make the CPEprotein, while mutants blocked at stages III to V continued toproduce CPE, albeit in reduced amounts (10). Sporulation-dependent expression of CPE was questioned by one group,which detected small amounts of CPE in cells of strains ATCC3624 and NCTC 10240 growing vegetatively in a chemostat(13). These results were unexpected since one of these strains,ATCC 3624, has been described as Cpe- (6, 11).

In 1989, three groups reported the cloning and sequencingof different parts of the cpe structural gene (14, 17, 38), and thegene has been located on the restriction map of the C.

* Corresponding author. Mailing address: Department of MolecularBiology and Microbiology, Tufts University School of Medicine, 136Harrison Ave., Boston, MA 02111. Phone: (617) 956-6761. Electronicmail address: asonensh@bopal.tufts.edu.

perfringens chromosome (5). More recently, Czeczulin et al. (6)reported the cloning and sequencing of the entire cpe struc-tural gene of strain NCTC 8239 and showed that CPE proteinis expressed at moderate levels from cloned DNA in Esche-richia coli and in trace amounts in vegetatively growing C.perfringens cells from the chromosomal gene. Brynestad et al.(4) recently reported the cloning and sequencing of the 4-kbregion upstream of the cpe structural gene of strain NCTC8239. The presence of multiple copies of sequences homolo-gous to that bound by the Hpr protein of Bacillus subtilis ledthose authors to suggest that an Hpr-like homolog in C.perfringens may be responsible for the regulation of the geneduring the sporulation cycle.To begin to dissect the mechanisms that regulate the syn-

thesis of CPE during the developmental cycle, we cloned andsequenced cpe promoter regions from three strains of C.perfringens and show here that two types of promoter regionsexist in nature. We established that CPE synthesis is regulatedat the transcriptional level in C. perfringens.

Since sporulation in C. perfringens has not been studied ingreat detail at the molecular level, we also tried to takeadvantage of the close evolutionary relationship between C.perfringens and B. subtilis, another gram-positive organism inwhich the regulation of spore formation has been studiedintensively. To that end, fusions of the cpe promoter region toa 3-glucuronidase reporter gene were introduced into wild-type and spo mutants of B. subtilis.

MATERIALS AND METHODS

Bacterial strains and culture medium. All bacterial strainsused in this study are listed in Table 1. E. coli JM107 was

grown in Luria-Bertani broth, while B. subtilis strains were

grown in nutrient broth sporulation (DS) medium as previ-ously described (29). C. perfringens strains were maintained as

frozen stocks in cooked-meat medium (Difco) at -20°C.Sporulation of C. perfringens strains was assayed in Duncan-

5550

Vol. 62, No. 12

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

C. PERFRINGENS ENTEROTOXIN REGULATION 5551

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid (parent) Genotype or phenotype Source and/or reference

E. coli JM107 endA41 gyrA96 thi hsdRl7 supE44 relAl A(lac-proAB) [F' traD36 proAB 40lacIqlacZAM15]

B. subtilisAG1447 trpC2 pheA1 AspoOA::cat::spc J. LeDeaux and A. GrossmanJH642 trpC2 pheAl J. Hoch (34)SMi JH642 4(cpeNCTC 10240-gusA)cat This workSM2 JH642 4(cpeNCrc 10240-gusA)cat AspoOA::cat:spc This workSM1o JH642 4)(cpeNCTC 8798-gusA)cat This workSMi1 JH642 4(CpeNC-C 8798-gusA)cat AspoOA::cat:spc This work

C. perfringensNCTC 8239 (Hobbs 3)a Cpe+ C. DuncanNCTC 8679 (Hobbs 6) Cpe+ C. DuncanNCTC 8798 (Hobbs 9) Cpe+ C. DuncanNCTC 10240 (Hobbs 13) Cpe+ C. Duncan4246 Cpe+ R. Skjelkvale3663 Cpe+ R. Skjelkvale13 Cpe- C. DuncanATCC 3624 Cpe- C. DuncanT-65 Cpe- C. DuncanFD-1 Cpe- C. Duncan

PlasmidspBluescript SK- StratagenepSM100 (pBluescript SK-) NCTC 10240 cpe promoter This studypSM101 (pBluescript SK-) NCTC 8798 cpe promoter This studypSM102 (pBluescript SK-) NCTC 8239 cpe promoter This studypJIR750 J. Rood (2)pSM103 (pJIR750) gusA This studypSM104 (pJIR750) 4(cpeNCTC 10240-gUSA) This studypSM105 (pJIR750) 4(cpeNCTC 8798-gUSA) This studypTG67 S. Cole (12)

a Indicates Hobbs serotype.

Strong sporulation medium (DSSM) with added raffinose (orstarch, as noted) as previously described (8, 22). For all othergrowth conditions, C. perfringens was cultured in PGY mediumcontaining the following (in grams per liter): proteose peptone(Difco), 30; glucose, 20; yeast extract (Difco), 10; and sodiumthioglycolate, 1. Anaerobic media were prepared in serum vialsor round-bottom flasks (both capped with butyl rubber stop-pers) by autoclaving each medium with a needle through thestopper to allow oxygen to escape and, after it had cooled,replacing the headspace gas with a 10% C02-90% N2 mixture.

Sporulation of B. subtilis and C. perfringens. To inducesporulation, B. subtilis strains were grown overnight on platesof tryptose blood agar base (Difco) at 30°C, inoculated into DSmedium at an initial optical density at 600 nm (OD6.) ofapproximately 0.05, and grown aerobically with shaking at37°C. At an OD600 of 0.60, cells were diluted 1:20 intoprewarmed, fresh DS medium and maintained on the shaker at37°C. Periodically during growth, samples of culture wereremoved to measure the OD600 and to assay for I-glucuroni-dase. For C. perfringens sporulation induction, 100 ,ul of athawed stock culture was suspended in anaerobically preparedPGY medium (5 to 10 ml) in screw-cap tubes and heated for 10min at 75°C to induce germination. After being heated, tubeswere cooled to room temperature, screw caps were tightened,and tubes were incubated overnight at 37°C. The next day,overnight cultures were inoculated (at a 1% final concentra-tion) into prewarmed DSSM in either anaerobically preparedserum vials or stoppered round-bottom flasks and incubated at37°C. The OD60 was monitored, and samples were removedfor enzyme assays with a needle and syringe.Chromosomal DNA isolation and transformation of B.

subtilis and E. coli. Chromosomal DNA from C. perfringens and

B. subtilis was isolated as described by Mengaud et al. (26).Competent B. subtilis cells were prepared and transformed aspreviously described (36). Electroporation-competent E. colicells were prepared and subjected to electroporation with aGenePulser apparatus (Bio-Rad Laboratories) by the methodof Dower et al. (7).

