Characterization of proteins involved in Bacillus subtilis spore formation and

germination

Bidisha Barat

Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of

Doctor of Philosophy In

Biological Sciences

David L. Popham, Chair Clayton C. Caswell

Birgit E. Scharf Ann M. Stevens

April 28, 2020 Blacksburg, Virginia

Keywords: Bacillus subtilis, spore, germination

Copyright CC BY-NC-SA 2020, Bidisha Barat

Characterization of proteins involved in Bacillus subtilis spore formation and

germination

Bidisha Barat

ABSTRACT

Members of the Bacillus genus, when faced with unfavorable environmental conditions

such as depletion of nutrients, undergo an asymmetric division process ultimately leading to the

formation of an endospore. In some instances, the spore serves as the infectious agent of an

associated disease; such is the case with the spore of Bacillus anthracis and the disease anthrax.

Spores are resistant to a variety of unfavorable environmental conditions including traditional

decontamination techniques. Spore resistance is due to the formation of specialized structures

that contribute to spore dormancy through several mechanisms, including maintenance of the

dehydrated state of the spore core. Spore germination is a rapid process resulting in the

irrevocable transformation of the non-metabolizing dehydrated spore into a vegetative

outgrowing bacterium. The exact mechanism by which individual proteins function in the

germination pathway remains unknown. In this study, we have focused on the roles of putative

ion transporters and other germination-active proteins in affecting spore formation and

germination.

Metal ions can activate enzymes during the sporulation process and/or be factors in spore

resistance properties. In B. subtilis, six proteins within the spore membrane proteome (ChaA,

YcnL,YflS, YloB, YugS, ZnuA) are similar to components of known cation transport systems. These

proteins may play roles in the accumulation of ions during sporulation and/or the release of ions

during germination. Multiple mutants altered in the putative ion transporter genes were

generated, and the effects of these mutations were analyzed. All strains containing a yloB

deletion showed a decrease in heat resistant cfu/ml, and >40% of the spores appeared phase

dark during microscopy, indicating the formation of unstable spores. Studies were conducted to

quantify the amounts of individual ions in phase-bright spores using atomic emission

spectroscopy and to analyze the rate at which ions are released from germinating spores. The

transport of Ca2+ from mother cell to forespore during sporulation seems to be affected in the

yloB deletion mutant. This Ca2+ deficit apparently renders the spores unstable, heat sensitive,

and partially germination defective, suggesting that a high-affinity transporter for Ca2+ is

nonfunctional.

To better understand the underlying mechanisms of germination, a high-throughput

genetic screening method called transposon sequencing was used. This analysis identified genes

that had not been previously implicated in germination. To investigate their functions, a number

of functional assays of all the Ger mutant strains were performed that indicated a delay in stage

I of germination. The mutant strains showed significant reduction in germination efficiency with

L-valine: about 50% of the population failed to initiate germination suggesting a defect in the

GerA-mediated response. The expression of gerA was studied using a lacZ transcriptional fusion

followed by quantitative western blot analyses to determine abundance of GerA in mutant

strains. The mutants were classified based upon normal or decreased gerA transcription and

normal or reduced GerA protein. Further work involves understanding the functions of the

identified genes and their correlation to the GerA receptor.

Insight into ion transporters of spore-forming bacteria and understanding the

germination apparatus may lead to promising new applications, detection methods, or

therapeutics for spores, and may allow the development of better spore decontamination

procedures.

Characterization of proteins involved in Bacillus subtilis spore formation and

germination

Bidisha Barat

GENERAL AUDIENCE ABSTRACT

Bacillus subtilis is an ubiquitous bacterium that is capable of forming endospores when

faced with unfavorable environmental conditions. Spores are highly resistant to heat, radiation,

lack of nutrients, desiccation and oxygen deprivation. They lack metabolism, which effectively

keeps them in a state of suspended animation until germinated. They may remain stable and

viable in this state for extremely long periods of time. Several important pathogenic bacteria are

spore formers. This leads to difficulty in their environmental eradication and the treatment of

patients. Germination allows spores to resume metabolism and reestablish a vegetative state.

Certain key molecules activate the germination process. Each species of spore-forming bacteria

has a specific set of these molecules called germinants that will enable the spore to exit its

dormant state. The work presented focuses on the understanding of the germination apparatus

of Bacillus subtilis, which may provide a model to understand the germination of other spore

formers and help to improve methods of decontamination.

vi

DEDICATION

This dissertation is dedicated to my tremendously supportive and loving parents, Vaswati and

Indranil Barat who have given me invaluable educational opportunities and for their endless

motivation. Thank you for believing in me and being there for my successes, my failures and

always encouraging me to strive for excellence.

vii

ACKNOWLEDGEMENTS

First, I would like to thank my advisor, Dr. David L. Popham and Dr. Birgit E. Scharf for

interviewing me via Skype during the summer of 2014 and giving me the opportunity to come to

USA and pursue my doctoral studies at Virginia Tech.

Dr. Popham, I cannot thank you enough for your patience and all the advice and

knowledge that you have shared with me over the years. I really appreciate your open-door

policy and your readiness to answer all my doubts during the countless number of times that I

have walked in, fretting over an experiment. I have always wondered how you juggle so many

things with ease, from research, writing grants, teaching to helping us with prelim practice,

feedback on our manuscripts, presentations and always replying promptly to our emails. You

have taught me to troubleshoot wisely, draw clear pictures to understand the experiment in

depth and develop as an independent scientist and I could not have asked for a better mentor.

I would also like to thank my other committee members, Dr. Ann M. Stevens, Dr. Birgit E.

Scharf and Dr. Clay C. Caswell for all your advice and support during my graduate studies. Your

words of encouragement and challenging questions always kept me motivated.

To all the past and present members of the Popham lab, all of you have made this

experience a little less daunting and a lot more fun. Dr. Yan Chen, although I never had the

opportunity to meet you, thank you for laying the foundation for my first project in the lab. Sean

Mury, thank you for welcoming me so easily and making the lab so lively! I will always cherish

our weekly lunch buffets, conversations about India and your experiences along with all your lab

hacks!

viii

Dr. Cameron V. Sayer, thank you for teaching me how to survive as a graduate student!

You have taught me how to be calm and not stress over a failed experiment and thank you for

always answering the numerous questions that I asked you! You were an amazing colleague and

friend and I am thrilled for the exciting research life you have ahead.

Matthew Flores, you have made the past year in the lab highly enjoyable! You are wise

beyond your years and thank you for having both science and non-science related conversations

with me! I wish you all the best for the rest of your graduate career and envision a great future

for you.

To all the undergraduate researchers, thank you for giving me the opportunity to be a

mentor and learning together. Isabelle Wal, thank you for being my first undergraduate mentee

and keeping the conversations alive!

To the rest of my friends and colleagues of the Microbiology program and teaching labs,

thank you for making graduate school fun. You are all destined for great things. A big thank you

to Holly Bartholomew, Dr. Manisha Shrestha, and Dr. Katie M. Broadway for the brunch sessions

and for being a great support system.

A special thank you to Kinanka Ghosh for always being there and listening to my rantings.

Thank you for your words of encouragement that got me through my moments of self-doubt.

A huge thank you to my friends in Blacksburg who made weekends fun and became my

family away from home. Last but not the least, thank you to all my friends and family who

supported me throughout this journey from afar.

ix

TABLE OF CONTENTS

ABSTRACT ii

GENERAL ABSTRACT v

DEDICATION vi

ACKNOWLEDGEMENTS vii

LIST OF FIGURES xiii

LIST OF TABLES xv

CHAPTER 1: Introduction and Literature Review 1

Bacillus subtilis sporulation 2

Spore structure 4

Gene regulation during sporulation 5

Spore germination 6

Ions in the spore core 9

Ca2+ 10

Mn2+ 11

K+ 12

Mg2+ 12

Cu2+, Fe3+, Zn2+ 13

Ion release during germination 13

Ion transporters in sporulation and germination 14 Transposon sequencing (Tn-seq) 17 Study objectives 17 References 21

CHAPTER 2: Membrane Proteomes and Ion Transporters in Bacillus anthracis and Bacillus subtilis Dormant and Germinating Spores 30

Attributions 31

Abstract 32 Importance 33

x

Introduction 34

Results 36

Proteins identified in dormant spore membrane preparations 36

Proteins identified in germinated spore membrane preparations 36

Novel membrane proteins identified in spore membrane fractions 37

Membrane proteins under control of sporulation-specific sigma factors 38

Similarities between the spore membrane proteomes in the two Bacillus species 38

Membrane protein changes during spore germination 39

Growth and sporulation of strains lacking putative ion transporters present in spore membranes 40

Quantification of metal ions in cellular compartments during sporulation 42

Germination rate and release of ions during germination 43

Discussion 44

Materials and Methods Spore preparation 49

Preparation of spore membrane fractions 50

SDS-PAGE, Trypsin digestion, and peptide fractionation 51

Mass spectrometry and protein identification 52 Generation of mutants lacking putative ion transporter genes 54

Analysis of sporulation properties 55 Separation of mother cell and forespore fractions 55

Quantification of ions using atomic emission spectroscopy 55

Acknowledgements 57

References 58

CHAPTER 3: Identification of L-valine-Initiated-Germination-Active Genes in Bacillus subtilis using Tn-seq 76

Attributions 77

Abstract 78

Introduction 79

xi

Material and Methods 81

Strain constructions 81

Spore preparation 82

Sequencing of Tn insertion sites 82

Germination assays 83

Assay of gerA transcription 85

Western blotting 85

Results 86

Identification of mutant strains with slowed or reduced germination 86

Characterization of germination mutant strains 88

Expression of the GerA receptor in mutant strains 90

Discussion 91

Acknowledgements 96 References 97

CHAPTER 4: Role of YlbC and YlbB in GerA-mediated spore germination in Bacillus subtilis 112

Attributions 113

Abstract 114

Introduction 115

Results 117

Germination rates of deletion strains 117

Microscopic analysis of germination 118

Polar effects of ylbB mutations 118

Expression of the GerA receptor 119

Overexpression of ylbB 120

Materials and Methods 120

Strain constructions 122

Spore preparation 122

Germination assays 122

Assay of gerA and ylbC transcription 122 Western blot analysis 123 Microscopy 123

xii

Discussion

124

References 127

CHAPTER 5: Final Discussion 141

References 147

APPENDIX A: Supplementary Materials for Chapter 2 148

APPENDIX B: Supplementary Materials for Chapter 3 152

APPENDIX C: Supplementary Materials for Chapter 4 168

References 172

xiii

LIST OF FIGURES

CHAPTER 1

Figure 1.1 Spore structure 25

Figure 1.2 Bacillus subtilis sporulation 26

Figure 1.3 Cascade of sigma factors 27

Figure 1.4 Spore germination 28

Figure 1.5 Organization of GerA receptor 29

CHAPTER 2

Figure 2.1 Predicted membrane-spanning domains of B. anthracis and B. subtilis spore membrane proteins 62

Figure 2.2 Mutant strains lacking yloB produce many phase-dark spores 63

Figure 2.3 Ca2+ content of forespore and mother cell in sporulating cells 64

Figure 2.4 Ion contents of purified phase-bright spores 65

Figure 2.5 Germination of purified phase-bright spores 66

Figure 2.6 Release of ions by germinating spores 67

CHAPTER 3

Figure 3.1 Germination rates of B. subtilis strains 102

Figure 3.2 Phase-contrast microscopy of germinating B. subtilis spore populations 103

Figure 3.3 Expression of a gerA-lacZ transcriptional fusion 104

Figure 3.4 GerAC is reduced in the spores of several B. subtilis mutant strains 105

xiv

CHAPTER 4

Figure 4.1 Germination rates of B. subtilis strains 130

Figure 4.2 Phase - contrast microscopy of germinating B. subtilis spore populations 131

Figure 4.3 Expression of ylbC-lacZ transcriptional fusion 132 Figure 4.4 Expression of gerA-lacZ transcriptional fusion 133

Figure 4.5 Quantitative anti-GerAC western blots of ylbB, ylbB::kan and yhcV::kan (A-C) with graphical representation 134

Figure 4.6 Germination rates of B. subtilis strains with ylbB overexpression 135 Figure 4.7 Hypothetical model A 136 Figure 4.8 Hypothetical model B 137

xv

LIST OF TABLES

CHAPTER 2

Table 2.1 B. anthracis and B. subtilis spore germination proteins identified in spore membrane proteomes 68

Table 2.2 Proteins detected in both Bacillus species spore membrane proteomes 69

Table 2.3 Validation of membrane protein quantification 71

Table 2.4 Changes in Bacillus spore membrane protein detection following germination 72

Table 2.5 Production of heat resistant spores of B. subtilis strains lacking putative ion transporters 74

Table 2.6 Production of heat resistant spores by B. subtilis ion transporter mutants with different Ca2+ concentrations 75

CHAPTER 3

Table 3.1 Genes in which Tn insertions altered germination 106

Table 3.2 Genes without previously known germination role identified by Tn-Seq and in spore membrane proteome 108

Table 3.3 Phenotypic properties of B. subtilis strains 109

Table 3.4 Response of B. subtilis strains to varied germinants 110

Table 3.5 Overexpression of gerA suppresses germination defect of multiple mutants 111

CHAPTER 4

Table 4.1 Response of B. subtilis strains to 10 mM L-valine 138

Table 4.2 ylbC-lacZ expression of sporulating cells 139

Table 4.3 Germination response of B. subtilis strains to 10mM L-valine 140

1

Chapter 1

Introduction and Literature Review

2

Bacillus subtilis sporulation:

Bacillus subtilis is a Gram-positive, aerobic, rod-shaped, and ubiquitous bacterium with a

doubling time of about 20 minutes when grown in rich medium at 37°C. The best genetically

characterized Gram-positive bacterium, it is used as model organism due to its natural

competency and easy genetic manipulation. B. subtilis is often used as the organism of choice for

industrial and pharmaceutical applications. This can be attributed to its high-level secreted

enzyme production, genetic engineering amenability and large-scale fermentation properties

without any production of toxic by-products.

Many members of the Bacillus genus and closely related genera such as Clostridium are

capable of forming endospores when nutrients in the environment are depleted. Under normal

conditions, these organisms grow vegetatively through symmetric binary fission of a cell resulting

in the production of two identical daughter cells. However, when the environment is not

conducive to growth, these organisms undergo sporulation wherein an asymmetric cell division

results in the formation of a larger, mother cell and a smaller developing endospore which is

eventually released and can be easily dispersed by wind [1, 2]. The entire sporulation event is a

well-coordinated process that takes approximately 6-8 hours and requires a large energy

investment (Figure 1.2). Spores of these species are dormant with little or no metabolic activity

and are resistant to various stress factors such as heat, UV radiation and toxic chemicals [2].

Transcription factors called sigma factors control the process of sporulation by undergoing a

coordinated sequence of activation and inactivation [4]. Electron microscopy can be used to

characterize the various stages (0-VII) of morphological changes during spore formation [5, 6].

3

Upon starvation, stage I of sporulation is characterized by the development of the axial

filament. The axial filament is formed by the condensation and aligning of the two copies of the

chromosome, immediately following DNA replication, along the long axis of the cell [7] [8]. Stage

II is characterized by an asymmetric septum formation near a polar position. The septum splits

the cell into a larger mother and smaller forespore component, each of which receives a copy of

the chromosome [3, 9]. The smaller developing forespore contains only about 30% of a

chromosome during this time; SpoIIIE, which is a DNA translocase, pumps in the remaining

chromosome [3-6]. Following the formation of the septum, the forespore is engulfed by the

larger mother cell and becomes enclosed by two membranes of opposing polarity during stage

III [1, 7, 10]. One membrane is attained from the mother cell and the other one is acquired from

the forespore. Once engulfed, the forespore forms a free protoplast inside the mother cell [9].

During stage IV, the spore cortex peptidoglycan is then deposited in between the inner and outer

membrane of the engulfed forespore [11]. The germ-cell wall is also synthesized during stage IV

[1, 3, 5]. Stage V is characterized by the creation of proteinaceous spore coats around the spore

cortex and relative dehydration of the spore core, which confers some resistance properties to

the developing spore [1, 3, 8]. In certain species, the exosporium is also synthesized outside the

coats during this stage. Stage VI is the maturation stage wherein the spore attains its remaining

resistance properties and dehydration, and develops refractility whilst inside the mother cell [3,

12]. Dipicolinic acid (DPA[pyridine-2,6-dicarboxylic acid]) synthesized within the mother cell is

transported and accumulates within the forespore [2]. DPA chelates calcium ions, leading to a

very high concentration of Ca2+-DPA within the spore core during stages V and VI of sporulation

[2]. DPA is not found in vegetative cells and accumulates late in sporulation making up 5-15% of

the total dry weight of the spore [12, 13]. Spores lacking DPA are extremely unstable and

4

germinate spontaneously [2]. Lastly, during stage VII, the mother cell is lysed, releasing the

mature spore into the environment, thereby completing the process [1, 3, 14] . When suitable

environmental conditions return, the dormant spore undergoes germination with a resumption

of metabolic activities [1]. Mature spores that are metabolically dormant contain very low

amounts of cellular high energy compounds such as ATP or NADH but their quantities rise once

germination is initiated [15, 16] .

Spore structure:

The structure of the spore is unique and differs considerably from that of a vegetative cell

(Figure 1.1). The outside of some spores is covered by a large, loose fitting structure termed the

exosporium. This is composed of proteins and glycoproteins but its function is not well defined

[17]. The exosporium may play a role in spore-host interactions based on the pathogenic nature

of some exosporium-containing spores [9]. Below the exosporium lies a multilayered structure

composed of a variety of proteins termed the spore coat. The spore coat provides no resistance

to heat or radiation, however, spores lacking spore coats are more sensitive to lysozyme and

certain chemicals such as hydrogen peroxide [9]. Underneath the spore coat is the outer

membrane of the spore which is important during spore formation but its exact role in the

dormant spore is unknown as it does not have a considerable protective role against heat,

radiation or chemicals and likely does not serve as a significant permeability barrier [3, 18] . Below

this membrane is the spore cortex which consists of peptidoglycan [9]. A notable difference is

the presence of muramic acid lactam (MAL) in the spore cortex peptidoglycan which is absent in

the peptidoglycan of a vegetative cell [12]. MAL is important as it is recognized by lytic enzymes

that degrade the cortex during spore germination. Inside the cortex lies the germ cell wall

peptidoglycan, which does not contain MAL and thus remains intact from the hydrolyzing action

5

of germination lytic enzymes [19]. The germ cell wall becomes the cell wall of an outgrowing

spore resulting in the generation of rod-shaped vegetative cells [11]. The inner membrane is

located below the germ cell wall [20]. It serves as a barrier that is impermeable to small

(molecular weight >100 g/mol) hydrophilic molecules [21, 22] and contains the germinant

receptor proteins [21]. The spore core, containing DNA, RNA, DPA, cations and various enzymes

is surrounded by the inner membrane. Due to the dehydrated state of the spore core, it is likely

that there is no enzymatic activity in the spore core [2, 12].

Gene regulation during sporulation:

Upon sensing unfavorable conditions, the change from vegetative growth to sporulation

involves a two-component signal transduction system, that begins with the phosphorylation of

the master regulator of sporulation, Spo0A, via a phosphorelay system [1]. Sensor kinases KinA,

KinB and KinC undergo autophosphorylation using ATP and the phosphate is transferred to

Spo0F, a response regulator. Spo0F-P transfers the phosphate to Spo0B and eventually to Spo0A.

Spo0A-P regulates the transcription of nearly 500 genes including the spoIIA operon encoding σF,

the spoIIG operon encoding σE and the spoIIE gene involved in activation of σF in the forespore

[1, 4]. The mother cell and the developing forespore undergo separate developmental routes

upon initiation of sporulation involving five distinct RNA polymerase sigma (σ) factors [1] that

undergo a coordinated sequence of activation and inactivation as shown in Figure 1.3.

At the onset of sporulation, gene expression is controlled by σH which is activated by

Spo0A-P [4, 23, 24]. σE and σF are synthesized prior to septation but remain inactive until after

septum formation and then control the mother cell and forespore gene expression, respectively.

An anti-sigma factor, SpoIIAB is responsible for maintaining σF in an inactive state although σF is

produced in an active state. σE is produced as a pro-sigma factor and needs proteolytic processing

6

for its activity, signaled by σF-directed expression of spoIIR [4, 23, 24]. Genes transcribed by σE

control the prevention of further asymmetric division, engulfment of the forespore, spore coat

assembly initiation, and σK production. Activity of σE is also linked to the engulfment of the

forespore. Other sporulation-specific sigma factors that are involved in the transcription of late

stage sporulation genes are σG and σK, which are forespore-specific and mother cell-specific

respectively. σK is produced as a pro-sigma factor (pro-σK). σG is initially held inactive by SpoIIAB

and is activated by SpoIIIA upon completion of engulfment. Genes transcribed by σG function in

pairing gene expression of late forespore and mother cell and preparing the spore for

germination. Pro-σK is processed to the active state by a protein encoded by spoIVB, which is

transcribed post activation of σG. σK transcribes genes involved in spore coat formation and spore

maturation [1, 4, 23, 24].

Spore germination:

When favorable conditions return to the environment, nutrients that are termed

germinants are sensed by the spores resulting in activation of germination and return to

vegetative growth [15, 16, 25, 26]. Germinants include nutrients such as L-alanine, sugars

(glucose and fructose), purine nucleosides or a combination. Most of the spores will germinate

within 5 minutes of exposure to germinants [26, 27]. In addition, spores will also germinate in

response to non-nutrients such as calcium dipicolinic acid, lysozyme, high pressure and salts,

although it is likely that steps of the germination pathway may be bypassed if germination is

triggered in this fashion [26, 27]. For germination to occur, the germinant must travel across the

spore coat and cortex to contact germination receptors (GR) located within the inner membrane

[16, 22].

7

Once germinants have contacted the GR receptors, Stage I of spore germination is

initiated, which involves release of certain core components of the spore such as H+, monovalent

cations, DPA and its bound divalent cations, causing water to rush in and partially hydrate the

core [15] [36]. During the expulsion of H+ from the core, the pH of the core increases from 6.5 to

7.7 which is essential for resumption of metabolism once the spore is rehydrated enough for

enzyme action [28]. During Stage II, the spore cortex is then broken down by the germination-

specific lytic enzymes (GSLEs) which causes the spore core to swell by further water uptake, germ

cell wall expansion and return to a completely hydrated state (Figure 1.4). Small acid-soluble

proteins (SASP), bound to the spore DNA for protection from stress factors, are also degraded

[14, 15] . At this point the spore is no longer dormant and has lost the majority of its resistance

characteristics [26, 27]. Eventually, there is spore outgrowth coupled with resumption of

metabolic activity. Under a light microscope, germination can be observed as a change from a

phase bright appearance to a phase dark appearance. This can also be observed as a decrease in

the optical density of spore cultures at 600 nm [27].

B. subtilis spores have three known functional germinant receptors in the inner

membrane that sense certain nutrient compounds and activates spore germination. These

germinant receptors may be functioning as ion channels themselves or their activation may

provide a signal to other proteins involved in germination [16][29]. The germinant receptor

proteins generally consist of three subunits (A, B and C), each encoded in a tricistronic operon

(gerA, gerB, and gerK operons), which are expressed in the forespore during late stage of

sporulation under the control of σG [29]. The gerA operon encodes three proteins, GerAA with

probable hydrophilic and hydrophobic domains, GerAB which is a putative integral membrane

protein and part of the single-component polyamine/amino acid/organocation transporter

8

superfamily and GerAC which is a predicted lipoprotein is associated with the forespore

membrane via a lipid anchor (Figure 1.5) [21, 30]. The B subunit is likely involved in germinant

binding [14]. The GerA nutrient receptor is the most abundant in B. subtilis spores and responds

to L-valine and L-alanine, while the GerB (GerBA, GerBB and GerBC) and GerK (GerKA, GerKB and

GerKC) nutrient receptors cooperate to respond to a combination of L-asparagine, D-glucose, D-

fructose and K+ ions (AGFK) [31]. Each B. subtilis spore contains nearly 2500 total germinant

receptors with ~1100 molecules of GerAA and GerAC and ~700 molecules of GerBC and GerKA

subunits [32]. Spore germination can potentially be inhibited by deficiencies in germinant

receptors and accompanying proteins such as Ca2+-dipicolinic acid channels and lytic enzymes

[33]. Spores fail to germinate with nutrients upon deletion of all three germinant receptors, but

they maintain an unknown mechanism of slow spontaneous germination. There may also be

some interaction between the germinant receptors and SpoVAD (~6,500 molecules per spore)

and SpoVAE, that are involved in releasing Ca2+-DPA during germination [34]. The signal

transduction mechanism from the germinant receptors to other spore proteins to begin

germination is not completely understood [35]. In Bacillus species, GerD is another inner

membrane protein involved in germination though it shares no homology with any known

protein, nor does it bear resemblance to Ger receptor proteins. Recent work indicates that GerD

is a ~20 kDa protein that may be a lipoprotein with a diacylglycerol associated to a particular

cysteine residue [36]. The transcription of gerD is also under the control of σG [37]. Each B. subtilis

spore contains ~3500 molecules of GerD [32]. In B. subtilis, GerD may be involved in signal

transduction from the nutrient receptors to downstream germination components, by the

colocalization of GerD and the germinant receptors within a cluster termed the germinosome in

the spore’s inner membrane [35, 38].

9

There is variation in the substrate specificity, affinity, and numbers of germinant

receptors between different Bacillus species and strains. There is some evidence indicating that

individual germinant receptors and subunits interact with each other and show synergy [34].

Single amino acid changes can eliminate the dependence of GerB on GerK [39]. Studies have

shown that overexpression of any individual GR, such as GerA, increases the rate of spore

germination with L-alanine or L-valine and decreases rates of germinations via GerB and GerK

[31, 40]. These results suggest that the overexpression of one germinant receptor may lead to a

decrease in the level of other germinant receptors resulting in decreased rate of germination.

Another explanation may be that all the germinant receptors are competing for a low

concentration of a signaling molecule that is present downstream in the germination pathway,

thus the overexpressed germinant receptor interferes with the accessibility of the signaling

molecule [34, 40, 41].

