Cloning, identification and expression analysis of ACC oxidasegene involved in ethylene production pathway

Zohreh Jafari • Raheem Haddad • Ramin Hosseini •

Ghasemali Garoosi

Received: 8 April 2012 / Accepted: 8 October 2012 / Published online: 18 October 2012

� Springer Science+Business Media Dordrecht 2012

Abstract 1-aminocyclopropane-1-carboxylic acid oxi-

dase (ACO) enzyme is a member of the Fe II-dependent

family of oxidases/oxygenases which require Fe2? as a

cofactor, ascorbate as a cosubstrate and CO2 as an activator.

This enzyme catalyses the terminal step in the plant sig-

naling of ethylene biosynthetic pathway. A 948 bp frag-

ment of the ACO1 gene cDNA sequence was cloned from

tomato (Lycopersicon esculentum) fruit tissues by using

reverse transcriptase-polymerase chain reaction (RT-PCR)

with two PCR primers designed according to the sequence

of a tomato cDNA clone (X58273). The BLAST search

showed a high level of similarity (77–98 %) between ACO1

and ACO genes of other plants. The calculated molecular

mass and predicted isoelectric point of LeACO1 were

35.8 kDa and 5.13, respectively. The three-dimensional

structure studies illustrated that the LeACO1 protein folds

into a compact jelly-roll motif comprised of 8 a-helices, 12

b-strands and several long loops. The cosubstrate was

located in a cofactor-binding pocket referred to as a 2-His-

1-carboxylate facial triad. Semi-quantitative RT-PCR

analysis of gene expression revealed that the LeACO1 was

expressed in fruit tissues at different ripening stages.

Keywords ACC oxidase 1 (ACO1) � Active site � Gene

expression � Lycopersicon esculentum � Motif

Abbreviations

ACC 1-Aminocyclopropane-1-carboxylic acid

ACO ACC oxidase

ACS ACC synthase

SAM S-adenosylmethionine

ORF Open reading frame

RT-PCR Reverse transcription polymerase chain

reaction

Bp Base pair

Introduction

Ethylene, one of the most important phytohormones,

involves in the various aspects of plant growth and

development including flower and leaf senescence, sexual

development, seed germination, fruit ripening and response

to both biotic and abiotic stresses [1]. Ethylene biosynthetic

pathway involves in the conversion of S-adenosylmethio-

nine (AdoMet) to 1-aminocyclopropane-1-carboxylic acid

(ACC) which is synthesized by ACC synthase (ACS) and

then converts ACC to ethylene by ACO (1-aminocyclo-

propane-1-carboxylic acid oxidase)[2]. ACO enzyme

belongs to the family of oxidoreductases [3] which utilize

Fe(II) as a cofactor and 2-oxoglutarate (2OG) as a cosub-

strate [4], although ACO uses ascorbate as a cosubstrate

[5]. ACO requires bicarbonate as an activator and catalyzes

the oxidation of ACC to give ethylene, CO2, and HCN. It

has been revealed that ACO forms a complex with Fe(II)

and its active site contains a single Fe(II) matched with

three residues [5]. In all isoforms and homolog proteins

with ACO such as IPNS and ANS Fe(II)-binding motif and

other motifs that are involved in binding the carboxylate of

ACC, are well conserved [6].

ACO has been isolated and characterised as an expressed

multigene family in many plant species such as white

Z. Jafari � R. Haddad (&) � R. Hosseini � G. Garoosi

Department of Agricultural Biotechnology, Imam Khomeini

International University, P.O. Box 34149-288, Qazvin,

Islamic Republic of Iran

e-mail: raheemhaddad@yahoo.co.uk

123

Mol Biol Rep (2013) 40:1341–1350

DOI 10.1007/s11033-012-2178-7

clover [7], petunia [6], strawberry [8], peach [9], melon

[10], plum [11], apple [12], banana [13], avocado [14],

tobacco [15], potato [16] and tomato [17]. In tomato,

multigene families encode ACC synthases (LeACS) and

ACC oxidases (LeACO), but LeACS2 and LeACO1 are the

main genes required during fruit ripening [18, 19]. In

preclimacteric fruits the rise in ACO activity precedes ACS

activity in response to ethylene, indicating that ACO

activity is important for controlling ethylene production

[20]. The diversity of fruit physiological and biochemical

responses to ethylene is mentioned that this hormone

controls the expression of a large number of genes (eth-

ylene-dependent genes). For example, tomato ripening

process is associated with alterations in the activity of

enzymes such as: polygalacturonase [21], pectin methy-

lesterase [22], b-galactosidase [23], expansin [24] invertase

[25], and malate dehydrogenase [26]. Ripening-related

genes are sensitive to low levels of ethylene [27, 28], and

ethylene levels in low ethylene producing transgenic fruits

affect the pattern of ripening related gene expression [27].