Electroporation of C. perfringens. The production of electro-poration-competent C. perfringens cells was based on themethod of Allen and Blaschek (1). One hundred microliters ofthawed stock culture of strain NCTC 8798 was suspended in 6ml of PGY medium in a screw-cap tube and heated for 10 minat 75°C to induce germination. After being cooled, the tubewas incubated for 16 h at 37°C. Five milliliters of cell suspen-sion was removed and centrifuged for 10 min at 5,000 x g, andthe supernatant was discarded. The cell pellet was washed with5 ml of electroporation buffer (0.272 M sucrose, 7 mMK2HPO4, and 1 mM MgCl2) and resuspended in 1 ml ofelectroporation buffer. For electroporation, 370 RI of cellsuspension was added to a prechilled 0.2-cm-electrode-gapelectroporation cuvette (Bio-Rad) before 2 to 4 ,ug of plasmidDNA was added. Cells were then shocked at 2.5 mV, 25 ,uF,and 200 fl. The cuvette was incubated on ice for 15 min, 1 mlof PGY medium was added, the suspension was transferred toa 1.5-ml microcentrifuge tube and incubated at 37°C for 3 h,and then cells were spread on PGY plates containing 20 mg ofchloramphenicol per liter and incubated at 37°C in anaerobicjars.PCR amplification and cloning of the cpe promoter region.

On the basis of published sequences of the cpe structural geneand upstream region from strain NCTC 8239 (17, 38), weanticipated that the cpe locus of strain NCTC 10240 wouldhave a TaqI site at position +32 relative to the translational

VOL. 62, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

5552 MELVILLE ET AL.

initiation site. Chromosomal DNA from NCTC 10240 wasdigested with TaqI, allowed to self-anneal, and ligated underdilute conditions (0.02 ,ug/,l). Circular DNA molecules wereused as a template for inverse PCR (32) with primers expectedto anneal approximately 150 bp upstream of the cpe transla-tional start site. Oligonucleotide primers OSM3 (5' CCCAAGClTl7AATTCCTTCAGC 3') and OSM4 (5' CGTTAAAGAGATCAAGTTG 3') gave a 1.5-kb PCR product. This PCRproduct was sequenced directly with primer OSM3, yieldingDNA sequence to a site approximately 500 bp upstream of thecpe translational start site. On the basis of this new sequence,we designed primers for the amplification of the cpe promoterregions from strains NCTC 10240, NCTC 8239, and NCTC8798, with purified chromosomal DNA as the template. Oneprimer, OSM5 (5' AATGAAAGATCTGCTTAACTATTCTTGATAGTTATCTGG 3', giving a BglII restriction site over-hang at the 5' end after digestion of the PCR product)annealed approximately 500 bp upstream of the translationalstart site, and the other primer, OSM6 (5' AATACTICTAGAGCATllI'[CGAACACCATTGG 3', giving an XbaI siteoverhang at the 3' end after cleavage of the PCR product)annealed at the N-terminal coding sequence of the cpe struc-tural gene. PCR products were treated with BglII and XbaI andcloned in the compatible BamHI and XbaI sites in thepolylinker of E. coli plasmid pBluescript SK- (StratageneCorp.) to give pSM100 (NCTC 10240), pSM101 (NCTC 8798),and pSM102 (NCTC 8239). The DNA sequences of the threecpe promoter regions were determined by standard methods(37).Plasmid constructs and DNA manipulations. Constructs in

which the cpe promoter and N-terminal coding sequence werefused in frame to the E. coli gusA coding sequence were madein two steps. The gusA gene (18) was amplified by PCR withprimers that overlapped the initiation codon and a sequencedownstream of the stop codon. The upstream primer, OSM7(5'CTFAATGAGGATCTAGAAATGTTACGTCCT 3'), in-cluded an XbaI cleavage site immediately adjacent to themethionine initiator codon; the downstream primer, OSM8 (5'AGGCTGTGAGCTCAAGCTTTGCGCCAGGAGAGTTG3'), included a Sacl site beyond the end of gusA. The PCRproduct was digested with XbaI and Sacl and ligated topSM100 and pSM101, derivatives of pBluescript SK- inwhich the promoter region and first 13 codons of the NCTC10240 and NCTC 8798 cpe genes, respectively, had beeninserted between the BamHI and XbaI sites within thepolylinker. In resulting constructs, a continuous open read-ing frame which consists of the first 13 codons of cpe and theentire coding sequence of gusA, joined by two linker codons(Leu-Glu), was created. Fusion constructs were transferredto the pJIR750 vector as PstI-SacI fragments, creatingpSM104 (NCTC 10240 promoter) and pSM105 (NCTC 8798promoter). To make plasmid pSM103, which contains anintact gusA gene but lacks a cpe promoter, pSM105 wasdigested with XbaI and PstI, the large fragment was isolated,and the ends were filled in with T4 DNA polymerase andligated.To measure cpe gene expression in B. subtilis, transcriptional

fusions of the cpe promoters were made to the E. coli gusAstructural gene in the promoter probe vector pLG102 (2a).This plasmid integrates in single copy at the B. subtilis amyElocus and carries a cat gene for the selection of integrants. B.subtilis JH642 was transformed with these plasmids to createstrains SM1 (an NCTC 10240 cpe-gusA fusion) and SM10 (anNCTC 8798 cpe-gusA fusion). To create spoOA mutant strains,chromosomal DNA from B. subtilis AG1447 (Table 1) was

used to transform strains SMI and SM10 to Spcr, creatingstrains SM2 and SM11, respectively.

,I-glucuronidase assays. 3-glucuronidase activity was mea-sured as follows: 1 ml of cell culture was placed in a 1.5-mlmicrocentrifuge tube and centrifuged for 1 min at 12,000 x g,and supernatant fluid was discarded. The cell pellet was storedfrozen at -70°C. The pellet was resuspended in 0.8 ml of buffercontaining 50 mM NaHPO4 (pH 7.0), 1 mM EDTA, and 5 mMdithiothreitol. Eight microliters of toluene was added, andtubes were capped and mixed vigorously for 1 min. Tubes werethen incubated on ice for 10 min and with caps open at 37°Cfor 30 min. The enzyme reaction was started by the addition of160 RI of a 6 mM solution of p-nitrophenyl ,B-D-glucuronide(Sigma Chemical Co.). After further incubation at 37°C, thereaction was stopped by the addition of 0.4 ml of a 1.0 Msolution of Na2CO3, and the elapsed time was recorded. Tubeswere centrifuged for 10 min at 10,000 x g to remove celldebris, and A405 was measured in an Ultrospec II spectropho-tometer (LKB). The specific activity was calculated by usingthe following equation, based on that of Miller (27): specificactivity = (A405 X 1,000)/(OD600 X time [in minutes] x culturevolume [in milliliters]).