Ions in the spore core:

Metal ions potentially act as catalytic activators of some enzymes essential for the

sporulation process [42]. The mineral composition of the medium influences the variability of

ions incorporated into spores. Usually divalent cations present in the spore core are associated

with DPA and there may be some additional minerals in the core. Calcium (Ca2+), manganese

(Mn2+), zinc (Zn2+), nickel (Ni2+) , iron (Fe3+) and copper (Cu2+) ions accumulate in developing

spores and affect the heat resistance of the spores [43][44]. The higher the spore levels of

divalent cations, the more wet heat resistant the spore. Resistance in spores imparted by cations

are in the following order: Ca2+ > Mn2+ > Mg2+> K+> Na+ > H+ [22]. Apart from affecting the amount

of water in the spore core, it is not evident why the spore wet heat resistance is affected by

mineralization of the spore core and the characteristic features of the mineral ions [22]. It may

10

be due to the interplay of spore macromolecules with a DPA-metal ion matrix that pervades the

spore core [45].

Ca2+

The most abundant cation in Bacillus spores is Ca2+ with the formation of calcium

dipicolinate (Ca2+-DPA) in the core. As spores mature, Ca2+ is accumulated and is considered to

be a prerequisite in the production of heat-resistant and refractile spores. A transporter possibly

accumulates Ca2+ in the cytosol of the mother cell, followed by facilitated diffusion of Ca2+ into

the core of the forespore, where the level of free Ca2+ is low due to the Ca2+-DPA complex

formation within the core [46, 47]. A Ca2+/H+ antiporter has been characterized in B. subtilis based

on Ca2+/H+ exchange driven by an electrical gradient over the plasma membrane in B. subtilis and

B. megaterium [48]. Ca2+ content in spores can be reduced at higher concentrations of Zn2+, Mn2+

and Ni2+ due to competition for Ca2+ sites in the spores. However, the competing divalent ions do

not confer the same degree of heat resistance in spores as they are incorporated into the spores

with low efficiency [49].

During Stage II of germination, the hydrolysis of the spore cortex is accomplished through

the activity of the GLSEs that specifically recognize muramic-δ-lactam and may require Ca2+-DPA.

The two main categories of GSLEs are the spore cortex-lytic enzymes (SCLE), which degrade the

spore cortex peptidoglycan, and the cortical fragment-lytic enzymes (CFLE) that further break

down the partly degraded peptidoglycan [16, 29]. In B. subtilis, SleB, which is a lytic

transglycosylase, and CwlJ are involved in cortex degradation. SleB is present in the region

between the inner membrane and coat while CwlJ is found in the inner spore coats near the

cortex. The activity of both SleB and CwlJ could involve the presence of Ca2+ [16, 49, 50]. After

the release of Ca2+-DPA from the spore core, there is partial rehydration of core as well as

11

deformation of the cortex [16, 29]. A suggested mechanism is that the Ca2+ from the released

Ca2+-DPA results in the collapse of a loosely cross-linked peptidoglycan, which causes rehydration

of the core and activation of the GSLEs [50]. It was proposed that SleB acts only on this structural

modification of the cortex [50], however studies by Heffron et al showed that SleB is active on

both intact and fragmented cortex [51]. It has been seen that calcium ions alone cannot trigger

spore germination but Ca2+-DPA can. CwlJ is activated in response to the release of Ca2+-DPA

during spore germination or addition of exogenous Ca2+-DPA as a germinant [50].

B. cereus spores germinate poorly in response to nutrient germinants when they have

lower DPA content, which is linked to the calcium content [52, 53]. Also, rate of germination of

spores with low Ca2+-DPA is enhanced in response to alanine by the exogenous addition of

calcium along with the uptake of these calcium ions while germination is inhibited by calcium

channel blockers [50, 52]. In Clostridium perfringens, a GSLE known as SleM also requires divalent

cations such as Ca2+ and Mg2+ for its activity [50].

Mn2+

The requirement of Mn2+ for sporulation is critical as it seems to be a co-factor of SpoIIE

serine phosphatase involved in the formation of the polar septum of the spore [54]. A complex

of Mn-superoxide dismutase (MnSOD) increases the resistance of sporulating cells against

oxidative stress [55]. Mn2+, upon forming a complex with DPA provides protection from ionizing

radiation in spores [56]. Dormant spores contain 3-phosphoglyceric acid (3PGA) as an essential

energy reserve comprising 0.15-0.3% of the spore dry weight. The accumulation of 3PGA late

during sporulation in the developing spore occurs upon inhibition of the enzyme

phosphoglycerate mutase. Phosphoglycerate mutase is extremely pH sensitive and acidification

of the forespore during sporulation results in deactivation of the enzyme [57]. Mn2+ can bind to

12

the catalytically inactive phosphoglycerate mutase and may promote the conversion of inactive

phosphoglycerate mutase as well as induce a conformational change to a catalytically active

state. Phosphoglycerate mutase catalyzes the interconversion of 3PGA and 2 phosphoglyceric

acid, during spore germination which results in the generation of ATP [57]. Henriques et al

provided evidence that MnSOD may be involved in spore coat assembly in B. subtilis by

generating hydrogen peroxide. H2O2 is essential for the o,o-dityrosine cross-linking of CotG, an

outer coat structural protein [58]. During the growth and early sporulation phase in B. subtilis,

Mn2+ is accumulated in an exchangeable and free form that is later converted to a bound form

during the later stages of sporulation [59].

K+

K+ is essential for activation of certain enzyme systems required for protein synthesis as

well as maintaining ribosomal structures in a suitable functional configuration [43]. One of the

first detectable events in spore germination is the release of K+ ions and it is not firmly bound

inside sporulating cells, unlike calcium [14].

Mg2+

Mg2+ is considered to be involved in protein and nucleic acid synthesis and thus essential

for sporulation. Magnesium ions can bind to enzymes and alter their structure as well as generate

magnesium-substrate scaffolds, to which enzymes bind. Mg2+ is involved in protein synthesis

through specific catalytic roles. Magnesium ions are required for activation of enzymes involved

in replication of DNA (topoisomerase II, polymerase I) and transcription and is essential for the

stability of nucleic acids [60]. Mg2+ is also associated with ribosomes and activates amino acids

involved in mRNA attachment to ribosomes [60]. Mg2+ however does not contribute to heat

resistance but rather interferes with the Ca2+-DPA complex and reduces heat resistance. In B.

13

subtilis, the uptake of Mg2+ declines during sporulation probably due to the reduction in the

function of one of the two magnesium transport systems postulated during late sporulation [61].

Cu2+, Fe3+, Zn2+

In Clostridium spores, Cu2+ limits sporulation by reacting with essential macromolecules

that catalyze hydrolytic reactions resulting in the production of free radicals that are toxic to DNA

[62]. Cu2+ forms non-functional metal-protein complexes by interacting with the sulfhydryl

groups of spore proteins resulting in reduction in sporulation [63]. Fe3+ and Zn2+ are considered

to be essential for sporulation in B. megaterium spores, however their exact role has not been

ascertained [43].

Ion release during germination:

Germination of spores begins with a rapid change in the membrane permeability of the

spore coupled with the rapid uptake of water in the protoplast along with the passage of ions

and water across the spore layers and induction of cortex lytic enzymes [64]. Upon interaction

with germinants, germination of spores involves a flux of monovalent cations such as K+, H+, Na+

probably along with the release of anions. Around 80% of the spore’s Na+ and K+ is released

during the early steps of germination driven by the concentration gradient between the inside

and the outside of the spore. This efflux is followed by the reuptake of K+ based on an energy

dependent system [65]. Various possible Na+/H+-K+ antiporters have been identified such as GerN

in B. cereus and B. megaterium [66, 67]. The release of monovalent ions is followed by the release

of Ca2+-DPA complex from the spore core and associated divalent cations through one or more

channels [14, 65] .

14

Ion transporters in sporulation and germination:

The extrusion of sodium is an important detoxification process in bacterial cells as a high

internal concentration of sodium inhibits many metabolic activities. Na+/H+ antiporters export

Na+ in exchange for H+ driven by a proton electrochemical gradient [68]. ShaA is a Na+/H+

antiporter deemed to be involved in sodium extrusion in B. subtilis and is essential for initiation

of sporulation [69]. Disruption of ShaA results in decreased sporulation but has no effect on

vegetative growth under increased concentration of external sodium [69]. The defect in the early

stages of sporulation may result from an effect on posttranscriptional control of σH due to an

increase in the level of internal Na+. At an early stage of sporulation, the expression of both spoOA

and spoVG under the control of σH is affected by addition of NaCl as the level of σH protein

diminishes in the shaA mutant [69]. Under high concentration of internal Na+, σH may be unable

to form the holoenzyme due to unstable association with RNA polymerase [69].

In B. megatarium ATCC 12872, grmA encodes a Na+/H+ antiporter homologue that shares 47%

amino acid identity with a Na+/H+ antiporter of Enterococcus hirae, NapA. GrmA, a member of

the PA-2 family of membrane transport proteins involved in monovalent cation and proton

antiport is considered to be essential for germination in response to all germinants as grmA

mutants failed to release DPA or lose heat resistance [70].

GerN of B. cereus ATCC 10876 and GrmA of Bacillus megaterium share 58% amino acid

identity and NapA of Enterrococcus hirae shares 43% amino acid identity with B. cereus GerN [66,

70] . Mutation of gerN results in a significant defect in inosine- triggered germination. The defect

in germination seems to be at an initial stage before the spore loses heat resistance wherein the

inosine germination receptor may be functionally coupled to GerN. This suggests that germinant

receptors may be dependent on the function of different ion transport proteins. Both Na+/H+

15

antiport as well as Na+/H+-K+ antiport are catalyzed by an electrogenic ATP-dependent GerN

antiporter, the latter being more rapid. The expression of GerN still remains unknown, whether

it is expressed in vegetative cells of B. cereus or is sporulation specific [66, 67] .

B. cereus has a GerT protein that is homologous to GerN and shares 74% amino acid

identity [71]. GerT is expressed during late stages of sporulation and may be involved in Na+ efflux

due to the sensitivity to NaCl and alkali observed during spore outgrowth in the gerT mutant of

B. cereus [71]. Thus, GerT protein may play a significant role in resumption of growth in B. cereus

spores. During germination of B. cereus ATCC 10876, GerT is required for the remaining inosine

germination of a gerN mutant mediated by GerI [71, 72].

In C. perfringens, GerO and GerQ proteins display both structural and sequence homology

to transporters of monovalent cations which are suggested to be involved in Bacillus spore

germination. GerO is suggested to be Na+/H+-K+ antiporter while GerQ may be a putative Na+

transporter. The expression of both GerO and GerQ occurs in the mother cell during C.

perfringens sporulation. In a rich medium, GerO mutants as well as, to a lesser extent, GerQ

mutants show a defect in spore germination but not with the germinant dodecylamine, which

suggests that monovalent cation transporters may be involved in C. perfringens nutrient-

triggered germination of spores [73].

In spore-forming bacteria, transport of calcium and DPA plays an important role in heat

and radiation resistance of spores as well as response to germination-inducing compounds. Gene

expression during the sporulation process is affected by calcium inside the forespore. A

transcriptome approach by Oomes et al., revealed that the transcription of nearly 305 genes are

influenced by calcium level in sporulating B. subtilis cells [74]. Transcription of genes such as

spoVFA and spoVFB that are responsible for the synthesis of DPA, the sps operon involved in

16

spore coat polysaccharide synthesis as well as other germination genes are induced by Ca2+ [74].

The exact mechanism for the transport of calcium in spores has not yet been elucidated. Most

microorganisms use transport mechanisms such as Ca2+/H+ exchangers to move calcium through

secondary transport in the cell using the energy accumulated in the gradient generation of other

ions [75]. During spore formation, the development of calcium transport systems result in

significant quantities of calcium accumulating in spores [13, 43] . In B. subtilis, a putative P-type

Ca2+-transport ATPase is encoded by yloB which shows similarity to the endo(sarco)plasmic

reticulum (SERCA) and PMR1 Ca2+ transporters which are type IIA P-type ion-motive ATPases in

eukaryotes [76]. The YloB protein forms a phosphorylated intermediate that is Ca2+- dependent

and is expressed by sporulating B. subtilis cells only. Neither the production of viable B. subtilis

spores nor the growth of vegetative cells was affected by the mutation of yloB [76]. However, a

yloB mutation reduced spore resistance to heat and resulted in slower germination of B. subtilis

spores. As the mutant cells were capable of accumulating large amounts of calcium, YloB may be

involved in the transport of other cations such as Mn2+ apart from Ca2+ [76].

During sporulation in B. subtilis, the uptake of the 1:1 chelate of DPA and Ca2+ and its

release during germination is mediated by the heptacistronic spoVA operon encoded proteins

[77]. There is structural homology between the SpoVAD crystal structure from B. subtilis and

thiolase-fold containing enzymes that bind to small aromatic molecules. SpoVAD can specifically

bind with similar affinity to both DPA and Ca2+-DPA [77]. Mutations in the putative SpoVAD

binding pockets of DPA weaken its binding capacity for DPA and abolishes DPA uptake by

developing spores [77].

17

Transposon sequencing (Tn-seq):

Tn-seq, a robust and high throughput screen for the discovery of quantitative genetic

interactions in microorganisms through massively parallel sequencing can be used to identify the

plethora of genes that may play roles in spore germination [78]. Previously, genetic studies of

spore germination have focused mainly on germination mutants that were identified using

methods that require a very large change in germination efficiency (>10-fold), while Tn-Seq can

potentially identify genes that produce important but more subtle changes in germination

efficiency on a genome-wide scale.

A transposon mutagenized library, which contains restriction sites in the inverted repeats

flanking the resistance genes, is first subjected to desired test conditions. This is followed by DNA

extraction and digestion of DNA with restriction enzymes resulting in isolation of fragments

containing the entire transposon flanked by unique genomic sequences. Following this, adapters

are ligated to the fragments, which are PCR amplified and submitted for next generation

sequencing. High throughput sequencing reveals the genomic sequences encompassing the

transposon ends and transposon insertion site. All Tn insertions are mapped to the genome,

allowing quantification of the abundance of each insertion within the cell population.

Comparisons are then drawn between the sample sets and controls to determine the identity of

genes selected for under the tested experimental conditions [84].

Study Objectives:

The aim of this research was to characterize proteins involved in B. subtilis spore

formation and spore germination with a focus on metal ion transporters and additional

germination active proteins. There are many unanswered questions about spore germination,

18

specifically with respect to the regulation of signal transduction and the events that take place

immediately after germinant receptor activation.

In a previous study, proteomic analysis of the spore membrane resulted in the

identification of nearly 100 membrane proteins of which nearly thirty proteins had not been

previously identified in spores. Chapter 2 investigates the role of six proteins (ChaA, YcnL, YflS,

YloB, YugS, ZnuA) from this repertoire of newly identified spore membrane proteins that bear

resemblance to components of identified cation transport systems. These proteins could play

roles in accumulating ions during sporulation and/or rapidly releasing ions during germination.

In B. subtilis, ZnuA and its apparent B. anthracis ortholog, have been suggested to be involved in

zinc transport in vegetative cells [79]. ChaA, has been reported to be a Ca2+/H+ antiporter under

the control of a sporulation-specific sigma factor in the forespore, σG [80]. YloB, which is a P-type

Ca2+ transport ATPase, is expressed during sporulation. YloB may play a role in Ca2+ efflux during

spore germination as spores prepared from a yloB deletion mutant show a slower rate of

germination [76]. YcnL and YflS, may be involved in copper, malate and sodium transport [81,

82]. YugS belongs to an uncharacterized protein family 0053 (UPF0053) and may be involved in

divalent ion transport as several proteins from this family are involved in the transport of

magnesium and cobalt in other bacterial species [83].

Previously, the interaction of proteins during spore germination was studied on a small

scale, focusing on specific interactions one at a time. Chapter 3 describes a Tn-Seq approach that

allows analysis of genetic interactions on the genome scale to identify additional genes that may

play a more subtle role in spore germination. A Tn-insertion library was generated in our

laboratory B. subtilis wild type strain, PS832, using a modified magellan6 transposon insertion

library featuring 5.5 x 104 insertions in over 3,114 genes with ≥ 10 unique insertions per gene

19

[84]. The generated transposon library was subjected to germination conditions with L-valine and

separated into two fractions: a dormant or partially germinated spore population and a fully

germinated population, using a sodium ditriazoate gradient. Following the processing,

normalization and mapping of reads to the genome, comparisons were drawn between the

sample sets. A two-fold difference in reads between the partially germinated sample vs the

germinated sample was used to select the genes of interest. This threshold left 61 genes in total.

Known germination proteins and others known to have germination defects such as coat proteins

were excised from the list, leaving a total of 35 genes. From this point the list was cross

referenced against two inner spore membrane proteome data sets [85][86]. Of the 35 genes, 14

genes were detected in the spore inner membrane proteome of one or both studies. The majority

of the 14 genes are largely uncharacterized, some better annotated than others but none have

been previously studied in the context of spore germination. Putative functions of the genes

varied from general stress, lipid metabolism, to completely uncharacterized. The genes we have

identified likely function in a complementary or supplementary role, and thus deletion mutants

may not result in complete abolishment of germination. From our study, it was seen that most

of the mutant phenotypes were consistent with a decrease in GerA receptor function but the

mechanism affecting GerA-mediated germination remains unknown.

Chapter 4 describes efforts to determine the mechanism by which the ylbC gene affects

germination of B. subtilis spores, a finding demonstrated in Chapter 3, and to understand if ylbC

works with other known genes in altering the production of germinant receptors.

Understanding the formation and germination of bacterial spores is of great importance

in the decontamination of facilities, in the treatment and prevention of spore-initiated disease,

and for numerous industrial and agricultural applications. Spore germination is a double-edged

20

sword involved in disease pathogenesis and a target for easier killing of spores. Thus, research is

intended to seek methods for prevention and/or triggering of spore germination for better spore

decontamination strategies. Studies of germination in B. subtilis have generally been found to be

applicable to the understanding of this process in diverse species, such as B. anthracis, B.

thuringiensis, and Clostridium difficile.

21

REFERENCES

1. Errington J. 1993. Bacillus subtilis sporulation: Regulation of gene expression and control of morphogenesis. Microbiol Rev 57:1-33.

2. Setlow P. 1994. Mechanisms which contribute to the long-term survival of spores of Bacillus species. J Appl Bacteriol Sympos Suppl 76:49S-60S.

3. Piggot PJ, Hilbert DW. 2004. Sporulation of Bacillus subtilis. Curr Opin Microbiol 7:579-86.

4. Piggot PJ, Losick R. Sporulation Genes and Intercompartmental Regulation.483-517. 5. Kay D, Warren SC. 1968. Sporulation in Bacillus subtilis. Morphological changes.

Biochem J 109:819-24. 6. Ryter A. 1965. Morphologic Study of the Sporulation of Bacillus Subtilis. Ann Inst

Pasteur (Paris) 108:40-60. 7. Stragier P, Losick R. 1996. Molecular genetics of sporulation in Bacillus subtilis. Annu

Rev Genet 30:297-341. 8. Hilbert DW, Piggot PJ. 2004. Compartmentalization of gene expression during Bacillus

subtilis spore formation. Microbiol Mol Biol Rev 68:234-62. 9. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation,

heat and chemicals. J Appl Microbiol 101:514-25. 10. Setlow P. 1995. Mechanisms for the prevention of damage to DNA in spores of Bacillus

species. Annu Rev Microbiol 49:29-54. 11. Buchanan CE, Henriques AO, Piggot PJ. 1994. Cell wall changes during bacterial

endospore formation, p 167-186. In Ghuysen J-M, Hakenbeck R (ed), Bacterial Cell Wall. Elsevier Science Publishers, New York, NY.

12. Russell AD. 1982. The destruction of bacterial spores. Academic Press, London. 13. Paidhungat M, Setlow B, Driks A, Setlow P. 2000. Characterization of spores of

Bacillus subtilis which lack dipicolinic acid. J Bacteriol 182:5505-5512. 14. Setlow P. 2003. Spore germination. Curr Opin Microbiol 6:550-556. 15. Paidhungat M, Setlow P. Germination and Outgrowth.537-548. 16. Setlow P. 2014. Germination of spores of Bacillus species: what we know and do not

know. J Bacteriol 196:1297-305. 17. Lai EM, Phadke ND, Kachman MT, Giorno R, Vazquez S, Vazquez JA, Maddock JR,

Driks A. 2003. Proteomic analysis of the spore coats of Bacillus subtilis and Bacillus anthracis. J Bacteriol 185:1443-54.

18. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev 64:548-572.

19. Popham DL, Helin J, Costello CE, Setlow P. 1996. Muramic lactam in peptidoglycan of Bacillus subtilis spores is required for spore outgrowth but not for spore dehydration or heat resistance. Proc Natl Acad Sci USA 93:15405-10.

20. Paidhungat M, Setlow P. 2001. Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. J Bacteriol 183:3982-3990.

21. Hudson KD, Corfe BM, Kemp EH, Feavers IM, Coote PJ, Moir A. 2001. Localization of GerAA and GerAC germination proteins in the Bacillus subtilis spore. J Bacteriol 183:4317-4322.

22. Gerhardt P, Marquis RE. 1989. Spore thermoresistance mechanisms, p 43-63. In Smith I, Slepecky RA, Setlow P (ed), Regulation of Prokaryotic Development. American Society for Microbiology, Washington, D.C.

23. Losick R, Stragier P. 1992. Crisscross regulation of cell-type-specific gene expression during development in B.subtilis. Nature 355:601-4.

24. Molle V, Fujita M, Jensen ST, Eichenberger P, Gonzalez-Pastor JE, Liu JS, Losick R. 2003. The Spo0A regulon of Bacillus subtilis. Mol Microbiol 50:1683-701.

22

25. Foster SJ, Johnstone K. 1990. Pulling the trigger: the mechanism of bacterial spore germination. Mol Microbiol 4:137-141.

26. Gould GW, Hurst A. 1969. The bacterial spore. Academic Press, London; New York. 27. Moir A, Kemp EH, Robinson C, Corfe BM. 1994. The genetic analysis of bacterial spore

germination. J Appl Bacteriol 77:9S-16S. 28. Jedrzejas MJ, Setlow P. 2001. Comparison of the binuclear metalloenzymes

diphosphoglycerate-independent phosphoglycerate mutase and alkaline phosphatase: their mechanism of catalysis via a phosphoserine intermediate. Chem Rev 101:607-18.

29. Moir A, Corfe BM, Behravan J. 2002. Spore germination. Cell Mol Life Sci 59:403-409. 30. Jack DL, Paulsen IT, Saier MH. 2000. The amino acid/polyamine/organocation (APC)

superfamily of transporters specific for amino acids, polyamines and organocations. Microbiology 146 ( Pt 8):1797-1814.

31. Atluri S, Ragkousi K, Cortezzo DE, Setlow P. 2006. Cooperativity between different nutrient receptors in germination of spores of Bacillus subtilis and reduction of this cooperativity by alterations in the GerB receptor. J Bacteriol 188:28-36.

32. Stewart KA, Setlow P. 2013. Numbers of individual nutrient germinant receptors and other germination proteins in spores of Bacillus subtilis. J Bacteriol 195:3575-82.

33. Ghosh S, Scotland M, Setlow P. 2012. Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. J Bacteriol 194:2221-7.

34. Yi X, Liu J, Faeder JR, Setlow P. 2011. Synergism between different germinant receptors in the germination of Bacillus subtilis spores. J Bacteriol 193:4664-71.

35. Li Y, Jin K, Ghosh S, Devarakonda P, Carlson K, Davis A, Stewart KA, Cammett E, Pelczar Rossi P, Setlow B, Lu M, Setlow P, Hao B. 2014. Structural and functional analysis of the GerD spore germination protein of Bacillus species. J Mol Biol 426:1995-2008.

36. Yon JR, Sammons RL, Smith DA. 1989. Cloning and sequencing of the gerD gene of Bacillus subtilis. J Gen Microbiol 135:3431-45.

37. Kemp EH, Sammons RL, Moir A, Sun D, Setlow P. 1991. Analysis of transcriptional control of the gerD spore germination gene of Bacillus subtilis. J Bacteriol 173:4646-4652.

38. Vepachedu VR, Setlow P. 2007. Analysis of interactions between nutrient germinant receptors and SpoVA proteins of Bacillus subtilis spores. FEMS Microbiol Lett 274:42-7.

39. Paidhungat M, Setlow P. 1999. Isolation and characterization of mutations in Bacillus subtilis that allow spore germination in the novel germinant D-alanine. J Bacteriol 181:3341-3350.

40. Cabrera-Martinez RM, Tovar-Rojo F, Vepachedu VR, Setlow P. 2003. Effects of overexpression of nutrient receptors on germination of spores of Bacillus subtilis. J Bacteriol 185:2457-64.

41. Paidhungat M, Setlow P. 2000. Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. J Bacteriol 182:2513-2519.

42. Kolodziej BJ, Slepecky RA. 1962. A copper requirement for the sporulation of Bacillus megaterium. Nature 194:504-5.

43. Kolodziej BJ, Slepecky RA. 1964. Trace Metal Requirements for Sporulation of Bacillus Megaterium. J Bacteriol 88:821-30.

44. Levinson HS, Hyatt MT. 1964. Effect of Sporulation Medium on Heat Resistance, Chemical Composition, and Germination of Bacillus Megaterium Spores. J Bacteriol 87:876-86.

45. Leuschner RGK, Lillford PJ. 2000. Effects of hydration on molecular mobility in phase-bright Bacillus subtilis spores. Microbiology 146 ( Pt 1):49-55.

46. Seto-Young DL, Ellar DJ. 1981. Studies on calcium transport during growth and sporulation. Microbios 30:191-208.

47. Stewart BT, Halvorson HO. 1953. Studies on the spores of aerobic bacteria. I. The occurrence of alanine racemase. J Bacteriol 65:160-6.

23

48. Matsushita T, Ueda T, Kusaka I. 1986. Purification and characterization of Ca2+/H+ antiporter from Bacillus subtilis. Eur J Biochem 156:95-100.

49. Igura N, Kamimura Y, Islam MS, Shimoda M, Hayakawa I. 2003. Effects of minerals on resistance of Bacillus subtilis spores to heat and hydrostatic pressure. Appl Environ Microbiol 69:6307-10.

50. YP DV. 2004. The role of calcium in bacterial spore germination. Microbes and Environments 19(3):199-202

51. Heffron JD, Sherry N, Popham DL. 2011. In vitro studies of peptidoglycan binding and hydrolysis by the Bacillus anthracis germination-specific lytic enzyme SleB. J Bacteriol 193:125-31.

52. Kamat AS, Lewis NF, Pradhan DS. 1985. Mechanism of Ca2+ and dipicolinic acid requirement for L-alanine induced germination of Bacillus cereus BIS-59 spores. Microbios 44:33-44.