In kiwifruit (Actinidia chinensis) 401 genes were identified

that changed after ethylene treatment, many of the changes

were consistent with the softening and flavour changes

[29]. The process of ethylene perception begins when this

molecule interacts with a receptor linked to the endoplas-

mic reticulum (ER) membrane [30] called ETR1, acting as

a dimmer and is also capable of binding ethylene.

Here, we report the isolation and cloning of a full-length

cDNA encoding an ACO1 (as the predominant ripening-

regulated isoform) from tomato fruit tissue (Lycopersicon

esculentum L. cv, Memory I). Using the neighbor joining

algorithm, we designed a phylogenetic tree for the com-

parison of LeACO1 with the other members of plant

dioxygenase family. Also, we used constructing structural

models to present a three-dimensional structure of LeAC-

O1, which allowed us to recognize its active site. Finally,

we investigated the expression of this gene in different

stages of tomato ripening and found an obvious increase in

its expression at the orange stage.

Materials and methods

Plant material

Three tomato cultivars (Lycopersicon esculentum Mill),

Memory I (Greenhouse-grown tomato), Urebana (early

maturating) and Crystal (late maturating) were harvested

from a commercial farm in Minoodar, Qazvin, IR Iran.

Tomato fruits collected at five ripening stages including

green, breaker, orange, pink and red ripe. All samples were

immediately frozen in liquid nitrogen at the time of col-

lection and then stored at -80 �C.

Total RNA extraction and cDNA synthesis

Total RNA was extracted from different stages of fruit

ripening as described by Reid et al. [31] with slight mod-

ifications. First strand of cDNA was synthesized from 5 lg

of total RNA treated with DNase I (Fermentas), using

Reverse Transcriptase (200 lg/ll, Fermentas) and Oligo

(dT)18 primer (1 lg/ll, Qiagen). Reverse transcription was

performed at 42 �C for 60 min and stopped by heating at

70 �C for 10 min. cDNA concentration was determined by

spectrophotometric measurement.

Gene amplification, cloning and sequencing

Amplification of the LeACO1 gene (from Memory I cultivar)

was performed by Reverse Transcription-PCR (RT-PCR) using

two sets of constructed oligonucleotide primers designed based

on the ACO1 sequences of the Lycopersicon esculentum (NCBI

GenBank accession number: X58273). Both the upstream and

downstream oligonucleotides were synthesized homologous to

the coding strand. Such constructions included forward (50

ttaggatccATGGAGAACTTCCCAAT 30) and reverse (50

taaggatccCTAAGCACTTGCAATTG 30) primers carrying an

additional sequence of three nucleotides and that of a BamHI

(Fermentas) restriction site at the 50-ends. The composition of

each reaction consisted of 10 mM KCl, 10 mM Tris–HCl (pH

8.3), 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1 % Triton X-100,

500 lM of each dNTP, 0.1 mg/ml BSA, 50 pmol each of gene-

specific primers, 100 ng template DNA and 1.25 units pfu DNA

polymerase (Fermentas) in a final volume of 50 ll. The RT-

PCR reaction was carried out using a thermal cycler (Techne,

UK) programmed under the following conditions: 35 cycles of

initial denaturation at 94 �C for 1 min, followed by 35 cycles of

94 �C for 45 s, 60 �C for 1 min, and 72 �C for 1 min, with a final

extension at 72 �C for 5 min. The PCR products were separated

on a 0.8 % (w/v) agarose gel, then the target DNA (with the

expected size) was excised from the gel and purified using GF-1

PCR Clean Up Kit (Vivantis). The purified fragments were

digested with the BamHI enzyme and were cloned into a pUC19

plasmid vector (Fermentas). The ligation samples were trans-

formed into the competent E. coli cells, strain DH5aas described

in Sambrook and Russell [32]. After screening, the recombinant

plasmids were isolated, purified and the target DNA was

sequenced in both directions by dideoxynucleotide chain ter-

mination method (Sequence Laboratories Gottingen, Germany).

Sequence analysis and prediction of 3D structure

of LeACO1

The obtained nucleotide sequence from sequencing was

translated using Translate tool (http://www.expasy.ch/ tools/

dna.html) and the properties of deduced amino acid sequence

were estimated using ProtParam (http://www.expasy.ch/

1342 Mol Biol Rep (2013) 40:1341–1350

123

tools/protparam.html) [33] and Conseq (http://consurf.tau.

ac.il/) [34] programs. Predictions for pI and molecular mass

were made using the entire ORF and the pI/MW tool at

Expasy (http://web.expasy.org/compute_pi/). Secondary

structure was determined by PSIpred (http://bioinf.cs.ucl.ac.

uk/psipred/), SOPMA (http://npsa-pbil.ibcp.fr) [35] and

SCRATCH (http://scratch.proteomics.ics.uci.edu). The

three-dimensional structure of LeACO1 was predicted using

(PS)2 (http://ps2.life.nctu.edu.tw/index.php) and I-TASSER

(http://zhang.bioinformatics.ku.edu/I-TASSER) [36] with

the crystal structure of PxhACO from Petunia hybrida (PDB

ID code 1W9Y) as a template. Conserved amino acids at the

protein surface were determined using ConSurf. The

deduced protein sequence was searched for homologous

proteins in different databases using BLAST-Basic Local

Alignment Search Tool at the National Center for Biotech-

nology Information (GenBank/NCBI) [37]. Sequences with

the highest similarities were separated and multiple align-

ment and the construction of phylogenetic tree was per-

formed using ClustalW (http://clustalw.genome.ad.jp) [38]

and Boxshade (http://bioweb.pasteur.fr/seq-anal/interfaces/

boxshade.html).

