Oxidosqualene cyclases from Withania somnifera

Cloning and Functional Characterization of Three Branch Point Oxidosqualene Cyclases From Withania somnifera (L.) Dunal

Niha Dhar1, Satiander Rana

1, Sumeer Razdan

1, Wajid Waheed Bhat

1, Aashiq Hussain

2, Rekha S.

Dhar1, Samantha Vaishnavi

3, Abid Hamid

2, Ram Vishwakarma

4, Surrinder K. Lattoo

1*

From the Divisions of 1Plant Biotechnology,

2Cancer Pharmacology,

4Medicinal Chemistry,

Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi-180001, India 3School of Biotechnology, Shri Mata Vaishno Devi University, Katra-182320, India

*Running title: Oxidosqualene cyclases from Withania somnifera

To whom correspondence should be addressed: Dr. Surrinder K. Lattoo, Plant Biotechnology, CSIR -

Indian Institute of Integrative Medicine, Canal Road, Jammu Tawi-180001, Tel.: +919419203465; Fax: +91-191-2569019; E-mail: sklattoo@iiim.ac.in

Keywords: Isoprenoid; metabolic engineering; gene regulation; mass spectrometry; western blotting; Withania somnifera; oxidosqualene cyclases; Schizosaccharomyces pombe; elicitor;

withanolides

Background: Pharmacological investigations

position withanolides as important bioactive molecules demanding their copious

production.

Results: Differential transcriptional and

translational expression of three oxidosqualene

cyclases leads to redirection of metabolic

fluxes.

Conclusion: Negative regulator channelizes substrate pool towards cycloartenol synthase at

sub-dividing junction leading to enhanced

withanolide production.

Significance: Understanding regulatory role of

oxidosqualene cyclases on withanolide

accumulation could serve as prognostic tool for metabolic engineering.

ABSTRACT

Oxidosqualene cyclases (OSCs) positioned at

a key metabolic sub-dividing junction execute

indispensable enzymatic cyclization of 2, 3-

oxidosqualene for varied triterpenoid

biosynthesis. Such branch-points present

favourable gene targets for redirecting

metabolic flux towards specific secondary

metabolites. However, detailed information

regarding the candidate OSCs covering

different branches and their regulation is

necessary for desired genetic manipulation.

The aim of the present study, therefore, was

to characterize members of OSC superfamily

from Withania somnifera (Ws), a medicinal

plant of immense repute known to synthesize

a large array of biologically active steroidal

lactone triterpenoids called withanolides.

Three full length OSC cDNAs, β-amyrin

synthase (WsOSC/BS), lupeol synthase

(WsOSC/LS) and cycloartenol synthase

(WsOSC/CS) having open reading frames of

2289 bp, 2268 bp and 2277 bp were isolated.

Heterologous expression in

Schizosaccharomyces pombe, LC-MS analyses

and kinetic studies confirmed their mono-

functionality. The three WsOSCs were found

to be spatially regulated at transcriptional

level with WsOSC/CS being maximally

expressed in leaf tissue. Promoter analysis of

three WsOSCs genes resulted in identification

of distinct cis-regulatory elements. Further,

transcript-profiling under methyl jasmonate

(MeJA), gibberellic acid (GA3) and yeast

extract (YE) elicitations displayed differential

1

http://www.jbc.org/cgi/doi/10.1074/jbc.M114.571919The latest version is at JBC Papers in Press. Published on April 25, 2014 as Manuscript M114.571919

Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

transcriptional regulation of each of the OSCs.

Changes were also observed in mRNA levels

under elicitations and further substantiated

with protein expression levels by western

blotting. Negative regulation by YE resulted in

significant increase in withanolide content.

Empirical evidence suggests that repression of

competitive branch OSCs like WsOSC/BS and

WsOSC/LS possibly leads to diversion of

substrate pool towards WsOSC/CS for

increased withanolide production.

INTRODUCTION

Terpenoids are metabolites of oligomers and

encompass the major group of plant natural products (1). Triterpenoids which are 30-carbon

subset of terpenoids, serve important functions

as steroids in eukaryotes, hopanoids in prokaryotes and pentacyclic triterpenoids in plants

(2). These pentacyclic triterpenoids possess a

robust spectrum of structural distinctiveness and biological activities primarily because of wide-

ranging cyclizations of a single substrate 2, 3-

oxidosqualene brought about by various members

of the oxidosqualene cyclase (OSC) gene family (1). It accentuates these to a potential source of

large array of medicinal compounds.

Withanolides nomenclatured as 22- hydroxyergostan -26-oic acid-26, 22-lactone, are

a naturally occurring group of triterpenoids

restricted to only few genera of Solanaceae. One such member includes Withania somnifera (Ws)

also known as ashwagandha or winter cherry. Ws

is often compared with Korean ginseng (Panax ginseng) for being a panacea for various ailments

and diseases (3) with most of the remedying

properties of this plant being ascribed to

withanolides of which about 40 members have been isolated from leaves and roots (4).

Substantial pharmacological activities have been

accredited to two main withanolides, withaferin A (WS-3) and withanolide D (WS-D). These

compounds have been reported to inhibit

angiogenesis, Notch-1, NFκB in cancer cells and

induce apoptosis in breast cancer cells (5-7).This prospect demands enhanced production of

withanolides either through homologous

intensification of biosynthetic machinery in host

plant or alternative heterologous production in

microbial systems. One of the strategies that can rationalize copious production of desired

secondary metabolites is through pathway

engineering. As pathways and metabolic flux are at the core of metabolic engineering, elucidation

of metabolic pathways becomes one of the main

pre-requisites. However, there exists sparse

information regarding the biosynthesis of withanolides (8) and therefore characterization

of its key pathway genes and understanding

about their regulation is of fundamental research value.

Withanolides are C28- steroidal lactones built

on an intact or rearranged ergostane framework, in which C-22 and C-26 are appropriately

oxidized to form a six-membered lactone ring.

Withanolides are synthesized via both

mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate/1-deoxy-D-xylulose 5-phosphate

(MEP/DOXP) pathways which direct the flux of

the isoprene (C5) units for the synthesis of triterpenoid pathway intermediates which are

further committed to withanolide biosynthesis

(9). Withanolides, sterols, and suite of triterpenoids are elaborated via common 30-

carbon intermediate 2, 3-oxidosqualene

involving a highly regio and stereo-specific step

carried by a family of genes called OSCs (Fig.1). In plants, this equivalent step involves

OSCs belonging to two groups based on the

nature of their presumed catalytic intermediates which are the protosteryl and dammarenyl

cations. Both these cations are significant for

imparting distinct stereochemistry and ring configurations to various triterpene skeletons. For

example, the protosteryl cation takes up the

chair-boat-chair (C-B-C) configuration and leads

to cycloartenol and lanosterol, whereas most of the pentacyclic triterpenes are derived from the

dammarenyl cation by D-ring expansion to

form lupeol or further E-ring expansion to form β-amyrin (10). This division is supposed to

constitute a key subdividing point for phytosterol

and triterpenoid biosynthesis in plants (11).

Similarly, in Ws this branching point leads to the division of 2, 3-oxidosqualene between

IPP, isopentenyl pyrophosphate; OSC, oxidosqualene cyclase; Ws, Withania somnifera; WS-3, withaferin A; WS-D, withanolide D; MVA, mevalonate; MEP/DOXP, 2-C-methyl-D-

erythritol4-phosphate/1-deoxy-D-xylulose 5-phosphate; C-B-C, chair-boat-chair

4-phosphate/1-deoxy-D-xylulose 5-phosphate; C-B-C, chair-boat-chair

2

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

cycloartenol synthase [(S)-2, 3-epoxysqualene

mutase (cyclizing, cycloartenol forming), EC

5.4.99.8] which leads to the formation of cycloartenol, a pentacyclic triterpene that

contains nine chiral centers and acts as the

precursor to phytosterols and apparently to withanolides and other array of OSCs that shape

a range of diverse triterpenoids. Such branch

point genes become prospective candidates for

perturbation which may impact respective branch flux by redirecting the precursor pool towards

desired secondary metabolite(s) and concurrently

decrease the flux through competitive pathways (12). For such perturbations to take place, both

upstream and metabolic branch point genes need

to be flexible, wherein the respective genes are

sufficiently susceptible to induced genetic and environmental influences thus permitting optimal

allocation of carbon fluxes (13).

Elicitations involving various signal

transduction pathways represent a promising

means for such perturbations (14). Elicitors through their corresponding cis-regulatory

elements in gene promoter alter the transcript

levels and subsequently change the yield of

various metabolites (15). As numerous studies have illustrated a moderate or weakly positive

correlation between mRNA and protein

expression. Therefore, a relative study between the two also holds equal significance to gauge the

effect of elicitation on the altered metabolite

levels (16). The flexibility of upstream genes at transcriptional level has already been reported

in our previous studies (8, 17). Therefore,

characterization and regulatory studies of

WsOSCs is important to corroborate whether the branches covering different OSCs are rigid or

flexible for increased withanolide production.

Here, we report cloning and characterization of

three members of OSC superfamily and

correlation of their relative tissue-specific

transcript levels with withanolide accumulation. On the basis of cis-regulatory elements identified

in the isolated promoters, plant derived and

microbe derived elicitors altered WsOSCs expression pattern both at mRNA and protein

level which corresponded with the change in the

accumulation of three key withanolides namely

withanolide A (WS-1), withanone (WS-2) and

withaferin A (WS-3). Thus suggesting that possibly repression of OSCs covering different

branches like WsOSC/BS and WsOSC/LS lead to

diversion of common precursor pool towards WsOSC/CS leading to increase in the withanolide

production. Subsequently, this approach has a

potential to become a useful predictive guide for

future metabolic engineering efforts aimed at enhanced withanolide biosynthesis.

EXPERIMENTAL PROCEDURES

Plant material and RNA extraction - In vitro cultures established from a WS-3 rich genetic

stock of Ws (WS-Y-08) grown at Indian Institute

of Integrative Medicine (Jammu, India,32˚44´N longitude, 74˚55´E latitude; 305 m inaltitude)

was used as a source material (17). Total RNA

was extracted using TRIzol reagent following

the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA) and treated with DNase I

(Fermentas Burlington, Canada) at 37 ˚C for 30

min to remove any traces of genomic DNA. The quality of RNA was checked by electrophoresis

on 1% formaldehyde containing agarose gel and

by determining the ratio of absorbance at 260 and 280 nm (A260/280). Concentration of

isolated RNAs was determined by measuring the

absorbance at 260 nm in a spectrophotometer

(AstraAuriga, Cambridge, UK).

cDNA synthesis and cloning of WsOSC/BS,

WsOSC/LS and WsOSC/CS - First strand cDNA

was reverse transcribed from 3 µg DNase I

treated total RNA using Revert-aid premium reverse transcription kit (Fermentas, Burlington,

Canada) with a modified Adapter-oligo dT

primer. Reaction was set in a total volume of 20 µl containing 3 μg total RNA, 10 µM oligo (dT)

primer, 1x first strand buffer (250 mM Tris-HCl, pH 8.3, 250 mM KCl, 20 mM MgCl2, 50 mM

DTT), 10 mM dNTPs and 1 µl M-MuLV reverse

transcriptase (200 U/µl) for 1 h at 42 ˚C followed

by 5 min at 70 ˚C to inactivate the reverse transcriptase.