53. Keynan A, Murrell WG, Halvorson HO. 1962. Germination properties of spores with low dipicolinic acid content. J Bacteriol 83:395-9.

54. Schroeter R, Schlisio S, Lucet I, Yudkin M, Borriss R. 1999. The Bacillus subtilis regulator protein SpoIIE shares functional and structural similarities with eukaryotic protein phosphatases 2C. FEMS Microbiol Lett 174:117-23.

55. Inaoka T, Matsumura Y, Tsuchido T. 1999. SodA and manganese are essential for resistance to oxidative stress in growing and sporulating cells of Bacillus subtilis. J Bacteriol 181:1939-43.

56. Granger AC, Gaidamakova EK, Matrosova VY, Daly MJ, Setlow P. 2011. Effects of Mn and Fe levels on Bacillus subtilis spore resistance and effects of Mn2+, other divalent cations, orthophosphate, and dipicolinic acid on protein resistance to ionizing radiation. Appl Environ Microbiol 77:32-40.

57. Chander M, Setlow B, Setlow P. 1998. The enzymatic activity of phosphoglycerate mutase from gram-positive endospore-forming bacteria requires Mn2+ and is pH sensitive. Can J Microbiol 44:759-67.

58. Henriques AO, Melsen LR, Moran CP, Jr. 1998. Involvement of superoxide dismutase in spore coat assembly in Bacillus subtilis. J Bacteriol 180:2285-91.

59. Eisenstadt E, Fisher S, Der CL, Silver S. 1973. Manganese transport in Bacillus subtilis W23 during growth and sporulation. J Bacteriol 113:1363-72.

60. Wolf FI, Cittadini A. 2003. Chemistry and biochemistry of magnesium. Mol Aspects Med 24:3-9.

61. Scribner H, Eisenstadt E, Silver S. 1974. Magnesium transport in Bacillus subtilis W23 during growth and sporulation. J Bacteriol 117:1224-30.

62. Williams RJP. 1981. The Bakerian Lecture, 1981: Natural Selection of the Chemical Elements. procroyasocilon2 Proceedings of the Royal Society of London Series B, Biological Sciences 213:361-397.

63. Loeb LA, James EA, Waltersdorph AM, Klebanoff SJ. 1988. Mutagenesis by the autoxidation of iron with isolated DNA. Proc Natl Acad Sci USA 85:3918-22.

64. Keynan A. 1978. Spore structure and its relations to resistance, dormancy, and germination. Spores VII American Society for Microbiology, Washington, DC:43-53.

65. Swerdlow BM, Setlow B, Setlow P. 1981. Levels of H+ and other monovalent cations in dormant and germinating spore of Bacillus megaterium. J Bacteriol 148:20-29.

66. Thackray PD, Behravan J, Southworth TW, Moir A. 2001. GerN, an antiporter homologue important in germination of Bacillus cereus endospores. J Bacteriol 183:476-482.

67. Southworth TW, Guffanti AA, Moir A, Krulwich TA. 2001. GerN, an endospore germination protein of Bacillus cereus, is an Na(+)/H(+)-K(+) antiporter. J Bacteriol 183:5896-903.

24

68. Padan E, Schuldiner S. 1994. Molecular biology of Na+/H+ antiporters: molecular devices that couple the Na+ and H+ circulation in cells. Biochim Biophys Acta 1187:206-10.

69. Kosono S, Ohashi Y, Kawamura F, Kitada M, Kudo T. 2000. Function of a principal Na(+)/H(+) antiporter, ShaA, is required for initiation of sporulation in Bacillus subtilis. J Bacteriol 182:898-904.

70. Tani K, Watanabe T, Matsuda H, Nasu M, Kondo M. 1996. Cloning and sequencing of the spore germination gene of Bacillus megaterium ATCC 12872: similarities to the NaH-antiporter gene of Enterococcus hirae. Microbiol Immunol 40:99-105.

71. Senior A, Moir A. 2008. The Bacillus cereus GerN and GerT protein homologs have distinct roles in spore germination and outgrowth, respectively. J Bacteriol 190:6148-52.

72. Clements MO, Moir A. 1998. Role of the gerI operon of Bacillus cereus 569 in the response of spores to germinants. J Bacteriol 180:6729-6735.

73. Paredes-Sabja D, Setlow P, Sarker MR. 2009. GerO, a putative Na+/H+-K+ antiporter, is essential for normal germination of spores of the pathogenic bacterium Clostridium perfringens. J Bacteriol 191(12):3822-31.

74. Oomes SJ, Jonker MJ, Wittink FR, Hehenkamp JO, Breit TM, Brul S. 2009. The effect of calcium on the transcriptome of sporulating B. subtilis cells. Int J Food Microbiol 133:234-42.

75. Smith RJ. 1995. Calcium and bacteria. Adv Microb Physiol 37:83-133. 76. Raeymaekers L, Wuytack E, Willems I, Michiels CW, Wuytack F. 2002. Expression of

a P-type Ca(2+)-transport ATPase in Bacillus subtilis during sporulation. Cell Calcium 32:93.

77. Li Y, Davis A, Korza G, Zhang P, Li YQ, Setlow B, Setlow P, Hao B. 2012. Role of a SpoVA protein in dipicolinic acid uptake into developing spores of Bacillus subtilis. J Bacteriol 194:1875-84.

78. Van Opijnen T, Bodi KL, Camilli A. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods 6:767-72.

79. Gaballa A, Helmann JD. 1998. Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis. J Bacteriol 180:5815-21.

80. Fujisawa M, Wada Y, Tsuchiya T, Ito M. 2009. Characterization of Bacillus subtilis YfkE (ChaA): a calcium-specific Ca2+/H+ antiporter of the CaCA family. Arch Microbiol 191:649-57.

81. Tanaka K, Kobayashi K, Ogasawara N. 2003. The Bacillus subtilis YufLM two-component system regulates the expression of the malate transporters MaeN (YufR) and YflS, and is essential for utilization of malate in minimal medium. Microbiology 149:2317-29.

82. Chillappagari S, Miethke M, Trip H, Kuipers OP, Marahiel MA. 2009. Copper acquisition is mediated by YcnJ and regulated by YcnK and CsoR in Bacillus subtilis. J Bacteriol 191:2362-70.

83. Gibson MM, Bagga DA, Miller CG, Maguire ME. 1991. Magnesium transport in Salmonella typhimurium: the influence of new mutations conferring Co2+ resistance on the CorA Mg2+ transport system. Mol Microbiol 5:2753-62.

84. Johnson CM, Grossman AD. 2014. Identification of host genes that affect acquisition of an integrative and conjugative element in Bacillus subtilis. Mol Microbiol 93:1284-301.

85. Zheng L, Abhyankar W, Ouwerling N, Dekker HL, van Veen H, van der Wel NN, Roseboom W, de Koning LJ, Brul S, de Koster CG. 2016. Bacillus subtilis Spore Inner Membrane Proteome. J Proteome Res 15:585-94.

86. Chen Y, Barat B, Ray WK, Helm RF, Melville SB, Popham DL. 2019. Membrane Proteomes and Ion Transporters in Bacillus anthracis and Bacillus subtilis Dormant and Germinating Spores. J Bacteriol 201(6).

25

Figure 1.1. Spore structure. Cartoon depicting the different structural components of the

dormant spore. The dehydrated core, which stores all the nucleic acids is surrounded by multiple

layers including an inner membrane, a germ cell wall, the cortex, an outer membrane, and

proteinaceous coats that contribute to spore resistance capacities and dormancy. An additional

exosporium layer is present in B. anthracis spores but this is not present in all species.

26

Figure 1.2. Bacillus subtilis sporulation. The events of sporulation occur when nutrients decrease

to a certain critical point in the environment of B. subtilis. Sporulation takes approximately eight

hours from onset to complete the assembly of a dormant spore. The beginning steps in

sporulation involve the segregation of two copies of the chromosome along an axial filament to

the two polar ends of the cell. A septum is formed asymmetrically towards one end of the cell

separating it into two compartments, each containing a copy of the chromosome. The larger

mother cell compartment engulfs the smaller forespore compartment. The forespore is then

surrounded by two cell membranes, and cortex peptidoglycan is deposited between the two

membranes. The inner and outer coat layers are built around the framework of the outer

forespore membrane and the spore undergoes maturation during which it achieves full

dormancy and resistance properties. Finally, the mother cell lyses to release the dormant spore.

27

Figure 1.3. Cascade of sigma factors. Simplified schematic depicting the crisscross regulation of

sigma factors involved in sporulation. Each sigma factor is required for activity of the next in a

temporal manner which keeps the mother cell and the forespore coordinated temporally.

28

Figure 1.4. Spore germination. Germination is initated when nutrients called germinants contact

Ger receptors located in the inner forespore membrane. During Stage 1 there is release of Ca2+-

DPA and other ions followed by partial rehydration of the core. Stage 2 features breakdown of

the cortex by cortex-lytic enzymes, coinciding with further rehydration of the core and

resumption of metabolic activities.

29

Figure 1.5. Organization of GerA receptor. The GerA receptor is encoded by the tricistronic gerA

operon. The operon contains three genes forming the three specific subunits GerAA, GerAB and

GerAC. Each of these subunits are required and they interact to form a functional GerA receptor.

The predicted membrane topologies of the proteins are indicated, with the core of the spore on

the bottom of the figure.

30

Chapter Two

Membrane Proteomes and Ion Transporters in Bacillus

anthracis and Bacillus subtilis Dormant and Germinating Spores

Yan Chen^, Bidisha Barat^, W. Keith Ray, Richard F. Helm, Stephen B. Melville, and David L. Popham#. Membrane proteomes and ion transporters in Bacillus anthracis and Bacillus subtilis dormant and germinating spores. Journal of Bacteriology. 2019 Mar 15;201(6): e00662-18.

^Y.C. and B.B. contributed equally to this work.

#Address correspondence to David Popham, dpopham@vt.edu

31

ATTRIBUTIONS

Yan Chen and Bidisha Barat contributed equally in performing the research,

experimentation, and data analysis of the material presented. David L. Popham was the principle

investigator. Yan Chen is responsible for the work presented in Figure 2.1 in addition to Tables

2.1, 2.2, 2.3, and 2.4. Bidisha is responsible for work presented in Figures 2.2, 2.3, 2.4, 2.5, 2.6,

and S1 in addition to Tables 2.5, 2.6, and S1. Yan, Bidisha, and David contributed to the writing

of the manuscript.

32

ABSTRACT

Bacterial endospores produced by Bacillus and Clostridium species can remain dormant

and highly resistant to environmental insults for long periods but can also rapidly germinate in

response to a nutrient rich environment. Multiple proteins involved in sensing and responding

to nutrient germinants, initiating solute and water transport, and accomplishing spore wall

degradation are associated with the membrane surrounding the spore core. In order to more

fully catalog proteins that may be involved in spore germination as well as to identify protein

changes taking place during germination, unbiased proteomic analyses of membrane

preparations isolated from dormant and germinated spores of Bacillus anthracis and Bacillus

subtilis were undertaken. Membrane-associated proteins were fractionated by SDS-PAGE, gel

slices were trypsin-digested, and extracted peptides were fractionated by liquid chromatography

and analyzed by MALDI-TOF/TOF tandem mass spectrometry. Over 500 proteins were identified

from each preparation. Bioinformatic methods were used to characterize proteins with regard to

membrane association, cellular function, and conservation across species. Numerous proteins

not previously known to be spore associated, 6 in B. subtilis and 68 in B. anthracis, were

identified. Relative quantitation based on spectral counting indicated that the majority of spore

membrane proteins decrease in abundance during the first 20 min of germination. The spore

membranes contained several proteins thought to be involved in the transport of metal ions, a

process that plays a major role in spore formation and germination. Analyses of mutant strains

lacking these transport proteins implicated YloB in the accumulation of calcium within the

developing forespore.

33

IMPORTANCE

Bacterial endospores can remain dormant and highly resistant to environmental insults

for long periods but can also rapidly germinate in response to a nutrient rich environment. The

persistence and subsequent germination of spores contributes to their colonization of new

environments and to the spread of certain diseases. Proteins of Bacillus subtilis and Bacillus

anthracis were identified that are associated with the spore membrane, a position that can allow

them to contribute to germination. A set of identified proteins that are predicted to carry out ion

transport were examined for their contributions to spore formation, stability and germination.

Greater knowledge of spore formation and germination can contribute to the development of

better decontamination strategies.

34

INTRODUCTION

Bacterial endospores produced by Bacillus, Clostridium, and related genera can remain

dormant for extended periods of time. In addition, these spores are highly resistant to many of

the chemical and physical treatments commonly employed to reduce bacterial contamination

(1). Upon exposure to conditions conducive to resumption of vegetative growth these spores

can rapidly germinate and resume metabolism (2, 3). These factors allow certain spore-forming

species to act as significant human pathogens including potential biological weapons (4), as

agents of food poisoning and spoilage (5), and, on a positive note, as effective vehicles for

delivery of antigens or metabolic and enzymatic activities of industrial, consumer, or patient

benefit (6-8).

Spore dormancy and resistance properties are directly related to the relative dehydration

of the spore core (cytoplasm) and high core concentrations of solutes such as calcium dipicolinate

(Ca2+DPA) (1). The dehydrated and metabolically inactive state of the core is maintained by the

spore membrane, which exists in a novel non-fluid state (9), and the surrounding spore cortex

peptidoglycan cell wall (10). Spore germination proceeds through the rapid release of the core

Ca2+DPA pool, a concomitant uptake of water (3), and the subsequent return of the spore

membrane fluidity (9). This is immediately followed by degradation of most of the cortex wall

(11), allowing full core rehydration, resumption of metabolic activity, and spore outgrowth.

Knowledge of the mechanisms driving spore germination will allow targeting of this process for

the improvement of decontamination regimens as well as regulating germination during antigen

or activity delivery (12).

Genome sequences and transcriptome profiling have produced predictions of proteins

present within spores (13-17). A number of proteome studies have examined spore fractions in

35

several species (16, 18-26). Most of these studies however were biased towards soluble proteins,

as opposed to membrane-associated proteins, even though many of the proteins currently

known to function in the spore germination process are associated with the spore membrane.

These include germinant receptor complexes (27, 28), the SpoVA proteins involved in Ca2+DPA

transport (29-32), the GerD lipoprotein (33, 34), and the YpeB-SleB proteins involved in cortex

degradation (35). Some of these germination-associated proteins are known to decrease in

amount or in their membrane-associations during germination (34, 35).

The goals of the current study were to catalog the spore membrane proteomes of Bacillus

subtilis and Bacillus anthracis and to examine changes in these proteomes during germination.

Over 500 proteins were identified in each proteome, and approximately 100 of these were found

to contain amino acid sequences predicted to result in integral or peripheral membrane

association. The majority of previously identified membrane-associated germination proteins

were identified, and many proteins were identified for the first time in the membrane proteomes

of both species. Spectral counting methods for determining protein abundance changes during

germination revealed that the levels of many spore membrane proteins decreased significantly

during germination. The functions of several spore membrane proteins predicted to be involved

in ion transport were subsequently examined.

36

RESULTS

Proteins identified in dormant spore membrane preparations. Membranes were

isolated from three independent preparations of B. anthracis and B. subtilis dormant spores.

Proteins were separated by SDS-PAGE followed by gel slice preparation and processing to provide

peptides that were submitted to LC separation and MALDI-TOF/TOF analysis. A total of 603 and

592 proteins were identified in B. subtilis and in B. anthracis samples, respectively. Bioinformatic

predictions suggested that 104 (17%) and 87 (15%) of these proteins were membrane-associated

proteins in B. subtilis and B. anthracis, respectively. Many ribosomal proteins and proteins

associated with macromolecular structures such as spore coats and exosporium were also

identified, presumably due to pelleting of these structures during centrifugation of membranes

or due to association of these structures with the membrane. Predicted membrane proteins

were further categorized based on the type of membrane association and number of predicted

membrane-spanning helices (Fig. 2.1). The presence of a wide variety of lipoprotein, peripheral,

monotopic, and integral polytopic membrane proteins indicates that the method used was

successful in recovering a broad membrane proteome. A total of 11 known germination-related

membrane proteins were identified in B. subtilis samples (Table 2.1). Similarly, a total of 5 known

germination related proteins were identified in B. anthracis samples (Table 2.1). The remaining

identified membrane proteins have predicted functions in 14 COG function categories.

Proteins identified in germinated spore membrane preparations. A portion of each

spore preparation was exposed to nutrient germinants until the optical density of the suspension

had decreased 50%, which resulted in germination of ≥95% of the spores. The membrane

fractions were then isolated, and the proteins were separated by SDS-PAGE. Collection and

processing of gel slices provided samples for LC separation and MALDI-TOF/TOF analysis. A total

37

of 497 and 508 proteins were identified in B. subtilis and B. anthracis germinated spore

membrane profiles, respectively. In each species, some proteins (82 and 88 proteins in B. subtilis

and B. anthracis, respectively) were identified only in the germinated samples and not in the

dormant spore samples, and these were predominantly predicted to be cytoplasmic proteins. Of

the 52 (10.5%) and 38 (7.5%) proteins that were predicted to be membrane-associated in

germinated B. subtilis and B. anthracis spores, respectively, all but two in B. subtilis (P40780 and

Q01464) were also present in the dormant spore samples.

Novel membrane proteins identified in spore membrane fractions. The spore

membranes are derived from the sporangium cytoplasmic membranes during the engulfment

stage of sporulation, so it was no surprise to find that membrane proteins expected to be in

vegetative cells were present in spore membrane fractions. Among the 104 predicted membrane

proteins we detected in B. subtilis dormant spores, 98 and 78 had been identified in previous

spore and vegetative proteome studies, respectively, and 75 of these were previously detected

in both cell types. Among the six predicted membrane proteins first identified in spores here:

RbsA, YckB, YerB, YpmQ, YqaR, and YuaB; 2 have unknown functions and others have predicted

COG functions in amino acid transport and metabolism; carbohydrate transport and metabolism,

colony structure, and energy production and conversion. GerAC, GerBC, GerKC, GerD, PrkC,

SpoVAC, SpoVAD, SpoVAF, YfkR, YhcN, and YpeB are known germination-active proteins that

were detected in spores in this study and previously (35, 36) (Table 2.1).

A similar analysis of the B. anthracis samples revealed that 12 predicted membrane

proteins were reported previously in a vegetative cell proteome study, and 12 proteins were

reported previously in spore proteome studies, with one protein, YlaJ/BA2560, being found in

both. Among the 75 predicted membrane proteins first identified in spores here, 16 are presently

38

listed with unknown functions, 5 are known germination-active proteins (Table 2.1), and the rest

sort into 12 different COG categories.

Membrane proteins under control of sporulation-specific sigma factors. Predicted

membrane-associated proteins identified in B. subtilis samples were searched against the

relatively well-characterized sporulation transcriptomes of that species (15, 17, 22, 37). Of the

104 predicted membrane-associated proteins, 29 have been shown to be controlled at the

transcriptional level by the sporulation-specific sigma factors E, F, G, and K (Table S3). Only

a small number of membrane proteins were identified from the mother cell-specific σE and K

regulons, 4 and 2 proteins, respectively. The remaining membrane proteins for which

transcriptome data is available were in the forespore-specific F (4 proteins) and G (19 proteins)

regulons, though the similarity between these two sigma factors results in some overlap of their

regulons (17). The genes of 10 known germination-active proteins identified are all within the G

regulon. Eight G-dependent proteins had not been previously detected in spore proteomes.

Among these, YutC, YhcC, YrbG, and YqfX have unknown functions, while YveA, YwjE, YitG, and

YthA were categorized into amino acid transport and metabolism, lipid biogenesis and

metabolism, general transporter, and energy production and conversion, respectively.

Similarities between the spore membrane proteomes in the two Bacillus species.

Searches using the BLAST program were done to compare the predicted membrane proteins

identified in samples from each species. Fifty-one B. anthracis spore membrane proteins showed

high similarity to 48 spore membrane proteins identified in B. subtilis (Table 2.2). Forty-five of

these proteins were considered to be orthologous, based on A) a high level of amino acid

sequence identity (>23%) and similarity (>42%) across an alignment of >62% of the protein

sequences and B) synteny. Among these, GerD, MisCA, SpoVAC, SpoVAD, SpoVAF, YetF, YpeB,

39

YthA, and YutC have been previously identified in spores under more defined studies and/or were

expressed in the forespore-specific F and G regulons. Several of these are known germination-

active proteins. MisCA (SpoIIIJ) is required for activation of G after engulfment of the forespore

is completed (38). YthA was suggested to compensate for the loss of cytochrome aa3, which is

critical for sporulation as one of two heme copper terminal oxidases in B. subtilis (39). There is

no known function reported for YutC and YetF. This leaves eight proteins that were detected in

both species and had not been previously identified in spore proteomes or sporulation-specific

regulons. ArtP, MetQ, and ZnuA are components of ABC transporters involved in amino acid or

inorganic ion transport. YpmQ is involved in assembly of a copper center in cytochrome c

oxidase, which has an important function in energy conversion and metabolism (40). YyxA was

predicted to be a serine protease due to its sequence similarity to the S1B peptidase family.

YndM, YugS and YkrK are proteins of unknown function.

Three B. subtilis membrane proteins, YhcC, YveA, and YitG, that are expressed in the G

regulon (17, 37) and do not have similar proteins in the B. anthracis protein database, were

detected. Three other G regulon proteins, YhbJ, YrbG, and YwjE (37), have highly similar proteins

in B. anthracis (BAS4465, BAS4309, and BAS5195, respectively) but were only detected in B.

subtilis.

Membrane protein changes during spore germination. Spectral counting methods (41,

42) were applied to determine protein abundance information before and after spore

germination. To test the validity of this method, we compared the ratio changes of proteins in

this data to more precise, previously published quantification data for several germination

proteins (43)(Table 2.3). The trends in terms of proteins increasing, decreasing, or not changing

in membrane association during germination were generally consistent in the two data sets with

40

only one protein, SpoVAC, exhibiting an inverse trend in the two studies. The decreased

abundance of B. anthracis proteins BAS2560, BAS1302, and BAS4323 after spore germination

was also consistent with a previous whole spore quantitative proteomic study (21). On the other

hand, our results showed that BAS0812 and BAS3922 decreased 5.9- and 3.7-fold respectively,

and BAS0405 increased 2-fold after spore germination, but these proteins showed no change in

quantity in the previous study (21). Preliminary protein quantity changes during germination

were determined for 99 B. subtilis and 83 B. anthracis spore membrane proteins. Strikingly, most

of the membrane proteins (>70%) in both species were either not detected or greatly reduced in

quantity after spore germination (73 B. subtilis proteins and 65 B. anthracis proteins) (Table 2.4).

In B. subtilis samples, two membrane proteins, YtxH and MinD, were present in germinated spore

samples that were not detected in the dormant spore samples.

Growth and sporulation of strains lacking putative ion transporters present in spore

membranes. Six proteins (ZnuA, YcnL, ChaA, YflS, YloB, YugS) identified in one or both of the

spore membrane proteomes are similar to components of known cation transport systems.

These proteins may play distinct roles in the accumulation of ions during sporulation and/or the

rapid release of ions during germination. Single and multiple mutants of the putative ion

transporter genes in B. subtilis were obtained or generated, and the effects of these mutations

were analyzed.

Cultures of B. subtilis strains lacking putative ion transporters were allowed to sporulate

for 3 days, and the total and heat resistant viable counts were determined. At this time point,

essentially no vegetative cells were visible by microscopy, and all of the remaining cells appeared

to be spores (Fig. 2.2 and data not shown). All strains containing a yloB deletion showed a

decrease in both total and heat resistant cfu/ml in comparison to the wild type strain (Table 2.5).

41

This could potentially result from decreased vegetative growth, a low percentage of spore

formation or completion of sporulation, or death of spores. When viewed under the microscope,

40%-50% of spores from all the strains containing a yloB deletion were phase dark (Fig. 2.2). The

phase dark spore phenotype (loss of refractility) suggests the formation of unstable spores.

Several of the multiple mutants lacking yloB also exhibited a relative decrease in heat resistance

(a low ratio of heated to unheated cfu/ml). Strains without a yloB deletion, such as DPVB706,

resembled the wild type phenotypically wherein >90% of the spores are phase bright. In order to

more closely analyze the effect of mutations on sporulation and germination, four strains were

chosen for further study: PS832 (wild type), DPVB693 (ΔyloB), DPVB706 (ΔznuA ΔyflS Δycnl;

abbreviated “Δ3”), and DPVB722 (ΔznuA ΔyflS Δycnl ΔyloB ΔyugS::mls ΔchaA::spec; abbreviated

“Δ5ΔyloB”).

The growth and sporulation of strains were examined following inoculation into 2xSG

medium at 37°C. All four strains grew and reached the initiation of sporulation (T0) at similar rates

(Fig. S1A). Samples were collected at various time points for assay of GDH activity, an early

sporulation marker, and DPA accumulation, a late sporulation marker. The timing and quantity

of GDH activity was reasonably similar for all four strains, suggesting that the early stages of

sporulation were not affected in B. subtilis strains with a yloB deletion (Fig. S1B). The four strains

accumulated similar amounts of DPA (Fig. S1C), though for DPVB693 (ΔyloB) and DPVB722

(Δ5ΔyloB) DPA accumulation may have been slightly reduced in comparison PS832 (wild type)

and DPVB706 (Δ3). This suggests that the mutant strains with a yloB deletion may be partially

defective in the uptake or maintenance of DPA during late-stage sporulation.

Spores were generated from the wild type and three mutant strains in CDSM minimal

medium to which defined concentrations of Ca2+ were added. (The various components used to

42

produce the CDSM contain some residual Ca2+ that allows growth and spore formation. The

concentrations indicated are the Ca2+ added in addition to those residual amounts.) With 1 mM

added Ca2+, all four strains produced similar numbers of heat resistant spores (Table 2.6). As

added Ca2+ was decreased from 1 mM to 0, the number of heat resistant spores produced by the

wild type and DPVB706 (Δ3) strains decreased 18- and 19-fold, respectively, whereas the number

of heat resistant spores produced by DPVB693 (ΔyloB) and DPVB722 (Δ5ΔyloB) decreased 43-

and 181-fold, respectively (Table 2.6). Similar dilution experiments with Mn2+ and Fe3+, in the

presence of 1 mM Ca2+, showed no differences between the spore formation rates among these

strains (data not shown). This suggests that there may be a high-affinity transporter for Ca2+ that

is nonfunctional in the yloB mutant strains, which is consistent with the observation that yloB

deletion strains appear to produce unstable spores.