Semiquantitative RT-PCR analysis

The expression of the LeACO genes family was analyzed at

different stages of ripening in Memory I, Urbana and

Crystal cultivars, by semi-quantitative RT-PCR (sqRT-

PCR). Each PCR reaction was performed in a final volume

of 20 ll containing 20 pmol of gene specific primers

(Table 1). The primers specific to Arabidopsis actin gene

(AtAct2; under accession number AF485783) were used as

the housekeeping gene (positive control). PCR was carried

out under the following conditions: 30 cycles of denatur-

ation at 94 �C for 30 s, annealing at 60 �C for 1 min and

extension at 72 �C for 1 min. Actin gene was amplified in

the same PCR conditions as LeACO genes with the same

amplification cycles (30 cycles). Reactions were performed

in triplicates. Five microliters of amplification products

were separated on a 1.5 % (w/v) agarose gel and quantified

using ImageJ software (W.S. Rasband; 1997–2007;

National Institutes of Health; http://rsb.info.nih.gov/ij).

Accession numbers

The NCBI, EMBL and SwissProt accession numbers for the

sequences mentioned in this study are as follows: (Solanum

tuberosum): St1 (AAK68075), (Lycopersicon esculentum):

Le2 (P07920); Le3 (P24157); Le4 (Q9ZWP2); Le6 (A4ZYQ6),

(Capsicum chinense): Cc (BAG30908), (Nicotian tabacum): Nt

(Q43792), (Petunia hybrida): Phy3 (Q08507); Phy4 (Q08508);

Phy1 (Q08506); (Ipomoea batatas): Ib (ADB03782), (Manihot

esculenta): Me3 (ABK58140), (Gossypium hirsutum): Gh1

(AAZ83342), (Carica papaya): Cp (AAF64528), (Betula

pendula): Bp (CAA71738), (Ficus carica): Fc (BAG06705),

(Trifolium repens):Tr1 (AAD28196), (Medicago sativa): Ms

(ABF61805), (Vigna radiate): Vr2 (CAJ56065), (Fagus sylv-

atica): Fs1 (CAD21844), (Phaseolus lunatus): Pl (BAB83762),

(Prunus persica): Ppe1 (AAF36483), (Pyrus pyrifolia): Ppy

(BAD60999), (Malus domestica): Md (BAC53656); (Ziziphus

jujuba): Zj1 (ABW91146), (Hevea brasiliensis): Hb2

(AAP41850), (Populus canadensis): Pc1 (BAA94601), (Pel-

argonium hortorum): Ph3 (AAB70884).

Results and discussion

Analysis of deduced amino acid and nucleotide

sequence

In order to characterize the full-length cDNA LeACO1 gene,

total RNA was isolated at the intermediate stage of ripening

(orange stage). cDNA was synthesized, and then, the corre-

sponding cDNA amplification was performed using oligo-

nucleotide primers forward and reverse, designated based on

the NCBI Genbank sequence (Table 1). A single PCR

fragment of the expected size was generated, purified, and

digested by BamHI restriction enzyme (Fermentas) and

cloned. The LeACO1 cDNA (deposited in NCBI GenBank

under accession number HQ322499) contained 948 bp of the

coding sequence encoding a protein of 315 amino acid res-

idues (Fig. 1). The calculated molecular mass of the deduced

Table 1 Sequences of the sq.RT-PCR primers used to quantify ACO-related transcripts in tomato fruit tissue. For each pair of primers, the size

of the PCR product (bp) and its melting temperature (�C) are presented

Gene Forward Reverse Size (bp) Tm (�C)

Sq-LeACO1 50ATGGAGAACTTCCCAAT30 50CTAAGCACTTGCAATTG30 948 57

Sq-LeACO2 50ATGGAGAATTTCCCA30 50CTAAGCAATTGCAAT30 951 52

Sq-LeACO3 50ATGGAAAGCCCTAGAGT 30 50TTAGATCTTGTAACGGG30 963 56

Sq-LeACO4 50ATGGAGAACTTCCCAAT30 50TTAAGCACTTGCAATTTG30 951 58

AtActa 50GTTAGCAACTGGGATGATATGG30 50AGCACCAATCGTGATGACTTG30 530 68

a The primers used to amplify the reference gene (actin) are also listed

Mol Biol Rep (2013) 40:1341–1350 1343

123

polypeptide was 35.8 KD and the predicted isoelectric point

was 5.13. Total number of negatively charged residues

(Asp ? Glu) and positively charged residues (Arg ? Lys)

were 51 and 38, respectively [33].