Degenerate primers (Table 1) were designed

WS-1, withanolide A; WS-2, withanone; WsOSC/BS, Withania somnifera β-amyrin synthase; WsOSC/LS,

Withania somnifera lupeol synthase; WsOSC/CS, Withania somnifera cycloartenol synthase

3

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

based on highly conserved regions of amino acid

sequences of reported OSCs by multiple

sequence alignment of retrieved sequences from the GenBank database at National Center for

Biotechnology Information (NCBI). The reverse

transcriptase-polymerase chain reaction (RT- PCR) for WsOSC/BS, WsOSC/LS and

WsOSC/CS was performed for the core

amplification under following conditions: one

cycle of 94 ˚C for 3 min, 35 cycles of 94 ˚C for 1 min, 60 ˚C for 1 min and 72 ˚C for 1 min

followed by a final extension of 72 ˚C for 10

min in a thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). The amplicons were

independently cloned into pTZ57R/T vector

(Fermentas, Burlington, Canada), transformed

into E. coli host strain (DH5α; New England Biolabs, Ipswich, MA, USA) and sequenced

using a BigDye terminator cycle sequencing kit

(Applied Biosystems, Foster City, CA, USA) with an ABI PRISM® 3130XL genetic analyser

(Applied Biosystems, Foster City, CA, USA).

Blastn analysis was performed to ensure the homology of the obtained nucleotide sequences.

5'and 3' RACE - The sequenced fragments were subsequently utilized for designing gene

specific primers (GSP) to be used in 5' and 3'

rapid amplification of cDNA ends (RACE) by means of first choice RLM-RACE kit according

to the product manual (Ambion, Austin, TX,

USA). Each of the 5' and 3' cDNAs obtained were separately subjected to two sets of PCR

reactions. First set of reaction was performed

with outer 5' RACE adapter primer (5' RACE-

OUT) and 5' OSC/BS5O, OSC/LS5O and OSC/CS5O as GSPs (Table 1). Second set of

PCR was carried out with inner 5' RACE adapter

primer (5' RACE-IN) and 5' OSC/BS5I, OSC/LS5I and OSC/CS5I as GSPs (Table 1).

Likewise, for 3' RACE, cDNA was subjected to

two rounds of PCR using outer and inner 3’

adapter primers along with 3' GSPs of all the three OSCs (Table 1). Both, the first and the

nested PCR amplification procedures for 5' and

3’ RACE were carried in a 50 μL reaction volume containing 1.0 μL cDNA as template,

2µl of 10 µM 5' GSPs/ 3' GSPs, 2 µl of

5'RACE adapter primer/ 3' RACE adapter primer

(Table 1) and 45.0 μL master Mix (34.5 μL PCR-

grade water, 10 mM Tris HCl; pH 9.0, 50 mM

KCl, 2.5 mM MgCl2, 200 μM dNTPs, 2.5 U Taq

DNA polymerase). For second round of PCR, amplified product of primary PCR was used as

template. The cycling conditions for the PCR

were as following: One cycle of 94 ˚C for 3 min and 35 cycles of 94 ˚C for 30 s, 60 ˚C for 30 s, 72

˚C for 2 min with a final extension at 72 ˚C of 10

min. 3' and 5' nested amplicons were purified and

subcloned into pTZ57R/T vector followed by sequencing. All the three sequences obtained

from core fragments and 3' and 5' nested RACE

amplicons were aligned in frame and BLAST analysis was performed to validate the prediction

of target OSCs.

Full-length cloning of WsOSCs - The open

reading frame (ORF) of WsOSC/BS, WsOSC/LS

and WsOSC/CS were located using ORF Finder on the NCBI Web

(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and

used for designing full length primers FULLOSC/BSF and FULLOSC/BSR,

FULLOSC/LSF and FULLOSC/LSR and

FULLOSC/CSF and FULLOSC/CSR (Table 1).

Using these primers and cDNA as template, a high fidelity proof-reading DNA polymerase

(New England Biolabs, Herts, UK) was

employed for amplification of the three ORFs under PCR conditions; One cycle of 94 ˚C for 3

min, 35 cycles of 94 ˚C for 30 s, 60 ˚C for 30 s,

72 ˚C for 2 min with a final extension at 72 ˚C of 10 min. The resulting amplicons were ligated in

pJET vector and transformed into E.coli DH5α.

Sequence and phylogenetic analyses - The

sequence homology and the deduced amino acid

sequence comparisons were carried out using BLAST at NCBI

(http://www.ncbi.nlm.nih.gov/blast). The full

length nucleotide sequence obtained were translated using Translate tool

(http://www.expasy.ch/tools/dna.html). Predicted

amino acid sequences of WsOSC/BS, WsOSC/LS

and WsOSC/CS were phylogenetically analysed against OSC sequences of different plant species

recouped from the GenBank through Blastp

algorithm. Sequences were aligned using the

RT-PCR, reverse transcriptase-polymerase chain reaction; GSP, gene specific primers; RACE, rapid

amplification of cDNA ends; ORF, open reading frame

4

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

ClustalW program (http://www.ebi.ac.uk) using

default parameters and the neighbour joining tree

was constructed with MEGA 5 software. Evolutionary distances were computed using the

Poisson correction method (18) and bootstrap

analysis with 100 replicates was also carried out in order to obtain confidence level with the

branches.

In silico protein analyses - Pattern and signature search in the deduced proteins were

done by means of PROSITE (19) and SMART

(20, 21) web tools. Conserved domains were verified using NCBI Conserved Domain Search

tool

(www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi)

.The three-dimensional structures were predicted

by Phyre2

server (Protein Homology/analogy

Recognition Engine V 2.0)

(http://www.sbg.bio.ic.ac.uk/phyre2/html/) using the crystal structure of Homo sapiens OSC (PDB

ID- 1w6ja) as a template. Ligand binding sites

were predicted using 3DLigandSite (22).

Plasmid construction - The ORFs of

WsOSC/BS, WsOSC/LS and WsOSC/CS were modified by adding restriction sites at both the

ends using sense and anti-sense primers (Table

1). The resulting ORFs were cloned and digested

from pJET with XhoI and NotI and subcloned respectively in digested Schizosaccharomyces

pombe expression vector pDS472a under the

control of nmt1 promoter. pDS472a harbours bacterial origin of replication and selectable

marker in addition to yeast selectable marker

(ura4+) and an autonomous replication sequence

(ARS) (23). Based on this, positive E.coli DH5α transformants were screened with ampicillin

resistance. The resultant positive plasmids

(pDS472aB, pDS472aL and pDS472aC) were validated by PCR and restriction enzyme

digestion.

Yeast transformation and inducement of transgenic yeast - The recombinant pDS472aB,

pDS472aL and pDS472aC plasmids and empty

vector pDS472a were transformed into S. pombe by electroporation (24). Concisely, S. pombe was

grown in YES (0.5% w/v yeast extract, 3.0%

w/v glucose) media to a density of approximately

1 x 107/ml at 30 ˚C. Cells were collected and

washed thrice with ice cold filter sterilized 1 M sorbitol and resuspended in 1 M sorbitol.

Recombinant plasmids (100 ng) were mixed with

0.1 ml of sorbitol resuspended cells and pulsed at 2.25 kV (11.25 kV/cm), 200Ω and 25µF in an

ice cold cuvette using multiporator (Eppendorf

AG, Hamburg, Germany). Instantly after the pulse, 0.5 ml of ice cold 1 M sorbitol was added; cells

were diluted, plated on selective media and

incubated at 30 ˚C. Single colony obtained after 48

h for each of the OSC was grown in YES media till mid log phase, washed and further induced in

1L Edinburgh Minimal Media (EMM) at 30 ˚C for

48 h with constant shaking at 200 rpm. Upon harvesting, methanol (MeOH) was added which

amounted to 10% of the volume of whole broth.

The entire culture was high-shear homogenized to lyse the cells. Homogenized whole broth was

transferred to a separating funnel with an equal

volume of dichloromethane (DCM) added.

Following shaking and separation of layers, the DCM phase was withdrawn and the organic

solvent was removed by rotary evaporation (25).

The organic extracts for the three OSCs and empty vector were dissolved in high performance liquid

chromatography (HPLC) grade ethanol and

subjected to liquid chromatography-mass

spectrometry (LC-MS) analysis.

LC-MS analyses - LC analyses of pDS472aB,

pDS472aL, pDS472aC and pDS472a extracts was performed on Agilent poroshell 120 EC-C8

column (3.0 x 30 mm I.D., particle size: 2.7µm,

Agilent technologies, California, USA) using two mobile phases: 93.5% acetonitrile and 6.5%

water with 0.1% formic acid. Injection volume

of 1µl was taken with a flow rate of 0.3 ml/min and run time of 10 min. The LC–MS system

consisted of a quaternary LC pump version

G1311B and an auto-sampler version G1329B.

Column was oven thermostatted at 38 ˚C when using 93.5% acetonitrile and 6.5% water as a

mobile phase. Diode array detector 3200 (λ=200

nm, range: 0.005, response: 1.0 s) and ion trap LCQ MS system were used which were

controlled by Agilent masshunter version B.06

software. Mass spectra were scanned using

ARS, autonomous replication sequence; EMM, edinburgh minimal media; MeOH, methanol;

DCM, dichloromethane; HPLC, high performance liquid chromatography; LC-MS, liquid chromatography-mass spectrometry; APCI, atmospheric-pressure chemical ionization

5

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

atmospheric-pressure chemical ionization

(APCI) in positive mode. The capillary and

APCI probe were maintained at 350 ˚C. MS experiments were carried out in m/z of 409.3.

MS–MS experiments were carried out in m/z

range between120 and 420 using collision energy of 32%.

Protein purification and in vitro enzyme

assays- Protein expression was induced as described earlier in EMM, cells were harvested

and crushed in liquid nitrogen for the three

WsOSCs independently. Crushed cells were resuspended in 1x PBS (140 mM NaCl, 2.7 mM

KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH

7.3) having 1% protease inhibitor cocktail for

fungal and yeast cells (Sigma, St. Louis, USA), incubated and shaked at 4 ˚C for 2 h. Further,

centrifuged to separate the supernatant from the

pellet. The supernatant was incubated overnight with glutathione-sepharose beads (1 ml/L of

culture) (GE Healthcare, Little Chalfont, UK) at 4

˚C that were previously washed five times with 10 bead volumes of 1x PBS. The beads were pelleted

(600 g at 4 ˚C for 5 min) and washed with 1xPBS

thrice. Protein was eluted using elution buffer (20

mM glutathione in 50 mM Tris Cl pH-8) used for the final wash. The purified protein samples were

denatured and analysed on 10% SDS-PAGE.

Activities of purified WsOSC/BS, WsOSC/LS

and WsOSC/CS were determined in 100 mM

potassium buffer pH 7.0, containing 2,3-oxidosqualene as the substrate, dithiothreitol (1

mM), BSA (1 mg/ml), Triton X-100 (0.05%, w/v)

and purified WsOSC/BS, WsOSC/LS and

WsOSC/CS (2 µg) in independent reactions. For measurement of kinetic parameters varying

concentrations of 2, 3-oxidosqualene (10–250

mM) were used in the reaction mixture. WsOSC/BS, WsOSC/LS and WsOSC/CS reaction

mixtures were incubated at 37˚C for 20, 30 and 35

min respectively. The reaction was quenched by

heating at 100 ˚C for 3 min and further extracted with chloroform. Extracts were subjected to LC

analysis to measure the quantities of β-amyrin,

lupeol and cycloartenol produced. The kinetic constants Km and Vmax, were calculated with non-

linear regression analysis using GraphPad Prism 5

software.