Primer extension and measurements of cpe-specific RNA.RNA was isolated from C. perfringens and B. subtilis by twoindependent methods; the first used Trizol reagent (GibcoBRL), and the second was as previously described (24, 35). Tomeasure cpe-specific RNA during the course of sporulation,RNA was isolated from samples at various times during thedevelopmental cycle and blotted onto a nylon membrane byvacuum suction with a slot blot apparatus. RNA was thenprobed with 32P-labeled antisense RNA made from the NCTC10240 cpe promoter cloned in pSM100, as described by themanufacturer of the kit (Stratagene). After the labeled probewas annealed, blots were cut from the membrane and theamount of radiolabel was assayed by liquid scintillation count-ing. For primer extension experiments, RNA was annealed toprimer OSM10 (5' GCATI"I"TCGAACACCATTGG 3'),which anneals to positions +22 to +41 relative to the start oftranslation. The primer was extended by using avian myelo-blastosis virus reverse transcriptase and deoxynucleosidetriphosphates, one of which was radioactively labeled ([a-32P]dATP). Primer extension products were separated byelectrophoresis on gels of 5% polyacrylamide-7.6 M urea.

In vitro transcription. In vitro transcription was done aspreviously described (23) with the Eo&A form of B. subtilis RNApolymerase (supplied by F. Whipple). C. perfringens RNApolymerase was a gift from S. Cole. Templates are described inthe legend to Fig. 7.Measurements of CPE protein in C. perfringens cells. En-

terotoxin concentrations in cell extracts were determined bycounterimmunoelectrophoresis as described by Naik and Dun-can (30), with purified enterotoxin as the standard. Entero-toxin was produced and purified as described by Heredia et al.(15). Protein concentrations were determined by the methodof Bradford (3), with bovine serum albumin as the standard.

Nucleotide sequence accession numbers. The DNA se-quences reported here have been submitted to GenBank andassigned accession numbers U11259 (NCTC 10240), U11294(NCTC 8798), and U11257 (NCTC 8239).

RESULTS

Cloning and sequence analysis of three cpe promoters.Taking advantage of published sequences (17, 38), we usedinverse PCR to clone about 1.5 kb of DNA upstream of the cpestructural gene in strain NCTC 10240. The sequence generated

INFECT. IMMUN.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

C. PERFRINGENS ENTEROTOXIN REGULATION 5553

H13 I

H9

H13 101

H9

H13 201

GCTTAACTATTCTTGATAGTrATCTGGTAAAATATTAATTTTAAATCCTTGTAAAACCAAGGAAATTAAGGTTGCTATAGAAAGCCATAACCCATAATTC(1)

TTAAACGTGATTTATTTATCATAATATATCACTCTCCTTGTTTATAATATATAATATTATGTTTAGTGAAATTATGTTAATATACATTGTCTATTTTTA

(2)--------------------,I-V PE

->

TAGTTTAACTATAAAATAAGrAGTATAGTCATTTATMCTTrATATAArrAACATTTCAACTGATCTGTTTAACGGAATATCTCTTTTATACCCA

H9 .............................TACTrATTTCTTCIATATrAA?rAACATA AACTCATCTCTTAAC GTATATCTCTTTATTACCCA

HindI I IH13 301

H9

H13 401

H9

AGCTTTAATTCTTTCAGCATrAATATCATAAAATGTCCATGTAGAAATATATTCAAGATTATrAAAGATATATATTTTATrrAATA-I--lrTTAATACTT

AGCTTTAATTCCTTCAGCATTAATATCATAAAATGTCCATGTAGAAATATATTCAAGATTATTAAAGATATATATT'IITTTAATATTTTGTTAATACTT

TAAGGATATGTATCCAAAATAAAAcrAAATAATATATTATATAAAAAAAATTAGAAATMA&^GATTAATTATAATA?0CTTAGTAACAATrrA

(3)

H13 501 AATCCAATGGTGTTCGAAAATGC

H9 AATCCAATGGTGTTCGAAAATGC

FIG. 1. Comparison of cpe promoter regions from C. perfringens NCTC 10240 (H13) and NCTC 8798 (H9). Differences in the sequences areindicated by vertical lines. A period indicates that no nucleotide is present at the given position. The initial methionine codons of the cpe structuralgenes are in boldfaced type, and the proposed Shine-Dalgarno translational recognition sequences are underlined. The 5' end detected in primerextension (PE) experiments (see Fig. 3, lanes 3 to 5, and 4) with RNA isolated from strains NCTC 8798 and NCTC 10240 is indicated (1').Asterisks indicate the approximate 5' ends of cpe mRNA as determined by PE of RNA isolated from B. subtilis SMl and in vitro transcription (IV)with NCTC 10240 cpe DNA as the template and B. subtilis RNA polymerase (see Fig. 3, lane 2, and 7, lane 2). Broken arrows indicate the DNAsequences and orientations of primers used for PCR reactions. Note that the sequence of primer 3 is complementary to that of the DNA strandshown. The location of the HindIII restriction site used for in vitro transcription assays is noted.

from this PCR product was then used to clone segments ofabout 500 bp upstream of the cpe gene in strains NCTC 10240,NCTC 8239, and NCTC 8798 by PCR. The sequences of theseupstream regions are shown in Fig. 1. The sequence of thecorresponding region from strain NCTC 8239 was identical tothat shown for strain NCTC 8798 but differed from thepublished sequence for NCTC 8239 (4) at five positions. Tomake the two sequences identical, it would be necessary toinsert a T after bp 4, 11, and 223 and an A after bp 333 and tosubstitute A for T at bp 335. The alignment of NCTC 10240and NCTC 8798 sequences shows a distinct 45-bp insertion,extending from bp 186 to 231 in NCTC 10240, relative to theNCTC 8798 sequence. Apart from this insertion, the twosequences differ only by 7 bp.