The comparison of amino acid sequence of LeACO1

with other isoforms indicated the highest identity with the

sequence of LeACO3 (93 % identity). However, a com-

parison of all LeACOs with LeACO5 showed lower identity

values of 48–50 %. A similar tendency was observed for

the nucleotide sequences. These results revealed that

LeACO5 is the most divergent among tomato ACO gene

family members (Table 2).

To further explain the characteristics of tomato ACO

genes, the known conserved amino acids were examined.

Therefore, the deduced amino acid sequences from the six

ACC oxidase genes from tomato were compared with a

consensus sequence devised from 23 other ACC oxidases

[39] (Fig. 2). ACO is a member of Fe II-dependent family

of oxidases which requires ascorbate as a cosubstrate and

Fe(II) as a cofactor for its enzymatic activity [40]. All

motifs for binding the cofactor (His-Xaa-Asp-Xaa-His) and

the cosubstrate (Arg-Xaa-Ser) that are highly conserved

among all members of the Fe(II) ascorbate family of

dioxygenases were also well conserved in LeACOs and

ACO of the 23 plant species [10, 41, 42].

Analysis of phylogeny

A phylogenetic tree was constructed from an alignment of

the deduced amino acid sequence from the tomato ACC

oxidases with the highest homology to ACO amino acid

sequences, most of which included climacteric fruits in the

database (Fig. 3). The amino acid deduced sequences of

the clone showed a high degree of homology with ACO

genes from Solanum tuberosum, Capsicum chinense,

Petunia hybrida, Nicotiana tabacum from 90 to 98 % of

identity. As expected, all the species showing such a high

degree of homology belonged to the Solanaceae. In the

phylogenetic tree, ACO proteins were classified into three

major groups. Each group contained nine to ten members.

LeACO1, LeACO2 and LeACO3 proteins that shared a

high degree of homology in amino acid sequence belonged

to a group, whereas LeACO4 and LeACO6 that had lower

degrees of identity to LeACO1 were classified into another

Fig. 1 LeACO1 cDNA

sequence from Lycopersiconesculentum and the translated

amino acid sequence. cDNA

was obtained from the mRNA at

the orange fruit stage. Primer

sequences used to amplify the

gene are shown bold

Table 2 Percentages of sequence identities between tomato ACOgenes

Sequence

name

NT

LeACO1 LeACO2 LeACO3 LeACO4 LeACO5 LeACO6

AA

LeACO1 – 84 92 75 58 77

LeACO2 89 – 83 74 58 76

LeACO3 93 87 – 76 57 75

LeACO4 78 75 78 – 60 83

LeACO5 48 49 48 50 – 58

LeACO6 79 76 78 85 48 –

NT nucleotide sequence, AA Amino acid sequence

1344 Mol Biol Rep (2013) 40:1341–1350

123

group. Also LeACO1, ACO1 from potato (Solanum

tuberosum; St1), and LeACO3 clustered strongly together,

with the closest relationship between LeACO1 and St1.

Structure prediction of tomato ACO1

Secondary structure analysis of LeACO1 protein by SOMPA

and PSIpred programs revealed that LeACO1 consists of 8 a-

helixes and 12 b-strands (Fig. 4). Using PxhACO as a tem-

plate for comparative modeling, a predicted 3D structure was

determined for LeACO1 by applying (PS)2 and I-TASSER

programs (Fig. 5a). The tertiary structure demonstrated that

this protein folds into a compact jelly-roll motif [41]. The

ligand-binding pocket is formed by eight antiparallel b-

strands (b4–b11). These b-strands form a jellyroll core that is

common in all members of 2OG oxygenases (Fig. 4) [43–

45]. Most of the a-helices are located in C-terminal and

N-terminal sides of jellyroll core [46]. Conserved residues

Leu186, Gln188, Phe187, Phe250, Val214, Val215, Leu195,

Leu197, Val236, Phe33 and Val206 involve in stabilizing the

jellyroll core [5]. The analysis of the evolutionary conser-

vation of amino acids of ACO1 was performed using Con-

Surf program (Fig. 5b, center). Residues H177, D179 and

H234 are required to bind iron in the active site (Fig. 5c) [39,

44] and R244, S246, T162, Lys158 are required as binding

sites for 5-carboxylate ACC [5, 41, 47]. The ascorbate

Fig. 2 Alignment of the

deduced ACC oxidase amino

acid sequences from tomato

with a consensus ACC oxidase

sequence collected by

Kadyrzhanova et al. [39].