Tissue-specific transcript study - Tissue- specific expression pattern of the WsOSC genes was

determined by quantitative real-time PCR analysis (qRT-PCR). The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used according to the

manufacturer’s instructions to extract total RNA from leaves, roots, berries and stalk. For each

sample, 5 µg of DNase treated RNA was used to synthesize the first strand cDNA by using

RevertAid cDNA synthesis kit according to product manual. Real-time qPCR reactions were

performed in triplicates by means of SYBR Premix Ex Taq (Takara, Dalian, China) in 48-well optical

plates using ABI Step One Real-time qPCR system (Applied Biosystems, Foster City, CA, USA).

SYBR green PCR reaction (20 μL) contained 0.2 μL cDNA template, 200 nM each of the primers

(Table 1), and 10 μL SYBRPremix Ex (Takara, Otsu, Japan) under following cycling conditions:

One cycle of 94 ˚C for 1 min, 40 cycle of 94 ˚C for 10 s, 60 ˚C for 20 s and 72 ˚C for 25 s. Primers

were designed using Primer Express Version 3.0. (Applied Biosystems, CA, USA) and validated by

a dissociation curve (a single peak was observed for each primer pair). Actin was used as

endogenous control using two primers, AtnFor and AtnRev (Table 1). On the basis of comparative Ct

method, gene expression levels of WsOSC/BS, WsOSC/LS and WsOSC/CS were calculated for

each of the tissue and evaluated on a comparison basis (26).

Promoter isolation - Genomic DNA was isolated

from young leaves of W.somnifera using DNeasy Plant mini kit (QIAGEN, Hilden, Germany)

according to manufacturer’s protocol. Isolated

DNA was used for construction of

GenomeWalker DNA libraries following the user manual provided by the manufacturer (Universal

GenomeWalkerTM

Kit, Clontech, Palo Alto, CA,

USA). Four different blunt-end restriction

enzymes (DraI, PvuII, EcoRV and StuI) were used to digest 5 µg genomic DNA separately.

Each set of digested genomic DNA was purified

and ligated to the GenomeWalker AP adaptor (provided with kit) independently. Four

Genome Walker libraries comprising of

qRT- PCR, quantitative real-time PCR analysis

6

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

adaptor-ligated genomic DNA fragments were

used as the template in PCR reactions for DNA

walking which consisted of two walking amplifications. For primary PCR, gene specific

primer PROOSC/BSO, PROOCS/LSO and

PROOSC/CSO (Table 1) along with outer adaptor primer AP1 (provided with kit) were

used with following thermal cycling conditions:

5 cycles at 94 ˚C for 25 s and 70 ˚C for 3 min;

30 cycles at 94 ˚C for 25 s, 65 ˚C for 3 min; and at 67 ˚C for 7 min. Primary PCR products were

diluted 10 times and used in nested PCR along

with nested adaptor primer AP2 and nested gene-specific primer PROOSC/BSI, PROOSC/LSI and

PROOSC/LSI (Table 1). Nested PCR was

performed with conditions as 5 cycles at 94 ˚C for

25 s and 70 ˚C for 3 min; 30 cycles at 94 ˚C for 25 s and 67 ˚C for 3 min, and followed by 67 ˚C

for 7 min. PCR products were analyzed on 1.5%

agarose gel, purified and cloned into pTZ57R/T cloning vector for sequencing. PlantCare,

(http://bioinformatics.psb.ugent.be/webtools/pla

ntcare/html/) and PLACE (http://www.dna.affrc. go.jp/PLACE/) databases were scanned to

identify various putative cis-acting elements in

promoter regions of WsOSCs.

Elicitor treatment and semi-quantitative

expression analyses - In vitro cultures of Ws were adopted to examine the variation in the

accumulation of WsOSC/BS, WsOSC/LS and

WsOSC/CS mRNA on elicitor treatment of plant-derived endogenous elicitors methyl jasmonate

(MeJA) and gibberellic acid (GA3) and microbe-

derived exogenous elicitor yeast extract (YE).

Plantlets were cultured in MS medium

supplemented with 3% sucrose, 1 mgl-1

indole-

3-butyric acid (IBA) and 1 mgl-1

of kinetin and incubated at 25±1 ˚C under 16 h photoperiod

with light intensity of 30 μmol m-2

s-1

provided by cool, white fluorescent tubes of 40 W (Philips, Calcutta, India). Relative humidity

(RH) was maintained at 50-60% (27). After 2wk

of adaptation, a single culture was maintained as

control for GA3 and YE treatments and a

separate control for MeJA treatment with

ethanol. Elicitor treatments of 0.1 mM MeJA, 0.1

mM GA3 and 0.1% w/v YE for 6 h, 12 h, 24 h

and 48 h were given and tissue harvesting was

done at defined time points for RNA, withanolide

and protein extraction. cDNA was prepared using the same cDNA synthesis protocols as described

above. Relative semi- quantitative PCR mixture

for each sample contained 10 mM Tris HCl pH 9.0, 50 mM KCl, 2.5 mM M gC l 2 , 2 0 0 μ M

d NT P , 1 µ M R T primers (Table 1), 0.5 µl of

cDNA template, and 0.5 U of Taq DNA

polymerase (Fermentas, Burlington, Canada). The thermal cycling conditions were as follows:

One cycle 94 ˚C for 1 min, 27 cycles of 94 ˚C for

30 s, 60 ˚C for 20 s and 72 ˚C for 25 with PCR cycles for each OSC being optimized to their

exponential phase. The expression levels of the

three genes were analyzed on 1.5 % agarose

gel with respect to the endogenous control β-actin gene and control cDNA samples with no

elicitor treatment.

Extraction and quantification of withanolides using HPLC

Preparation of sample solutions - Total withanolides were extracted and quantified as

described earlier (28). Briefly, harvested tissue

was powdered and extracted with 50% ethanol

(v/v) with stirring at room temperature (26±2 ˚C). The samples were filtered through 0.45 μm

(Millipore, Bedford, MA) filter and the solvent

was removed under vacuum. The extracts obtained from each sample were prepared in HPLC-grade

methanol–water 50:50 (v/v) for quantitative

analysis. Standards (1.2 mg ml-1

) were prepared in HPLC-grade methanol.

Apparatus and analytical conditions - HPLC

analysis was performed with Shimadzu HPLC

system (Shimadzu, Tokyo, Japan) equipped with 515 quaternary gradient pump, 717 Rheodyne

injector, 2996 PDA detector and CLASS-VP

software v 6.14. Extracts were separated on a RP-18 (4.6×250 mm, 5 μm; Merck, Bangalore,

India) column. The mobile phase consisted of

methanol–water (60:40; v/v) delivered at a flow

rate of 0.7 ml min-1

. The samples were analyzed at

30 ˚C to provide efficiency to the peaks and the

UV chromatograms were recorded at 237 nm.

MeJA, methyl jasmonate; GA3, gibberellic acid; YE, yeast extract; IBA, indole-3-butyric acid; RH,

relative humidity 7

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

Western blotting- For western blot analysis,

harvested tissue of each elicitation was

homogenized in a buffer (5 ml) composed of 10 mM β-mercaptoethanol and 1 mM PMSF, in 50

mM Tris (pH 7.8). Total soluble protein was

separated by centrifugation at 80,000g (29). Polyclonal antibodies for WsOSCs genes were

raised in rabbit against WsOSC/BS

(INNSIHNAVKYLEDVQM), WsOSC/LS

(TEEAVKATLTRGISYYSTVQAH) and WsOSC/CS

(DPLEAKRLYDAVNVLLSLQNSGS) peptides

produced by Merck Millipore Company, Bangalore, India.

Equal amounts of total protein were resolved by

SDS-PAGE gel (8%) at 80V (30). The resolved proteins were transferred to polyvinylidene

difluoride (PVDF) membrane at 120V for 3 h

(31). 5% skimmed milk was used for blocking the membrane for 4 h. The membrane was then

incubated with appropriate dilutions (1:500) of

WsOSC/BS, WsOSC/LS and WsOSC/CS primary antibody in 5% skimmed milk for overnight

period at 4˚C. It was followed by 3 washings with

mixture of tris-buffered saline and tween 20

(TBST) for 5 minutes each. The blot was further treated with secondary antibody (HRP-

conjugated) of 1:10000 dilutions in 5% skimmed

milk for 1 h, followed by 3 washings of 15 minutes each with TBST. The three WsOSC

proteins were detected using chemiluminescence

substrate.

Genomic southern blot analysis - Leaves from

in vitro grown Ws were taken for genomic DNA

extraction. 25 µg of DNA was digested with SpeI (non-cutter), ScaI and EcoRI (single-cutter) for

WsOSC/BS, with SalI (non-cutter), NcoI and

EcoRV (single-cutter) for WsOSC/LS and with XbaI, XhoI (non-cutter), HindIII and DraII (single

cutter) for WsOSC/CS. Digested genomic DNA

was separated by electrophoresis on 0.7% (w/v)

agarose gel, transferred independently onto a positively charged nylon membrane (Roche,

Basel, Switzerland) and hybridized with three

DIG-labelled DNA probes. Probes corresponding to the three ORFs were synthesized by PCR using

full length primers during which each probe was

labelled with digoxigenin (DIG)-dUTP using the

DIG-DNA synthesis Kit (Roche, Manheim,

Germany). The blot was washed, blocked and hybridized probe signals were identified using

DIG labelling and detection kit (Roche, Manheim,

Germany) according to the manufacturer’s protocols.

RESULTS

Isolation of WsOSC/BS, WsOSC/LS and

WsOSC/CS - To isolate full length cDNAs of WsOSC/BS, WsOSC/LS and WsOSC/CS from

WS-3 rich chemo-variant, homology based

approach and 5' and 3' RACE strategy was adopted. Based on highly conserved regions

among reported plant OSCs, degenerate primers

were designed using multiple sequence alignment

principle by ClustalW. Core fragments of 400, 750 and 800 bp were obtained by RT-PCR.

These were identified as OSCs by sequencing

and BLASTn analysis. All three OSC core fragments were further completed in 5' and 3'

directions by RACE. Full-length GSPs were

designed and used to obtain 2.289 kb, 2.268 kb

and 2.277 kb ORFs which were designated as WsOSC/BS, WsOSC/LS and WsOSC/CS. In

addition to the ORFs, the full length cDNAs of

WsOSC/BS, WsOSC/LS and WsOSC/CS comprised of upstream untranslated regions

(UTRs) of 107, 64 and 69 bp along with 3'

UTRs of 178, 187 and 145 bp respectively. BLASTn searches showed extended similarity of

WsOSC ORFs with already reported β-amyrin

synthase, lupeol synthase and cycloartenol

synthase from various other plant species including Solanum lycopersicum (GenBank

Accession Number ACA28830.1), Panax

ginseng (GenBank Accession Number AB014057.1) and Olea europaea (GenBank

Accession Number AB025343.1).