Since the sequence from strain NCTC 10240 had a 45-bpinsertion and those from strains NCTC 8798 and NCTC 8239did not, we tested several other strains available in ourlaboratory to determine if they contained a similar regionupstream of cpe and, if so, whether the 45-bp insertion waspresent. We used purified chromosomal DNA as the templateand pairs of primers (1 and 3 or 2 and 3; Fig. 1) to assay byPCR for the presence of the cpe gene, the upstream region,and the 45-bp insertion. The results are shown in Table 2. Ofthe 10 strains tested, 6 had been reported in the literature to beCpe+ and 4 had been reported to be Cpe-. Each putativeCpe+ strain gave a PCR product of the predicted size whenprimers 1 and 3 were used. Of these six, three strains gave aPCR product of the predicted size when primers 2 and 3 wereused, indicating that these cpe genes had the 45-bp insertionupstream. These results show that there are two types of cpeloci present in food-borne isolates of C. perfringens. None ofthe four strains reported in the literature to be Cpe- gave aPCR product with either primer pair, indicating that they lackeither the cpe gene or the region found upstream of cpe inknown Cpe+ strains. ATCC 3624 (see the introduction) wasone of these four strains.

Effects of ralfinose and starch on sporulation and CPEproduction in C. perfringens NCTC 10240 and NCTC 8798. Wechose strains NCTC 8798 and NCTC 10240 to represent eachtype of cpe locus for further analyses. Each strain was grown inDSSM with either raffinose or starch to determine whichcarbohydrate stimulated sporulation and CPE production to agreater extent. The results are shown in Table 3. Strain NCITC10240 sporulated with similar efficiencies on these two sub-strates (95% on raffinose and 90% on starch) but producedfour times as much CPE when grown on raffinose. StrainNCTC 8798 had a fourfold-greater sporulation rate and pro-duced twice as much CPE with raffinose as the carbohydrate.Since raffinose-containing media gave the highest levels ofCPE production, we used it for all further experiments de-signed to analyze cpe expression in C. perfringens.

TABLE 2. Detection of cpe promoters in several strains ofC. perfringens

Strain Enterotoxin cpe geneb Promoter typec

NCTC 8239 (Hobbs 3) Cpe+ + ANCTC 8679 (Hobbs 6) Cpe+ + ANCT7C 8798 (Hobbs 9) Cpe+ + ANCI7C 10240 (Hobbs 13) Cpe+ + B4246 Cpe+ + B3663 Cpe+ + B13 Cpe- - NDATCC 3624 Cpe- - NDT-65 Cpe- - NDFD-1 Cpe- - ND

a As described by the supplier (Table 1).b Determined by PCR with primers 1 and 3 (Fig. 1).c Determined by PCR with primers 2 and 3. As shown in Fig. 1, the type B

promoter region includes a 45-bp sequence that is absent in type A promoters.ND, not detected.

VOL. 62, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

5554 MELVILLE ET AL.

TABLE 3. Effects of raffinose and starch on sporulation andCPE productiona

CPE (p.g/mg of cell Sporulation ()Strain protein)'

Raffinose Starch Raffinose Starch

NCTC 10240 320 88 95 91NCTC 8798 236 108 90 24

a Cells were grown in DSSM with either raffinose (0.4%) or starch (0.4%) asthe carbohydrate.

b Values are the averages of duplicate samples from cultures harvested 7 hafter inoculation.'Determined by the method of Labbe and Rey (22).

G A T C 1 2 3 4 5 6

Pattern of cpe transcription and translation during sporu-lation in strains NCTC 10240 and NCTC 8798. The pattern ofcpe expression at both the transcriptional and translationallevels during the sporulation of strain NCTC 10240 wasdetermined by growing cells in DSSM with added raffinose anddirectly measuring the amount of cpe mRNA and CPE protein(Fig. 2A). During the exponential phase of growth, no CPEprotein could be detected and only trace amounts of cpe

i.

10

FIG. 3. Primer extension of NCTC 10240 cpe-specific RNA iso-lated from B. subtilis SM1 or C. perfringens NCTC 10240 with primerOSM10. Lane 1, RNA from sporulating strain SM1; lane 2, RNA fromvegetatively growing strain SM1; lanes 3 to 5, RNA from strain NCTC10240 grown in DSSM with raffinose to To, T2, and T3, respectively;lane 6, yeast RNA control. GATC lanes, sequence derived with primerOSM10. Although the sequence of the template strand was actually

0 determined, we have labeled the lanes to correspond to the nontem-plate strand in order to make a direct comparison with Fig. 1 possible.The longest extension products of SM1 (arrow A) and NCTC 10240(arrow B) are indicated.

.01

10

0C0.1

.01O 1 2 3 4 5 6 7 8 9 10

Time (h)FIG. 2. (A) Synthesis of cpe mRNA (squares) and CPE protein

(solid circles) during the growth cycle (OD6w [open circles]) of C.perftingens NCTC 10240 grown on DSSM with raffinose (see Materialsand Methods). (B) Synthesis of CPE protein (circles) during thegrowth cycle (OD600 [squares]) of C. perfringens NCTC 8798 grown inDSSM with raffinose.

mRNA were seen. The induction of cpe mRNA and CPEprotein occurred simultaneously about 1 h after To (the end ofthe exponential-growth phase). CPE protein and cpe mRNAlevels rose sharply throughout the stationary phase; intracellu-lar light-refractile spores were observed after about 6.5 h ofgrowth. For strain NCTC 8798, CPE protein was also mea-sured during the course of the sporulation cycle under thesame conditions as those for strain NCTC 10240. Unlike withstrain NCTC 10240, CPE could be detected at low levels in theearly and mid-exponential phases of growth and the inductionof CPE synthesis occurred in the late exponential phase andcontinued up to about T5 (5 h after the end of the exponential-growth phase) before falling off (Fig. 2B). As with strain NCTC10240, intracellular light-refractile spores were observed afterabout 6.5 h of growth.Primer extension of cpe mRNA. As a first measure of

potential start sites for cpe mRNA synthesis, RNA samplesextracted from strain NCTC 10240 at To, T2, and T3 and strainNCTC 8798 at T2 were assayed by primer extension with aprimer corresponding to the beginning of the coding sequence(see Materials and Methods). The results are shown in Fig. 3and 4. For strain NCTC 10240, the longest extension productwas seen at T2 and T3 (Fig. 3, arrow B) and corresponded to anapparent mRNA 5' end at bp 284 of the NCTC 10240 cpesequence shown in Fig. 1. Several shorter extension productswere also seen; these may also represent start sites of tran-

_- A

-_- B

c

a

0.0

*8000

*6000

z

4000 S

9

2000

n

300

Time (h)

200

100

c

0o06

0

a-0

0

INFEcr. IMMUN.