Quantification of metal ions in cellular compartments during sporulation. PS832 (wild

type) and DPVB693 (ΔyloB) were grown to sporulation in 2xSG medium at 37°C and were

harvested at T6 or T8. The separation of mother cell and forespore contents was achieved

through lysozyme treatment and differential centrifugation, followed by the quantification of

Ca2+ using atomic emission spectroscopy. During sporulation, the Ca2+ content in the wild type

was far greater in the forespore than in the mother cell, while in the yloB deletion mutant the

Ca2+ content was nearly equal in the forespore and mother cell compartments (Fig. 2.3). This

suggests that the transport of Ca2+ from the mother cell to the forespore may be affected in the

yloB deletion mutant. In addition, at both time points, the yloB mutant sporangia contained

≤65% of the total Ca2+ found in the wild type sporangia, suggesting that the failure to concentrate

Ca2+ in the forespore impaired the overall Ca2+ accumulation.

43

Assays of yloB mutant spore characteristics were complicated by the presence of a mixed

population of phase bright and phase dark spores, which made varying contributions to

normalizing measurements such as cfu and OD. Phase bright spores were therefore further

purified using density gradients. Purified phase bright spores were extracted with HCl and the

amounts of several metal ions were quantified using atomic emission spectroscopy (Fig. 2.4).

Phase bright spores of the yloB deletion strain (DPVB693) contained amounts of all ions similar

to those of wild type spores. A surprising observation was a significant increase (p≤0.05) in the

levels of Mg2+ and Mn2+ in the sextuple transporter mutant in comparison to the wild type. This

difference in ion content between strain DPVB722 (Δ5ΔyloB) and strains DPVB693 (ΔyloB) and

DPVB706 (Δ3) suggested to us that the additional mutations in yugS or chaA that are present in

DPVB722 (Δ5ΔyloB) might be responsible. We therefore assayed ion contents of spores produced

by strains DPVB715 (ΔyugS::mls) and DPVB716 (ΔchaA::spec). These spores were

indistinguishable from those of the wild type (Fig. 2.4).

Germination rate and release of ions during germination. Purified phase bright spores

were heat activated and stimulated to germinate by addition of 10 mM L-alanine. The rate of

germination as assayed by OD decrease was slower in the strains with a yloB deletion than for

the wild type (Fig. 2.5). The release of Ca2+ and K+ during spore germination was similar for all

strains (Fig. 2.6). The release of Mg2+ and Mn2+ was also similar for strains except for the sextuple

mutant, DPVB722 (Δ5ΔyloB), which released significantly larger amounts than the wild type. The

release of K+ and Mg2+ appeared to be essentially complete within three minutes of the start of

germination, whereas the release of Ca2+ and Mn2+ continued to increase gradually for 10-20

minutes.

44

DISCUSSION

Proteins associated with the membranes separating the mother cell and forespore play

crucial roles in communication between the cells during sporulation, allowing the two cells to

coordinate the timing of gene expression changes and morphological development. Membrane

proteins localized at the inner spore membrane have been demonstrated to play key roles in

multiple stages of spore germination. In addition, germination processes such as ion efflux and

water influx are likely to involve membrane proteins, yet few proteins involved in these processes

have been identified. The goal of this study was to compare and contrast spore membrane-

associated proteins present in two Bacillus species in an effort to further our understanding of

cell differentiation processes at the molecular level and to identify new germination-active

proteins. A gel-based approach was used to provide a set of integral membrane proteins,

lipoproteins, and peripheral membrane proteins. This study identified 65 membrane-associated

spore proteins that had not been previously reported in any B. subtilis or B. anthracis vegetative

or spore proteomic study. The percentages of proteins identified that are predicted to be

membrane associated were high, 15-17% of all proteins identified, which is a significant

improvement over some previous spore proteomic studies (<5%) (19, 21, 22) and similar to more

recent studies (25, 26). Identification of these proteins may provide a pathway to better

understand the role of membrane proteins during sporulation and germination.

To provide preliminary information about the fate of spore membrane proteins during

germination, relative quantities were derived using label-free spectral counting methods. This

strategy is based on the empirical observation that the amount of unique MS/MS spectrum

counts of a protein has strong linear correlation with relative protein abundance (41, 42).

Although this method is not as accurate as targeted MRM-based methods, it has higher dynamic

45

range than other mass spectrometry quantification methods (44) and therefore is a popular

method to detect global protein changes between experimental groups. Note that this relative

quantification method was established using data generated by electrospray ionization mass

spectrometry. The limitations of applying this method on data generated by MALDI mass

spectrometry have not been previously examined. However, the relative quantity values for

multiple proteins acquired in this work were consistent with those acquired in our previous MRM

study (43) and a previous stable isotope-labeled quantitative study (21), suggesting that this

method is applicable to MALDI-generated data. Results published while this work was in progress

indicate that membrane fractions produced by methods such as those used here recover only a

portion of the spore membrane proteins, and extensive chemical extraction is required to

recover the full amount of several spore membrane proteins (45). However, such a chemical

extraction precludes the separation of membrane and soluble proteins. In the absence of a spore

membrane extraction process that provides high recovery, protein quantitation will have to be

done using whole spore extracts or will require evidence that the partial membrane extract is

representative of the entire membrane.

A notable trend in our study is that the number of identified membrane proteins is greatly

reduced after spore germination. Several membrane proteins, mostly lipoproteins, have been

previously suggested to dissociate from the membrane during spore germination (21, 34, 43).

Spectral counting showed similar results with most lipoproteins diminished or undetectable

following germination. The decreased recovery of lipoproteins may be due to proteolysis or may

indicate a change in their ability to maintain membrane association during fractionation, which

in turn could be associated with the membrane reorganization process. Surprisingly, over half of

the membrane proteins that decreased to below detectable levels during germination of both

46

Bacillus species spores were integral membrane proteins. Although previous efforts to quantify

spore integral membrane proteins are rare, decreased levels of BAS1302 after spore germination

was consistent with previous work (21). Since the membrane proteins identified that were

observed to decrease are involved in multiple COG function categories, this decrease appears to

be a general spore germination phenomenon. The shift from a relatively nonfluid impermeable

membrane to a fluid membrane with solute transfer may require a rather complex

rearrangement of the membrane and membrane-associated proteome.

Several proteins detected in spore membranes are involved in protein degradation. B.

subtilis HtrC (YyxA, YycK), a predicted Htr-type serine protease, was suggested to be transcribed

from its own σG promoter (46). Loss of HtrC produced no obvious phenotypic change in B. subtilis

vegetative cells (46, 47), however, the presence of HtrC, and its apparent B. anthracis ortholog,

which is also expressed during sporulation (16), in the spore membrane suggested that it may

play a role in spore formation or germination. Disruption of htrC in both B. anthracis and B.

subtilis caused a reduction in proteolysis of YpeB during spore germination, but this did not alter

the progress of germination of these spores (48). B. subtilis HtpX and B. anthracis RasP are two

predicted zinc proteases detected in the spore membranes. Their functions have not been

characterized, but may be involved in membrane protein quality control based on the function

of the well-known homolog FtsH (49). Further characterization of the roles these proteases play

in the spore may shed light on the observed decrease in membrane proteins during spore

germination.

Several proteins involved in amino acid transport were identified in the spore

membranes. YveA was previously characterized to be the primary L-aspartate transporter in B.

subtilis vegetative cells (50), and transcriptome analysis showed that this gene was expressed

47

under control of the forespore-specific σG (17). MetQ and ArtP were previously characterized in

B. subtilis vegetative cells as involved in methionine and arginine transport, respectively (51, 52).

These proteins, as well as their apparent B. anthracis orthologs, were present in the spore

membranes. The roles of these amino acid transporters in either sporulation or germination

processes are unknown at present.

Cations such as Ca2+, Mn2+, and Zn2+ accumulate in spores the during the sporulation of

Bacillus species (53), and the rapid release of cations is a distinct early germination step (54).

Divalent metal ions, predominantly Ca2+, conjugated with DPA contribute to spore resistance to

heat (55, 56) and ionizing radiation (57). Six membrane proteins with predicted functions

involved in inorganic ion transport were identified in the spores of both species. These proteins

may play roles in accumulation of ions during sporulation and/or the rapid release of ions during

germination.

A mutant lacking yloB appeared to have a defect in accumulation of Ca2+ into developing

forespores, and a subpopulation of these spores were unstable and did not retain refractility and

heat resistance. A previous study of a yloB mutant did not detect a reproducible defect in Ca2+

uptake by sporulating cells, however, that study did not differentiate Ca2+ uptake into the mother

cell versus the developing spore (58). In that study, the yloB mutant was found to have defects

in spore germination and spore heat resistance (58), and we found similar defects in this mutant.

A potential explanation for this suite of phenotypic properties is that Ca2+ transport from the

mother cell into the forespore is slowed in the yloB mutant, and this results in the spores not

achieving the normal Ca2+ content. A subpopulation of developing spores that does not reach

some threshold Ca2+ content is unstable, losing refractility and viability relatively rapidly. The

subpopulation that remains phase bright includes those spores that reached a threshold level of

48

Ca-DPA content that we could not differentiate from that of the wild type spores. These stable

yloB spores are still not entirely normal and exhibited reduced heat resistance and germination

rate.

An interesting parallel to Ca2+ transport into the spore may exist for transport of DPA,

which complexes with Ca2+ in the spore core. DPA is synthesized in the mother cell (59),

transported across the outer forespore membrane by mother cell-expressed SpoVV (60), and

then across the inner forespore membrane by the SpoVA complex (30). Mother cell-expressed

YloB may play the (partially redundant) role of Ca2+ transport across the outer membrane, with

another system responsible for transport across the inner membrane.

The sextuple mutant lacking six putative ion transport components, including YloB,

exhibits essentially the same phenotype as the yloB mutant but in addition accumulates larger

amounts of Mn2+ and Mg2+ into the dormant spores. This might be due to a failure to export

these ions out of the forespore, or perhaps they accumulate to higher levels in the developing

spore, along with DPA, when Ca2+ transport is diminished. We note that during germination,

Mn2+ is released slowly, like Ca2+ and DPA, whereas Mg2+ is released more rapidly, similar to K2+.

This suggests that the excess Mn2+ may be associated with DPA, while the excess Mg2+ is not

bound to DPA.

In both Bacillus species, one quarter of the identified spore membrane proteins have no

assigned COG functional category and most have no significant sequence similarity to known

genes or functional domains. More interestingly, most of these proteins were not identified in

vegetative cell membranes previously, and some were present in both Bacillus spores, suggesting

that these proteins are likely expressed for particular purposes in spores. Further

characterization of these proteins may reveal roles in the sporulation, germination, or outgrowth

49

processes. For example, B. subtilis YetF and YutC were previously characterized to be expressed

under control of spore-specific σF and σG, respectively (37, 61), and their apparent B. anthracis

orthologs were also identified in this study. Five other B. subtilis proteins together with YetF are

grouped in an uncharacterized protein family (UPF0702), in which a G-regulated protein YrbG

(37) was also identified in B. subtilis spore membrane. Homologs of these proteins with no known

function are not found in other bacteria, indicating that they might be very specific for Bacillus

species. Considering their expression is under the control of forespore sigma factors, these

proteins may play yet uncharacterized roles in either spore formation, stabilization, and/or

germination processes.

MATERIALS AND METHODS

Spore preparation. Spores of B. anthracis Sterne strain 34F2, an attenuated vaccine

strain, were prepared in Modified G broth (62). Spores of B. subtilis strain PS832 and derivatives

were prepared in 2xSG broth (63). Spores were harvested after 3-4 days incubation at 37°C,

washed in water for several days, and purified by centrifugation through a 50% sodium

diatrizoate (Sigma) layer as described (64). All spores used in proteome analyses were 99% free

of vegetative cells and were stored in deionized water at 4°C until analysis.

To prepare germinated spores, a 10-ml suspension of dormant spores at an optical

density at 600 nm (OD600) of 20 in water was heat-activated at 70°C for 30 min (B. anthracis) or

75°C for 30 min (B. subtilis) and cooled on ice for 10 min. The spores were then germinated at

37°C and at an OD600 of 2 with 50 mM L-alanine plus 1 mM inosine (B. anthracis) or 10 mM L-

valine (B. subtilis) in 25 mM Tris-HCl buffer (pH 7.4). The germination of spores was terminated

after the OD600 dropped to 50% of the initial value (within 10 min and 35 min after germinant

50

addition for B. anthracis and B. subtilis, respectively). Germinated spores were collected by

centrifugation at 12,000 g for 5 min at 4°C, quickly washed with cold deionized water, centrifuged

again, and frozen at -80°C. Examination by phase-contrast microscopy indicated that >95% of the

spores in each preparation had germinated.

Preparation of spore membrane fractions. Spore membrane fractions were prepared by

a modification of a previously described method (43). Dormant and germinated spores were

lyophilized, and the dry spores (~19 mg for germinated spores and ~24 mg for dormant spores)

were pulverized with 100 mg of glass beads in a dental amalgamator (Wig-L-Bug) at 4,600 rpm

for pulses of 30 s each, with 30 s pauses on ice between pulses. Spore disruption was monitored

by suspending an aliquot of spore material in H2O and observing under phase-contrast

microscopy. After >80% of spores were disrupted, the dry powder was suspended in 0.5 ml of

4°C extraction buffer (10 mM Tris-HCl [pH 7.4], 1 mM EDTA, 2 mg/ml RNase A, 2 mg/ml DNase I,

1 mM phenylmethylsulfonyl fluoride (PMSF)). The suspension was centrifuged (6,000 X g, 10 min,

4°C) and the resultant supernatant was centrifuged again (13,000 X g, 10 min, 4°C) to remove

insoluble material. The remaining supernatant was centrifuged at 100,000 X g for 60 min at 4°C,

and the resulting pellet was designated as the crude spore membrane fraction. This membrane

fraction was homogenized in 1 ml alkaline buffer (100 mM Na2CO3-HCl [pH 11], 10 mM EDTA, 100

mM NaCl, 1 mM PMSF) and was gently shaken for 60 min at 4°C. The homogenate was subjected

to ultracentrifugation as described above. The resulting pellet was homogenized in 1 ml high salt

buffer (20 mM Tris-HCl [pH 7.5], 10 mM EDTA, 1 M NaCl, 1 mM PMSF) and was again subjected

to ultracentrifugation. After a final wash with 1 ml TE buffer (10 mM Tris-HCl [pH 7.4], 1 mM

EDTA, 1 mM PMSF), the resulting pellet was homogenized in 200 µl TE buffer, flash frozen, and

51

stored at -80°C until analysis. Protein concentrations were determined by acid hydrolysis and

amino acid analysis (65) with comparison to a standard set of amino acids (Sigma).

SDS-PAGE, Trypsin digestion, and peptide fractionation. Membrane fractions were dried

and re-suspended in SDS-PAGE sample loading buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 10%

glycerol, 5% -mercaptoethanol, 0.05% bromophenol blue) to a final protein concentration of 2

µg/µl. SDS-PAGE was used to separate 30 µg protein of each spore membrane sample in both

10% polyacrylamide and 12.5-14% gradient polyacrylamide gels for B. subtilis samples, and in a

12.5-14% gradient polyacrylamide gel for B. anthracis samples. Gels were stained with ProtoBlue

Safe (National Diagnostics). Each gel lane was cut into 10-12 slices, consistently for all samples

within each species, in an effort to isolate regions containing many lower abundance proteins

away from higher abundance proteins that could dominate MS profiles. Gel slices were ground

and de-stained with 50% LC/MS-grade acetonitrile supplemented with 25 mM NH4HCO3. The gel

slices were then dehydrated with 100% acetonitrile and vacuum dried. Gel slices were soaked in

25 mM NH4HCO3 containing 10 µg/ml trypsin (Sigma), and digestion was carried out at 37°C for

at least 16 hours. Tryptic peptides were extracted from gel slices into 50% LC/MS-grade

acetonitrile, 0.1% trifluoroacetic acid (TFA) using a sonication bath. Peptides were vacuum dried

and re-suspended in 40 µl 2% LC/MS-grade acetonitrile, 0.1% TFA.

An Eksigent nano2D-LC unit, flowing at 0.7 µL/min, was used to inject 10 µl of each

peptide sample through a Captrap cartridge (Michrom Bioresources) and a self-packed New

Objective Integrafrit 50 X 0.1 mm column, both packed with Magic C18 AQ (200Å, 3 µm)(Michrom

Bioresources). Elution was with 5% acetonitrile for 25 minutes, a 5 min linear increase to 14%

acetonitrile, and a 95 min linear increase to 34% acetonitrile. An Ekspot plate spotter (Eksigent)

52

was used to spot the eluate onto MALDI target plates at a rate of 10-15 seconds per spot

dependent on the band intensity and the size of a gel slice, and the spots were air-dried.

Mass spectrometry and protein identification. Matrix was prepared by suspending

approximately 200 mg αCHCA (Aldrich) in 1 ml 100 mM acetic acid and mixing vigorously.

Following centrifugation for 2 min at 1000 x g, the supernatant was removed, and the wash

procedure was repeated. Two additional washes were performed with 100% acetonitrile, and the

αCHCA was vacuum-dried and stored at 4°C. Matrix solution was prepared by dissolving 4 mg of

washed αCHCA in 1 ml 1:1:0.001(v/v/v) water:acetonitrile:TFA, to which 2 M NH4Cl was then

added to a final concentration of 10 mM. Each dried sample spot on the MALDI plates were

overlaid with 1 µl of matrix solution and air-dried.

For calibrating and tuning the MALDI-TOF/TOF 4800 analyzer (AB SCIEX), 200 µl of the

matrix solution was added to an aliquot of a mix of six standard peptides (Anaspec, #60882). This

mix was spotted onto all calibration spots when analyzing a sample MALDI plate. For each

peptide sample spot, a scan for the m/z range of 800-4,000 was acquired with averaged data

from 1,000 laser shots in reflector positive ion mode. The 10 most abundant ions for each spot,

above a minimum signal-to-noise ratio (>50), were then automatically selected for subsequent

MS/MS analysis. Parent ions chosen for one spot were excluded from analyses in subsequent

spots. MS/MS scans were the averages of 3,000 laser shots (1 kV, positive ion mode).

The MS and MS/MS data were analyzed using ProteinpilotTM software version 4.0 (AB

SCIEX) and Scaffold version 3.0 software (Proteome Software, Inc.). The parameters used in

ProteinpilotTM were: identification as sample type, no cysteine alkylation, trypsin as digestion

enzyme, gel-based identification as special factors, biological modifications and amino acid

substitutions as ID focus, thorough ID as search effort, and detected protein threshold (unused

53

prot score) > 0.05 (10%) as result quality. The B. subtilis 168 protein database (2/10/2012) and B.

anthracis (BACAN) protein database (12/18/2012) were downloaded from Universal Protein

Resources (http://www.uniprot.org/). Based on the ProteinpilotTM false discovery rate analysis

of acquired protein list, a cutoff line at 5% false discovery rate (FDR) and a minimum of one

peptide at 95% identification confidence was applied to each biological sample protein profile.

The raw data is available from the PRIDE database under access number PXD002136 (66).

Proteins identified in at least two biological replicates were considered a valid identification. All

proteins in dormant and germinated protein profiles were then annotated according to their

accession number using two databases: The National Center for Biological Information

(http://www.ncbi.nlm.nih.gov/) and Universal Protein Resources. Other online resources that

were used for predicting membrane associations are: Brinkman Laboratory at Simon Fraser

University (http://www.psort.org/psortb/index.html) and PRED-LIPO server at University of

Athens (http://bioinformatics.biol.uoa.gr/PRED-LIPO/input.jsp). Protein NCBI Cluster of

Orthologous Groups (COG) were predicted using the COMBREX database

(http://combrex.bu.edu/).

To acquire preliminary relative protein quantification, the Mascot data files of three

biological replicates were merged and onsite Mascot searches were performed for each peptide

fragmentation mass spectrum against the B. subtilis and B. anthracis protein databases. Mascot

parameters were: Trypsin specificity with one missed cleavage; deamidation; pyro-cmC and

oxidations were considered variable modifications. The peptide mass tolerance and fragment

mass tolerance were set to ±500 ppm and ±0.2 Da, respectively. Search results were analyzed

using ScaffoldTM version 3.4.9. The ScaffoldTM parameters were 95% protein threshold and 1

54

minimum identified peptide at 95% of threshold, and the normalized unique spectrum count of

a protein was used to relatively quantify the protein changes between two samples (41).

All identified B. anthracis membrane proteins were searched against the whole B. subtilis

protein database and the proteins identified in B. subtilis spore membrane profile using the NCBI

protein BLAST tool (67). Only sequences with alignment coverage ≥60% were considered possible

orthologs in the two species. If the protein in the full B. subtilis protein database that had the

highest identity percentage against a B. anthracis membrane query protein was also identified in

the B. subtilis spore membrane profile, these two proteins were considered to be the most likely

orthologs. If a protein in B. subtilis spore membrane proteome had high similarity to a B.

anthracis membrane query protein, but it was not the highest identity match in the full B. subtilis

protein database, then the two proteins were considered to be likely paralogs.

Generation of mutants lacking putative ion transporter genes. Single mutants lacking

four genes (znuA, ycnL, yflS, yloB) were obtained from the Bacillus subtilis Genetic Stock Center.

Each mutation was a deletion, with the gene of interest replaced by an erythromycin resistance

gene flanked by two loxP sites (68). The mutations were introduced into B. subtilis strain PS832

by natural transformation with selection for erythromycin (2.5 µg/ml) and lincomycin (12.5

µg/ml) (MLS) resistance. The Cre recombinase was expressed from plasmid pDR244 (68) to

stimulate deletion of the resistance gene, leaving an unmarked in-frame deletion mutation. This

process was repeated to produce multiple mutants. All mutations were verified by PCR and

agarose gel electrophoresis.

Two additional mutations were generated using the Long-Flanking Homology PCR (LFH-

PCR) method (69, 70). PCR products were prepared containing ~1 kb of sequence upstream of

the gene, the first 10-50 bp of the coding sequence, a spectinomycin or MLS resistance cassette,

55

the last 10-50 bp of the coding sequence, and ~1 kb downstream. The PCR products were used

to transform PS832 competent cells to generate the single mutants chaA::spec and yugS::mls,

respectively. The mutations were verified by PCR and agarose gel electrophoresis.

Analysis of sporulation properties. Spores were prepared in 2xSG broth and in CDSM

minimal medium (71) to which different concentrations of calcium ions were added. The number

of heat resistant spores was estimated by heat treatment at 80°C for ten minutes and serial

dilution onto LB plates. The rate of progression through sporulation in 2xSG medium 37°C was

analyzed by collecting samples for assay of glucose dehydrogenase (GDH) activity and dipicolinic

acid (DPA) accumulation as previously described (64).

Separation of mother cell and forespore fractions. Strains were grown with shaking in

2xSG medium at 37°C. Samples (30 ml) of culture were collected at T6 and T8 and centrifuged at

7,741 x g for 5 minutes. The supernatant was removed and the pellet was suspended in 5 ml

SMM (72). This was followed by addition of 25 mg lysozyme (Sigma-Aldrich) and incubation at

37° C for 15 minutes (73). The protoplasts were centrifuged at 7,741 x g for 10 minutes and the

supernatant was discarded. The pellet was suspended in 5 ml cold, sterile deionized water,

vortexed and centrifuged at 7,741 x g for 10 minutes. The supernatant contained the lysed

mother cell fraction and the pellet contained the purified forespores. Ca2+ was quantified in each

fraction using inductively coupled plasma atomic emission spectroscopy at the Virginia Tech Soil

Testing Laboratory (CirOS VISION ICP-AES, Spectro Analytical Instruments)(74).

Quantification of ions using atomic emission spectroscopy. Phase bright spores were

purified away from phase dark spores by centrifugation through a 50% sodium diatrizoate layer

as described (64) and were suspended at OD600 = 10 in 1 ml 200 mM Tris-HCl, pH 8.0 to remove

coat-associated ions. The spore suspension was rocked at room temperature for 20 minutes and

56

washed three times with fresh deionized water by centrifugation at 15,800 x g for 2 minutes.

Pellets were suspended in 1 ml of 6 M ultrapure HCl (Fisher Chemicals) and heated at 100°C for

10 minutes followed by centrifugation at 15,800 x g for 10 minutes. The supernatant was

collected, and the amounts of individual ions were quantified using atomic emission

spectroscopy.

Purified phase bright spores were heat activated (70°C for 20 minutes and cooling on ice)

and stimulated to germinate at a starting OD600 of 10 by addition of 10 mM L-alanine in 50 mM

NaPO4 buffer at pH 7.0. At different time intervals, samples were removed and centrifuged for 2

mins at 15,800 x g. The ion contents of germination exudate (supernatant) samples were

analyzed using atomic emission spectroscopy. Significant differences between values were

determined using unpaired two-tailed Student’s t-tests.

57

ACKNOWLEDGEMENTS

Research reported in this publication was supported by the National Institute of Allergy

and Infectious Disease of the National Institutes of Health under award number R21AI088298.

The content is solely the responsibility of the authors and does not necessarily represent the

official views of the National Institutes of Health. The mass spectrometry resources used in this

work are maintained in part through funding by the Fralin Life Science Institute at Virginia Tech

and the Agricultural Experiment Station Hatch Program at Virginia Tech (CRIS Project Number:

VA-135981).

58

REFERENCES

1. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat

and chemicals. J Appl Microbiol 101:514-525. 2. Moir A. 2006. How do spores germinate? J Appl Microbiol 101:526-530. 3. Setlow P. 2003. Spore germination. Curr Opin Microbiol 6:550-556. 4. Mallozzi M, Viswanathan VK, Vedantam G. 2010. Spore-forming Bacilli and Clostridia in

human disease. Future Microbiology 5:1109-1123. 5. Setlow P, Johnson EA. 2007. Spores and Their Significance. Food Microbiology:

Fundamentals and Frontiers, Third Edition:35-67. 6. Amuguni H, Tzipori S. 2012. Bacillus subtilis: a temperature resistant and needle free

delivery system of immunogens. Hum Vaccin Immunother 8:979-986. 7. Cutting SM, Hong HA, Baccigalupi L, Ricca E. 2009. Oral vaccine delivery by

recombinant spore probiotics. Int Rev Immunol 28:487-505. 8. Knecht LD, Pasini P, Daunert S. 2011. Bacterial spores as platforms for bioanalytical and

biomedical applications. Anal Bioanal Chem 400:977-989. 9. Cowan AE, Olivastro EM, Koppel DE, Loshon CA, Setlow B, Setlow P. 2004. Lipids in

the inner membrane of dormant spores of Bacillus species are largely immobile. Proc Natl Acad Sci USA 101:7733-7738.