In silico characterization and phylogenetic

analyses - The ORFs of WsOSC/BS, WsOSC/LS and WsOSC/CS corresponded to a protein of 763

(87.5 kDa), 756 (86.56 kDa) and 759 (85.9 kDa)

amino acids with a calculated pI of 6.33, 6.21 and 6.39. The first methionine as per First-AUG

rule was considered as initiator codon. The amino

DIG, digoxigenin; UTR, untranslated region

8

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

acid sequences of the three OSCs showed 73-98

% identity with already reported proteins of the

same kind. WsOSC/BS and WsOSC/CS amino acid sequence revealed approximately the same

identity percentage of 92-93% with β- amyrin

synthase and cycloartenol synthase of Solanum lycopersicum (NP001234604.1,

NP001233784.1). However, WsOSC/LS

demonstrated a much lesser identity of 55-72 %

with its homolog lupeol synthases of S. lycopersicum (XP_004243674.1) and Vitis

vinifera (XP_002269060.1). Presence of OSC

conserved domains were verified using NCBI conserved domain search tool. The three

Withania specific OSC proteins have conserved

domains, SQCY_1 (cd02892) and

“ISOPREN_C2_like” (cd00688) as a superfamily domain which belong to class II

terpene cyclases and includes 2, 3-oxidosqualene

cyclase (OSQCY) (supplemental Fig. S1). SMART sequence analysis revealed the prenyl-

transferase and squalene oxidase repeat (Motif A)

in all the three OSCs. WsOSC/BS and WsOSC/LS proteins have MWCYCR (256–261) and

MLCYCR (255-260) (Motif B) as a conserved

motif respectively while as WsOSC/CS lacked the

same (Fig. 2). The three OSC proteins also possess conserved catalytic aspartic acid (D)

(Motif C) responsible for converting squalene into

a carbocation necessary for initiating ring cyclization by protonating the first C=C bond

(32). PROSITE analysis demonstrated terpene

synthase signature pattern of OSCs in all the three ORFs, as a highly conserved region situated in the

C- terminal, holding a consensus pattern of

[DE]-G-S-W-x- [GE]-x-W-[GA]-[LIVM]-x-

[FY]-x-Y-[GA] (Motif D), rich in aromatic residues (Fig. 2). These f ea tures

substant ia te the ox idos qua lene cyclase

identity of the three WsOSCs.

Three dimensional (3D) protein models were also determined using single highest scoring crystal

structure of human OSC (PDB ID-1w6ka) as a

template with the help of Phyre2 tool. The three structures evened scrupulously with the template.

Homology modelling was performed with 100%

confidence, with a coverage score of 93% for both

WsOSC/CS and WsOSC/LS and 91% for

WsOSC/BS wherein 705, 703 and 696 residues

were modelled (Fig. 3A, B and C). 3DLigandSite

tool predicted a 6 amino acid ligand binding site in WsOSC/CS and WsOSC/LS and a 5 amino acid

binding site in WsOSC/BS comprising of H677,

V678, V679, N680, W683 and S724, L677, V678, Q679, W682 and T723 and L679, V680, Q681,

W684 and T725 respectively (Fig. 3 D, E and F).

Pairwise alignment of WsOSC/BS, WsOSC/LS and

WsOSC/CS demonstrated moderate diversity. WsOSC/BS and WsOSC/LS are 57.4% identical at

amino acid level and 63.9% identical at nucleotide

level. While as WsOSC/CS is 54.75% and 57.0 % identical at amino acid level and 63.3% and 61.9%

at nucleotide level with WsOSC/LS and

WsOSC/BS.

To elucidate the phylogenetic relationship of

the deduced amino acid sequences of the three

OSC proteins with other known members of the OSC superfamily (GenBank), a phylogenetic

analysis was performed with MEGA 5 software

based on Neighbour joining method. Each of the WsOSC grouped in accord with the amino acid

correspondence, constituting three separate

phylogenetic clusters; OSC1- Cycloartenol

synthase, OSC2- Lupeol synthase and OSC3- β- amyrin synthase. WsOSC/CS clustered within the

authentic cycloartenol synthase subgroup, while

WsOSC/BS and WsOSC/LS aligned with the group of β-amyrin and lupeol synthase

independently (Fig. 4).

Functional validation of WsOSCs - WsOSC/BS, WsOSC/LS and WsOSC/CS were

functionally validated by expressing the three

ORFs in S. pombe expression vector pDS472a.

pDS472aB, pDS472aL and pDS472aC recombinant plasmids were electroporated in S.

pombe and induced using EMM. Induced cells

were further used for extract preparation by DCM method and analysed by LC-MS. As shown in

Fig. 5, pDS472aB, pDS472aL and pDS472aC

extracts contained single triterpenoid compounds that were not detected in the control S. pombe

transformed with empty vector (pDS472a) (Fig.

5A, B, C and D). Retention times of WsOSC

extracts and β-amyrin, lupeol and cycloartenol standards obtained from sigma (Sigma, St. Louis,

9

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

USA) were coincident. For further validation MS

and MS-MS was performed. These two patterns

for pDS472aB, pDS472aL and pDS472aC were similar to that of their respective standards (Fig.

5E-P).

Purification of protein and kinetic studies-

Induced culture of S. pombe was also used for

purifying the three WsOSC proteins. The OSCs

expressed as GST-tag fusion protein in S. pombe which enabled complete purification based on the

principle of affinity chromatography using the

glutathione sepharose beads. The purified fusion protein bands of WsOSC/BS, WsOSC/LS and

WsOSC/CS were observed at around 113 kDa on

SDS-PAGE which coincided with the calculated

molecular mass of the three proteins in addition to the 26 kDa GST tag (Figure 6).

The purified proteins were used for investigating the kinetic properties of WsOSCs. Purified

WsOSC/BS, WsOSC/LS and WsOSC/CS used 2,

3-oxidosqualene as substrate in independent reactions. The enzyme was kept constant whereas

the concentration of the substrate was taken in

increasing order. As the substrate concentration

was increased, the amount of β-amyrin, lupeol and cycloartenol produced also increased. Vmax of each

purified protein was also calculated as shown in

Table 2.This was explained by Michaelis- Menten plots (Figure 7). The apparent Km value for

WsOSC/BS, WsOSC/LS and WsOSC/CS was

38.48, 100.4 and 99.51 µM respectively. This showed WsOSC/BS has higher affinity towards 2,

3-oxidosqualene followed by WsOSC/CS and

WsOSC/LS wherein WsOSC/CS and WsOSC/LS

demonstrated almost the same affinity. Among the three OSCs, WsOSC/BS was observed to possess

a higher specific activity of 2.9 µM/min/ml as

compared to 2 µM/min/ml and 1.43 µM/min/ml of WsOSC/LS and WsOSC/CS correspondingly.

Tissue-specific transcript profile - WsOSC/BS,

WsOSC/LS and WsOSC/CS gene expression

pattern in different tissues of Ws was analysed by qPCR. Total RNA extracted from leaves,

roots, stalk and berries was used for cDNA

synthesis, which was further employed as template in quantitative real-time PCR analysis.

WsOSC/LS displayed relatively higher transcript

accumulation in roots followed by berries, stalk

and minimum in leaves (Fig. 8A). WsOSC/BS expressed highly in both roots and berries

followed by stalk and leaves (Fig. 8B). These

results are in consonance with the earlier studies in Glycyrrhiza glabra. Both lupeol synthase and

β-amyrin synthase along with their triterpenoid

products comprising of betulinic acid and

glycyrrhizin have been reported to be abundant in root and root nodules of G. glabra (33).

Conversely WsOSC/CS was found to be

transcribing most in leaves followed by nearly equal transcript abundance in stalk and berries

and minimum in roots (Fig. 8C). This expression

pattern of WsOSC/CS is coincident with the

higher concentrations of withanolides reported earlier in the leaves of Ws (8).

Isolation and in silico characterization of promoters - To elucidate the transcriptional

regulation of the three WsOSCs via their

respective promoters, upstream region of each gene was isolated and scanned for various

putative cis-regulatory elements using in silico

tools. Using genome walking strategy, we isolated 900 bp, 922 bp and 475 bp promoter

regions of WsOSC/BS, WsOSC/LS and

WsOSC/CS genes respectively. The

transcription initiation site (TIS) was determined by 5' RACE analysis and is

located at 107 bp, 64 bp and 69 bp upstream

of the ATG start codon in WsOSC/BS, WsOSC/LS and WsOSC/CS (Supplemental

Fig. 2A, B and C). PLACE and PlantCare

databases were used for the in silico analysis of the isolated promoters. Putative TATA box

of WsOSC/BS, WsOSC/LS and WsOSC/CS is

located 32 bp, 39 bp and 47 bp upstream of the

TIS in promoters respectively. Several important cis-acting elements for gene

regulation were identified within the promoter

regions of WsOSCs. These included light- responsive, hormone-responsive, and various

other stress related elements (supplemental

Table 1). Among these, three regulatory

elements were selected to investigate their mediation in elicitor responsiveness with an

aim to study the inducible/repressible nature of

TIS, transcription initiation site 10

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

the promoters. These included 1) bZIP protein-

binding motifs TGACG/CGTCA present in

all the three promoters responsible for MeJA responsiveness, 2) GARE-motif (TCTGTTG)

involved in GA3 responsiveness, found in

WsOSC/BS and WsOSC/LS promoters, 3)

Box- W1, a fungal elicitor responsive element with a consensus sequence of TTGACC

identified in promoters of WsOSC/BS and

WsOSC/LS.

Elicitor treatment - Information regarding the

regulation of withanolide biosynthesis

encompassing the various signal transduction

pathways and transcription factors involved is unavailable. The recent advances in the

understanding of plant signalling pathways has

paved the way for using elicitor-induced plant metabolite variation as a prognostic tool for

prospective pathway engineering and regulation

based studies (34). In this context, three common

elicitors selected on the basis of promoter analysis were evaluated with regard to withanolide

production and WsOSCs gene and protein

expression levels. In vitro liquid cultures established in MS liquid medium were grown for

an adaptation period of 2 wk and used for

endogenous plant-derived elicitor treatments of MeJA (0.1mM) and GA3 (0.1mM) and for

exogenous microbe-derived YE (0.1%w/v)

treatments. Liquid cultures were opted because

exogenous supplements of elicitors give better response than the static cultures. Samples were

harvested in duplicates after 6, 12, 24 and 48 h

of interval and used for RNA and protein

isolation and HPLC extract preparation. Equal amounts of DNase-treated RNA (1 µg) of each

treated sample and control were employed for

cDNA synthesis. The effect of each treatment on expression profile of WsOSC/BS, WsOSC/LS and

WsOSC/CS was studied using semi- quantitative

PCR. Further, to assess the correspondence

between expression of WsOSCs protein and mRNA, isolated protein at each time point of the

three elicitations was employed for western blot

investigation. Incongruity between the two was correlated with the withanolide flux determined

by HPLC analysis.

Effect of methyl jasmonate - Jasmonic acid (JA)

and its associated compounds together with MeJA

have long been reported to be transducers of elicitor signals for the biosynthesis of plant

secondary metabolites. In Ws, treatment with

MeJA resulted in up-regulation of WsOSC/BS while the expression of WsOSC/LS was down-

regulated, both of which were discernible after

24 h of treatment. However, WsOSC/CS

transcript level remained relatively constant in- spite of having the MeJA responsive motif in its

promoter (Fig. 9A and B). These observations were

in agreement with earlier reports on G.glabra where addition of 10–100 μM of MeJA led to

accumulation of β-amyrin synthase and showed no

appreciable variation in cycloartenol synthase

mRNA levels (35). At protein level, WsOSC/CS and WsOSC/LS expression was concurrent with

its mRNA profile in showing no change and a

gradual decrease correspondingly. Whereas WsOSC/BS displayed no variation at protein level

which is not in agreement with its transcription

profile that showed an increase (Fig. 10A). HPLC analysis revealed a significant increase in WS-3

(396.37±0.44−2629.397±0.41 µg g-1

of dry

weight) while as WS-2 accumulated meagrely

(13.818±0.14 µg g-1

of dry weight) after 48 h of

MeJA treatment (Fig. 11A, supplemental Fig. 4A

and B). JA signalling pathway is usually regarded as a fundamental signal for biosynthesis of many

plant secondary products including terpenoids,

flavonoids, alkaloids, and phenylpropanoids. Studies in ginseng cells (36) and Bupleurum

falcatum root fragments (37) have also shown

MeJA to be an inducer of saponin and

saikosaponins respectively. Various such studies prove that MeJA is a potential candidate for

elicitation process leading to transcriptional

alteration of many genes and subsequently affect the de novo synthesis of secondary metabolites in

plants (34).