--

mift

..- a&K--

MS=

.6fA, =.9-

ll..,: ..:jc.g ...,

1

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

C. PERFRINGENS ENTEROTOXIN REGULATION 5555

1 2 3 G A T C

FIG. 4. Primer extension of cpe-specific RNA isolated from 6-h(T3) cultures of C. perfringens NCTC 10240 (lane 2) and NCTC 8798(lane 3) grown on DSSM with raffinose. Lane 1, yeast RNA control.GATC lanes, sequence derived with primer OSM10. Although thesequence of the template strand was actually determined, we havelabeled the lanes to correspond to the nontemplate strand in order tomake a direct comparison with Fig. 1 possible.

scription or reflect premature termination of extension reac-tions. The longest primer extension product was not seen inRNA from cells at To. For strain NCTC 8798, the sameapparent 5' end was detected in T2 cell RNA as that for NCTC10240, corresponding to bp 284 in Fig. 1 (Fig. 4, lanes 2 and 3).Expression ofcpe-gusA protein fusions in C. perfringens. The

cpe-gusA protein fusions in plasmids pSM104 and pSM105were introduced into strain NCTC 8798 by electroporation todetermine if the cloned promoter regions were sufficient toprovide normal regulation of the cpe gene. Strain NCTC 8798was chosen as the host since it is Cpe+ (Tables 1 and 2) andelectroportable and has a very low endogenous 1-glucuroni-dase activity (Fig. 5). Expression of the cpe-gusA fusion derivedfrom the NCTC 10240 cpe promoter region (pSM104) showedlow levels throughout exponential growth, rose sharply be-tween T1 and T2, and continued to rise more slowly until T6(Fig. 5). Intracellular spores were visible after 6.5 h of growth.

4000

S0

30000

aa

C

a

0

2000

1000

0

1 2 3 4 5 6 7 8 9 10

10

.1

.01

Tlme (h)

FIG. 5. Expression of NCTC 10240 cpe-gusA (-) and NCTC 8798cpe-gusA (0) fusions and the vector alone (A) in C. perfringens NCTC8798 grown on DSSM. Samples were removed at the indicated timesand assayed for ,B-glucuronidase activity. OD6. of NCTC 10240cpe-gusA (C1), NCTC 8798 cpe-gusA (0), and the vector (A).

>, 70

60-5

50-0coco

40-

01- 30-.

- 0

O 10

0

I *I . I . I . I rI *I *I .

1 2 3 4 5 6 7 8

1a

0

.1

.01

Time (h)

FIG. 6. Expression of the NCTC 10240 cpe-gusA transcriptionalfusion in B. subtilis SM1 (wild type) (-) and SM2 (spoOA) (-) and ofthe NCTC 8798 cpe-gusA transcriptional fusion in B. subtilis SM10(wild type) (*) and SM11 (spoOA) (A) grown on DS medium (seeMaterials and Methods). OD6w of SM1 (l), SM2 (0), SM10 (K), andSMi1 (A).

These data indicate that the NCTC 10240 cpe promoter regionin the cpe-gusA fusion is regulated in much the same manner asthe chromosomal copy of the gene (Fig. 2A).

Expression from the cpe-gusA fusion from the NCTC 8798cpe promoter region (pSM105) was somewhat different; ex-pression increased dramatically between T_1 and To andquickly rose before falling (Fig. 5). As with the strain contain-ing pSM104, these cells made light-refractile spores after about6.5 h of growth. The timing of the initial increase in NCTC8798 cpe-gusA expression was similar to that seen for CPEsynthesis from the chromosomal copy of the gene, i.e., betweenT-1 and To (Fig. 2B).The vector containing the gusA gene but lacking a cpe

promoter (pSM103) (Fig. 5) showed a very low level ofexpression, confirming that the cpe promoter regions areresponsible for the activity seen in Fig. 5.

Transcription of the cpe promoters of strains NCTC 10240and NCTC 8798 in sporulating B. subtilis cells. To see whethercpe expression is regulated in a sporulation-dependent fashionin B. subtilis, as it is in C. perfringens, we made cpe-gusAtranscriptional fusions with DNA fragments likely to containthe cpe promoters from strains NCTC 10240 and NCTC 8798.In each case, cpe promoter fragments identical to those used tomeasure cpe-gusA expression in C. perfringens (extending fromapproximately 220 bp upstream to 280 bp downstream of theapparent mRNA 5' end) were used (see Materials and Meth-ods) (Fig. 1). These fusions were crossed onto the B. subtilischromosome in single copy at the amyE locus by transforma-tion with plasmid pLG102, modified to contain the cpe-gusAfusions. ,-Glucuronidase activity was measured during growthand sporulation (Fig. 6). The NCTC 10240 cpe promoter inwild-type B. subtilis showed a moderate level of expressionduring exponential growth; ,-glucuronidase activity increasedabout threefold between To and T2 and then leveled off (Fig.6). To confirm that the expression seen was derived from theNCITC 10240 cpe promoter, the promoter-containing fragmentwas cloned in the gusA expression vector in the opposite

VOL. 62, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

5556 MELVILLE ET AL.

orientation; no significant levels of 3-glucuronidase could bedetected (data not shown). The vector alone also gave no3-glucuronidase activity (2a). A pattern similar to that seen

with wild-type cells was observed with a B. subtilis spoOAmutant strain (spoOA mutants are blocked at stage 0 of sporedevelopment), though the level of expression during the sta-tionary phase was about 20% higher than that seen in thewild-type strain. Mutants defective in other proteins thatcontrol stationary-phase gene expression in B. subtilis (includ-ing rH, aB, rE, and AbrB) were also tested for altered NCTC10240 cpe expression, but no significant differences from thewild-type pattern were observed (data not shown). The NCTC8798 cpe-gusA fusion exhibited a pattern of expression similarto that of the NCTC 10240 cpe-gusA fusion, but the levels of3-glucuronidase obtained were only 30 to 50% of those seen

with the NCTC 10240 cpe promoter (Fig. 6). Again, a spoOAmutation had very little effect on cpe-gusA expression (Fig. 6).RNA from B. subtilis SM1 (which contains an NCTC 10240

cpe-gusA fusion) was used as a template for primer extensionexperiments with the primer used for primer extension of C.perfringens RNA (Fig. 3). Only low levels of extension productswere detected with sporulating-cell RNA from B. subtilis (Fig.3, lane 1), but several apparent 5' ends were seen in RNA fromexponential-phase cells (Fig. 3, lane 2). The longest extensionproduct observed (arrow A in Fig. 3) corresponds to bp 229 to232 of the NCTC 10240 cpe sequence (Fig. 1), near thedownstream end of the 45-bp insertion in the NCTC 10240 cpepromoter (see above). These results suggested that cpe expres-sion in B. subtilis is dependent on different promoter sequencesand is under different regulation than in C. perfringens.