10. Koshikawa T, Beaman TC, Pankratz HS, Nakashio S, Corner TR, Gerhardt P. 1984. Resistance, germination, and permeability correlates of Bacillus megaterium spores successively divested of integument layers. J Bacteriol 159:624-632.

11. Popham DL, Heffron JD, Lambert EA. 2012. Degradation of Spore Peptidoglycan During Germination, p. 121-142. In Abel-Santos E (ed.), Bacterial Spores: Current Research and Applications. Caister Academic Press, Norwich, UK.

12. Indest KJ, Buchholz WG, Faeder JR, Setlow P. 2009. Workshop report: modeling the molecular mechanism of bacterial spore germination and elucidating reasons for germination heterogeneity. Journal of food science 74:R73-78.

13. Bergman NH, Anderson EC, Swenson EE, Niemeyer MM, Miyoshi AD, Hanna PC. 2006. Transcriptional profiling of the Bacillus anthracis life cycle in vitro and an implied model for regulation of spore formation. J Bacteriol 188:6092-6100.

14. Eichenberger P, Fujita M, Jensen ST, Conlon EM, Rudner DZ, Wang ST, Ferguson C, Haga K, Sato T, Liu JS, Losick R. 2004. The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PLoS Biol 2:e328.

15. Eichenberger P, Jensen ST, Conlon EM, van Ooij C, Silvaggi J, Gonzalez-Pastor JE, Fujita M, Ben-Yehuda S, Stragier P, Liu JS, Losick R. 2003. The sigmaE regulon and the identification of additional sporulation genes in Bacillus subtilis. J Mol Biol 327:945-972.

16. Liu H, Bergman NH, Thomason B, Shallom S, Hazen A, Crossno J, Rasko DA, Ravel J, Read TD, Peterson SN, Yates J, 3rd, Hanna PC. 2004. Formation and composition of the Bacillus anthracis endospore. J Bacteriol 186:164-178.

17. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P. 2006. The forespore line of gene expression in Bacillus subtilis. J Mol Biol 358:16-37.

18. Abhyankar W, Beek AT, Dekker H, Kort R, Brul S, de Koster CG. 2011. Gel-free proteomic identification of the Bacillus subtilis insoluble spore coat protein fraction. Proteomics 11:4541-4550.

19. Delvecchio VG, Connolly JP, Alefantis TG, Walz A, Quan MA, Patra G, Ashton JM, Whittington JT, Chafin RD, Liang X, Grewal P, Khan AS, Mujer CV. 2006. Proteomic profiling and identification of immunodominant spore antigens of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. Appl Environ Microbiol 72:6355-6363.

59

20. Huang CM, Foster KW, DeSilva TS, Van Kampen KR, Elmets CA, Tang DC. 2004. Identification of Bacillus anthracis proteins associated with germination and early outgrowth by proteomic profiling of anthrax spores. Proteomics 4:2653-2661.

21. Jagtap P, Michailidis G, Zielke R, Walker AK, Patel N, Strahler JR, Driks A, Andrews PC, Maddock JR. 2006. Early events of Bacillus anthracis germination identified by time-course quantitative proteomics. Proteomics 6:5199-5211.

22. Kuwana R, Kasahara Y, Fujibayashi M, Takamatsu H, Ogasawara N, Watabe K. 2002. Proteomics characterization of novel spore proteins of Bacillus subtilis. Microbiology 148:3971-3982.

23. Lai EM, Phadke ND, Kachman MT, Giorno R, Vazquez S, Vazquez JA, Maddock JR, Driks A. 2003. Proteomic analysis of the spore coats of Bacillus subtilis and Bacillus anthracis. J Bacteriol 185:1443-1454.

24. Mao L, Jiang S, Wang B, Chen L, Yao Q, Chen K. 2011. Protein profile of Bacillus subtilis spore. Curr Microbiol 63:198-205.

25. Swarge BN, Roseboom W, Zheng L, Abhyankar WR, Brul S, de Koster CG, de Koning LJ. 2018. "One-Pot" Sample Processing Method for Proteome-Wide Analysis of Microbial Cells and Spores. Proteomics Clin Appl:e1700169.

26. Zheng L, Abhyankar W, Ouwerling N, Dekker HL, van Veen H, van der Wel NN, Roseboom W, de Koning LJ, Brul S, de Koster CG. 2016. Bacillus subtilis Spore Inner Membrane Proteome. J Proteome Res 15:585-594.

27. Korza G, Setlow P. 2013. Topology and accessibility of germination proteins in the Bacillus subtilis spore inner membrane. J Bacteriol 195:1484-1491.

28. Paidhungat M, Setlow P. 2001. Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. J Bacteriol 183:3982-3990.

29. Fort P, Errington J. 1985. Nucleotide sequence and complementation analysis of a polycistronic sporulation operon, spoVA, in Bacillus subtilis. J Gen Microbiol 131:1091-1105.

30. Tovar-Rojo F, Chander M, Setlow B, Setlow P. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. J Bacteriol 184:584-587.

31. Vepachedu VR, Setlow P. 2005. Localization of SpoVAD to the inner membrane of spores of Bacillus subtilis. J Bacteriol 187:5677-5682.

32. Vepachedu VR, Setlow P. 2007. Role of SpoVA proteins in release of dipicolinic acid during germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme. J Bacteriol 189:1565-1572.

33. Igarashi T, Setlow B, Paidhungat M, Setlow P. 2004. Effects of a gerF (lgt) mutation on the germination of spores of Bacillus subtilis. J Bacteriol 186:2984-2991.

34. Pelczar PL, Setlow P. 2008. Localization of the germination protein GerD to the inner membrane in Bacillus subtilis spores. J Bacteriol 190:5635-5641.

35. Chirakkal H, O'Rourke M, Atrih A, Foster SJ, Moir A. 2002. Analysis of spore cortex lytic enzymes and related proteins in Bacillus subtilis endospore germination. Microbiology 148:2383-2392.

36. Stewart KA, Yi X, Ghosh S, Setlow P. 2012. Germination protein levels and rates of germination of spores of Bacillus subtilis with overexpressed or deleted genes encoding germination proteins. J Bacteriol 194:3156-3164.

37. Steil L, Serrano M, Henriques AO, Volker U. 2005. Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiol 151:399-420.

38. Serrano M, Corte L, Opdyke J, Moran CP, Jr., Henriques AO. 2003. Expression of spoIIIJ in the prespore is sufficient for activation of sigma G and for sporulation in Bacillus subtilis. J Bacteriol 185:3905-3917.

39. Winstedt L, von Wachenfeldt C. 2000. Terminal oxidases of Bacillus subtilis strain 168: one quinol oxidase, cytochrome aa(3) or cytochrome bd, is required for aerobic growth. J Bacteriol 182:6557-6564.

60

40. Mattatall NR, Jazairi J, Hill BC. 2000. Characterization of YpmQ, an accessory protein required for the expression of cytochrome c oxidase in Bacillus subtilis. J Biol Chem 275:28802-28809.

41. Liu H, Sadygov RG, Yates JR, 3rd. 2004. A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal Chem 76:4193-4201.

42. Gilchrist A, Au CE, Hiding J, Bell AW, Fernandez-Rodriguez J, Lesimple S, Nagaya H, Roy L, Gosline SJ, Hallett M, Paiement J, Kearney RE, Nilsson T, Bergeron JJ. 2006. Quantitative proteomics analysis of the secretory pathway. Cell 127:1265-1281.

43. Chen Y, Ray WK, Helm RF, Melville SB, Popham DL. 2014. Levels of Germination Proteins in Bacillus subtilis Dormant, Superdormant, and Germinating Spores. PloS one 9:e95781.

44. Patel VJ, Thalassinos K, Slade SE, Connolly JB, Crombie A, Murrell JC, Scrivens JH. 2009. A comparison of labeling and label-free mass spectrometry-based proteomics approaches. J Proteome Res 8:3752-3759.

45. Stewart KA, Setlow P. 2013. Numbers of individual nutrient germinant receptors and other germination proteins in spores of Bacillus subtilis. J Bacteriol 195:3575-3582.

46. Fabret C, Hoch JA. 1998. A two-component signal transduction system essential for growth of Bacillus subtilis: implications for anti-infective therapy. J Bacteriol 180:6375-6383.

47. Fukuchi K, Kasahara Y, Asai K, Kobayashi K, Moriya S, Ogasawara N. 2000. The essential two-component regulatory system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis. Microbiology 146 ( Pt 7):1573-1583.

48. Bernhards CB, Chen Y, Toutkoushian H, Popham DL. 2015. HtrC is involved in proteolysis of YpeB during germination of Bacillus anthracis and Bacillus subtilis spores. J Bacteriol 197:326-336.

49. Dalbey RE, Wang P, van Dijl JM. 2012. Membrane proteases in the bacterial protein secretion and quality control pathway. Microbiol Mol Biol Rev 76:311-330.

50. Lorca G, Winnen B, Saier MH, Jr. 2003. Identification of the L-aspartate transporter in Bacillus subtilis. J Bacteriol 185:3218-3222.

51. Sekowska A, Robin S, Daudin JJ, Henaut A, Danchin A. 2001. Extracting biological information from DNA arrays: an unexpected link between arginine and methionine metabolism in Bacillus subtilis. Genome Biol 2:RESEARCH0019.

52. Hullo MF, Auger S, Dassa E, Danchin A, Martin-Verstraete I. 2004. The metNPQ operon of Bacillus subtilis encodes an ABC permease transporting methionine sulfoxide, D- and L-methionine. Res Microbiol 155:80-86.

53. Charney J, Fisher WP, Hegarty CP. 1951. Managanese as an essential element for sporulation in the genus Bacillus. J Bacteriol 62:145-148.

54. Swerdlow BM, Setlow B, Setlow P. 1981. Levels of H+ and other monovalent cations in dormant and germinating spore of Bacillus megaterium. J Bacteriol 148:20-29.

55. Gerhardt P, Marquis RE. 1989. Spore thermoresistance mechanisms, p. 43-63. In Smith I, Slepecky RA, Setlow P (ed.), Regulation of Prokaryotic Development. American Society for Microbiology, Washington, D.C.

56. Paidhungat M, Setlow B, Driks A, Setlow P. 2000. Characterization of spores of Bacillus subtilis which lack dipicolinic acid. J Bacteriol 182:5505-5512.

57. Granger AC, Gaidamakova EK, Matrosova VY, Daly MJ, Setlow P. 2011. Effects of Mn and Fe levels on Bacillus subtilis spore resistance and effects of Mn2+, other divalent cations, orthophosphate, and dipicolinic acid on protein resistance to ionizing radiation. Appl Environ Microbiol 77:32-40.

58. Raeymaekers L, Wuytack E, Willems I, Michiels CW, Wuytack F. 2002. Expression of a P-type Ca(2+)-transport ATPase in Bacillus subtilis during sporulation. Cell Calcium 32:93.

59. Daniel RA, Errington J. 1993. Cloning, DNA sequence, functional analysis and transcriptional regulation of the genes encoding dipicolinic acid synthetase required for sporulation in Bacillus subtilis. J Mol Biol 232:468-483.

61

60. Ramirez-Guadiana FH, Meeske AJ, Rodrigues CDA, Barajas-Ornelas RDC, Kruse AC, Rudner DZ. 2017. A two-step transport pathway allows the mother cell to nurture the developing spore in Bacillus subtilis. PLoS Genet 13:e1007015.

61. Arrieta-Ortiz ML, Hafemeister C, Bate AR, Chu T, Greenfield A, Shuster B, Barry SN, Gallitto M, Liu B, Kacmarczyk T, Santoriello F, Chen J, Rodrigues CD, Sato T, Rudner DZ, Driks A, Bonneau R, Eichenberger P. 2015. An experimentally supported model of the Bacillus subtilis global transcriptional regulatory network. Mol Syst Biol 11:839.

62. Kim HU, Goepfert JM. 1974. A sporulation medium for Bacillus anthracis. J Appl Bacteriol 37:265-267.

63. Leighton TJ, Doi RH. 1971. The stability of messenger ribonucleic acid during sporulation in Bacillus subtilis. J Biol Chem 254:3189-3195.

64. Nicholson WL, Setlow P. 1990. Sporulation, germination, and outgrowth., p. 391-450. In Harwood CR, Cutting SM (ed.), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, England.

65. González-Castro MJ, López-Hernández J, Simal-Lozano J, Oruña-Concha MJ. 1997. Determination of amino acids in green beans by derivitization with phenylisothiocyanate and high-performance liquid chromatography with ultraviolet detection. J Chrom Sci 35:181-185.

66. Vizcaino JA, Deutsch EW, Wang R, Csordas A, Reisinger F, Rios D, Dianes JA, Sun Z, Farrah T, Bandeira N, Binz PA, Xenarios I, Eisenacher M, Mayer G, Gatto L, Campos A, Chalkley RJ, Kraus HJ, Albar JP, Martinez-Bartolome S, Apweiler R, Omenn GS, Martens L, Jones AR, Hermjakob H. 2014. ProteomeXchange provides globally coordinated proteomics data submission and dissemination. Nat Biotechnol 32:223-226.

67. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403-410.

68. Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA. 2017. Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell Syst 4:291-305 e297.

69. Mascher T, Margulis NG, Wang T, Ye RW, Helmann JD. 2003. Cell wall stress responses in Bacillus subtilis: the regulatory network of the bacitracin stimulon. Mol Microbiol 50:1591-1604.

70. Wach A. 1996. PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12:259-265.

71. Hageman JH, Shankweiler GW, Wall PR, Franich K, McCowan GW, Cauble SM, Grajeda J, Quinones C. 1984. Single, chemically defined sporulation medium for Bacillus subtilis: growth, sporulation, and extracellular protease production. J Bacteriol 160:438-441.

72. Wyrick PB, Rogers HJ. 1973. Isolation and characterization of cell wall-defective variants of Bacillus subtilis and Bacillus licheniformis. J Bacteriol 116:456-465.

73. Meador-Parton J, Popham DL. 2000. Structural analysis of Bacillus subtilis spore peptidoglycan during sporulation. J Bacteriol 182:4491-4499.

74. Soil and Plant Analysis Council I. 1999. Methods of Instrumental Analysis, p. 207-224. In Jones Jr. J (ed.), Soil Analysis Handbook of Reference Methods. CRC Press.

62

Figure 2.1. Predicted membrane-spanning domains of B. anthracis and B. subtilis spore

membrane proteins. Predictions of membrane association mechanisms were made for proteins

identified in membrane fractions as described in Materials and Methods. Proteins were further

classified based upon their predicted number of membrane spanning helices.

63

Figure 2.2. Mutant strains lacking yloB produce many phase-dark spores. B. subtilis strains

were grown and sporulated in 2xSG medium, and spores were purified by water washing. Phase

contrast microscopy revealed that approximately 50% of the spores produced by all strains

containing yloB deletion mutations were phase dark. Bars = 5 µm

64

Figure 2.3. Ca2+ content of forespore and mother cell in sporulating cells. Strains were grown

with shaking in 2xSG medium at 370C and O.D.600 was measured. Samples were removed at T6 or

T8 and treated with lysozyme and several rounds of centrifugation to separate forespore and

mother cell compartments. The samples were extracted with HCl and Ca2+ was quantified using

atomic emission spectroscopy. Values are averages of three assays and error bars are standard

deviations.

0

10

20

30

40

50

60

70

80

90

PS832 T6 PS832 T8 DPVB693 T6 DPVB693 T8

% C

a2+

co

nte

nt

Strain and time in sporulation

Forespore

Mother cell

65

Figure 2.4. Ion contents of purified phase-bright spores. Purified spores were extracted with HCl

and the amounts of various ions were quantified using atomic emission spectroscopy. Values are

averages of three to nine assays, depending on the strain, and are expressed as a percentage of

the values found in PS832 spores prepared on the same day. Error bars are standard errors.

* indicates a significant difference from PS832; P≤0.05.

0

50

100

150

200

250

PS832 DPVB693 DPVB706 DPVB715 DPVB716 DPVB722

Ion

co

nte

nt (%

WT

va

lue

)

Strain

Ca

Mg

Mn

K

*

*

66

Figure 2.5. Germination of purified phase-bright spores. Purified spores of B. subtilis wild type

and mutant strains were heat activated and stimulated to germinate by addition of 10 mM L-

alanine. Values are averages of three assays and error bars are standard deviations. For DPVB706,

all points after 2 m, and for DPVB722, all points, are significantly different from those of PS832;

P≤0.05.

67

Figure 2.6. Release of ions by germinating spores. Spores were germinated as described in

68

Materials and Methods. Samples were collected at the indicated times and centrifuged briefly

to pellet spores. Ions in the germination exudate were quantified using atomic emission

spectroscopy. Values are averages of three assays and error bars are standard deviations.

* indicates points that were significantly different from those of PS832 and DPVB693; P≤0.05.

Table 2.1. B. anthracis and B. subtilis spore germination proteins identified in spore membrane proteomes.

Gene Function

B. subtilis

Uniprot

number

B. anthracis

Uniprot

number

Membrane

predictiona

gerAC Germinant receptor P07870 Lipoprotein

gerBC Germinant receptor P39571 Lipoprotein

gerD Germinant response P16450 Q81VP4 Lipoprotein

gerKC Germinant receptor P49941 Lipoprotein

prkC Peptidoglycan receptor O34507 Integral

spoVAC DPA transport P40868 Q81X68 Integral

spoVAD DPA transport P40869 Q81X67 Peripheral

spoVAF DPA transport P31845 Q81MG2 Integral

yfkR Germinant receptor O35028 Lipoprotein

yhcN Outgrowth P54598 Lipoprotein

ypeB Cortex degradation P38490 Q81PQ4 Integral

a Mechanism of membrane association predicted as described in Materials and Methods.

69

Table 2.2. Proteins detected in both Bacillus species spore membrane proteomes.

Gene name

B. subtilis Uniprot number

B. anthracis Uniprot number

Protein function Sequence identity1

(%)

Sequence similarity1

(%)

Alignment length2 (%)

ahpF/ahpF P42974 Q81ZC5 NADH dehydrogenase 84 91 100

artP/GBAA_0367 P54535 Q6I447 Arginine-transport, ArtP 37 55 95

atpD/atpD P37809 Q81JZ5 ATP synthase 86 92 99

atpF/atpF P37814 Q81JZ1 ATP synthase 57 76 98

atpG/atpG P37810 Q81JZ4 ATP synthase 68 84 100

bdbD/bdbD O32218 Q81YT8 Disulfide bond formation 42 64 85

era/era P42182 Q81LT7 GTPase Era 75 89 100

fhuD/GBAA_0351 P37580 Q81ZB8 Iron-hydroxamate-binding, FhuD 38 61 93

ftsH/ftsH P37476 Q81VX5 Zinc metalloprotease, FtsH 80 89 100

gerD/gerD P16450 Q81VP4 Germination, GerD 43 69 89

metQ/GBAA_5220 O32167 Q81XL5 Methionine-binding lipoprotein 57 76 100

misCA/yidC2 Q01625 Q81JH1 Membrane protein insertase 68 81 100

msmX/potA P94360 Q81TH83 Maltodextrin import, MsmX 51 71 76

oppA/GBAA_0656 P24141 Q81V45 Oligopeptide transport, OppA 28 45 92

oppB/GBAA_1192 P24138 Q81TS3 Oligopeptide transport, OppB 50 70 100

oppC/GBAA_1193 P24139 Q81TS2 Oligopeptide transport, OppC 46 66 98

oppD/GBAA_1194 P24136 Q81TS1 Oligopeptide transport, OppD 73 85 97

oppF/GBAA_1195 P24137 Q81TS0 Oligopeptide transport, OppF 80 89 97

pbpF/GBAA_1474 P38050 Q81T17 Penicillin-binding protein 1F 42 61 89

plsY/plsY3 Q45064 Q81Y92 Glycerol-3-PO4 acyltransferase 63 75 94

ponA/GBAA_2345 P39793 Q81QS3 Penicillin-binding protein 1 46 65 89

prsA/prsA1 P24327 Q81U45 Foldase, PrsA 47 66 96

ptsG/ptsG P20166 Q81MH9 PTS system 61 79 100

qcrA/qcrA P46911 Q81SV1 Menaquinol-cytochrome c reductase

70 80 95

qcrB/qcrB P46912 Q81SV0 Menaquinol-cytochrome c reductase

95 97 100

qoxA/ctaC P34957 Q81MT93 Quinol oxidase 36 56 62

rbsA/ecsA P36947 Q81U403 Ribose import, RbsA 28 49 84

resA/resA P35160 Q81SZ9 Thiol-disulfide oxidoreductase 52 69 99

secDF/secDF O32047 Q81LH8 Protein translocase, SecDF 60 76 97

secY/secY1 P16336 Q81VR0 Protein translocase, SecY 72 82 100

spoVAC/GBAA_5375 P40868 Q81X68 DPA transport, SpoVAC 60 78 89

spoVAD/GBAA_5376 P40869 Q81X67 DPA transport, SpoVAD 50 65 98

spoVAF/spoVAF P31845 Q81MG2 DPA transport SpoVAF 63 80 96

tagU/tagU Q02115 Q81K33 Transcriptional regulator, LytR 50 72 93

tcyA/GBAA_0855 P42199 Q81UL3 L-cystine-binding protein TcyA 53 69 98

yetF/GBAA_5379 O31533 Q81X64 Unknown 35 59 63

yfmC/GBAA_5330 O34348 Q81XB03 Unknown 25 46 93

yfmC/fpuA O34348 Q81L65 Fe-citrate-binding, YfmC 33 53 96

70

yfmC/GBAA_0615 O34348 Q81V853 Unknown 34 49 99

ykrK/GBAA_2841 O31656 Q81PG5 Unknown 37 59 94

ylaJ/GBAA_2746 O07634 Q81PQ5 Unknown, lipoprotein 47 67 100

yndM/BAS2909 O31816 Q6HWX1 Unknown 35 50 88

yndM/GBAA_2961 O31816 Q81P56 Unknown 27 47 92

ypeB/ypeB P38490 Q81PQ4 Cortex degradation, YpeB 57 77 99

ypmQ/GBAA_2249 P54178 Q81R11 SCO1 protein homolog 49 70 96

yqfX/BA_1410 P54481 Q81T77 Unknown 33 48 92

ythA/cydA3 C0SP90 Q81WZ0 Cytochrome bd menaquinol oxidase

53 71 98

yugS/GBAA_0608 O05241 Q81V91 Unknown 59 75 100

yutC/GBAA_5199 O32128 Q81XN4 Unknown, lipoprotein 35 58 72

yyxA/GBAA_5710 P39668 Q81JJ5 Serine protease, YyxA 50 68 97

znuA/GBAA_2035 O34966 Q81RK9 Zinc uptake, ZnuA 37 55 97

1 Sequences were aligned using BlastP (67). 2 The percent of the B. subtilis protein sequence that was aligned with the B. anthracis sequence. 3 A more similar protein than that detected in the spore proteome was present in the full B. subtilis genome: (B. anthracis gene:Most similar B. subtilis gene) (Q81XB0:P94421) (Q81V85:O31567) (Q81MT9:P24011) (Q81U40:P55339) (Q81TH8:O32151)

71

Table 2.3. Validation of membrane protein quantification.

B. subtilis

protein

Dormant/Germinated

spore ratio by

spectral counting

Dormant/Germinated

spore ratio by MRMa

GerAC 1.7 1.9

GerBC 0.8 1.5

GerKC 1.5 2.4

GerD 3.0 3.5

PrkC 1.9 3.3

SpoVAC 3.3 0.8

SpoVAD 0.5 0.6

YpeB 4.2 6.8

a MRM data are from reference (43).

72

Table 2.4. Changes in Bacillus spore membrane protein detection following germination.

Gene B. subtilis

Uniprot number

B. anthracis Uniprot number

Membrane prediction

Fold change in unique

spectra (D/G)

fruA P71012 Integral 5.4

qcrB P46912 Integral 4.5

ypeB P38490 Integral 4.2e

yheB O07543 Integral 3.9

znuA O34966 Lipoprotein 3.6

ylaJ O07634 Lipoprotein 3.3

oppC P24139 Integral 3.3

atpF P37814 Integral 3.3

spoVAC P40868 Integral 3.3a

fhuD P37580 Lipoprotein 3.1

yugS O05241 Q81V91 Integral 3.0 / 3.3

gerD P16450 Lipoprotein 3.0e

ythA C0SP90 Integral 2.9

secDF O32047 Integral 2.9

ypmQ P54178 Lipoprotein 2.8

yitG Q796Q1 Integral 2.7

yqfX P54481 Q81T77 Integral 2.6 / INFb, c

oppA P24141 Q81V45 Lipoprotein 2.6 / 3.8

qoxA P34957 Integral 2.2

rbsA P36947 Peripheral 2.2

yfmC O34348 Lipoprotein 2.1

yhcN P54598 Lipoprotein 2.0

yugP O05248 Integral 2.0

spoVAD P40869 Q81X67 Peripheral 0.5e / 1.4

atpG P37810 Q81JZ4 Peripheral 0.5 / 3.9

BAS4323 Q6HSW8 Lipoprotein 8.9b

GBAA_2961 Q81P56 Integral 7.0

prsA1 Q81U45 Lipoprotein 6.3

GBAA_0855 Q81UL3 Lipoprotein 5.9c

GBAA_0615 Q81V85 Lipoprotein 4.8

GBAA_3048 Q81NX4 Peripheral 4.1

GBAA_5684 Q81JM0 Integral 3.9

GBAA_422 Q81ML8 Lipoprotein 3.7d

cccA Q81LU6 Integral 3.3

psd Q81LP7 Peripheral 3.3

GBAA_1195 Q81TS0 Peripheral 3.0

GBAA_1523 Q81SX1 Integral 2.2

GBAA_3927 Q81WP4 Lipoprotein 13

GBAA_0418 Q81Z55 Peripheral 0.5d a Result is not consistent that of (43).

73

b Result is consistent with that of (21). c This protein was detected in B. anthracis dormant spores but not in germinated spores. d Result is not consistent with that of (21). e Result is consistent that of (43).

74

Table 2.5: Production of heat resistant spores by B. subtilis strains lacking putative ion transporters.