Effect of gibberellic acid - Effect of GA3 as

signal phytohormone in regulating OSCs mRNA

levels and withanolide biosynthesis was

examined. GA3 treatment induced the mRNA

level of WsOSC/BS and down-regulated WsOSC/LS which was in conformity with the

11

JA, jasmonic acid

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

effect of MeJA described above (Fig. 9A and

B). WsOSC/CS expression level remained

unchanged at transcriptional stage as with MeJA treated plantlets. Conversely, WsOSC/LS protein

expression remained constant and WsOSC/CS

protein showed a decrease. WsOSC/BS protein demonstrated similar trend corresponding with

mRNA level with an overall decreasing

expression with advancing time intervals (Fig.

10B). This pattern is in agreement with the mRNA expression profile shown by the three

OSCs in GA3 treated licorice cells (29).

Estimation of withanolide accumulation

demonstrated a gradual decline in WS-3

(404.54±23.4−218.49±2.13 µg g-1

of dry weight)

while as WS-1 increased moderately with each

time-course (56.90±2.2−137.26±2 µg g-1

of dry weight). WS-2 showed an interesting pattern in

its accumulation as it peaked by 12 h

(58.71±2.5−20.67±1.6 µg g-1

of dry weight) followed by a decrease after 24 h and un-

detectable concentration after 48 h (Fig. 11B,

supplemental Fig. 5A, B). It has also been earlier shown that application of exogenously applied

phytohormones influence the physiological and

metabolic processes in many plant organ and cell cultures. Previous reports have demonstrated

changes in metabolism and accumulation of

anthocyanins, flavonoids etc. on application of GA3 (39, 40).

Effect of fungal elicitor - Elicitors of fungal origin have been employed in a number of studies

with an aim to induce secondary metabolite(s)

concentration. For instance, benzophenanthridine alkaloid production increased in Eschscholzia

californica when treated with YE (41). Likewise,

effect of fungal elicitation on withanolide production was examined in liquid cultures of Ws

treated with YE. In comparison to the plant-

derived elicitations, YE demonstrated a role of

negative regulator by down-regulating both the mRNA and protein levels of WsOSC/BS and

WsOSC/LS (Fig. 9A and B). Whereas, WsOSC/CS

displayed complete conformity in its expression profile with that of the plant-derived elicitations

by showing no difference in its transcript

abundance over a period of 48 h. There was also

no discernible change observed in WsOSC/CS

protein accumulation (Fig. 10C). This observation

complemented the in silico analysis of WsOSC/CS promoter that identified absence of fungal elicitor

responsive element (Box-W1). HPLC analysis

showed marked increase in the content of WS-3 (742.87±3.0−4971.24±13.4 µg g-1 of dry weight)

and WS-1 (150.57±3.7−849.63±2.5 µg g-1

of dry

weight) in comparison to control (WS-3 423.3±2.3; WS-1 35.39±2.2). YE treatment had

more pronounced effect than MeJA (Fig. 11C,

supplemental Fig. 6A and B).

Genomic southern analyses - To determine the

copy number of three OSC genes in the Ws

genome, we performed genomic southern analyses

using DIG-labelled full length probes for WsOSC/BS, WsOSC/LS and WsOSC/CS.

Genomic DNA was digested using non-cutter and

single-cutter restriction enzymes, subjected to electrophoresis and transferred to a positively

charged membrane for hybridization with probes.

For WsOSC/BS and WsOSC/LS, single bands were scored for DNA digested with SpeI and SalI

enzymes and two bands with ScaI and EcoRI and

NcoI and EcoRV respectively (Fig. 12 A and B).

The results obtained suggest that Withania genome possibly contains a single allele for both

WsOSC/BS and WsOSC/LS. In WsOSC/CS, two

bands were detected in XbaI and XhoI digested DNA and more than two were detected with

HindIII and DraII digestion (Fig. 12 C). The

southern blot results suggest that an additional

gene copy of WsOSC/CS may exist in the Ws genome.

DISCUSSION

Principally, the high value secondary

metabolites produced by plants are in scarce

amounts whose biosynthetic machineries are inadequately understood in entirety. One such

potential group of molecules biosynthesized by

Ws is withanolides. These are pharmacologically

active lead molecules against various ailments and diseases. Detailed understandings of both

biosynthetic and regulatory gears provide

potential means to improve the specificity and effectiveness of genetic modifications and such

12

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

metabolic engineering efforts augment well for

the manipulation of metabolic flux towards

efficient biosynthesis of desired secondary metabolites. With this viewpoint, we have

successfully cloned and characterized three

members of OSC super-family belonging to both protosteryl and dammarenyl cation group from

Ws. Co-occurrence of OSCs from both these

groups for structuring different triterpenoid

skeletons is often found in many plants such as G. glabra, Kalanchoe daigremontiana,

Arabidopsis thaliana etc (33, 42, 43). Being

juxtapositioned at a critical metabolic branch point, WsOSCs lead to the production of sterols,

withanolides and an array of triterpenoids. It is

obvious that OSCs represent a vital cog of a

decisive branching point between primary and secondary metabolites. The three OSCs in

Withania utilize the common substrate pool of 2,

3 oxidosqualene and lead to the formation of different triterpenoids serving both primary and

secondary functions for the plant.

WsOSC/BS, WsOSC/LS and WsOSC/CS

showed moderate similarity at nucleotide and amino acid levels with each other. This similarity

encompasses various conserved domains which

were detected in all the three OSCs and play an essential role for the protein to carry out the

cationic cyclization of linear triterpenes into

fused ring compounds. Whereas, one of the

conserved motif (Motif B) was detected exclusively in WsOSC/BS and WsOSC/LS.

Interestingly, on the basis of site directed

mutagenesis, tryptophan and leucine positioned at the second place in these motifs have been

proved to be characteristic for functional β-

amyrin and lupeol synthases (44). Though a point mutation can radically mutate such

specificities, but in many situations numerous

other sequence alterations may counterbalance

each other without modifying the enzyme specificity (45).This implicates the significance

of both diversity and similarity for definite

functioning of each OSC.

Phylogenetic clustering also grouped

WsOSC/BS, WsOSC/LS and WsOSC/CS in three

separate sub-groups comprising of β-amyrin,

lupeol and cycloartenol synthases respectively.

Several factors are supposed to drive this

expansion and diversification of OSC family. Recruitment of mutated/duplicated genes for new

functions (neo-functionalization) involves one

key mechanism for this pathway evolution and extension. And such post-speciation expansion

indicates the members to have evolved mostly

for utility other than the primary metabolism.

This is significantly evident in various OSC sub- families wherein the ones that use the

dammarenyl cation intermediate show

comparatively more lineage specific diversity (1, 46). In contrast, cycloartenol synthase subfamily

performing core housekeeping functions have

undergone minimum post speciation expansion.

Evolutionarily, it accounts for the existence of multiple OSCs and numerous skeletal types of

triterpenes found in a single plant (45).

Previous studies have revealed many members of OSC gene family exhibiting multifunctional

properties wherein a single OSC contributes more

than one functional triterpene rather than being a single product specific enzyme. For instance,

Costus speciosus CsOSC2 is a multiproduct

synthase producing lupeol, germanicol, and β-amyrin (47). Likewise, orthologous mixed-

amyrin synthases have been characterized from

the legumes Lotus japonicas and Pisum sativum

(48, 49). Thus, sequence homology is far from being a definitive argument to illustrate the

defined enzymatic activity of different OSCs.

Functional validation of the three WsOSCs in S. pombe revealed their mono-functionality. LC-MS

profile of each WsOSC extract was essentially

identical to its respective authentic standard showing a single product whose retention time

was coincident with that of the standard. MS and

fragmentation patterns of WsOSCs products and

their respective standards further authenticated their mono-functionality. The combined results

clearly demonstrate that WsOSC/BS, WsOSC/LS

and WsOSC/CS encode mono-specific proteins committed for biosynthesis of defined single

product and thus being a favourable attribute for

future pathway engineering endeavours.

The spatial expression pattern revealing high

13

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

levels of WsOSC/CS gene expression in leaves

complement earlier reports demonstrating leaves

to be the richest source of withanolides in Ws (3). Restriction of secondary metabolite

biosynthesis to particular tissue(s) in plants is

mostly executed by regulating the expression levels of biosynthetic pathway genes. In

accordance with this fact, our previous studies

have shown elevated expression profile of three

upstream genes namely squalene synthase (WsSQS), squalene epoxidase (WsSQE) and

cytochrome P450 reductase 2 (WsCPR2) of

withanolide biosynthetic pathway in leaves as compared to other tissues (17, 50, 8).

Additionally, enhanced expression of

obtusifoliol-14-demthylase (CYP51) and sterol

methyl transferase (SMT-1) that constitute important part of downstream withanolide

biosynthetic pathway has also been reported in

leaves of Ws (51). Hence, the higher expression of putative biosynthetic genes in leaves indicate

these as conceivable candidates for future studies

for enhancing withanolide production by genetic manipulations.

Copy number validation of WsOSC/BS, WsOSC/LS and WsOSC/CS was done using

southern blot analysis. Both WsOSC/BS and

WsOSC/LS exist as single copy number genes

whereas WsOSC/CS may have more than one copy in Ws genome. In view of the fact that

cycloartenol synthase participates in both sterol

and withanolide biosynthesis, we wanted to know that how cycloartenol synthase confronts

the high metabolic demand in terms of gene copy

number. The results suggest that possibly dual copies of WsOSC/CS might be involved in

carrying primary and secondary functions

separately in Ws. However, it needs further

validation.

To get an insight into the regulatory

mechanism of the three OSCs, promoter regions of WsOSCs were isolated and presence of

various cis-acting elements were confirmed

using in silico tools. Cis-acting regulatory elements and their corresponding transcription

factors constitute one of the transcriptional

regulatory mechanisms induced by different

environmental and extracellular conditions to

help the plants in adaptive strategies (52).

Therefore, presence of numerous putative cis-

regulatory motifs in the three OSC promoters suggests control over their transcriptional activity

being mediated in response to various signals.

Elicitations mediated by MeJA, GA3 and YE altered OSC transcript profiles and demonstrated

change in withanolide content.

The regulation of cellular processes takes place

at different levels including transcription, RNA processing, translation and post-translational

modification. Nevertheless, numerous studies

have revealed transcriptional modulation of genes as a frequent response to elicitor signals (34).

Generally, mRNA concentrations are broadly

employed as a surrogate for protein expression.

However, various studies evaluating mRNA and protein expression on a global scale, point towards

their partial correspondence (53). Approximately,

it has been assessed that only 20%–40% of protein expression is determined by their analogous

mRNA concentrations (54, 55). Consequently,

examination of translational differences along with mRNA measurements is imperative for a better

interpretation of obtained results (56).