In vitro transcription from cpe promoters. As an indepen-dent test of promoter utilization by B. subtilis, in vitro tran-scription assays were performed with purified B. subtilis RNApolymerase (containing the major vegetative sigma factor, &a)and the cloned NCTC 10240 cpe promoter region as templateDNA (Fig. 7). With the 522-bp PstI-XbaI fragment as tem-plate, the strongest transcript seen was about 300 nucleotidesin length (Fig. 7, lane 1, arrow 1). The lengths of transcriptswere estimated by using DNA size standards and subtracting7.5% of the total length, since RNA runs as a seemingly largerspecies than does single-stranded DNA of equal length onsequencing gels (33). With cpe template DNA shortened bycleavage with HindlIl (Fig. 7, lane 2), the strongest transcriptseen was a family of bands 77 to 81 nucleotides in length(arrow 2). Since cleavage with HindIII shortened the runofftranscript by the expected amount, the direction of transcrip-tion is consistent with that of the cpe gene. Because the lengthof the shorter transcript can be measured more precisely thanthat of the longer one, its length was used as the basis fordetermining the in vitro start site. As shown in Fig. 1, this sitecorresponds to positions 223 to 226 in the NCTC 10240 cpesequence, near the 3' end of the 45-bp insertion in the NCTC10240 cpe promoter. This is also close to the putative 5' endseen in primer extension experiments with RNA from vegeta-tive cells of B. subtilis (Fig. 1 and 3). No significant transcriptswere seen when cpe DNA downstream of the Hindlll site wasused as the template (Fig. 7, lane 3).Attempts to generate in vitro transcripts with the NCTC

10240 and NCTC 8798 cpe promoter regions as templates forpurified C. perfringens RNA polymerase were unsuccessful,even though a control template, pTG67 (12), consistently gavethe expected transcription product (data not shown). Since theC. perfringens RNA polymerase was purified from vegetativelygrowing cells (12), it may have lacked a necessary transcriptionfactor or alternate sigma factor that is present only in sporu-lating cells. To address this problem, we partially purified RNA

2 3

404 -

I190m

110

2 --

67 .

FIG. 7. In vitro transcription assays with purified B. subtilis RNApolymerase and C. perfringens NCTC 10240 cpe promoter DNA as thetemplate. Lane 1, PstI-XbaI DNA fragment from pSM100 containingthe entire cpe promoter; lane 2, PstI-HindIII fragment from pSM100containing the cpe promoter region upstream of the HindIll site shownin Fig. 1; lane 3, HindIII-XbaI fragment from pSM100 containing thecpe promoter region downstream of the HindIll site shown in Fig. 1.Sizes (in nucleotides) are indicated on the left. The strongest tran-scripts with the PstI-XbaI fragment (arrow 1) and the PstI-HindIIIfragment (arrow 2) as the template are also indicated.

polymerase from sporulating cells of C. perfringens NCTC10240 and NCTC 8798 and performed in vitro transcriptionassays with the NCTC 10240 and NCTC 8798 cpe promoterregions as templates. No consistent transcript could be de-tected under the variety of conditions tested (data not shown).

DISCUSSION

In C. perfringens NCTC 10240, the synthesis of both cpemRNA and CPE protein was suppressed during vegetativegrowth and greatly increased after T1. This indicates that theinduction of cpe gene expression is an early-stationary-phaseevent and supports an earlier report that showed a similar timecourse of toxin induction (20). It also provides indirect evi-dence for the conclusions of Duncan et al. (10), who isolatedSpo- mutants and showed that mutants blocked at stage 0 failto make CPE, while those blocked at later stages, III to V,continue to do so. If the stage of spore development blocked inSpo- mutants indicates a temporal block as well as a develop-mental block, as is the case with B. subtilis, it can be concludedthat cpe expression is induced after stage 0 and before stage III(unfortunately, no stage II mutants were isolated by Duncan et

INFECT. IMMUN.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

C. PERFRINGENS ENTEROTOXIN REGULATION 5557

al. [10]). This temporal window corresponds closely to thatobserved here forcpe induction.The similar patterns for cpe mRNA accumulation and CPE

protein accumulation in strain NCTC 10240 suggest that CPEsynthesis is limited by the rate of transcription of the cpe gene.However, since no kinetic analysis of cpe mRNA synthesis wasdone, it is unknown whether the accumulation of RNA seenhere is due to an increasing rate of synthesis or to stabilizationof the message. The 58-min functional half-life ofcpe mRNAreported earlier (21) suggests that the stability of cpe mRNA isan important factor in the rate of CPE protein synthesis.The accumulation of CPE protein during the sporulation of

strain NCTC 8798 had slightly different kinetics than those forstrain NCTC 10240. In strain NCTC 10240, CPE inductionoccurred between T1 and T2, whereas with strain NCTC 8798,CPE induction occurred between T-1 and To. These patternsare similar to those for 3-glucuronidase activity when each cpepromoter region was used to drive expression of cpe-gusAprotein fusions (Fig. 5). Again, the NCTC 10240 cpe-gusAfusion was induced between T1 and T2, while the NCTC 8798cpe-gusA fusion showed induction between T-1 and To. Theseresults suggest that the exact timing of cpe transcription andtranslation in strains NCTC 10240 and NCTC 8798 differsbecause of differences in the cpe regulatory regions. Note thatin strain NCTC 8798, ,B-glucuronidase synthesis and CPEsynthesis start at the same time during the growth cycle buthave different kinetics of accumulation. The reason for thisdifference is unknown.