Strain Genotype Total cfu/ml

Heated cfu/ml

Heated/Total

Heated/ WT

Heated

PS832 Wild type 1.2x109 0.9x109 0.8 1

DPVB689 ΔznuA::mls 1.4x109 1.3x109 0.9 1.4

DPVB690 Δycnl::mls 1.3x109 1.4x109 1.1 1.6

DPVB691 ΔyflS::mls 1.2x109 1.0x109 0.8 1.1

DPVB693 ΔyloB::mls 4.3x109 3.4x108 0.8 0.4

DPVB706 a ΔznuA ΔyflS Δycnl 1.1x109 1.0x109 0.9 1.1

DPVB715 ΔyugS::mls 0.9x109 6.9x108 0.8 0.8

DPVB716 ΔchaA::spec 1.1x109 1.3x109 1.2 1.4

DPVB717 ΔznuA ΔyflS Δycnl ΔyloB::mls 4.7x108 2.5x108 0.5 0.3

DPVB718 ΔyugS::mls ΔchaA::spec 4.4x108 4.8x108 1.1 0.5

DPVB719 ΔznuA ΔyflS Δycnl ΔyloB 6.0x108 2.2x108 0.3 0.2

DPVB720 ΔznuA ΔyflS Δycnl ΔyloB ΔchaA::spec 4.4x108 2.4x108 0.5 0.3

DPVB721 ΔznuA ΔyflS Δycnl ΔyloB ΔyugS::mls 5.0x108 2.0x108 0.4 0.2

DPVB722 b ΔznuA ΔyflS Δycnl ΔyloB ΔyugS::mls ΔchaA::spec 3.9x108 1.6x108 0.4 0.2

Values are averages of three independent experiments a The genotype for DPVB706 is abbreviated to “Δ3” throughout the text. b The genotype for DPVB722 is abbreviated to “Δ5ΔyloB” throughout the text.

75

Table 2.6: Production of heat resistant spores by B. subtilis ion transporter mutants with different Ca2+ concentrations.

Added CaCl2 Strain

Total cfu/ml

HeatR

cfu/ml

1 mM

PS832 3.9x107 4.5x107

DPVB693 5.8x107 4.0x107

DPVB706 4.2x107 5.0x107

DPVB722 2.9x107 6.7x107

0.2 mM

PS832 3.6x107 3.1x107

DPVB693 2.8x108 3.5x107

DPVB706 2.7x108 3.2x107

DPVB722 6.3x107 3.2x107

0.04 mM

PS832 3.9x107 4.2x106

DPVB693 1.4x108 5.7x106

DPVB706 6.8x107 4.5x106

DPVB722 1.4x108 3.5x106

0 mM

PS832 3.4x107 2.5x106

DPVB693 3.9x107 9.3x105

DPVB706 2.9x107 2.6x106

DPVB722 8.1x107 3.7x105

Values are averages of two independent experiments

76

Chapter 3

Identification of L-valine-Initiated-Germination-Active Genes

in Bacillus subtilis using Tn-seq

Cameron V. Sayer^, Bidisha Barat^, and David L. Popham*. Identification of L-valine-

initiated-germination-active genes in Bacillus subtilis using Tn-seq. PLOS One. 2019;14(6).

^ These authors contributed equally to this work.

* Corresponding author, dpopham@vt.edu

77

ATTRIBUTIONS

Cameron V. Sayer and Bidisha Barat contributed equally in performing the research,

experimentation, and data analysis of the material presented. David L. Popham was the principle

investigator. Cameron is responsible for the work presented in Figures 3.1, 3.4, S2, S3, S6 and S7

in addition to Tables 3.1, 3.2, 3.3, 3.4, S2 and S3. Bidisha is responsible for work presented in

Figures 3.2, 3.3, 3.4, S2, S3, S4, S5, S6, and S7 in addition to Tables 3.3, 3.4, 3.5, S2, S3 and S5.

Cameron, Bidisha, and David contributed to the writing of the manuscript.

78

ABSTRACT

Bacterial endospores can survive harsh environmental conditions and long-term

dormancy in the absence of nutrients but can rapidly germinate under favorable conditions. In

the present study, we employed transposon sequencing (Tn-seq) to identify genes with

previously uncharacterized roles in spore germination. Identified genes that encoded spore inner

membrane proteins were chosen for study of defined mutants, which exhibited delayed

germination in several assays in response to varying germinants. Significantly slowed release of

DPA indicated that mutants were affected in Stage I of germination. Several mutants exhibited

phenotypic traits consistent with failure of a GerA germinant receptor-mediated response, while

others appeared to have a more general loss of response to varied germinants. Use of a gerA-

lacZ transcriptional fusion and quantitative western blotting of GerAC allowed mutants to be

classified based upon normal or decreased gerA transcription and normal or reduced GerA

accumulation. Fourteen genes were identified to have newly described roles within Bacillus spore

germination. A more complete understanding of this process can contribute to the development

of better spore decontamination procedures.

79

INTRODUCTION

Bacterial endospores are capable of extended periods of dormancy while remaining

resistant to a variety of chemical and physical decontamination measures [1]. Dormant spores

can rapidly germinate when in a suitable environment, returning to a vegetative state [2, 3].

These factors allow endospores produced by certain species of Bacillus and Clostridium to excel

as human pathogens, act as potential bioterrorism agents, and contribute to significant food

contamination events [4, 5]. Preservation of dehydration of the metabolically inactive spore core

is the greatest factor in spore resistance properties and maintenance of spore dormancy [1]. This

dormant state is maintained by the inner spore membrane, which exists in a largely non-fluid

state [6], and a thick layer of peptidoglycan termed the cortex [7]. Additionally, the accumulation

of small molecule solutes within the core, such as calcium dipicolinic acid (DPA), contribute to

spore dehydration and resistance properties [1].

When dormant spores sense an environment conducive to vegetative growth, they will

rapidly germinate. Environmental sensing is achieved through the action of proteins expressed

late in sporulation, termed germinant receptors. Bacillus subtilis encodes three functional Ger

receptors: GerA, GerB, and GerK [8]. The GerA receptor responds to amino acids such as L-Alanine

and L-valine, while the GerB and GerK receptors work together to respond to a mixture of L-

Asparagine, D-glucose, D-fructose and K+ ions (AGFK) [2]. The mechanism of signal transduction

from Ger receptors to other spore components to initiate germination is not well understood,

but a major event is the opening of a channel involving SpoVA proteins to release Ca2+-DPA from

the spore core [9]. The GerD protein of Bacillus species is required for a rapid response to

germinants. Recent work suggests that GerD is essential for the colocalization of Ger receptors

in the spore’s inner membrane in a cluster termed the germinosome and probably plays an

80

intermediate role in the signal transduction pathway from germinant-receptor complex to

downstream germination effectors [9, 10].

Each Ger receptor is composed of three subunits: A, B, and C. The A subunits are

transmembrane proteins featuring sizable domains on each side of the membrane [3, 8]. The B

subunit proteins are thought to be integral membrane proteins that may be involved in

germinant recognition [11]. The C subunits are lipoproteins attached to the other surface of the

membrane [12]. Following triggering of the Ger receptors, water begins to partially rehydrate the

spore core, and Ca2+-DPA is released along with other ions contained within the spore core. The

spore cortex is then degraded through the action of germination-specific lytic enzymes (GSLEs)

which allow the spore core to continue to expand and return to a fully hydrated state [13]. The

spore will then resume metabolism and continue through outgrowth, eventually returning to a

fully vegetative state.

The goals of the current study were to identify additional genes with potential roles in

spore germination. Whereas previous studies have characterized genes whose loss resulted in a

near complete block of germination, we sought to find genes with more subtle phenotypes that

were potentially missed by previous procedures. Creation of a transposon-insertion mutant

library and submission of spores produced by that library to germination conditions, in

combination with Transposon Sequencing (Tn-seq)[14], facilitated identification of 61 genes that

exerted significant effects on germination efficiency or rate. Among these, 14 genes had not been

previously associated with spore germination and had been shown to produce proteins within

the spore membrane proteome, and these were selected for further characterization. Defined

gene knockout strains demonstrated reduced germination. Further studies implicated certain

genes in affecting the overall GerA receptor abundance within the dormant spores.

81

MATERIALS AND METHODS

Strain constructions. All strains are listed in Table A in S1 File. DNA extracted from a

previously constructed Tn-insertion library [15] was transformed into PS832 with selection for

spectinomycin resistance (100 µg/mL). Roughly 150,000 independent transformants were pooled

from plates to produce a new library.

Mutants lacking single genes were obtained from the Bacillus Genetic Stock Center. Each

mutation was a deletion/insertion, with the gene of interest replaced by an erythromycin

resistance gene flanked by two loxP sites [16]. The mutations were introduced into B. subtilis

strain PS832 by natural transformation with selection for erythromycin (2.5 µg/ml) and

lincomycin (12.5 µg/ml) (MLS) resistance.

Chromosomal DNA from B. subtilis strain DPVB724 with a gerB deletion and insertion of

a chloramphenicol (3.0 µg/ml) resistance gene was used to transform strains to GerB-. This was

done to reduce background detection of GerBC during Western blot quantification of GerAC.

B. subtilis strain DPVB761 with a gerA-lacZ fusion marked with an MLS resistance gene

was obtained from the Setlow lab [17, 18]. Since all the putative Ger mutant strains had the same

resistance gene marker, it was essential to delete the MLS resistance gene in order to transform

the mutant strains with chromosomal DNA carrying the gerA-lacZ fusion. The Cre recombinase

was expressed from plasmid pDR244 [16] to stimulate deletion of the resistance gene, leaving an

unmarked in-frame deletion mutation. The gerA-lacZ fusion was then introduced by natural

transformation into the 14 mutant strains carrying an unmarked deletion, with selection for MLS

resistance.

82

Chromosomal DNA from B. subtilis strain DPVB833, in which gerA expression is under the

control of spore-specific promoter PsspD [19], was introduced by natural transformation into

strains with an unmarked deletions, with selection for MLS resistance. All mutations were verified

by PCR and agarose gel electrophoresis.

Spore preparation. B. subtilis spores, both single strains and the Tn-insertion strain

library, were prepared in 2xSG broth [20]. Spores were harvested after 3-4 days incubation at

37°C and washed by shaking in water at 4°C and repeated centrifugation for several days. Purified

spores were examined by microscopy and were judged to be >95% phase-bright spores prior to

further assay.

To prepare germinated spores from the Tn-insertion library, a 10-ml suspension of

dormant spores at an optical density at 600 nm (OD600) of 100 (~3x1011 spores in total) in water

was heat-activated at 70°C for 30 min and cooled on ice for 10 min. The spores were then

submitted to germination conditions in 50 mM NaPO4 buffer (pH 7.4) with 10 mM L-valine at

37°C for 45 minutes. OD600 was monitored to ensure progression through germination.

Germinated spores were collected by centrifugation at 12,000 g for 5 min at 4°C. After

germination, subpopulations of dormant and partially germinated spores (𝛿≥1.25 g/ml) and fully

germinated spores (𝛿~1.19 g/ml) were collected following centrifugation through a layer of 43%

sodium diatrizoate.

Sequencing of Tn insertion sites. All spore samples were decoated using urea, SDS, and

DTT as described previously [21]. DNA was extracted from decoated spores using the Gram-

Positive protocol from the Qiagen Blood and Tissue kit. DNA was digested with MmeI and

quantified using Qubit (ThermoFisher). Samples were sent to the High-Throughput Sequencing

and Genotyping Center at the University of Illinois for library preparation and sequencing.

83

Adaptor ligations were performed including index bar codes as well as flow cell sequences.

Following adaptor ligation, samples were PCR amplified for 18 cycles. After amplification,

samples were purified and sequenced using an Illumina Hi Seq 2500, yielding reads with 5’

transposon sequence followed by a 16-bp region of genomic DNA. Sequencing read data files

were uploaded an analyzed using Geneious (version 10.0) (http://www.geneious.com, [22]).

Reads were filtered and trimmed leaving only genomic sequences and mapped to the JH642 B.

subtilis genome. Tables were exported from Geneious listing number of reads contained within

each annotated gene. Reads within each individual data set were expressed as a function of the

total number of reads per million from that sample. Once normalized, both experimental data

sets, dormant and germinated, were compared against one another allowing reporting of fold

change between samples. DESeq2 was used to determine p-values comparing dormant and

germinated samples [23]. Genes with 2-fold higher number of reads in the dormant versus the

germinated sample and significant p-values (≤0.05) were selected for further study.

Germination assays. To quantify change in OD600, purified spores were heat activated at

70°C for 30 minutes, quenched on ice for 5 minutes, and diluted to an OD600 of 0.2 in 50 mM

NaPO4 buffer (pH 7.4) containing L-valine (10 mM) or AGFK (10 mM L-Asparagine, 1 mM D-

Glucose, 1 mM D-Fructose, 10 mM KCl). Purified spores were heat activated at 70°C for 30

minutes, quenched on ice for 5 minutes, and stimulated to germinate by dilution to an OD600 of

0.2 in 2xYT (Final concentrations: 8 mg/ml Yeast Extract, 12.8 mg/ml Tryptone, 4 mg/ml NaCl).

Changes in OD600 were monitored using a Spectronic Genesys 5 spectrophotometer.

Purified spores of strains with and without overexpressed gerA were heat activated at

70°C for 30 minutes, quenched on ice for 5 minutes, and diluted to OD600 of 0.1 in 25 mM HEPES

84

buffer (pH 7.4). Nutrient germinants were added as described above, and changes in OD600 were

monitored using a Tecan M200 plate reader.

To quantify non-nutrient-triggered germination, purified spores at an OD600 of 1.0 were

germinated with 1 mM dodecylamine in 20 mM KPO4 buffer (pH 7·4) at 37°C. At indicated times,

1 ml of germinating spore suspensions were centrifuged 15,800 x g for 2 min. The A270 of the

supernatant was measured to quantify DPA release, which was expressed as a fraction of the

total spore DPA content. Total spore DPA was determined by boiling spores for 30 min and

measuring the A270 of the resulting supernatant.

To measure DPA release, spores from each mutant strain were heat activated at 70°C,

suspended in 25 mM HEPES buffer (pH 7.4) and submitted to germination conditions with 10 mM

L-valine at 37°C. Aliquots were taken from the germinating spores at indicated times and

centrifuged at 10,000 g for 45 seconds. The spore exudate was analyzed to determine the

amount of DPA released [24].

To measure release of cortex fragments, mutant spores were heat activated at 70°C,

suspended in 25 mM HEPES buffer (pH 7.4) and incubated with 10 mM L-valine at 37°C. OD600

was recorded and aliquots were taken from the germinating spores at indicated times. Samples

were centrifuged, and the spore exudate was subjected to amino acid/amino sugar analysis as

previously described [25]. Peaks representing N-acetyl muramic acid (NAM) were identified

based on elution times and quantified by integration of peak areas in comparison to known

standards.

Dormant spores were observed using phase-contrast microscopy prior to germination,

such that there were 70-100 spores per field of view and images were collected for 10 fields per

sample. Spores were then heat activated at 70°C for 30 minutes, quenched on ice for 5 minutes,

85

resuspended in 50 mM NaPO4 buffer (pH 7.4) and stimulated to germinate by addition of 10 mM

L-valine for 1 hour, and observed by microscopy again. The image processing toolkit Fiji was

combined with segmentation machine learning algorithms [26], in the open-source software

project Trainable Weka (Waikato Environment for Knowledge Analysis) Segmentation (TWS)[27].

This prototype segmentation algorithm was used to classify phase-bright and phase-dark spores.

To segment the input image data, TWS transforms the segmentation problem into a pixel

classification problem in which each pixel can be classified as belonging to a specific segment or

class such as phase-bright or phase-dark. A set of input pixels that has been labeled is then used

as the training set for a selected classifier. Once the classifier is trained, it can be used to classify

either the rest of the input pixels or completely new image data. Data were analyzed for images

from 3 fields per sample.

Assay of gerA transcription. B. subtilis strains with a gerA-lacZ transcriptional fusion were

grown and sporulated at 37°C in 2xSG medium. Purified spores were chemically decoated,

washed, and extracted, and 𝛽-galactosidase activity was assayed using methyl-umbelliferyl-D-

galactoside (MUG) as previously described [28-30]. MUG fluorescence was measured in a

microplate reader (Tecan) using excitation and emission wavelengths of 365 nm and 450 nm,

respectively. Standard solutions of methylumbelliferone were prepared in the same mix of

buffers in order to calibrate the fluorescence readings. The average activity of PS832 (wildtype

without gerA-lacZ fusion) samples was subtracted from the values for all samples containing the

gerA-lacZ fusion, and all readings were normalized to decoated spore OD600 values.

Western blotting. Quantitative western blots were performed on strains carrying a gerB

deletion to avoid cross-reactivity with the GerAC antibody. Purified dormant B. subtilis spores

(~100 OD600 units) were decoated and proteins were extracted as previously described for

86

western blot analysis [21]. Samples were then serially diluted with 2x SDS-PAGE sample loading

buffer and gerA gerB or gerD spore protein extract. TGX Stain-Free Fast Cast premixed

acrylamide solution (Bio-Rad) was used, which enabled rapid fluorescent detection of tryptophan

residues in proteins directly within gels and blots. The proteins were Trp-modified after

separation by a trihalo compound included in the electrophoresis gel, allowing fluorescent

visualization and quantitation of proteins on gels and blots immediately after the completion of

electrophoresis and transfer. The total protein load and recovery for each lane was measured as

the total fluorescence intensity for each lane of the blot. This was followed by probing with anti-

GerAC [30] or anti-GerD [30] antibodies via chemiluminescent western blot. Band intensity was

normalized to the protein present in each lane. Biorad Image Lab 6.0 was used to perform data

analysis of quantitative blots. Dilutions of 1.0, 0.5, 0.25, and 0.125 concentration were blotted.

Only the 1.0 and 0.5 concentrations were found to be within the linear range of detection, and

these were used for quantification. Quantitative GerAC and GerD western blots were performed

in triplicate.

RESULTS

Identification of mutant strains with slowed or reduced germination. Seeking to identify

additional genes that contribute to spore germination, Tn-seq was used to reveal genes

functioning in the early stages of germination. A library of magellan6x transposon insertions [15]

was transformed into a B. subtilis wild type strain, PS832, that is highly efficient at spore

formation and germination. An estimated 150,000 independent transformants were pooled into

a library from which dormant spores were produced. A sample of this spore library was collected

for Tn insertion site sequencing.

87

Dormant spores were heat-activated and were submitted to germination-inducing

conditions with 10 mM L-valine at 37°C for 45 minutes. A 45% drop of the starting OD600 was

observed as an indication of germination. Following germination, a density gradient was used to

separate dormant (and possibly partially germinated) spores (≥1.25 g/ml) from fully germinated

spores (~1.19 g/ml)[31]. This procedure was performed using two independent dormant spore

preparations.

DNA was extracted from the starting spore population and the dormant and germinated

spores, and the Tn insertion sites were sequenced as described [15] and mapped to the B. subtilis

genome. Sequence data is available at https://www.ncbi.nlm.nih.gov/sra/PRJNA544251. The

total library was found to have 5.5 x 104 unique insertions spread over 3,114 genes featuring ≥10

unique insertions per gene. The number of reads within each gene were normalized as a fraction

of the total reads obtained for that sample. Normalized data sets from germinated and dormant

spores were then compared against one another to determine fold change. Genes with a higher

proportion of reads in the dormant population indicate a possible role in germination. DESeq2

was implemented to determine p-values to further differentiate mutant abundance between

sample sets [23, 32].

In total, Tn insertions in 61 genes were found to be ≥2-fold underrepresented in the

germinated spores compared to those unable to complete germination (Table 3.1). These

included all three genes of the gerA operon, gerE, coat proteins cotH and cotE, and genes from

the gerP operon, all of which have known strong effects on germination. Slightly less than half

of the genes identified were known previously to have either sporulation or germination defects.

The identified genes that were not previously implicated in spore germination were cross-

referenced against proteins found in the inner spore membrane proteome [44, 45], identifying a

88

group of 14 genes that were studied further (Table 3.2). The majority of these genes were largely

uncharacterized and were annotated with a wide range of putative functions. Many of the genes

are not known to be expressed via sporulation-specific regulatory factors but rather are regulated

by vegetative cell transcriptional controls.

Characterization of germination of mutant strains. Strains carrying insertion mutations

[16] in each of the genes listed in Table 3.2 were obtained from the Bacillus Genetic Stock Center,

and these mutations were transformed into PS832. Mutant strains were characterized with

regard to growth rate and sporulation efficiency (Table 3.3). A number of the mutants exhibited

significant growth rate defects, and the ytxG mutant had a severely reduced sporulation

frequency. For comparison, gerA mutants grow and sporulate at wild type rates [34]. Purified

spores were analyzed using several germination assays to verify the defects indicated by the Tn-

seq data in addition to providing insight into potential function of these genes in germination.

Spores were germinated with the addition of 10 mM L-Val, and OD600 was monitored; an example

assay is shown in Fig 1 (Additional data in Figure S2). Each mutant strain exhibited a significant

germination rate defect in response to L-Val in comparison to the wild type (Table 3.4). The most

severe delays in germination rate were observed for the ylbC, dnaJ, sipT, and hfq mutants. For

comparison, a gerA mutant exhibited <1% germination even in the presence of 200 mM L-Ala,

which is more strongly stimulatory than 10 mM L-Val [61].

The slowed germination phenotype was further characterized by examining the individual

stages of germination using assays for release of dipicolinic acid (DPA) (Stage I) and N-

acetylmuramic acid (Stage II)[3]. Spores from each mutant strain were heat-activated, suspended

in 25 mM HEPES buffer, and submitted to germination conditions with 10 mM L-Val at 37°C. The

amount of DPA released from many of the mutant strains was vastly reduced compared to that

89

of PS832 (Table 3.3). For comparison, spores of a gerA mutant release ≤1% of their DPA over 120

min in the presence of L-Val [62]. The only strains that were not significantly different from PS832

were the yybT, ytxG, pcrB, and phoR mutants. Mutant strains lacking sipT, ylbC, or ytpA

demonstrated NAM release significantly less (p<0.05) than that of PS832 (Table 3.3, Figure S3).

The rest of the mutants exhibited reduction compared to PS832 but due to high variation among

replicates were not found to be significantly different (Table 3.3, Figure S3).

When mutant spore populations exhibit a decreased OD600 change during germination, it

could result from a large percentage of the spore population germinating incompletely or from a

smaller percentage of the population germinating at a normal rate with the remainder remaining

fully dormant. Spores of the various strains were imaged using phase-contrast microscopy, both

prior to and one-hour post-germination with 10 mM L-Val (Fig 3.2), and spores were classified as

phase-bright or phase-dark based on pixel intensities (Figure S4). All spore samples had ≥95%

phase-bright spores prior to germination. Post-germination, the wildtype spores had 95% phase-

dark spores while most of the mutant strains had significantly decreased percentages of phase-

dark spores (Table 3.3), indicating that much of the mutant strain spore populations did not

initiate germination.

Additional assays were performed using the germinants AGFK and 2xYT (Table 3.4), which

began to differentiate the mutants into distinct phenotypic groups. The first group features a

reduction in germination rate to all nutrient germinants tested: L-Val, AGFK, and 2xYT, and

includes strains with mutations in skfE, ylbC, hfq and dnaJ. The second phenotype includes strains

with a significantly delayed L-Val germination response, via a GerA receptor, but otherwise

germinate normally in response to rich medium and AGFK, via the GerB and GerK receptors. The

following strains featured this phenotype: yybT, ygaC, yqhL, yqeF and sipT. The final group

90

included strains with significantly slower germination rates in response to L-Val but have a delay

in response to either AGFK or 2xYT, but not both. Mutants lacking ytpA, phoP, phoR, pcrB and

ytxG feature these phenotypes. In addition, like a gerA mutant [63], all mutant strains were

capable of normal non-nutrient, non-Ger-receptor-mediated germination, in response to

dodecylamine (Table 3.4).

To determine if spores from mutant strains were blocked in germination or if they were

simply severely delayed, spores were plated and colonies that appeared over a 48-hour period

were counted. After 24 hours, all strains produced cfu/OD600 values similar to that of the wild

type strain, and none of the strains produced a >4% increase in colonies after the first 24 hours

(Table S3), indicating that the defects were a significantly slowed germination process and not

death of the spores.

Expression of the GerA receptor in mutant strains. Decreased germination in response

to L-Val can result from a low abundance of the GerA receptor [29, 30]. A gerA-lacZ

transcriptional fusion was used to determine if germination defects were correlated to reduced

gerA transcription. Mutant strains lacking sipT, ytpA, ylbC, or ygaC showed a significant decrease

in gerA transcription in comparison to the wildtype (Fig 3.3). To determine if this was a general

effect on 𝜎G-dependent transcription, the effects of these mutation on the expression of pbpF

and sspB were examined using lacZ fusions. The expression of these two genes was unaffected

by these mutations (Figure S5).

Quantitative GerAC western blots were performed to determine the amount of GerA

receptor in spores of all strains. An example Western blot is in Fig 3.4A, and additional blots are

in Figure S6. Many of the mutant strains exhibited significant decreases in GerAC abundance;

the most significant being a 75% decrease in a dnaJ mutant (Fig 3.4B). The abundance of GerD

91

was also determined using quantitative Western blots for spores of all mutant strains, as a GerD

deficiency could result in reduced germination efficiency. All the strains contained amounts of

GerD similar to that of the wild type, suggesting that GerD remains unaffected in these mutant

strains (Figure S7).

Overexpression of the GerA receptor in spores has previously been shown to increase

the response to GerA-specific germinants [19]. A fusion of the gerA operon to the forespore-

specific sspD promoter [19] was introduced into strains in order to determine if GerA

overexpression could reverse the germination defects associated with the mutations under

study. In almost all cases, GerA overexpression reversed the germination deficiency with L-Val

(Table 3.5), suggesting that decreased GerA abundance made a significant contribution to the

reduced germination efficiency in these mutant strains. Strikingly, in the ytxG mutant,

overexpression of GerA increased the germination deficiency. As previously observed [19],

overexpression of GerA resulted in significant decreases in the germination response to AGFK in

all strains (Table S4). In mutant strains that exhibited reduced germination in response to 2xYT,

GerA overexpression reversed this deficiency (Table S4).

DISCUSSION

The germination and return to growth of bacterial spores is an essential step in the

initiation of several diseases and of some causes of food spoilage. This Tn-seq analysis identified

42 B. subtilis genes that had not previously been associated with germination but are required

for a highly efficient germination response to L-Val. As the majority of proteins previously found

to play major roles in germination are membrane-associated, fourteen of these genes, whose

products had also been identified in studies of the spore membrane proteome [44, 45], were

further characterized. Well-defined mutations in these genes caused significantly reduced

92

responses to L-Val, and in some cases a decreased response to other nutrient germinants.