In present study the three elicitors acted as

both positive and negative regulators for the three

OSCs. Differential transcript and translational profiles were clearly reflected in relation to

elicitor treatments with discernible changes in

withanolide concentrations. MeJA elicitation significantly increased the WS-3 accumulation

over a period of 48 h. These results are in

conformity with our earlier studies where MeJA

mediated induction of WsSQS, WsSQE and WsCPR2 mRNA also led to enhanced

withanolide accumulation. It may be attributed to

increased synthesis of 2, 3–oxidosqualene produced by induced upstream genes. As a

consequence, WsOSC/CS is able to utilize an

increased precursor pool for withanolide

biosynthesis. Although the OSC mRNA expression model in case of GA3 coincided with

MeJA treatment, the total withanolide

accumulation demonstrated a regular drop with

increasing time-course. This may be attributed mainly to the decrease in WsOSC/CS protein

14

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

concentration as evident from the western blot

study. Nevertheless, transcript abundance of

WsOSC/BS showed a rise which hinted towards the decrease in the total substrate availability for

WsOSC/CS but at protein level WsOSC/BS

expression declined with increasing time intervals. Thus possibly substantiating the drop

in WS-3 concentration due to decreased

WsOSC/CS protein availability.

Interestingly, microbe-derived exogenous YE

elicitor played a role of negative regulator for the

two competitive OSCs of WsOSC/CS

(WsOSC/BS and WsOSC/LS) at both protein and mRNA level. While as WsOSC/CS showed no

change in its transcript or protein expression in

response to YE. However, there was significant

increase in withanolide concentration with YE in comparison to MeJA treatment. The down

regulation of WsOSC/BS and WsOSC/LS is

possibly indicative of differential channelling of common substrate among the three branch OSCs.

Plausibly, this leads to rearrangement of

metabolic fluxes wherein bulk of 2, 3- oxidosqualene substrate pool shifts towards

WsOSC/CS leading to much improved

withanolide yields.

In continuum to our previous studies covering characterization of withanolide biosynthetic

genes, the present investigation has validated

OSCs covering three branches of an important

metabolic junction. Further, for homologous

intensification of withanolides, these results in

totality could be useful to reveal various underlying signal transduction pathways as

indicated by elicitations in corroboration with

cis-regulatory motifs. Specific transcription factors along with the biosynthetic genes can

become prospective targets for pathway

engineering. Plausibly, the characterization and

validation of WsOSCs seems important for strategising the enhanced production of

withanolides.

Acknowledgements - This work was supported by

a grant from the Council of Scientific and Industrial Research (CSIR), Government of

India, New Delhi under Network Project BSC-

0108. N.D., S. Rana, S. Razdan, A. Hussain and

W.W.B. are highly thankful to CSIR, Government of India, New Delhi for Senior Research

Fellowship (CSIR-SRF). The authors are grateful

to Prof. Asis Datta (National Institute of Plant Genome Research, New Delhi, India) for

providing Schizosaccharomyces pombe and

pDS472a. We are also thankful to. R.K. Khajuria

and A.P. Gupta (Indian Institute of Integrative medicine Jammu, India) for facilitating LC-MS

analyses. This manuscript represents institutional

communication number IIIM/1568/2013.

REFERENCE

1. Phillips, D. R., Rasbery, J. M., Bartel, B., and Matsuda, S. P. T. (2006) Biosynthetic diversity

in plant triterpene cyclization. Curr Opin Plant Biol. 9, 305-314

2. Mahato, S. B., Nandy, A. K., and Roy, G. (1992) Triterpenoids. Phytochemistry. 31, 2199-

2249

3. Lattoo, S.K., Dhar, R.S., Khan, S., Bamotra, S., and Dhar, A.K. (2007) Temporal sexual maturation and incremental stamina movement encourages mixed mating in Withania

somnifera-an insurance for reproductive success. Curr. Sci. 92, 1390-1399

4. Elsakka, M., Grigorescu, E., Stanescu, U., and Dorneanu, V. (1990) New data referring to chemistry of Withania somnifera species. Rev Med Chir Soc Med Nat Iasi. 94, 385-7

5. Hahm, E. R., Moura, M. B., Kelley, E. E., Van Houten, B., Shiva, S., and Singh, S. V.

(2011)Withaferin A-induced apoptosis in human breast cancer cells is mediated by reactive oxygen species. Plos One 6(8), e23354

6. Kaileh, M., Vanden Berghe, W., Heyerick, A., Horion, J., Piette, J., Libert, C., De Keukeleire,

D., Essawi, T., and Haegeman, G. (2007) Withaferin A strongly elicits I kappa B kinase beta

15

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

hyperphosphorylation concomitant with potent inhibition of its kinase activity. J. Biol Chem.

282, 4253-4264

7. Koduru, S., Kumar, R., Srinivasan, S., Evers, M. B., and Damodaran, C. (2010) Notch-1 inhibition by Withaferin-A: A therapeutic target against colon carcinogenesis. Mol

Cancer Ther 9, 202-210

8. Rana, S., Lattoo, S. K., Dhar, N., Razdan, S., Bhat, W. W., Dhar, R. S., and Vishwakarma, R.

(2013) NADPH-Cytochrome P450 Reductase: Molecular cloning and functional characterization of two paralogs from Withania somnifera (L.) Dunal. PLoS ONE. 8(2), e57068

9. Mirjalili, M. H., Moyano, E., Bonfill, M., Cusido, R. M., and Palazon, J. (2009) Steroidal lactones from Withania somnifera, an ancient plant for novel medicine. Molecules. 14, 2373-

2393

10. Xu, R., Fazio, G. C., and Matsuda, S. P. T. (2004) On the origins of triterpenoid skeletal

diversity. Phytochemistry. 65, 261-291 11. Abe, I., Rohmer, M., and Prestwich, G. D. (1993) Enzymatic cyclization of squalene

andoxidosqualene to sterols and triterpenes. Chem Rev. 93, 2189-2206

12. Jacobs, D.I., Heijden, R.V.D., and Verpoorte, R. (2000) Proteomics in plant biotechnology

and secondary metabolism research. Phytochem. Anal. 11, 277-287 13. Stephanopoulos, G. (1999) Metabolic fluxes and metabolic engineering. Metab Eng. 1, 1-11

14. Radman, R., Saez, T., Bucke, C., and Keshavarz, T. (2003) Elicitation of plants and microbial cell systems. Biotechnol Appl Bioc. 37, 91-102

15. Liu, L. S., White, M. J., and MacRae, T. H. (1999) Transcription factors and their genes in higher plants - Functional domains, evolution and regulation. Eur J Biochem. 262, 247-257

16. Fu, N., Drinnenberg, I., Kelso, J., Wu, J.R., Pa¨a¨bo, S., Zeng, R., and Khaitovich, P. (2007)

Comparison of protein and mRNA expression evolution in humans and chimpanzees. PLoS ONE 2(2), e216

17. Bhat, W. W., Lattoo, S. K., Razda, S., Dhar, N., Rana, S., Dhar, R. S., Khan, S., and

Vishwakarma, R. A. (2012) Molecular cloning, bacterial expression and promoter analysis of

squalene synthase from Withania somnifera (L.) Dunal. Gene. 499, 25-36 18. Zuckerkandl, E., and Pauling, L. (1965) Evolutionary divergence and convergence in proteins.

Evolving Genes and Proteins 97-166

19. Sigrist, C. J. A., de Castro, E., Cerutti, L., Cuche, B. A., Hulo, N., Bridge, A., Bougueleret,

L., and Xenarios, I. (2013) New and continuing developments at PROSITE. Nucleic Acids Res. 41, E344-E347

20. Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998) SMART, a simple modular architecture research tool: Identification of signaling domains. P Natl Acad Sci USA. 95,

5857-5864

21. Letunic, I., Doerks, T., and Bork, P. (2012) SMART 7: recent updates to the protein domain

annotation resource. Nucleic Acids Res. 40, D302-5 22. Wass, M. N., Kelley, L. A., and Sternberg, M. J. E. (2010) 3DLigandSite: predicting ligand-

binding sites using similar structures. Nucleic Acids Res. 38, W469-W473

23. Forsburg, S. L., and Sherman, D. A. (1997) General purpose tagging vectors for fission yeast.

Gene. 191, 191-5

24. Prentice, H. L. (1992) High-Efficiency Transformation of Schizosaccharomyces pombe by

electroporation. Nucleic Acids Res. 20, 621-621

25. McCloud, T. G. (2010) High throughput extraction of plant, marine and fungal specimens for preservation of biologically active molecules. Molecules. 15, 4526-4563

26. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using

real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 25, 402-408

27. Rana, S., Dhar, N., Bhat, W.W., Razdan, S., Khan, S., Dhar, R.S., Dutt, P., and Lattoo, S.K.

16

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

(2012) A 12- deoxywithastramonolide-rich somaclonal variant in Withania somnifera (L.)

Dunal–molecular cytogenetic analysis and significance as a chemotypic resource. In Vitro

Cell. Dev. Biol.-Plant 48, 546-554 28. Dhar, R. S., Verma, V., Suri, K. A., Sangwan, R. S., Satti, N. K., Kumar, A., Tuli, R., and

Qazi, G. N. (2006) Phytochemical and genetic analysis in selected chemotypes of Withania

somnifera. Phytochemistry. 67, 2269-2276

29. Kavi Kishor, P.B., Hong, Z., Miao, C.H., Hu, C.A.A., and Verma, D.P.S. (1995) Overexpression

of A1-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiol. 108, 1387-1 394

30. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature 227, 680–685

31. Towbin, H., Staehelin, T., and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad.

Sci. U. S. A. 76, 4350–4354 32. Marchler-Bauer, A., Zheng, C. J., Chitsaz, F., Derbyshire, M. K., Geer, L. Y., Geer, R. C.,

Gonzales, N. R., Gwadz, M., Hurwitz, D. I., Lanczycki, C. J., Lu, F., Lu, S. N., Marchler, G.

H., Song, J. S., Thanki, N., Yamashita, R. A., Zhang, D. C., and Bryant, S. H. (2013) CDD: conserved domains and protein three-dimensional structure. Nucleic Acids Res. 41, D348-

D352

33. Hayashi, H., Huang, P., Takada, S., Obinata, M., Inoue, K., Shibuya, M., and Ebizuka, Y. (2004) Differential expression of three oxidosqualene cyclase mRNAs in Glycyrrhiza glabra.