3-Glucuronidase activity derived from the cpe-gusA fusionsin C. perfringens NCTC 8798 reached high levels during thestationary phase (Fig. 5). Since the gusA gene is derived fromE. coli and encodes a 68-kDa protein (18), there appears to beno barrier to the transcription or translation of a lengthyheterologous gene in C. perfringens, even though E. coli and C.perfringens have highly divergent codon usage (primarily be-cause of differences in the G+C content of their DNA, 51%forE. coli and 26% for C. perfringens). This leaves us optimisticthat otherE. coli genes may also be expressed in C. perfringens.The cpe promoter regions from strains NCTC 8239 and

NCTC 8798 have identical sequences over the range of basestested in this report (Fig. 1), although our sequence varies atfive positions from that previously published for strain NCTC8239 (4). It is interesting that strains from different sourceshave identical cpe promoter sequences, while strains thought tobe identical do not. Czeczulin et al. (6) reported that theirsequence for the cpe gene from strain NCTC 8239 differed atseveral positions from that previously reported (38) for thesame strain. Czeczulin et al. (6) suggested that sequencedivergence in laboratory strains was probably responsible forthe differences seen in a gene derived from a single originalisolate.

Unexpectedly, the cpe promoter region from strain NCTC10240 contains an insertion of 45 bp in comparison to thecorresponding regions from strains NCTC 8798 and NCTC8239. Two other Cpe+ strains had insertions of similar sizes.These results indicate the presence of at least two types of cpepromoter regions in food-borne isolates. Geographical segre-gation is apparently not responsible for this diversity, since theinsertion was found in both British (NCTC 10240) and Nor-wegian (4246 and 3663) strains.

Although the insertion did not seem to alter the start pointof transcription in C. perfringens, it may be responsible in partfor the failure of B. subtilis to regulate cpe transcription in thesame way as does C. perfringens. On the basis of primerextension and in vitro transcription experiments (Fig. 3 and 7),B. subtilis seems to recognize a promoter site contained within

the insertion. Analysis of the insertion sequence reveals apotential vegetative-type promoter, characterized by five of sixmatches (TAAAAT, starting at position 212 in Fig. 1) to acanonical -10 region (TATAAT), an 18-bp spacer, and four ofsix matches (TTGTCT, starting at position 187 in Fig. 1) to acanonical -35 region (TTGACA). Recognition of this pro-moter by the major vegetative RNA polymerase of B. subtilismay obscure any sporulation-dependent regulation. It remainsto be seen whether this potential promoter site is ever used inC. perfingens.The cpe promoters from strains NCTC 10240 and NCTC

8798 exhibited similar patterns of expression when placed insingle copy in sporulating B. subtilis cells (Fig. 6). Bothpromoters were utilized in vegetative cells, and in both cases,threefold induction of cpe occurred very early during thestationary phase. The threefold induction of cpe expression inearly-stationary-phase cells of B. subtilis must occur at apromoter other than the one internal to the 45-bp insertionsince the NCTC 8798 cpe promoter lacks this sequence yetshows this induction. Even this stationary-phase regulation wasnot subject to regulation by the SpoOA protein, however.Moreover, mutations in genes for other regulatory proteins,such as aB, uH, aE, and AbrB, were without effect on expres-sion from the NCTC 10240 cpe promoter.We note that gusA expression from the cpe promoter in C.

perfringens was much higher than that in B. subtilis andappeared to initiate in C. perfringens from a site that is not usedduring either growth or sporulation in B. subtilis. Since thecpe-gusA fusions used in B. subtilis and C. perfringens containedidentical cpe promoter sequences, B. subtilis may lack pro-tein(s) essential for wild-type regulation of the cpe gene.The apparent cpe mRNA 5' ends detected by primer exten-

sion of RNA isolated from sporulating cells of NCTC 10240and NCTC 8798 were the same (Fig. 5). Examination of thesequence immediately upstream of this putative 5' end (bp 284[Fig. 1]) does not reveal any obvious similarity to knownbacterial promoter recognition sequences, including thoseknown to be recognized by sporulation-specific sigma factors inB. subtilis (28).

In vitro transcription of the NCTC 10240 and NCTC 8798cpe promoters with purified, vegetative-cell C. perfringens RNApolymerase and partially purified preparations from sporulat-ing cells of NCTC 10240 or NCTC 8798 failed to give anyconsistent transcription product. This may be due to theabsence or lability of an essential transcription factor, such asan activator protein or alternate sigma factor. Further bio-chemical experiments with C. perfringens extracts may help toanswer this question.

ACKNOWLEDGMENTSWe thank S. Cole for the gifts of C. perfringens RNA polymerase,

plasmid pTG67, and helpful discussions; J. I. Rood for plasmidpJIR750 and helpful discussions; and F. Whipple for the gift of B.subtilis eA RNA polymerase. C. Duncan and R. Skjelkvale kindlyprovided numerous isolates of C. perfringens.

This work was supported by a research grant from the Public HealthService (GM42219) and in part by GRASP Center, National Instituteof Diabetes and Digestive and Kidney Diseases, National Institutes ofHealth grant P30 DK34928.

REFERENCES1. Allen, S. P., and H. P. Blaschek 1990. Factors involved in the

electroporation-induced transformation of Clostridium perfringens.FEMS Microbiol. Lett. 70:217-220.

2. Bannam, T. L., and J. I. Rood. 1993. Clostridium perfringens-Escherichia coli shuttle vectors that carry single antibiotic resis-tance determinants. Plasmid 229:233-235.

VOL. 62, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.

5558 MELVILLE ET AL.

2a.Belitsky, B., P. Janssen, and A. Sonenshein. Unpublished data.3. Bradford, M. M. 1976. A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72:248-254.

4. Brynestad, S., L. A. Iwanejko, G. S. A. B. Stewart, and P. E.Granum. 1994. A complex array of Hpr consensus DNA recogni-tion sequences proximal to the enterotoxin gene in Clostridiumperfringens type A. Microbiology 140:97-104.

5. Canard, B., B. Saint-Joanis, and S. T. Cole. 1992. Genomicdiversity and organization of virulence genes in the pathogenicanaerobe Clostridium perfringens. Mol. Microbiol. 6:1421-1429.

6. Czeczulin, J. R., P. C. Hanna, and B. A. McClane. 1993. Cloning,nucleotide sequencing, and expression of the Clostridium perfrin-gens enterotoxin gene in Escherichia coli. Infect. Immun. 61:3429-3439.

7. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. Highefficiency transformation of E. coli by high voltage electroporation.Nucleic Acids Res. 16:6127-6145.

8. Duncan, C. L., and D. H. Strong. 1968. Improved medium forsporulation of Clostridium perfringens. Appl. Microbiol. 16:82-89.

9. Duncan, C. L., and D. H. Strong. 1969. Ileal loop fluid accumula-tion and production of diarrhea in rabbits by cell-free products ofClostridium perfringens. J. Bacteriol. 100:86-94.