Several of these strains also exhibited slowed vegetative growth; such a growth defect could

certainly alter gene expression and progression through the sporulation process, potentially

affecting the germination apparatus. Future work on the specific mechanism by which these

mutations alter germination may reveal such effects. For all these mutants, the germination

defect appears to largely be a slow initiation of germination rather than a specific slowing of a

subsequent step in the germination process. The reduced percentage of spores within the

population that do initiate germination appear to progress through Stages I and II of germination

at a near normal pace; rates of OD loss and phase darkening are largely mirrored by rates of DPA

and NAM release. This suggests that the genes under study play a role in the earliest steps of

germination initiation.

Consistent with this idea, many of the mutant strains had reduced abundance of the GerA

receptor, indicating effects on receptor expression and stability or membrane incorporation. A

GerA deficiency is not surprising, given that the primary screen for identification of these genes

was for a reduced response to L-Val, which is recognized via GerA [2]. Based on responses to

additional germinant classes, the mutant strains could be separated into distinct phenotypic

groups. The first group features a reduction in germination rate with all nutrient germinants

tested (L-Val, AGFK, and 2xYT), demonstrating reduced germination efficiency mediated through

all receptors: GerA, GerB, and GerK. Mutant strains lacking skfE, ylbC, hfq, or dnaJ fall in this

group, which also includes the strains with the greatest decreases in GerA abundance. These

genes may play roles in expression or assembly of all Ger receptors or in facilitating signal

transduction from germinant receptors to other parts of the germination apparatus. The well-

studied function of DnaJ as a protein chaperone [64] might explain its effect on GerAC abundance

93

in spores, and this effect suggests that DnaJ is active in the forespore late into sporulation. While

the role of Hfq in Gram-positive species is not as well studied as in some Gram-negative species,

its known role as an RNA chaperone [65] might exert post-transcriptional effects on the

production of proteins important in the germination process. Interestingly, several other genes

found in this study to affect germination (dnaJ, ylbBC, yqeF, yqhL, yybT) have sizable 5’

untranslated regions in their mRNAs, which might be sites for post-transcriptional regulation, or

for which antisense RNAs have been identified (See http://subtiwiki.uni-goettingen.de/ for genes

yqeF, yqhL, and yybT). A mechanism by which SkfE, which is involved in export of a sibling-killing

antimicrobial [66], might affect germination is harder to imagine, but the fact that Tn insertions

in two other genes in the skf operon also reduced germination supports the importance of this

effect. Interestingly, expression of the skf operon is regulated by PhoPR [52], genes also

implicated by this study in altering germination response.

One of the more interesting genes identified for future study may be ylbC, which is likely

expressed as the downstream gene in the σF-regulated ylbB-ylbC operon [55]. YlbC contains two

conserved domains: an N-terminal cysteine rich secretory “CAP” domain, and a YkwD domain of

unknown function that is found only in proteins of spore-forming bacteria [67]. YlbB contains two

conserved CBS domains [67], which in at least one case has a role in ATP-binding [68]. Tn

insertions in ylbB were significantly underrepresented in the germination screen (p=0.014) but

did not achieve the cutoff of a 2-fold change. Thus, ylbB may function with ylbC, but might be

partially redundant with the paralogous yhcV, which is 𝜎G-dependent [55, 69] and encodes one

of the most abundant transcripts in the dormant spore [70]. The mechanism by which YlbC affects

gerA transcription and GerA abundance is a topic for ongoing study.

94

A second phenotypic group is composed of mutant strains with significantly delayed

germination via a GerA-mediated response but germinate normally through GerB and GerK

sensing. Strains lacking yybT, ygaC, yqhL, yqeF, or sipT exhibit this phenotype, and all except the

yybT mutant have significantly reduced spore GerA content. The roles of these genes in

germination are unclear, as most are relatively uncharacterized. YybT (GdpP) acts as a c-di-AMP

phosphodiesterase and exerts pleotropic effects on physiology and gene expression [71-74].

SipT, acting as a signal peptidase [75], could certainly exert effects on assembly of membrane

proteins important for germination, including GerA.

The third phenotypic group includes strains with significantly slower germination rates in

response to L-valine but either have a decreased response to AGFK or 2xYT but not both. Mutants

lacking ytpA, phoP, phoR, pcrB or ytxG feature these phenotypes. It is not clear how or why a

mutant would be deficient in GerA mediated response, have a normal GerB and GerK response,

but still be deficient for germination in rich media. The PhoPR mutants have poor vegetative

growth and pleotropic effects on gene expression [76, 77], which might exert quite variable

effects into the sporulation process. These mutants seemed to exhibit significant variability

between multiple spore preparations. Three mutants in this group may exert effects on

membrane structure. YtpA is a phospholipase [57, 78], PcrB is a heptaprenylglyceryl phosphate

synthase [79], and a ytxG mutant exhibits defects in membrane morphology [80]. Alterations in

the spore inner membrane might affect assembly or function of the germination initiation

apparatus. None of these three genes are specifically expressed in sporulating cells, and thus

their activity levels and effects on germination might be more varied among spore preparations

and possibly with regard to different germinants. Interestingly, the ytxG mutant was the only

strain in which overexpression of gerA did not correct the L-Val germination defect. This

95

overexpression in the ytxG mutant did decrease AGFK germination, as in other strains, suggesting

that the gerA overexpression was successful. Perhaps a membrane defect in this mutant renders

Ger protein complexes nonfunctional regardless of their expression level.

Four of the mutants identified here exhibit decreased gerA transcription. The predicted

functions of these gene’s products provide no simple explanation for how such an effect on

transcription could come about, and the mechanisms may therefore be indirect. The expression

of two other 𝜎G-dependent genes, pbpF and sspB, was not decreased in the mutant strains,

indicating that this was not an effect on the entire regulon. Altered activity of a transcription

factor involved in gerA transcription, SpoVT or YlyA [17, 55, 69, 81, 82], could be an expected

pathway for such an effect. Future work should examine the effects of these mutations on other

genes within forespore-specific regulons to resolve this.

Among the germination mutants identified in our Tn-seq screen, strains that could

complete Stage I of germination but were blocked in Stage II were not present. This may be due

to the mutant screening process utilized. Mutants with Tn insertions in cwlD, which should

exhibit this phenotype [83, 84], were slightly enriched in our non-germinating spore population,

but not above the significance cutoff value used. Spores blocked at stage II were expected to

pellet with dormant spores in the density gradient utilized [31]. One possibility is that spores

blocked at Stage II were unstable through the time of incubation with germinant, density gradient

separation, and subsequent washing, and thus were not efficiently recovered. Utilization of an

alternative isolation method might allow identification of mutants with this phenotype.

96

ACKNOWLEDGEMENTS

We thank Alan Grossman for providing the Tn insertion library, Peter Setlow and George

Korza for strains and antibodies, and Jennifer Meador-Parton and Isabelle Wal for technical

assistance.

97

REFERENCES

1. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J Appl Microbiol 101:514-25.

2. Moir A. 2006. How do spores germinate? J Appl Microbiol 101:526-530. 3. Setlow P. 2003. Spore germination. Curr Opin Microbiol 6:550-556. 4. Mallozzi M, Viswanathan VK, Vedantam G. 2010. Spore-forming Bacilli and Clostridia

in human disease. Future Microbiology 5:1109-1123. 5. Setlow P, Johnson EA. 2007. Spores and Their Significance. Food Microbiology:

Fundamentals and Frontiers, Third Edition:35-67. 6. Cowan AE, Olivastro EM, Koppel DE, Loshon CA, Setlow B, Setlow P. 2004. Lipids

in the inner membrane of dormant spores of Bacillus species are largely immobile. Proc Natl Acad Sci USA 101:7733-7738.

7. Koshikawa T, Beaman TC, Pankratz HS, Nakashio S, Corner TR, Gerhardt P. 1984. Resistance, germination, and permeability correlates of Bacillus megaterium spores successively divested of integument layers. J Bacteriol 159:624-32.

8. Ross C, Abel-Santos E. 2010. The Ger receptor family from sporulating bacteria. Curr Issues Mol Biol 12:147-58.

9. Vepachedu VR, Setlow P. 2007. Analysis of interactions between nutrient germinant receptors and SpoVA proteins of Bacillus subtilis spores. FEMS Microbiol Lett 274:42-7.

10. Li Y, Jin K, Ghosh S, Devarakonda P, Carlson K, Davis A, Stewart KA, Cammett E, Pelczar Rossi P, Setlow B, Lu M, Setlow P, Hao B. 2014. Structural and functional analysis of the GerD spore germination protein of Bacillus species. J Mol Biol 426:1995-2008.

11. Christie G, Lowe CR. 2007. Role of chromosomal and plasmid-borne receptor homologues in the response of Bacillus megaterium QM B1551 spores to germinants. J Bacteriol 189:4375-83.

12. Igarashi T, Setlow P. 2005. Interaction between individual protein components of the GerA and GerB nutrient receptors that trigger germination of Bacillus subtilis spores. J Bacteriol 187:2513-2518.

13. Popham DL, Bernhards CB. 2015. Spore Peptidoglycan, p In Press. In Driks A, Eichenberger P (ed), The Bacterial Spore: From Molecules to Systems. ASM Press, Washington, D.C.

14. Van Opijnen T, Bodi KL, Camilli A. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods 6:767-72.

15. Johnson CM, Grossman AD. 2014. Identification of host genes that affect acquisition of an integrative and conjugative element in Bacillus subtilis. Mol Microbiol 93:1284-301.

16. Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA. 2017. Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell Syst 4:291-305 e7.

17. Feavers IM, Foulkes J, Setlow B, Sun D, Nicholson W, Setlow P, Moir A. 1990. The regulation of transcription of the gerA spore germination operon of Bacillus subtilis. Molec Microbiol 4:275-282.

18. Zuberi AR, Moir A, Feavers IM. 1987. The nucleotide sequence and gene organization of the gerA spore germination operon of Bacillus subtilis 168. Gene 51:1-11.

19. Cabrera-Martinez RM, Tovar-Rojo F, Vepachedu VR, Setlow P. 2003. Effects of overexpression of nutrient receptors on germination of spores of Bacillus subtilis. J Bacteriol 185:2457-64.

20. Leighton TJ, Doi RH. 1971. The stability of messenger ribonucleic acid during sporulation in Bacillus subtilis. J Biol Chem 246:3189-95.

21. Stewart KA, Setlow P. 2013. Numbers of individual nutrient germinant receptors and other germination proteins in spores of Bacillus subtilis. J Bacteriol 195:3575-82.

98

22. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647-9.

23. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550.

24. Nicholson WL, Setlow P. 1990. Sporulation, germination, and outgrowth., p 391-450. In Harwood CR, Cutting SM (ed), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, England.

25. Dowd MM, Orsburn B, Popham DL. 2008. Cortex peptidoglycan lytic activity in germinating Bacillus anthracis spores. J Bacteriol 190:4541-8.

26. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676-82.

27. Hall M, Frank E, Holmes G, Pfahringer B, Reutemann P, Witten IH. 2009. The WEKA data mining software: an update. ACM SIGKDD Explorations Newsletter 11:10-18.

28. Ghosh S, Scotland M, Setlow P. 2012. Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. J Bacteriol 194:2221-7.

29. Ramirez-Peralta A, Stewart KA, Thomas SK, Setlow B, Chen Z, Li YQ, Setlow P. 2012. Effects of the SpoVT regulatory protein on the germination and germination protein levels of spores of Bacillus subtilis. J Bacteriol 194:3417-25.

30. Ramirez-Peralta A, Zhang P, Li YQ, Setlow P. 2012. Effects of sporulation conditions on the germination and germination protein levels of Bacillus subtilis spores. Appl Environ Microbiol 78:2689-97.

31. Setlow B, Melly E, Setlow P. 2001. Properties of spores of Bacillus subtilis blocked at an intermediate stage in spore germination. J Bacteriol 183:4894-4899.

32. Robinson DG, Chen W, Storey JD, Gresham D. 2014. Design and analysis of Bar-seq experiments. G3 (Bethesda) 4:11-8.

33. Naclerio G, Baccigalupi L, Zilhao R, De Felice M, Ricca E. 1996. Bacillus subtilis spore coat assembly requires cotH gene expression. J Bacteriol 178:4375-80.

34. Moir A, Lafferty E, Smith DA. 1979. Genetics analysis of spore germination mutants of Bacillus subtilis 168: the correlation of phenotype with map location. J Gen Microbiol 111:165-80.

35. Zheng L, Donovan WP, Fitz-James PC, Losick R. 1988. Gene encoding a morphogenic protein required in the assembly of the outer coat of the Bacillus subtilis endospore. Genes & Dev 2:1047-1054.

36. Behravan J, Chirakkal H, Masson A, Moir A. 2000. Mutations in the gerP locus of Bacillus subtilis and Bacillus cereus affect access of germinants to their targets in spores. J Bacteriol 182:1987-94.

37. Takamatsu H, Kodama T, Nakayama T, Watabe K. 1999. Characterization of the yrbA gene of Bacillus subtilis, involved in resistance and germination of spores. J Bacteriol 181:4986-94.

38. Fukushima T, Ishikawa S, Yamamoto H, Ogasawara N, Sekiguchi J. 2003. Transcriptional, functional and cytochemical analyses of the veg gene in Bacillus subtilis. J Biochem 133:475-83.

39. Zhang J, Fitz-James PC, Aronson AI. 1993. Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. J Bacteriol 175:3757-66.

40. Serrano M, Zilhao R, Ricca E, Ozin AJ, Moran CP, Jr., Henriques AO. 1999. A Bacillus subtilis secreted protein with a role in endospore coat assembly and function. J Bacteriol 181:3632-43.

99

41. Kuwana R, Okuda N, Takamatsu H, Watabe K. 2006. Modification of GerQ reveals a functional relationship between Tgl and YabG in the coat of Bacillus subtilis spores. J Biochem 139:887-901.

42. Beall B, Driks A, Losick R, Moran CP, Jr. 1993. Cloning and characterization of a gene required for assembly of the Bacillus subtilis spore coat. J Bacteriol 175:1705-16.

43. Perez-Valdespino A, Li Y, Setlow B, Ghosh S, Pan D, Korza G, Feeherry FE, Doona CJ, Li YQ, Hao B, Setlow P. 2014. Function of the SpoVAEa and SpoVAF proteins of Bacillus subtilis spores. J Bacteriol 196:2077-88.

44. Chen Y, Barat B, Ray WK, Helm RF, Melville SB, Popham DL. 2019. Membrane Proteomes and Ion Transporters in Bacillus anthracis and Bacillus subtilis Dormant and Germinating Spores. J Bacteriol 201(6).

45. Zheng L, Abhyankar W, Ouwerling N, Dekker HL, van Veen H, van der Wel NN, Roseboom W, de Koning LJ, Brul S, de Koster CG. 2016. Bacillus subtilis Spore Inner Membrane Proteome. J Proteome Res 15:585-94.

46. Wetzstein M, Volker U, Dedio J, Lobau S, Zuber U, Schiesswohl M, Herget C, Hecker M, Schumann W. 1992. Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis. J Bacteriol 174:3300-10.

47. Dambach M, Irnov I, Winkler WC. 2013. Association of RNAs with Bacillus subtilis Hfq. PLoS One 8:e55156.

48. Au N, Kuester-Schoeck E, Mandava V, Bothwell LE, Canny SP, Chachu K, Colavito SA, Fuller SN, Groban ES, Hensley LA, O'Brien TC, Shah A, Tierney JT, Tomm LL, O'Gara TM, Goranov AI, Grossman AD, Lovett CM. 2005. Genetic composition of the Bacillus subtilis SOS system. J Bacteriol 187:7655-66.

49. Puri-Taneja A, Paul S, Chen Y, Hulett FM. 2006. CcpA causes repression of the phoPR promoter through a novel transcription start site, P(A6). J Bacteriol 188:1266-78.

50. Kaushal B, Paul S, Hulett FM. 2010. Direct regulation of Bacillus subtilis phoPR transcription by transition state regulator ScoC. J Bacteriol 192:3103-13.

51. Tjalsma H, Bolhuis A, van Roosmalen ML, Wiegert T, Schumann W, Broekhuizen CP, Quax WJ, Venema G, Bron S, van Dijl JM. 1998. Functional analysis of the secretory precursor processing machinery of Bacillus subtilis: identification of a eubacterial homolog of archaeal and eukaryotic signal peptidases. Genes Dev 12:2318-31.

52. Allenby NE, Watts CA, Homuth G, Pragai Z, Wipat A, Ward AC, Harwood CR. 2006. Phosphate starvation induces the sporulation killing factor of Bacillus subtilis. J Bacteriol 188:5299-303.

53. Molle V, Fujita M, Jensen ST, Eichenberger P, Gonzalez-Pastor JE, Liu JS, Losick R. 2003. The Spo0A regulon of Bacillus subtilis. Mol Microbiol 50:1683-701.

54. Strauch MA, Bobay BG, Cavanagh J, Yao F, Wilson A, Le Breton Y. 2007. Abh and AbrB control of Bacillus subtilis antimicrobial gene expression. J Bacteriol 189:7720-32.

55. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P. 2006. The forespore line of gene expression in Bacillus subtilis. J Mol Biol 358:16-37.

56. DeLoughery A, Lalanne JB, Losick R, Li GW. 2018. Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in Bacillus subtilis. Proc Natl Acad Sci U S A 115:E5585-E5594.

57. Eiamphungporn W, Helmann JD. 2008. The Bacillus subtilis sigma(M) regulon and its contribution to cell envelope stress responses. Mol Microbiol 67:830-48.

58. Petersohn A, Brigulla M, Haas S, Hoheisel JD, Volker U, Hecker M. 2001. Global analysis of the general stress response of Bacillus subtilis. J Bacteriol 183:5617-31.

59. Rao F, See RY, Zhang D, Toh DC, Ji Q, Liang ZX. 2010. YybT is a signaling protein that contains a cyclic dinucleotide phosphodiesterase domain and a GGDEF domain with ATPase activity. J Biol Chem 285:473-82.

100

60. Luo Y, Helmann JD. 2012. A sigmaD-dependent antisense transcript modulates expression of the cyclic-di-AMP hydrolase GdpP in Bacillus subtilis. Microbiology 158:2732-41.

61. Atluri S, Ragkousi K, Cortezzo DE, Setlow P. 2006. Cooperativity between different nutrient receptors in germination of spores of Bacillus subtilis and reduction of this cooperativity by alterations in the GerB receptor. J Bacteriol 188:28-36.

62. Yi X, Liu J, Faeder JR, Setlow P. 2011. Synergism between different germinant receptors in the germination of Bacillus subtilis spores. J Bacteriol 193:4664-71.

63. Setlow B, Cowan AE, Setlow P. 2003. Germination of spores of Bacillus subtilis with dodecylamine. J Appl Microbiol 95:637-48.

64. Straus D, Walter W, Gross CA. 1990. DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of s32. Genes & Dev 4:2202-2209.

65. Kavita K, de Mets F, Gottesman S. 2018. New aspects of RNA-based regulation by Hfq and its partner sRNAs. Curr Opin Microbiol 42:53-61.

66. Gonzalez-Pastor JE, Hobbs EC, Losick R. 2003. Cannibalism by sporulating bacteria. Science 301:510-3.

67. Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F, Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Geer LY, Bryant SH. 2017. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res 45:D200-D203.

68. Zhou R, Cusumano C, Sui D, Garavito RM, Kroos L. 2009. Intramembrane proteolytic cleavage of a membrane-tethered transcription factor by a metalloprotease depends on ATP. Proc Natl Acad Sci U S A 106:16174-9.

69. Steil L, Serrano M, Henriques AO, Volker U. 2005. Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiol 151:399-420.

70. Korza G, Camilleri E, Green J, Robinson J, Nagler K, Moeller R, Caimano MJ, Setlow P. 2019. Analysis of the Messenger RNAs in Spores of Bacillus subtilis. J Bacteriol 201(9):e00007-19.

71. Gundlach J, Mehne FM, Herzberg C, Kampf J, Valerius O, Kaever V, Stulke J. 2015. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis. J Bacteriol 197:3265-74.

72. Gundlach J, Rath H, Herzberg C, Mader U, Stulke J. 2016. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation. Front Microbiol 7:804.

73. Luo Y, Helmann JD. 2012. Analysis of the role of Bacillus subtilis sigma(M) in beta-lactam resistance reveals an essential role for c-di-AMP in peptidoglycan homeostasis. Mol Microbiol 83:623-39.

74. Gandara C, Alonso JC. 2015. DisA and c-di-AMP act at the intersection between DNA-damage response and stress homeostasis in exponentially growing Bacillus subtilis cells. DNA Repair (Amst) 27:1-8.

75. Tjalsma H, Bolhuis A, Jongbloed JD, Bron S, van Dijl JM. 2000. Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of the secretome. Microbiol Mol Biol Rev 64:515-47.

76. Allenby NE, O'Connor N, Pragai Z, Ward AC, Wipat A, Harwood CR. 2005. Genome-wide transcriptional analysis of the phosphate starvation stimulon of Bacillus subtilis. J Bacteriol 187:8063-80.

77. Antelmann H, Scharf C, Hecker M. 2000. Phosphate starvation-inducible proteins of Bacillus subtilis: proteomics and transcriptional analysis. J Bacteriol 182:4478-90.

101

78. Tamehiro N, Okamoto-Hosoya Y, Okamoto S, Ubukata M, Hamada M, Naganawa H, Ochi K. 2002. Bacilysocin, a novel phospholipid antibiotic produced by Bacillus subtilis 168. Antimicrob Agents Chemother 46:315-20.

79. Guldan H, Matysik FM, Bocola M, Sterner R, Babinger P. 2011. Functional assignment of an enzyme that catalyzes the synthesis of an archaea-type ether lipid in bacteria. Angew Chem Int Ed Engl 50:8188-91.

80. Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ. 2016. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS Biol 14:e1002341.

81. Bagyan I, Hobot J, Cutting S. 1996. A compartmentalized regulator of developmental gene expression in Bacillus subtilis. J Bacteriol 178:4500-7.

82. Traag BA, Ramirez-Peralta A, Wang Erickson AF, Setlow P, Losick R. 2013. A novel RNA polymerase-binding protein controlling genes involved in spore germination in Bacillus subtilis. Mol Microbiol 89:113-22.

83. Popham DL, Meador-Parton J, Costello CE, Setlow P. 1999. Spore peptidoglycan structure in a cwlD dacB double mutant of Bacillus subtilis. J Bacteriol 181:6205-6209.

84. Sekiguchi J, Akeo K, Yamamoto H, Khasanov FK, Alonso JC, Kuroda A. 1995. Nucleotide sequence and regulation of a new putative cell wall hydrolase gene, cwlD, which effects germination in Bacillus subtilis. J Bacteriol 177:5582-5589.

102

Fig 3.1. Germination rates of B. subtilis strains. Purified spores were heat activated,

stimulated to germinate by addition of 10 mM L-Val, and shaken at 37°C, during which

the OD600 was monitored. Values are averages of three assays and error bars are standard

deviations. Each assay was performed on three replicate spore preparations. For the ylbC

(■) and phoP (▲) mutants, all points after 10 min are significantly different from those of

the wild type (●); P≤0.05.

103

Fig 3.2. Phase-contrast microscopy of germinating B. subtilis spore populations.

Purified spores of B. subtilis wild type and mutant strains were heat-activated and

stimulated to germinate by addition of 10 mM L-Val followed by incubation at 37°C for

60 mins. A) PS832 B) ytpA mutant strain C) ylbC mutant strain All panels are the same

magnification; the bar in panel C is 5 µm.

104

Fig 3.3: Expression of a gerA-lacZ transcriptional fusion. Purified spores carrying a gerA-

lacZ transcriptional fusion were decoated and lysed, and extracts were assayed for β-

galactosidase. Values are expressed as a percentage of that detected in DPVB761, the

wild type strain containing the gerA-lacZ fusion. Values are averages of triplicate assays

and error bars are standard deviations. * indicates a significant difference from the wild

type (p ≤ 0.05).

105

Fig 3.4: GerAC is reduced in the spores of several B. subtilis mutant strains. Equal

quantities of spore suspensions were decoated and broken, and proteins were extracted,

serially diluted, run on SDS-PAGE, and transferred to PVDF membrane as described

previously [21]. The membrane was probed with anti-GerAC antibodies [30] (Panel A and

Fig S4). Strain genotype (All strains were also gerB.) and sample dilution is indicated

above each lane. Protein load and transfer to membrane in each lane was normalized as

described in Materials and Methods, and the amount of GerAC detected in each strain

was compared to that found in the wild type (Panel B). Error bars indicate standard

deviations. * indicates a significant difference from the wild type (p ≤ 0.05).