Uppercase letters in the

consensus sequence represent

complete agreement within the

23 ACC oxidases compared,

and lowercase letters depict the

most frequently occurring

residues. Conserved similarity

shading is based on 50 %

identity (black) and 50 %

similarity (gray). Fe(II)-binding

motifs (dash) and cosubstrate-

binding motifs (continuousdash) are marked with boxes.

Amino acids important for

tomato ACO activity are

italicized and bolded and are

conserved in all members of

Fe(II) ascorbate family of

dioxygenases [10]

Mol Biol Rep (2013) 40:1341–1350 1345

123

molecule is found between the RXS motif and Fe(II) atom

[41] and the hydroxyl group of ascorbate interacts via

hydrogen bonds with the side chain atoms of Arg244 and

Ser246 [47]. Arg244 of LeACO1 is away from the active site

and forms an interaction with a sulfate ion on the surface of

the protein (Fig. 5b, right) [5].

Expression pattern of LeACO genes

It has been reported in several plant species that the mem-

bers of ACO multigene family display unique expression

patterns depending on environmental and developmental

factors [7, 9, 10, 12, 17, 48, 49]. Therefore, the expression

level of ACC oxidase genes during tomato ripening were

compared by RT-PCR analysis in Memory I (Fig. 6a),

Urebana and Crystal (Fig. 6b) cultivars during five devel-

opmental stages from green to red ripe. Expression analysis

exhibited that the LeACO genes display a high degree of

differential expression in tomato fruit at various stages of

ripening. The accumulation level of the LeACO1 transcript

in all cultivars and all stages was high, especially; it was

strongly transcribed in orange stage (Fig. 6). In early mat-

urating cultivar (Urebana), gene expression was obviously

severe at breaker stage. The results are in agreement with

the observation that LeACO1 is the predominant member of

the ACO gene family being expressed in tomato fruits [17,

48]. In both early and late maturating cultivars (Urebana

and Crystal, respectively) no expression was observed in the

case of LeACO2 and LeACO3 expression in the green and

breaker stages and they exhibited almost similar expression

patterns (Fig. 6). LeACO4 expression level was different in

both cultivars. In Urebana (early maturating) LeACO4 was

expressed at the highest level in the green stage and at a low

level in the red stage, but in the late maturating variety

(Crystal) its expression was low in earlier stages and then it

showed an increase. Various expression levels of the ACO

gene in the fruit tissues have been reported in several plant

species. In melon, for example, CM-ACO1 is expressed in

the ripe fruit and in the response to ethylene treatment in

leaves and wounding. CM-ACO2 is detectable at low levels

in etiolated hypocotyls. CM-ACO3 is induced in flowers

[10]. In apple fruit, MD-ACO1 accumulates in mature fruit,

MD-ACO2 expression occurs predominantly in younger

fruit tissues, while MD-ACO3 shows a less expression level

in young fruit tissues and shows the least expression level in

ripening fruits [12]. In peach fruit, PP-ACO1 transcript

accumulation increases in ripe mesocarp and senescing

leaves, PP-ACO2 mRNA accumulation is detected in fruits,

only during early development [9].

In conclusion, LeACO1 and LeACO4 expressions sus-

tained during ripening, especially in the early maturating

cultivator (Urebana). But, LeACO3 expression was low and

transitory. It is consistent with other results that have

shown only three ACO isoforms were differentially

expressed in fruit tissues [17, 50, 51]. LeACO1 might be

considered as a credible marker to compare varieties for

Fig. 3 Phylogenetic unrooted

dedrogram of tomato ACC

oxidase1. Amino acid sequences

were aligned using ClustalW

Multiple Sequence Alignments

to create the dendrogram

1346 Mol Biol Rep (2013) 40:1341–1350

123

their rate of ripening. Whereas LeACO1 expression pat-

terns were similar in Urbana and Memory I cultivators, we

concluded that their ripening behavior might also be the

same. The levels of ACO transcripts have been shown to

be regulated by ethylene itself and also by a varied group

of factors such as flooding, chilling, wounding, flower

Fig. 4 Predicted secondary

structure of LeACO1 using the

PSIpred programs

Fig. 5 Three-dimensional models, Fe2?-binding pocket and con-

served residue prediction for LeACO1. (a) Cartoon display of the

three-dimensional structure of LeACO1. (b) Conserved residue

analysis of LeACO1. Residue conservation from variable to conserved

shown in green to dark red, respectively. The left, front and right

views of protein are from left to right, respectively. (c) The active site

and Fe2?-binding pocket, the Fe(II) binding residues and the ligating

phosphate in the active site sequence are displayed. (Color figure

online)

Mol Biol Rep (2013) 40:1341–1350 1347

123

pollination, senescence, phytohormones such as IAA, GA

and 1-MCP [49, 52–59]. Changes in ACO gene expression

are critical in the control of fruit ripening and resistance to

senescence caused by ethylene. These changes could be

controlled by the adjustment of the LeACO1 gene, using

antisense or RNAi (RNA interfering) or post harvest

techniques such as 1-MCP and CO2 (inhibitors of ethylene

action).