10. Duncan, C. L., D. H. Strong, and M. Sebald. 1972. Sporulation andenterotoxin production by mutants of Clostridium perfringens. J.Bacteriol. 110:378-391.

11. Garcia-Alvarado, J. S., R. G. Labbe, and M. A. Rodriguez. 1992.Sporulation and enterotoxin production by Clostridium perfringenstype A at 37 and 43°C. Appl. Environ. Microbiol. 58:1411-1414.

12. Garnier, T., and S. T. Cole. 1988. Studies of UV-induciblepromoters from Clostridium perfingens in vivo and in vitro. Mol.Microbiol. 2:607-614.

13. Goldner, S. B., M. Solberg, S. Jones, and L. S. Post. 1986.Enterotoxin synthesis by nonsporulating cultures of Clostridiumperfingens. Appl. Environ. Microbiol. 52:407-412.

14. Hanna, P. C., A. P. Wnek, and B. A. McClane. 1989. Molecularcloning of the 3' half of the Clostridium perfringens enterotoxingene and demonstration that this region encodes receptor-bindingactivity. J. Bacteriol. 171:6815-6820.

15. Heredia, N., J. Garcia-Alvarado, and R. Labbe. Improved rapidmethod for production and purification of Clostridium perfringenstype A enterotoxin. J. Microbiol. Methods, in press.

16. Hulkower, K. L., A. P. Wnek, and B. A. McClane. 1989. Evidencethat alterations in small molecule permeability are involved in theClostridium perfringens type A enterotoxin-induced inhibition ofmacromolecular synthesis in Vero cells. J. Cell. Physiol. 140:498-504.

17. Iwanejko, L. A., M. N. Routledge, and G. S. A. B. Stewart. 1989.Cloning in Escherichia coli of the enterotoxin gene from Clostrid-ium perfringens type A. J. Gen. Microbiol. 135:903-909.

18. Jefferson, R A., S. M. Burgess, and D. Hirsh. 1986. ,-Glucuron-idase from Escherichia coli as a gene-fusion marker. Proc. Natl.Acad. Sci. USA 83:8447-8451.

19. Johnson, C. C. 1989. Clostridium perfringens food poisoning, p.629-638. In S. M. Finegold and W. L. George (ed.), Anaerobicinfections in humans. Academic Press Ltd., London.

20. Labbe, R G. 1980. Relationship between sporulation and entero-toxin production in Clostridium perfringens type A. Food Technol.34:88-90.

21. Labbe, R G., and C. L. Duncan. 1977. Evidence for stablemessenger ribonucleic acid during sporulation and enterotoxinsynthesis by Clostridium perfringens type A. J. Bacteriol. 129:843-849.

22. Labbe, R G., and D. K. Rey. 1979. Raffinose increases sporulationand enterotoxin production by Clostridium perfringens type A.Appl. Environ. Microbiol. 27:1196-1200.

23. Le Grice, S. F. J., C.-C. Shih, F. Whipple, and A. L Sonenshein.1986. Separation and analysis of the RNA polymerase bindingsites of a complex Bacillus subtilis promoter. Mol. Gen. Genet.204:229-236.

24. Mathiopoulos, C., and A. L. Sonenshein. 1989. Identification ofBacillus subtilis genes expressed early during sporulation. Mol.Microbiol. 3:1071-1081.

25. McDonel, J. L. 1980. Mechanism of action of Clostridium perfrin-gens enterotoxin. Food Technol. 34:91-95.

26. Mengaud, J., C. Geoffroy, and P. Cossart. 1991. Identification of anew operon involved in Listeria monocytogenes virulence: its firstgene encodes a protein homologous to bacterial metalloproteases.Infect. Immun. 59:1043-1049.

27. Miller, J. H. 1972. Experiments in molecular genetics. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

28. Moran, C. P., Jr. 1993. RNA polymerase and transcription factors,p. 653-668. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.),Bacillus subtilis and other gram-positive bacteria: biochemistry,physiology, and molecular genetics. American Society for Micro-biology, Washington, D.C.

29. Mueller, J. P., G. Bukusoglu, and A. L. Sonenshein. 1992. Tran-scriptional regulation of Bacillus subtilis glucose starvation-induc-ible genes: control ofgsiA by the ComP-ComA signal transductionsystem. J. Bacteriol. 174:4361-4373.

30. Naik, H. S., and C. L. Duncan. 1977. Rapid detection andquantitation of Clostridium perfringens enterotoxin by counterim-munoelectrophoresis. Appl. Environ. Microbiol. 34:125-128.

31. Rood, J. L., and S. T. Cole. 1991. Molecular genetics and patho-genesis of Clostridium perfringens. Microbiol. Rev. 55:621-648.

32. Saiki, R K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R Higuchi,G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directedenzymatic amplification of DNA with a thermostable DNA poly-merase. Science 239:487-491.

33. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-ratory, Cold Spring Harbor, N.Y.

34. Slack, F. J., J. P. Mueller, M. A. Strauch, C. Mathiopoulos, andA. L. Sonenshein. 1991. Transcriptional regulation of a Bacillussubtilis dipeptide transport operon. Mol. Microbiol. 5:1915-1925.

35. Slack, F. J., J. P. Mueller, and A. L. Sonenshein. 1993. Mutationsthat relieve nutritional repression of the Bacillus subtilis dipeptidepermease operon. J. Bacteriol. 175:4605-4614.

36. Sonenshein, A. L., B. Cami, J. Brevet, and R Cote. 1974. Isolationand characterization of rifampin-resistant and streptolydigin-resis-tant mutants of Bacillus subtilis with altered sporulation proper-ties. J. Bacteriol. 120:253-265.

37. Tabor, S., and C. C. Richardson. 1987. DNA sequence analysiswith a modified bacteriophage T7 DNA polymerase. Proc. Natl.Acad. Sci. USA 84:4767-4771.

38. Van Damme-Jongsten, M., K. Werners, and S. Notermans. 1989.Cloning and sequencing of the Clostridium perfringens enterotoxingene. Antonie Leeuwenhoek 56:181-190.

39. Wnek, A. P., and B. A. McClane. 1989. Preliminary evidence thatClostridium perftingens type A enterotoxin is present in a160,000-Mr complex in mammalian membranes. Infect. Immun.57:574-581.

40. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide sequencesof the M13mpl8 and pUC19 vectors. Gene 8:103-119.

INFECT. IMMUN.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 27

Nov

embe

r 20

21 b

y 45

.166

.157

.9.