Biol Pharm Bull. 27, 1086-92

34. Zhao, J., Davis, L. C., and Verpoorte, R. (2005) Elicitor signal transduction leading to

production of plant secondary metabolites. Biotechnol Adv. 23, 283-333

35. Hayashi, H., Huang, P., and Inoue, K. (2003) Up-regulation of soyasaponin biosynthesis by

methyl jasmonate in cultured cells of Glycyrrhiza glabra. Plant Cell Physiol. 44, 404-11 36. Lu, M. B., Wong, H. L., and Teng, W. L. (2001) Effects of elicitation on the production of

saponin in cell culture of Panax ginseng. Plant Cell Rep. 20, 674-677

37. Aoyagi, H., Kobayashi, Y., Yamada, K., Yokoyama, M., Kusakari, K., and Tanaka, H. (2001) Efficient production of saikosaponins in Bupleurum falcatum root fragments combined with

signal transducers. Appl Microbiol Biot. 57, 482-8

38. Cheong, J. J., and Choi, Y. D. (2003) Methyl jasmonate as a vital substance in plants. Trends Genet. 19, 409-413

39. Bais, H. P., Sudha, G., George, J., and Ravishankar, G. A. (2001) Influence of exogenous hormones on growth and secondary metabolite production in hairy root cultures of Cichorium

intybus L. cv. Lucknow Local. In Vitro Cell Dev-Pl. 37, 293-299

40. Sharaf-Eldin, M. A., Schnitzler, W. H., Nitz, G., Razin, A. M., and El-Oksh, I. I. (2007) The effect of gibberellic acid (GA(3)) on some phenolic substances in globe artichoke (Cynara

cardunculus var. scolymus (L.) Fiori). Sci Hortic-Amsterdam. 111, 326-329

41. Byun, S.Y. (1989). Studies on elicitation and in situ recovery of alkaloids in suspension

cultures of Californica poppy. Rutgers University

42. Wang, Z. H., Yeats, T., Han, H., and Jetter, R. (2010) Cloning and characterization of

oxidosqualene cyclases from Kalanchoe daigremontiana enzymes catalyzing up to 10

rearrangement steps yielding friedelin and other triterpenoids. J Biol Chem. 285, 29703-

29712

43. Husselstein-Muller, T., Schaller, H., and Benveniste, P. (2001) Molecular cloning and expression in yeast of 2, 3-oxidosqualene-triterpenoid cyclases from Arabidopsis thaliana.

Plant Mol Biol. 45, 75-92 44. Kushiro, T., Shibuya, M., Masuda, K., and Ebizuka, Y. (2000) Mutational studies on triterpene

17

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

syntheses: engineering lupeol synthase into β-amyrin synthase. J. Am. Chem. Soc. 122, 6816-

6824

45. Brendolise, C., Yauk, Y. K., Eberhard, E. D., Wang, M., Chagne, D., Andre, C., Greenwood,

D. R., and Beuning, L. L. (2011) An unusual plant triterpene synthase with predominant alpha-amyrin-producing activity identified by characterizing oxidosqualene cyclases from

Malus x domestica. FEBS. J. 278, 2485-2499

46. Shiu, S. H., Karlowski, W. M., Pan, R. S., Tzeng, Y. H., Mayer, K. F. X., and Li, W. H. (2004) Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant

Cell. 16, 1220-1234 47. Kawano, N., Ichinose, K., and Ebizuka, Y. (2002) Molecular cloning and functional

expression of cDNAs encoding oxidosqualene cyclases from Costus speciosus. Biol Pharm

Bull. 25, 477-82

48. Iturbe-Ormaetxe, I., Haralampidis, K., Papadopoulou, K., and Osbourn, A. E. (2003) Molecular cloning and characterization of triterpene synthases from Medicago truncatula and

Lotus japonicus. Plant Mol Biol. 51, 731-43 49. Morita, M., Shibuya, M., Kushiro, T., Masuda, K., and Ebizuka, Y. (2000) Molecular cloning

and functional expression of triterpene synthases from pea (Pisum sativum) new alpha- amyrin-

producing enzyme is a multifunctional triterpene synthase. FEBS. 267, 3453-60

50. Razdan, S., Bhat, W. W., Rana, S., Dhar, N., Lattoo, S. K., Dhar, R. S., and Vishwakarma, R. A. (2013) Molecular characterization and promoter analysis of squalene epoxidase gene from

Withania somnifera (L.) Dunal. Mol Biol Rep. 40, 905-916

51. Pal, S., Singh, S., Shukla, A. K., Gupta, M. M., Khanuja, S. P. S., and Shasany, A. K. (2011)

Comparative withanolide profiles, gene isolation, and differential gene expression in the leaves and roots of Withania somnifera. J Hortic Sci Biotech. 86, 391-397

52. Walther, D., Brunnemann, R., and Selbig, J. (2007) The regulatory code for transcriptional

response diversity and its relation to genome structural properties in A. thaliana. PLoS Genet. 3(2), e11

53. Brockmann, R., Beyer, A., Heinisch, J.J., and Wilhelm, T. (2007) Posttranscriptional expression

regulation: what determines translation rates?. PLoS Comput Biol, 3(3), e57

54. Tian, Q., Stepaniants, S.B., Mao, M., Weng, L., Feetham, M.C., Doyle, M.J., Yi, E.C., Dai, H., Thorsson, V., Eng, J., Goodlett, D., Berger, J.P., Gunter, B., Linseley, P.S., Stoughton, R.B.,

Aebersold, R., Collins, S.J., Hanlon, W.A., and Hood, L.E. (2004) Integrated genomic and

proteomic analyses of gene expression in mammalian cells. Mol Cell Prot 3, 960–969. 55. Nie, L., Wu, G., Zhang, W. (2006) Correlation between mRNA and protein abundance in

Desulfovibrio vulgaris: A multiple regression to identify of variations. Biochem Biophys Res

Commun 339, 603–610 56. Kolkman, A., Daran-Lapujade, P., Fullaondo, A., Olsthoorn, M.M.A., Pronk, J.T, Slijper, M., and

Heck, A.J. (2006) Proteome analysis of yeast response to various nutrient limitations. Mol Syst

Biol doi: 10.1038/msb4100069

18

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

Figure legends

FIGURE 1. Scheme of proposed withanolide biosynthesis pathway. Abbreviations of the pathway

intermediates are as follows: GA-3P, glyceraldehyde-3- phosphate; DXS, 1-deoxy- D -xylulose 5-

phosphate synthase; DOXP, 1-deoxy-D-xylulose 5-phosphate pathway; DXR, 1-deoxy-D-xylulose−5- phosphate reductoisomerase; MEP, 2-C-methyl-D-erythritol 4-phosphate; DMAPP, dimethylalyl

pyrophosphate; IPP, isopentenyl pyrophosphate; IPI, isopentenyl diphosphate isomerase; HMG-CoA,

3-hydroxy-3- ethylglutaryl-coenzyme A; SQS, squalene synthase; SQE, squalene epoxidase; CS, cycloartenol synthase; CPR, cytochrome P 450 reductase; BS, β-amyrin synthase; LS, lupeol

synthase. Branch A: the branch leading to the biosynthesis of sterol/withanolide, Branch B: the branch

leading to the biosynthesis of β-amyrin and lupeol. Single dark arrows represent one step; two or more dark arrows represent multiple steps.

FIGURE 2. Comparison of deduced amino acid sequences of WsOSC/BS, WsOSC/LS and

WsOSC/CS with other plant OSCs using ClustalW2 multiple alignment tool. OSCs used for the

multiple alignment were from Solanum lycopersicum (SlBS/1-761, NCBI Reference Sequence: NP_001234604.1, SlLS/1-756, NCBI Reference Sequence: XP_004243674.1, SlCS/1-757, NCBI

Reference Sequence: NP_001233784.1); Aralia elata (AeBS/1-763, NCBI Reference Sequence:

ADK12003.1); Vitis vinifera (VvCS/1-766, NCBI Reference Sequence: XP_002264372.1); Lotus

japonicas (LjLS/1-755, NCBI Reference Sequence: BAE53431.1); Withania somnifera (WsOSC/BS/1-762, NCBI Reference Sequence: JQ728553, WsOSC/LS/1-755, NCBI Reference

Sequence: JQ728552, WsOSC/CS/1-758, NCBI Reference Sequence: HM037907). Motifs are

indicated as follows: Prenyltransferase and squalene oxidase repeat (Motif A), MWCYCR and MLCYCR motif (Motif B), Catalytic Asp (Motif C), terpene synthase signature (Motif D).

FIGURE 3. Predicted three dimensional models and ligand binding sites for WsOSCs: Ribbon

model display of the 3-D structures of (A) WsOSC/BS, (B) WsOSC/LS and (C) WsOSC/CS as

predicted by Phyre2

web server, using crystal structure of human OSC (Protein Data Bank (PDB) ID: 1w6ka) as template for modelling of all the three proteins. Predicted ligand binding sites (highlighted

in blue at the core of the structure) in (D) WsOSC/BS, (E) WsOSC/LS and (F) WsOSC/CS as predicted

by 3DLigandSite web server.

FIGURE 4. Phylogenetic tree of WsOSC/BS, WsOSC/LS and WsOSC/CS. Phylogenetic analysis

was performed using the ClustalW program and MEGA 5 software based on the neighbour-joining method. OSCs grouped into three sub-groups namely OSC1- Cycloartenol synthase, OSC2- Lupeol

synthase and OSC3- β-amyrin synthase. WsOSC/BS, WsOSC/LS and WsOSC/CS clustered with their

respective subgroups. 23 protein sequences used for analysis were from subsequent plant species: Solanum lycopersicum (Solanum lycopersicum BS, NCBI Reference Sequence: NP_001234604.1,

Solanum lycopersicum LS, NCBI Reference Sequence: XP_004243674.1, Solanum lycopersicum CS,

NCBI Reference Sequence: NP_001233784.1), Lotus japonicas (Lotus japonicas BS, NCBI

Reference Sequence: BAE53429.1, Lotus japonicas LS, NCBI Reference Sequence: BAE53430.1), Euphorbia tirucalli (Euphorbia tirucalli BS, NCBI Reference Sequence: BAE43642.1), Artemisia

annua (Artemisia annua BS, NCBI Reference Sequence: ACA13386.1), Bupleurum kaoi (Bupleurum

kaoiBS, NCBI Reference Sequence: AAS83468.1), Vitis vinifera (Vitis vinifera BS, NCBI Reference Sequence: XP_002270934.1 Vitis vinifera LS, NCBI Reference Sequence: XP_002269060.1, Vitis

vinifera CS, NCBI Reference Sequence: XP_002264372.1), Taraxacum officinale (Taraxacum

officinale LS, NCBI Reference Sequence: BAA86932.1), Glycyrrhiza uralensis (Glycyrrhiza uralensis

19

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

LS, NCBI Reference Sequence: BAL41371.1), Olea europaea (Olea europaea LS, NCBI Reference

Sequence: BAA86930.1), Arabidopsis thaliana (Arabidopsis thaliana CS, NCBI Reference Sequence:

AAC04931.1), Azadirachta indica (Azadirachta indica CS, NCBI Reference Sequence: AGC82085.1), Centella asiatica (Centella asiatica CS, NCBI Reference Sequence: AAS01524.1),

Panax notoginseng (Panax notoginseng CS, NCBI Reference Sequence: ABY60426.1).

FIGURE 5. Identification of Withania somnifera β-amyrin, lupeol and cycloartenol synthases by

use of the yeast heterologous expression system. Extracted ion chromatogram (EIC) of standards β-

amyrin, lupeol and cycloartenol and S. pombe cells transformed with expression constructs (A)

pDS472aB, (B) pDS472aL, (C) pDS472aC and empty vector (D) pDS472a. The mass spectrometry (MS) data of (E) pDS472Ab, (F) β-amyrin standard, (G) pDS472aL, (H) lupeol standard, (I) pDS472aC

and (J) cycloartenol standard. Fragmentation pattern of (K) β-amyrin, (L) pDS472aB, (M) lupeol (N)

pDS472aL (O) pDS472aC and (P) cycloartenol.

FIGURE 6. SDS-PAGE profile of purified recombinant proteins. SDS-PAGE (10%) of purified

recombinant proteins from S. pombe transformed with pDS472aB, pDS472aL and pDS472aC. Lane 1;

Purified recombinant GST-fused WsOSC/BS, Lane 2; Purified recombinant GST fused WsOSC/LS, Lane 3; Standard protein marker, Lane 4; Purified recombinant GST-fused WsOSC/CS.