Fig. 6 The expression of

LeACO genes in different stages

of tomato ripening. (a) RT-PCR

analysis of LeACO1 gene in

greenhouse-grown (Memory I)

cultivar at five stages of

ripening. (b) RT-PCR analysis

of LeACO genes in early

maturating (Urebana) and late

maturating (crystal) cultivars.

Each column height indicates

relative mRNA abundance.

Error bars on each column

indicate SEs from three

independent RT-PCR reactions.

G green, B breaker, O orange, P

pink, R red

1348 Mol Biol Rep (2013) 40:1341–1350

123

References

1. Bleecker AB, Kende H (2000) Ethylene: a gaseous signal mol-

ecule in plants. Annu Rev Cell Dev Biol 16:1–18

2. Adams DO, Yang SF (1979) Ethylene biosynthesis: identification

of ACC as an intermediate in the conversion of methionine to

ethylene. Proc Natl Acad Sci USA 76:170–174

3. Prescott AG (1993) A dilemma of dioxygenases (or where bio-

chemistry and molecular biology fail to meet). J Exp Bot 44:

849–861

4. Ryle MJ, Hausinger RP (2002) Non-heme iron oxygenases. Curr

Opin Chem Biol 6(2):193–201

5. Zhang ZH, Ren JS, Clifton LJ, Schofield CJ (2004) Crystal

structure and mechanistic implications of 1-aminocyclopropane-

1-carboxylic acid oxidase the ethylene-forming enzyme. Chem

Biol 11:1383–1394

6. Tang X, Wang H, Brandt AS, Woodson WR (1993) Organization

and structure of the 1-aminocyclopropane-1-carboxylate oxidase

gene family from Petunia hybrida. Plant Mol Biol 23:1151–1164

7. Chen CM, McManus MT (2006) Expression of 1-aminocyclo-

propane-1-carboxylate (ACC) oxidase genes during the devel-

opment of vegetative tissues in white clover (Trifolium repens L.)

is regulated by ontological cues. Plant Mol Biol 60:451–467

8. Trainotti L, Pavanello A, Casadoro G (2005) Different ethylene

receptors show an increased expression during the ripening of

strawberries: does such an increment imply a role for ethylene in

the ripening of these non-climacteric fruits? J Exp Bot 56:

2037–2046

9. Ruperti B, Bonghi C, Rasori A, Ramina A, Tonutti P (2001)

Characterization and expression of two members of the peach

1-aminocyclopropane-1-carboxylate oxidase gene family. Physiol

Plant 111:336–344

10. Lasserre E, Bouquin T, Hernandez JA, Bull J, Pech JC, Balague

C (1996) Structure and expression of three genes encoding ACC

oxidase homologs from melon (Cucumis melon L.). Mol Gen

Genet 251:81–90

11. Fernandez-Otero C, Matilla AJ, Rasori A, Ramina A, Bonghi C

(2006) Regulation of ethylene biosynthesis in reproductive

organs of damson plum (Prunus domestica L. subsp. Syriaca).

Plant Sci 171:74–83

12. Binnie JE, McManus MT (2009) Characterization of the 1-ami-

nocyclopropane-1-carboxylic acid (ACC) oxidase multigene

family of Malus domestica Borkh. Phytochem 70:348–360

13. Clendennen SK, Kipp PB, May GD (1997) The role of ethylene

in banana fruit ripening. In: Kanellis AK, Chang C, Kende H,

Grierson D (eds) Biology and biotechnology of the plant hormone

ethylene. Kluwer, Dordrecht, pp 141–148

14. McGarvey DJ, Christofferson RE (1990) Nucleotide sequence of

a ripening related cDNA from avocado fruit. Plant Mol Biol

15:165–167

15. Knoester M, Bol JF, van Loon LC, Linthorst HJ (1995) Virus-

induced gene expression for enzymes of ethylene biosynthesis in

hypersensitively reacting tobacco. Mol Plant-Microbe Interact

8:177–180

16. Nie X, Singh RP, Tai GC (2002) Molecular characterization and

expression analysis of 1-aminocyclopropane-1-carboxylate oxi-

dase homologs from potato under abiotic and biotic stresses.

Genome 45:905–913

17. Barry CS, Blume B, Bouzayen M, Cooper W, Hamilton AJ,

Grierson D (1996) Differential expression of the 1-aminocyclo-

propane-1-carboxylate oxidase gene family of tomato. Plant J

9:525–535

18. Alexander L, Lin Z, Chen G, Kim S, Hackett R, Wilson I, Gri-

erson D (2002) Ethylene signalling in ripening tomato fruit.

Comp Biochem Physiol A 132:S97

19. Huang LC, Lai UL, Yang SF, Chu CK, Tsai MF, Sun CW (2007)

Delayed flower senescence of Petunia hybrida plants transformed

with antisense broccoli ACC synthase and ACC oxidase genes.

Postharvest Biol and Technol 46:47–53

20. Liu Y, Hoffman NE, Yang SF (1985) Promotion by ethylene of

the capability to convert 1-aminocyclopropane-1-carboxylic acid

to ethylene in preclimacteric tomato and cantaloupe fruits. Plant

Physiol 77:407–411

21. DellaPenna D, Lincoln JE, Fischer RL, Bennett AB (1989)

Transcriptional analysis of polygalacturonase and other ripening

associated genes in Rutgers, rin, nor, and Nr tomato fruit. Plant

Physiol 90:1372–1377

22. Gaffe J, Mishra KK, Tiznado ME, Handa AK (1997) Functional

expression of a ubiquitously expressed tomato pectin methylester-

ase gene in transgenic tobacco plants. Plant Physiol 114:1311–1312

23. Smith DL, Gross KC (2000) A family of at least seven betagal-

actosidase genes is expressed during tomato fruit development.

Plant Physiol 123:1173–1183

24. Cosgrove DJ (2000) Loosening of plant cell walls by expansins.

Nature 407:321–326

25. Iki K, Sekigushi K, Kurata K, Tada T, Nakagawa H, Ogura N,

Takehana H (1978) Immunological properties of b-fructofuran-

osidase from ripening tomato fruit. Phytochemistry 17:311–312

26. Jeffery D, Smith C, Goodenough P, Prosser I, Grierson D (1984)

Ethylene-independent and ethylene-dependent biochemical

changes in ripening tomatoes. Plant Physiol 74:32–38

27. Sitrit Y, Bennett AB (1998) Regulation of tomato fruit polyga-

lacturonase mRNA accumulation by ethylene: a re-examination.

Plant Physiol 116:1145–1150

28. Wei j, Ma F, Shi SH, Qi X, Zhu X, Yuan J (2010) Changes and

postharvest regulation of activity and gene expression of enzymes

related to cell wall degradation in ripening apple fruit. Posthar-

vest Biol and Technol 56:147–154

29. Atkinson RG, Gunaseelan K, Wang MY, Luo L, Wang T, Norling

C, Johnston S, Maddumage R, Schroder R, Schaffer R (2011)

Dissecting the role of climacteric ethylene in kiwifruit (Actinidiachinensis) ripening using a 1-aminocyclopropane-1-carboxylic

acid oxidase knockdown line. J Exp Bot 62(11):3821–3835

30. Stepanova A, Alonso J (2005) Ethylene signaling and response

pathway: a unique signaling cascade with a multitude of inputs

and outputs. Physiol Plant 123:195–206

31. Reid KE, Olsson N, Schlosser J, Peng F, Lund ST (2006) An

optimized grapevine RNA isolation procedure and statistical

determination of reference genes for real-time RT-PCR during

berry development. BMC Plant Biol 6:27–37

32. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor

33. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR,

Appel RD, Bairoch A (2005) In: Walker JM (ed) Protein iden-

tification and analysis tools on the ExPASy server-the proteomics

protocols handbook. Humana Press, Totowa

34. Ashkenazy H, Erez E, Martz E, Pupko T, Ben-Tal N (2010)

ConSurf 2010: calculating evolutionary conservation in sequence

and structure of proteins and nucleic acids. Nucl Aci Res 38:

529–533

35. Geourjon C, Deleage G (1995) SOPMA: significant improvement

in protein secondary structure prediction by consensus prediction

from multiple alignments. CABiOS 11:681–684

36. Zhang Y (2008) I-TASSER server for protein 3D structure pre-

diction. BMC Bioinf. 9:40. doi:10.1186/1471-2105-9-40

37. Altschul SF, Gish W, Miller W, Meyers EW, Lipman DJ (1990)

Basic local alignment search tool. J Mol Biol 215:403–410

38. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW:

improving the sensitivity of progressive multiple sequence

Mol Biol Rep (2013) 40:1341–1350 1349

123

alignment through sequence weighting, position specific gap

penalties and weight matrix choice. Nucleic Acids Res 11:

4673–4680

39. Kadyrzhanova DK, McCully TJ, Jaworski SA, Ververidis P,

Vlachonasios KE, Murakami KG, Dilley DR (1997) Structure

function analysis of ACC oxidase by site-directed mutagenesis.