FIGURE 7. Kinetic study of WsOSC/BS, WsOSC/LS and WsOSC/CS. Michaelis–Menten plot of (A) β-amyrin synthase, (WsOSC/BS) (B) lupeol synthase (WsOSC/LS) and (C) cycloartenol synthase

(WsOSC/CS) with 2,3- oxidosqualene. Kinetic parameters Km and Vmax were obtained by fitting the

data in the Michaelis–Menten equation by non-linear regression analysis using GraphPad Prism 5 software

FIGURE 8. Tissue-specific real-time expression analysis. Quantitative estimation of the expression

of (A) WsOSC/LS, (B) WsOSC/BS and (C) WsOSC/CS in leaf, roots, stalk and berries of Withania somnifera. Data were compared and analysed with analysis of variance (ANOVA). Values are means,

with standard errors indicated by bars, representing three independent biological samples, each with

three technical replicates. Differences were scored as statistical significance at *p<0.05 and **p<0.01 levels.

FIGURE 9. Transcript profiles of WsOSCs in response to elicitor treatments. (A) Time courses

of WsOSC/BS, WsOSC/LS and WsOSC/CS expression in micropropagated Withania somnifera elicited

by methyl jasmonate (MeJA; 0.1 mM), gibberellic acid (GA3; 0.1 mM) and yeast extract (YE;

0.1% w/v). β-actin was kept as endogenous control. (B) Densitometric quantification of WsOSC/BS, WsOSC/LS and WsOSC/CS band intensities for the different treatments and controls (ethanol and

water). Experiments were performed in triplicate with similar results; error bars indicate ± standard

deviation of the mean. IOD, integrated optical density; A.U., arbitrary units.

FIGURE 10. Western immunoblot of WsOSCs in response to elicitor treatments. Time courses of

WsOSC/BS, WsOSC/LS and WsOSC/CS protein expression in micropropagated Withania somnifera

elicited by ( A) methyl jasmonate (MeJA; 0.1 mM), ( B) gibberellic acid (GA3; 0.1 mM) and (C)

yeast extract (YE; 0.1% w/v). β-actin was kept as endogenous control.

FIGURE 11. Time-course effect of elicitor treatments on accumulation of withanolides.

Withanolide accumulation in response to (A) 0.1mM methyl jasmonate (MeJA), (B) 0.1 mM gibberellic

acid (GA3) and (C) 0.1%w/v yeast extract (YE) at different time courses. Variation in three key

withanolides - withanolide A (WS-1), withanone (WS-2) and withaferine A (WS-3) was confirmed by HPLC analysis at 6, 12, 24 and 48 h. All values obtained were means of triplicate with standard errors.

Time-course accumulation of WS-1, WS-2 and WS-3 was statistically significant at p<0.01 level.

20

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

FIGURE 12. Southern blot analysis of (A) WsOSC/BS, (B) WsOSC/LS and (C) WsOSC/CS: Withania somnifera genomic DNA was digested with SpeI (non-cutter), ScaI and EcoRI (single-

cutter) for WsOSC/BS, with SalI (non-cutter), NcoI and EcoRV (single-cutter) for WsOSC/LS and

with XbaI, XhoI (non-cutter), HindIII and DraII (single cutter) for WsOSC/CS, separated on 0.8 % agarose gel, blotted onto a nylon membrane and hybridized with DIG-labelled ORF of WsOSC/BS,

WsOSC/LS and WsOSC/CS as probes.

21

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

Table 1

Primers used in present study

Primer name Direction Sequence ( 5´ 3´ )

Degenerate primers

DEGOSC/BSF Forward GTCATAGTACTATGTTCTGTACAGC

DEGOSC/BSR Reverse GAGTAGTATCTGCTATCTCATTGTT

DEGOSC/LSF Forward AGGTGAGGG/AAGAAT/ACCTTCTGG/CGA

DEGOSC/LSR Reverse TTC/TCACGA/CTGTATAGGTGTTGGATC

DEGOSC/CSF Forward GAAGG/TGATACA/CATGGAAGTCAATCT

DEGOSC/CSR Reverse CATAGCCCAT/GGCTGTATTTACAACA

5'& 3' RACE primers

OSC/BS5O Reverse CTACCATGATCAAGAATCCATTTCC

OSC/BS5I Reverse CCACCATATGGTCCTTCTCCAAGGA

OSC/LS5O Reverse CAGAAGTGCAATCAGAGACTTGCC

OSC/LS5I Reverse TTCCCAGAAGGATTCTCCCTCACCT

OSC/CS5O Reverse TCCATATTCTTCGCCAAGCCCAGT

OSC/CS5I Reverse AGATTGACTTCCATTGTATCCCTTC

5' Adaptera

GCUGAUGGCGAUGAAUGAACACUGCGUU

UGCUGGCUUUGAUGAAA

5' RACE-OUTa

Forward

GCTGATGGCGATGAATGAACACTG

5' RACE-INa

Forward

CGCGGATCCGAACACTGCGTTTGCTGGCTT TGATG

3' Adaptera

GCGAGCACAGAATTAATACGACTCACTAT

AGGT12V(G/A/C)N(A/C/T/G)

3' RACE-OUTa Reverse GCGAGCACAGAATTAATACGACT

3' RACE- INa

Reverse

CGCGGATCCGAATTAATACGACTCACTAT AGG

OSC/BS3O Forward CTTAGGAAGGGACATGACTTTATA

OSC/BS3I Forward ATCGACATATATCAAAAGGATCATGG

OSC/LS3O Forward GCGATCAGTCAAATTTGGTACAAAC

OSC/LS3I Forward GATCCAACACCTATACATCGTGGAA

OSC/CS3O Forward ATGTCAAAACAAGGTGTATACAAAT

22

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

OSC/CS3I

Full length primers

Forward TGTTGTAAATACAGCATGGGCTATG

FULLOSC/BSF Forward ATGTGGAAATTGAAAATTGCAAA

FULLOSC/BSR Reverse TTAGTTGTGTTTCAATGGTGATA

FULLOSC/LSF Forward ATGTGGAAGCTTAAAACAGCAGAA

FULLOSC/LSR Reverse CTACTTGAGAAAACTTTTGCGATA

FULLOSC/CSF Forward ATGTGGAAGTTGAAGATAGCAGA

FULLOSC/CSR Reverse TCAATTAGCTTTGAGTACACGAA

Expression primers

EXP/BSF Forward CTCGAGCTATGTGGAAATTGAAAATTGCA AA

EXP/BSR Reverse GCGGCCGCCGTTGTGTTTCAATGGTGATA

EXP/LSF Forward CTCGAGGTATGTGGAAGCTTAAAACAGCA

GAA

EXP/LSR Reverse GCGGCCGCACTTGAGAAAACTTTTGCGAT

A

EXP/CSF Forward CTCGAGTCATGTGGAAGTTGAAGATAGCA

GA

EXP/CSR Reverse GCGGCCGCGATTAGCTTTGAGTACACGAA

Real-time primers

RT/BSF Forward TGGTTCCTGGTTTGCTCTTGGA

RT/BSR Reverse CTGGGCAAGAACGGTAGCATT

RT/LSF Forward TGCTGGGGAATTTGCTACACAT

RT/LSR Reverse TCCACCATCTGGCAATTGCTT

RT/CSF Forward GCTAATCAACCCTGCTGAGAC

RT/CSR Reverse CAATACAGTGTTCCACTTCTT

AtnFor Forward GAGAGTTTTGATGTCCCTGCCATG

AtnRev Reverse CAACGTCGCATTTCATGATGGAGT

Promoter primers

PROOSC/BSO Reverse AGATCGAAGAGGCCCGTCAACA

PROOSC/BSI Reverse ATTGAAAATTGCAAAAGGGCAAG

PROOSC/LSO Reverse GAGCTCTCTCCTTTGAAGAGTTC

23

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

PROOSC/LSI Reverse CCCTTCTGCTGTTTTAAGCTTC

PROOSC/CSO Reverse CTGGAGATCCAAGATTTGGAT

PROOSC/CSI

Walker-AP1a

Walker-AP2a

Reverse

Forward

Forward

CTCCTTCTGCTATCTTCAACT

GTAAT ACGAC TCACT ATAGG GC-3'

ACTAT AGGGC ACGCG TGGT-3'

Note: a

Primers were provided with the kit. Start codon or stop codon are in bold, enzyme sites are

underlined.

Table 2

Specific activities and kinetic constants of WsOSC/BS, WsOSC/LS and WsOSC/CS. For measuring

specific activities, 2, 3- oxidosqualene (100 µM) was used. Kinetic parameters were studied in reaction

mixture containing different concentrations of 2, 3- oxidosqualene (10-250 µM). Values were obtained

by non-linear regression of Michaelis-Menten plots and are presented as mean±SE.

Protein Specific activity

µmol min-1

mg-1

)

Vmax

(µmol min-1

mg-1

)

Km

(µM) WsOSC/BS 2.9±0.068 0.39±0.031 38.48±0.53

WsOSC/LS 2.0±0.088 0.49±0.049 100.4±0.44

WsOSC/CS 1.43±0.014 0.61±0..026 99.51±0.58

24

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

21

FIGURES

Oxidosqualene cyclases from Withania somnifera

FIGURE 1

25

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

22

Oxidosqualene cyclases from Withania somnifera

FIGURE 2

26

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

23

Oxidosqualene cyclases from Withania somnifera

FIGURE 3

27

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

24

Oxidosqualene cyclases from Withania somnifera

FIGURE 4

28

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

25

Oxidosqualene cyclases from Withania somnifera

FFFFFFFF

FIGURE 5

29

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

26

Oxidosqualene cyclases from Withania somnifera

(E)

(G)

pDS472aB

pDS472aL

(F)

(H)

β-amyrin standard

Lupeol standard

(I) (J) pDS472aC

Cycloartenol standard

FIGURE 5

30

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

27

Oxidosqualene cyclases from Withania somnifera

(K)

β-amyrin standard

(L) pDS472aB

(M)

(N)

Lupeol standard

pDS472aL

FIGURE 5

31

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

28

Oxidosqualene cyclases from Withania somnifera

(O)

pDS472aC

(P)

Cycloartenol standard

FIGURE 5

32

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

29

Oxidosqualene cyclases from Withania somnifera

FIGURE 6

33

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

FIGURE 7

WsOSC/BS

[Type a quote from the document or

the summary of an interesting point.

You can position the text box

anywhere in the document. Use the

Text Box Tools tab to change the

formatting of the pull quote text box.]

WsOSC/LS WsOSC/CS

Substrate- 2, 3 Oxidisqualene

2, 3- oxidosqualene-

Substrate- 2, 3- Oxidosqualene Substrate- 2, 3- Oxidosqualene

34

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

FIGURE 8

35

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

30

FIGURE 9

36

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

FIGURE 10

A

B

C

37

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

Oxidosqualene cyclases from Withania somnifera

FIGURE 11

FIGURE 12

38

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from

LattooRekha S. Dhar, Samantha Vaishnavi, Abid Hamid, Ram Vishwakarma and Surrinder K.

Niha Dhar, Satiander Rana, Sumeer Razdan, Wajid Waheed Bhat, Aashiq Hussain,Cyclases From Withania somnifera (L.) Dunal

Cloning and Functional Characterization of Three Branch Point Oxidosqualene

published online April 25, 2014J. Biol. Chem. 

  10.1074/jbc.M114.571919Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2014/04/25/M114.571919.DC1

by guest on June 16, 2020http://w

ww

.jbc.org/D

ownloaded from