In: Kanellis AK, Chang C, Kende H, Grierson D (eds) Biology

and biotechnology of the plant hormone ethylene. Kluwer, The

Netherlands, pp 5–13

40. McGarvey DJ, Christoffersen RE (1992) Characterization and

kinetic parameters of ethylene-forming enzyme from avocado

fruit. J Biol Chem 267:5964–5967

41. Seo YS, Yoo A, Jung J, Sung SK, Yang DR, Kim WT, Lee W (2004)

The active site and substrate-binding mode of 1-aminocyclopropane-

1-carboxylate oxidase determined by site-directed mutagenesis and

comparative modelling studies. Biochem J 380:339–346

42. Solomon EI, Brunold TC, Davis MI, Kemsley JN, Lee SK, Le-

hnert N, Neese F, Skulan AJ, Yang YS, Zhou J (2000) Geometric

and electronic structure/function correlations in non-heme iron

enzymes. Chem Rev 100:273–278

43. Elkins JM, Ryle MJ, Clifton IJ, Dunning Hotopp JC, Lloyd JS,

Burzlaff NI, Baldwin JE, Hausinger RP, Roach PR (2002) X-ray

crystal structure of Escherichia coli taurine/_-ketoglutarate diox-

ygenase complexed to ferrous iron and substrates. Biochemistry

41:5185–5192

44. Roach PL, Clifton IJ, Fulop V, Harlos K, Barton GJ, Hajdu J,

Andersson I, Schofield CJ, Baldwin JE (1995) Crystal structure of

isopenicillin N synthase is the first from a new structural family

of enzymes. Nature 375:700–704

45. Zhang ZH, Ren JS, Stammers DK, Baldwin JE, Harlos Schofield

CJ (2000) Structural origins of the selectivity of the trifunctional

oxygenase clavaminic acid synthase. Nat Struct Biol 7:127–133

46. Wilmouth RC, Turnbull JJ, Welford RWD, Clifton IJ, Prescott

AG, Schofield CJ (2002) Structure and mechanism of anthocy-

anidin synthase from Arabidopsis thaliana. Structure 10:93–103

47. Lay VJ, Prescott AG, Thomas PG, John P (1996) Heterologous

expression and site-directed mutagenesis of the 1-aminocyclo-

propane-1-carboxylate oxidase from kiwi fruit. Eur J Biochem

242:228–234

48. Anjanasree KN, Bansal KC (2005) Differential expression of

tomato ACC oxidase gene family in relation to fruit ripening.

Curr Sci 89:1394–1398

49. Lelievre JM, Tichit L, Fillion L, Larrigaudiere C, Vendrell M, Pech

JC (1995) Cold-induced accumulation of 1-aminocyclopropane-1-

carboxylate oxidase protein in Granny Smith apples. Postharv Biol

Technol 5:11–17

50. Barry CS, Llop-Tous MI, Grierson D (2000) The regulation of

1-aminocyclopropane-1-carboxylic acid synthase gene expression

during the transition from system-1 to system-2 ethylene syn-

thesis in tomato. Plant Physiol 123:979–986

51. Van-der-Hoeven R, Ronning C, Giovannoni J, Martin G,

Tanksley S (2002) Deductions about the number, organization,

and evolution of genes in the tomato genome based on analysis of

a large expressed sequence tag collection and selective genomic

sequencing. Plant Cell 14:1441–1456

52. Calvo G (2004) Efecto del 1-metilciclopropeno (1-MCP) en peras

cv Williams cosechadas en dos estados de madurez. Rev Invest

Agropecu 33:3–26

53. Chae HS, Cho YG, Park MY, Lee MC, Eun MY, Kang BG, Kim

WT (2000) Hormonal cross-talk between auxin and ethylene

differentially regulates the expression of two members of the

1-aminocyclopropane-1-carboxylate oxidase gene family in rice

(Oryza sativa L.). Plant Cell Physiol 41:354–362

54. English PJ, Lycett GW, Roberts JA, Jackson MB (1995)

Increased 1-aminocyclopropane-1-carboxylic acid oxidase activ-

ity in shoots of flooded tomato plants raises ethylene production

to physiologically active levels. Plant Physiol 109:1435–1440

55. Kim JH (2006) Ethylene-regulated expression of ACC oxidase

and ACC synthase genes in mung bean hypocotyls. J Plant Biol

49:291–297

56. Llop-Tous I, Barry CS, Grierson D (2000) Regulation of ethylene

biosynthesis in response to pollination in tomato flowers. Plant

Physiol 123:971–978

57. Owino WO, Manabe Y, Mathooko FM, Kubo Y, Inaba A (2006)

Regulatory mechanisms of ethylene biosynthesis in response to

various stimuli during maturation and ripening in fig fruit (Ficuscarica L.). Plant Physiol Biochem 44:335–342

58. Tassoni A, Watkins CB, Davies PJ (2006) Inhibition of the eth-

ylene response by 1-MCP in tomato suggests that polyamines are

not involved in delaying ripening, but may moderate the rate of

ripening or over-ripening. J Exp Bot 57:3313–3325

59. Woltering EJ, Balk PA, Nijenhuis-deVries MA, Faivre M, Ruys

G, Somhorst D, Philosoph-Hadas S, Friedman H (2005) An

auxinresponsive 1-aminocyclopropane-1-carboxylate synthase is

responsible for differential ethylene production in gravistimulated

Antirrhinum majus L. flower stems. Planta 220:403–413

1350 Mol Biol Rep (2013) 40:1341–1350

123