106

Table 3.1: Genes in which Tn insertions altered germination

Gene p-valuea Fold-change Sample 1b

Fold-change Sample 2b

Reference for Ger defect

cotH 2.2E-35 15.0 10.9 [33]

gerAA 4.4E-31 150.1 43.7 [18, 34]

gerAC 2.0E-29 279.9 73.9 [18, 34]

cotE 3.8E-24 17.0 12.0 [35]

ygaC 2.3E-18 4.6 4.2

yqfT 3.0E-16 15.4 8.8

ypzK 6.3E-16 10.1 9.7

yqeF 2.0E-15 3.3 5.5

ymzD-ymcCc 5.7E-13 2.5 2.7

gerPF 5.8E-13 7.4 4.1 [36]

safA 1.1E-11 7.3 4.1 [37]

pcrB 2.3E-11 3.0 2.6

ylbC 3.9E-11 4.1 2.9

gidA 1.3E-10 4.2 2.8

gerPB 1.0E-09 5.9 3.6 [36]

gerPC 3.1E-09 11.7 3.9 [36]

nocA 4.2E-09 2.0 2.2

veg 1.1E-08 4.8 3.2 [38]

gerE 1.8E-08 Infinite 32.0 [34]

ytoA 2.2E-08 5.1 4.1

ytpA 1.0E-07 5.3 4.6

ytpB 1.1E-07 3.9 3.5

rsbW 1.2E-07 2.2 2.5

yfhD 2.8E-07 4.2 4.6

cotZ 7.7E-07 2.1 3.1 [39]

yqhL 1.1E-06 4.3 2.5

kinB 1.8E-06 1.6 1.9

skfC 1.9E-06 7.9 3.7

skfE 3.8E-06 8.4 3.7

gerAB 5.8E-06 181.7 73.6 [18, 34]

ymaB 6.6E-06 1.9 2.9

sipT 7.5E-06 2.5 2.8

skfG 9.7E-06 3.5 2.3

phoR 1.0E-05 2.5 3.0

cotN (tasA) 1.5E-05 2.1 2.2 [40]

yhbJ 2.8E-05 1.8 1.7

yhaM 3.3E-05 4.6 2.5

ymaF 3.7E-05 8.1 2.8

107

yabG 1.7E-04 2.5 2.3 [41]

spoVID 1.8E-04 2.7 2.1 [42]

yqhR 3.6E-04 2.3 2.0

yonF 4.7E-04 1.8 3.0

spoVAF 4.8E-04 2.2 1.8 [43]

hfq 6.7E-04 3.2 2.5

yosK 9.2E-04 4.4 6.4

yozE 9.4E-04 3.0 4.8

yopI 1.1E-03 2.3 2.8

flgN 1.2E-03 14.2 3.6

gerD 1.2E-03 2.6 1.9 [34]

fliW 2.0E-03 1.9 3.4

yfbJ 2.0E-03 3.1 2.3

ytmO 2.1E-03 4.0 3.5

gerPE 2.1E-03 6.5 1.7 [36]

phoP 2.3E-03 3.2 3.4

gerPD 4.7E-03 8.2 3.2 [36]

tufA 5.2E-03 5.7 3.1

ispA 5.7E-03 2.9 2.8

yoqL 1.7E-02 6.1 3.7

dnaJ 4.7E-02 2.5 2.9

yaaB (remB) 5.0E-02 7.4 2.3

ytxG 2.1E-01 2.7 2.9

yybT (gdpP) 2.4E-01 7.5 2.1 a p-value determined using DESeq2 [23] comparing Dormant and Germinated sample read counts. b Fold change in read counts of Dormant/Germinated samples

c Intergenic region

108

Table 3.2: Genes without previously known germination role identified by Tn-seq and in

spore membrane proteome.

Gene Function Locus structure Regulation of expression

dnaJ Protein quality control

hrcA-grpE-dnaK-dnaJ-yqeTUV

σA, HrcA [46]

hfq RNA chaperone hfq Increased protein during transition to stationary phase [47]

pcrB Heptaprenylglyceryl phosphate synthase

pcrB-pcrA-ligA-yerH

LexA regulon [48]

phoP Response regulator, phosphate metabolism

phoPR σA, σB, σE, CcpA, ScoC [49, 50]

phoR Sensor kinase, phosphate metabolism

phoPR σA, σB, σE, CcpA, ScoC [49, 50]

sipT Signal peptidase I sipT DegU [51]

skfE Export of spore killing factor (SkfA)

skfABCEFGH Spo0A, AbrB, PhoP [52-54]

ygaC Unknown ygaCD

ylbC Unknown ylbBC σF [55]

yqeF Unknown yqeF

yqhL Unknown yqhL mRNA processed by RNase Y [56]

ytpA Phospholipase, Bacilysocin synthesis

ytpAB σM [57]

ytxG General stress ytxGHJ σB, σH [58]

yybT (gdpP)

c-di-AMP phosphodiesterase. Functions in DNA damage and acid resistance [59]

yybS-gdpP-rplI σA, σD-induced antisense RNA [60]

109

Table 3.3: Phenotypic properties of B. subtilis strains

Genotype Doubling timea (min)

Sporulation efficiencyb (%)

DPA releasec (µg/ml/OD)

NAM releasec (nmole/ml/OD)

% phase-dark sporesd

Wild type 20 66 5.3 ± 0.1 61.0 ± 14.2 95

dnaJ 31 89 1.1 ± 0.4* 25.9 ± 12.7 14

hfq 40 63 2.2 ± .03* 30.1 ± 6.2 48

pcrB 31 68 3.0 ± 0 30.3 ± 8.0 41

phoP 44 83 2.7 ± 0.4* 46.6 ± 5.8 63

phoR 35 54 3.9 ± 0.5 39.2 ± 9.5 86

sipT 34 54 2.3 ± 1.0* 23.5 ± 10.2* 22

skfE 27 59 1.8 ± 0* 40.6 ± 10.7 38

ygaC 21 71 3.1 ± 0.4* 36.6 ± 9.9 60

ylbC 29 48 1.1 ± 0.3* 14.3 ± 3.4* 19

yqeF 23 84 1.9 ± 0* 37.2 ± 9.4 50

yqhL 20 53 2.6 ± 0.4* 36.1 ± 8.1 69

ytpA 22 95 1.63 ± 0* 17.7 ± 2.7* 55

ytxG 31 18 4.8 ± 0.3 50.9 ± 4.8 90

yybT 21 69 4.7 ± 0.4 56.6 ± 14.1 92 a Growth in 2xSG medium at 37°C b Heat-resistant count/total viable count after 24 hr incubation on 2xSG medium at 37°C. c Release of DPA and NAM 30 or 45 min, respectively, after exposure to 10 mM L-Val at 37°C. *

indicates a significant difference from the wild type (T-test, p<0.05). Values are indicative of averages and standard deviations of three biological replicates.

d Spores pixel intensities quantified and classified as described in Materials and Methods after 60 min exposure to 10 mM L-Val at 37°C.

110

Table 3.4: Response of B. subtilis strains to varied germinants.

Genotype

% OD600 lossa

% DPA released by dodecylamineb

L-Val (60 mins)

AGFK (60 mins)

2xYT (40 mins)

Wild type 60 ± 1 41 ± 2 60 ± 2 75 ± 1

dnaJ 6 ± 0** 28 ± 10* 40 ± 3* 68 ± 4

hfq 26 ± 5* 30 ± 1* 52 ± 2* 75 ± 1

pcrB 47 ± 10* 27 ± 3* 58 ± 4 87 ± 2

phoP 28 ± 1* 36 ± 10 53 ± 1* 59 ± 6

phoR 44 ± 2* 22 ± 10* 56 ± 1 52 ± 6

sipT 7 ± 0** 33 ± 10 57 ± 7 69 ± 5

skfE 35 ± 10* 28 ± 6* 50 ± 3* 82 ± 5

ygaC 22 ± 3* 37 ± 10 55 ± 2 67 ± 5

ylbC 8 ± 1** 13 ± 2** 23 ± 8** 66 ± 3

yqeF 38 ± 3* 33 ± 7 58 ± 1 84 ± 1

yqhL 33 ± 6* 37 ± 10 54 ± 3 71 ± 2

ytpA 32 ± 3* 41 ± 3 47 ± 3* 73 ± 4

ytxG 35 ± 0* 28 ± 8 53 ± 1* 72 ± 4

yybT 47 ± 2* 44 ± 7 60 ± 0 76 ± 4 a Values are averages and standard deviations of assays on three replicate spore preparations.

OD600 of purified spore suspension monitored at the indicated time after addition of 10 mM L-valine, 1X AGFK, or 2xYT while shaking at 37°C. * indicates a significant difference (T-test, p<0.05) or ** indicates a significant difference (T-test, p<0.01) from the wild type.

b Values are averages and standard deviations of assays on three replicate spore preparations. DPA release by purified spore suspension monitored 100 min after addition of 1 mM dodecylamine while shaking at 37°C.

111

Table 3.5. Overexpression of gerA suppresses germination defect of multiple mutants.

Genotype

% OD Lossa

without sspDp-gerA

with sspDp-gerA

Wild type 35 ± 4 38 ± 2

𝛥skfE 23 ± 5* 38 ± 3

𝛥pcrB 34 ± 7 37 ± 1

𝛥ygaC 26 ± 1* 36 ± 1

𝛥sipT 9 ± 5* 41 ± 1

𝛥ylbC 7 ± 0* 37 ± 0

𝛥hfq 27 ± 3* 38 ± 3

𝛥yqhL 29 ± 3* 37 ± 0

𝛥dnaJ 12 ± 2* 36 ± 2

𝛥yqeF 28 ± 2* 31 ± 2

𝛥phoR 37 ± 1 42 ± 9

𝛥phoP 32 ± 1 36 ± 0

𝛥ytxG 25 ± 6* 15 ± 4*

𝛥ytpA 25 ± 0* 38 ± 2

𝛥yybT 37 ± 2 37 ± 2 a Values are averages and standard deviations of assays on three replicate spore preparations. OD600 of purified spore suspension monitored 45 min after addition of 10 mM L-valine while shaking at 37°C. * indicates a significant difference from the wild type (T-test, p<0.05)

112

Chapter 4

Role of YlbC and YlbB in GerA-mediated spore germination in

Bacillus subtilis

Bidisha Barat and David L. Popham

113

ATTRIBUTIONS

Bidisha Barat performed the research, experimentation, and data analysis. David L. Popham is

the principal investigator.

114

ABSTRACT

Germination of dormant B. subtilis spores with specific nutrient germinants starts at the

inner membrane with the interaction of a germinant with Ger receptor proteins and progresses

through core rehydration and cortex breakdown. Deficiencies in Ger receptors such as GerA,

GerB, GerK, receptor-associated proteins such as GerD, Ca2+-dipicolinic acid channels, and lytic

enzymes can potentially inhibit the germination process. Using transposon sequencing, genes

newly implicated in germination were identified in a previous study. One such gene was ylbC,

encoding a protein of unknown function. The ylbC mutant strain showed a significant reduction

in germination efficiency with L-valine, about 80% of the population failed to initiate germination,

suggesting a defect in the GerA-mediated response. YlbC-deficient spores demonstrated a 30%

reduction in gerA transcription and 50% reduced GerA abundance relative to those of wild-type

spores. The ylbC gene is expressed in an operon with another gene ylbB under the control of a

forespore-specific sigma factor, σF. In an effort to better understand the underlying mechanism,

genetic studies were performed to determine if ylbC works with other known genes in altering

the production of germinant receptors. YlbC seemed to have an overall positive effect while YlbB

seemed to have a negative effect on GerA-dependent germination. Genetic characterization of

YlbC and YlbB demonstrated that they seem to act independently of each other in affecting GerA-

mediated germination despite being expressed in the same operon.

115

INTRODUCTION

Bacillus subtilis spores are formed under adverse conditions and are resilient to a range

of environmental agents including ultraviolet radiation, heat, desiccation and toxic chemicals [1].

These spores remain metabolically dormant for years, until nutrients are available in the

environment and they can revert to the vegetative state by spore germination followed by

outgrowth [2, 3]. Spore germination is an irreversible process that is generally initiated by the

addition of certain nutrients called germinants that are sensed by specific germinant receptors

present within the inner membrane of the spore. In B. subtilis , spore germination may be induced

by nutrients such as L-alanine, L-valine, a mixture of L-asparagine, D-glucose, D-fructose and

potassium ions (AGFK) or rich media as well as with non-nutrient germinants such as

dodecylamine (a cationic surfactant) Ca2+-DPA, or high pressure [4, 5]. B. subtilis germinant

receptors are expressed during late sporulation in the forespore, encoded by the homologous

tricistronic gerA, gerB, and gerK operons [4, 5]. The individual germinant receptors are composed

of A, B and C subunits, which work synergistically to function. The GerA receptor senses either L-

valine or L-alanine, whereas the GerB and GerK receptors respond to a combination of AGFK [6].

Although the process of germination in B. subtilis has been studied extensively, there are still

many undetermined aspects in this area. The exact mechanism of commitment to germinate and

the activation of germinant receptors by binding of nutrients is still not clear.

Recently, the YlbC protein was reported to be important in B. subtilis spore germination

with L-valine [7]. YlbC deficient spores demonstrated a >50-fold reduction in germination rate, a

30% reduction in gerA transcription, and 50% reduced GerA abundance relative to those of wild-

type spores [7]. YlbC is an uncharacterized membrane protein in Bacillus subtilis. ylbC is

expressed as a part of a two-gene operon under the control of σF, an early sporulation forespore-

116

specific sigma factor [8]. YlbC contains two conserved domains, including a CAP domain which is

a cysteine-rich secretory domain and a YkwD domain that is conserved in spore-forming bacteria

but with unknown function [9]. The protein contains a likely transmembrane domain near the N-

terminus [9] which together with indications from previous work could indicate that YlbC is

anchored to the inner spore membrane.

The upstream gene in the operon, ylbB, is annotated as a putative oxidoreductase. It has

a paralogous gene yhcV, which is expressed in the forespore later in sporulation under σG control

[8, 10]. YlbB contains conserved domains of cystathionine-beta-synthase (CBS) pairs [9], which

while largely uncharacterized, are predicted to have a role in ligand binding, most likely adenosyl

groups such as AMP or ATP [11]. YlbB shares a 38% sequence identity to a signaling protein from

Burkholderia which was shown to bind both NAD and AMP [12]. It could be theorized that YlbB

in a partially redundant manner with YhcV, acts as a sensor for the function of YlbC whose role

has yet to be determined. The ylbB-ylbC operon is transcribed under σF control [8], and thus

mutations to ylbC may have implications for spore assembly, thus affecting germination. YlyA is

produced during the late stage of sporulation and fine tunes forespore-specific transcription by

regulating the expression of σG-dependent genes involved in spore germination by binding to

RNA polymerase [13].

In the quest to provide more insight to what the function of YlbC is within spore formation

and germination, we have examined the roles of YlbB and YhcV as well as YlyA, which is involved

in modulation of genes that encode germinant receptors (GR), and their potential interaction

with YlbC.

117

RESULTS

Germination rates of deletion strains. Single mutants of ylbC, ylbB, yhcV, ylyA were

received from the Bacillus Genetic Stock Center. The wildtype strain PS832 was naturally

transformed with each of these mutations. Multiple mutants of the various genes were

generated (Table S5) and the impact of these mutations on spore germination was analyzed.

Purified spores were heat activated and germinated with 10 mM L-valine and changes in OD600

was monitored. All mutant strains with a ylbC deletion show a significantly reduced rate of

germination in comparison to the wildtype as seen in our previous studies for ylbC, which was

attributed to a defect in GerA receptor function. Single mutants ylbB::kan, ylbB, and

yhcV::kan have a germination rate significantly better than the wildtype, while the double

mutant ylbB::mls yhcV::kan has a germination rate comparable to the wildtype (Figure 4.1,

Table 4.1). Thus, YlbB and YhcV may have a negative effect or act as negative regulators of GerA,

therefore a ylbB and/or yhcV results in increased germination rates. The double mutants,

ylbB::kan ylbC::mls and ylbC::mls yhcV::kan show a significantly greater germination defect

than the wildtype and ylbC::mls. Since ylbB::kan ylbC::mls, ylbC::mls yhcV::kan, and

ylbB::kan ylbC::mls yhcV strains show germination rates similar to the ylbC strain (Figure

4.1, Table 4.1), YlbB and YhcV seem to be acting upstream of YlbC. Spores from ylyA show a

moderately reduced germination rate in comparison to the wildtype, though not as drastic as the

ylbC mutant strains. From previous studies on ylyA, it has been seen that a ylyA deletion leads to

an increase in SpoVT, which in turn may repress genes under σG control such as gerA [13].

However, germinant receptor levels of GerAA, GerAC, GerKA and GerD were found to be normal

in ylyA mutant spores [13]. Hence some additional factor may be responsible for this germination

defect.

118

Microscopic analysis of germination. In mutant strains that show a significant decrease

in germination rate, this phenotype could be attributed to the majority of the spore culture

germinating poorly or to a subpopulation of spores germinating normally and the rest remaining

dormant. To compare and quantify the number of germinated and dormant spores in the various

mutant strains, purified spores were induced to germinate with 10 mM L-valine and 25mM HEPES

buffer (pH 7.4), imaged at 1 hour pre and post germination by phase-contrast microscopy, and

categorized as phase-bright and phase-dark spores based on pixel intensity of the spores (Figure

S8). Prior to germination, all spore samples from the various strains had 95-99% phase- bright

spores. Post germination, PS832 (wildtype) and strains with a ylbB or yhcV deletion had ~90%

phase-dark spores and strains with a ylyA deletion had ~60% phase-dark spores while all the

mutant strains with a ylbC deletion had only ~20% phase- dark spores (Figure 4.2, S8). The ylbC

phenotype is conserved in the double and triple mutants with a ylbC deletion. The failure to

change from phase-bright to phase-dark indicates that these mutant spores failed to initiate

germination.

Polar effects of ylbB mutations. Since ylbB and ylbC are expressed in the same operon,

creating a single ylbB::kan or ylbB::mls mutant could lead to polar effects on expression of

ylbC. In order to check for polarity, a transcriptional fusion of ylbC to lacZ was generated to allow

quantification of ylbC transcription. The ylbC-lacZ expression in the wildtype, ylbB::kan, and

ylbB was compared by measuring the β-galactosidase activity. The ylbB::kan ylbC-lacZ strain

had a high ylbC expression in dormant spores in comparison to the wildtype, while a ylbB ylbC-

lacZ strain had a significantly lower ylbC expression in comparison to the wildtype (Figure 4.3).

However, a germination assay of ylbB spores in response to L-valine shows a similar rate of

germination in comparison to ylbB::kan, both faster than the wildtype.

119

The ylbC expression during sporulation was also measured for the various strains. Samples

were collected at timepoints throughout sporulation for assay of β-galactosidase. During sporulation,

ylbC expression was similar between mutant strains and wildtype. However, at T20 (20 hours after

initiation of sporulation and dormant spore formation), the ylbB::kan ylbC-lacZ strain had an

exceptionally high level of ylbC expression in comparison to the wildtype, while a ylbB ylbC::lacZ

strain had a significantly lower ylbC expression in comparison to the wildtype (Table 4.2). This

suggests that although ylbB::kan and ylbB have significantly different levels of ylbC expression,

these levels of YlbC production are sufficient to support rapid germination, and the effect on ylbB on

germination is through another YlbB function.

Expression of the GerA receptor. To determine if there was any difference in the gerA

transcription level in the single mutant strains ylbB::kan, ylbB, yhcV::kan, ylbC::kan, ylyA::kan

in comparison to the wildtype, gerA expression was determined using a gerA-lacZ transcriptional

fusion and measurement of β-galactosidase activity. The single mutants, ylbB::kan, ylbB,

yhcV::kan and ylyA::kan had comparable gerA transcription to the wildtype, while the ylbC::kan

mutant had a significant decrease in gerA transcription (Figure 4.4).

Previously, through the germination assays targeting different germinant receptors, it was

observed that a GerA germinant receptor mediated response (L-valine) may have led to the reduction

in germination initiation in ylbC::mls. [7] . This was supported by the observation that ylbC::mls

strain showed a ~50% decrease in the abundance of the GerA receptor in comparison to the wildtype.

Since the ylbB::kan,ylbB and yhcV::kan strains showed a better rate of germination than the

wildtype, the GerA abundance in these spores was measured using quantitative GerAC western blots

in comparison to the wildtype. All three mutant strains had similar GerAC abundance in comparison

to the wildtype (Figure 4.6).

120

Overexpression of ylbB. As mutants with a ylbB or yhcV deletion have a better rate of

germination than the wildtype, YlbB/YhcV could be having a negative effect on function of YlbC

or GerA. Overexpression of YlbB was obtained by cloning ylbB downstream of a sigma F-

dependent promoter (dacFp) and then insertion to the B. subtilis chromosome [14]. Purified

spores of PS832 (Wildtype), PS832 with ylbB overexpression, ∆ylbC, and ∆ylbC with ylbB

overexpression were stimulated to germinate with 10 mM L-valine and changes in optical density

were monitored. Overexpression of ylbB did not affect the germination rate in the wildtype

however, it significantly reduced the rate of germination in ∆ylbC with ylbB overexpression in

comparison to ∆ylbC (Figure 4.6, Table 4.3). This suggests that in the ∆ylbC strain which already

has reduced GerA abundance, overexpression of ylbB may inhibit the low amounts of GerA.

While, in the wildtype strain that has normal amounts of GerA, overexpression of ylbB may not

affect the higher levels of GerA.

MATERIALS AND METHODS

Strain constructions. Single mutants lacking four genes (ylbC, ylbB, yhcV, and ylyA) were

received from the Bacillus subtilis Genetic Stock Center. Each mutation was a deletion with the

replacement of the gene of interest by an erythromycin resistance gene flanked by two loxP sites

[21]. B. subtilis strain PS832 was naturally transformed with the mutations with selection for

erythromycin (2.5μg/ml) and lincomycin (12.5μg/ml) (MLS) resistance. To promote deletion of

the resistance gene, the Cre recombinase was expressed from plasmid pDR244 [21], which left

an unmarked in-frame deletion mutation. Multiple mutants were produced by repeating this

process. All strains are listed in Table S5.

121

To construct a ylbC-lacZ transcriptional fusion, the first 400 bases of ylbC was inserted into

plasmid pDPC87 [15], which contains a promoterless lacZ. The 5’-region of ylbC was amplified and

restriction sites were added onto the 5’ and 3’ ends. This 400 bp PCR product and vector pDPC87

[15] were digested with EcoRI and BamHI and ligated. Escherichia coli cells (DPVE3) were transformed

with the resulting plasmid (pDPV500), and transformants were screened by restriction mapping

followed by sequencing. Rec+ E. coli cells (DPVE2) were transformed with the plasmid with the correct

insert. The resulting plasmid DNA was transformed into B. subtilis strains PS832, ylbB::kan, and

ylbB with selection for chloramphenicol resistance when recombined into the chromosome via a

single crossover at the ylbC locus.

To reduce cross-reactivity of GerBC during quantitative western blot analysis of GerAC, strains

were converted to GerB- by transformation with chromosomal DNA from B. subtilis strain DPVB724

with an insertion of a chloramphenicol resistance gene and a gerB deletion.

B. subtilis strain with a gerA-lacZ fusion and MLS resistance gene (DPVB761) was received from the

Setlow lab [18, 19]. The gerA-lacZ fusion was naturally transformed into the ylbB::kan and yhcV::kan

mutant strains with selection for kanamycin and MLS and into the ylbB deletion strain with selection

for MLS. Since the strain with a ylbC deletion was also marked with a MLS resistance gene, it was

necessary to eliminate the MLS resistance gene for transformation of the ylbC mutant strain with

chromosomal DNA bearing the gerA-lacZ fusion. An unmarked in-frame deletion mutant was

generated by the Cre recombinase that deleted the MLS resistance gene followed by the introduction

of the gerA-lacZ fusion into the ylbC deletion strain by natural transformation with selection for MLS

resistance.

For overexpression of ylbB, the entire ylbB gene without the promoter region but

including the RBS was inserted into the plasmid pDPV115 which allows cloning of a gene

122

downstream of a sigma F-dependent promoter (dacFp) and then insertion to the B. subtilis

chromosome [14]. The promoterless ylbB gene was amplified and restriction sites were added

onto the ends. This 447 bp PCR product and vector pDPV115 were digested with SpeI and SacII

and ligated together. E. coli cells (DPVE3) were transformed with the resulting plasmid

(pDPV498), and transformants were screened by restriction mapping, followed by sequencing.

Rec+ E. coli cells (DPVE2) were transformed with the plasmid with a correct insert.. The resulting

plasmid DNA was transformed into B. subtilis with selection for chloramphenicol resistance

(3.0μg/ml) with recombination into the chromosome via a double crossover at the amyE locus.

All mutations were verified by PCR and agarose gel electrophoresis.

Spore preparation. Spores of B. subtilis strain PS832 and the various mutant strains were

prepared in 2xSG broth [20]. Cultures were incubated at 37°C and harvested after 3-4 days.

Spores were washed in cold water with repeated centrifugation for several days until >98% of

spores were free and phase-bright when observed by phase-contrast microscopy. Prior to assays,

purified spores were checked for >95% phase-bright phenotype by microscopy.

Germination assays. To quantify change in OD600 as a measure the of rate of germination,

purified spores were heat activated at 70˚C for 30 minutes and quenched on ice for 5 minutes. The

spores were then germinated at 37°C at an OD600 of 0.2 with 10 mM L-valine in 25mM HEPES buffer

(pH 7.4). Changes in OD600 over time was observed using a Tecan M200 microplate reader.

Assay of gerA and ylbC transcription. B. subtilis strains with a ylbC-lacZ or gerA-lacZ

transcriptional fusion were induced to sporulate by the nutrient exhaustion method in 2xSG at 37˚C.

Purified dormant spores were chemically decoated to remove the outer membrane and spore coat

proteins, washed, and extracted, followed by assay of β-galactosidase activity using methyl-

umbelliferyl-D-galactoside (MUG) as previously described [16]. A microplate reader (Tecan M200)

123

was used to measure the MUG fluorescence at excitation and emission wavelengths of 365 nm and

450 nm, respectively. To calibrate the fluorescence readings, methylumbelliferone standard

solutions were made in the same buffer mixture. The average β-galactosidase activity of PS832

(wildtype without gerA-lacZ or ylbC-lacZ fusion) was deducted from the readings for each sample

containing the gerA-lacZ or ylbC-lacZ fusion, and the decoated spore OD600 values were used for

normalization of the readings.

Western blot analysis. In order to avoid cross-reactivity of GerB with the GerAC antibody,

strains with a gerB deletion were used for performing quantitative western blots. Purified dormant

spores of B. subtilis (~100 OD600 units) were chemically decoated followed by extraction of proteins

as previously described [7]. Samples were then serially diluted with ∆gerA ∆gerB strain extract and

2x SDS-PAGE sample loading buffer. The Bio-Rad TGX Stain-Free Fast Cast premixed acrylamide

solution was used for SDS-PAGE as described previously [7]. A trihalo compound present in the

electrophoresis gel modified the proteins after separation, which made the proteins fluorescent

directly within the gel. Following membrane transfer, the total protein amount in each lane was

measured directly from the stain-free image of the membrane. The total density for each lane was

measured from the blot. The anti-GerAC antibody was used for probing via western blot. Individual

band intensity was compared between sample lanes and normalized to the total protein amount

measured from the stain-free image of the membrane for a particular lane. Dilutions of 1.0 and 0.5

were blotted and used for quantification. Data analysis of quantitative blots was performed using

Biorad Image Lab 6.0. Quantitative GerAC western blots were performed in triplicate.

Microscopy. Purified spores were observed both 1 hour prior and post germination with

10mM L-valine and 25 mM HEPES buffer via phase-contrast microscopy. Images were collected

124

and analyzed for each sample, using three visual fields each containing 70–300 spores per field,

as described previously [7].

DISCUSSION

The ylbC gene was identified in a previous Tn-Seq study of genes associated with L-valine

germination [7]. That study demonstrated a reduction in germination rate, a 30% reduction in gerA

transcription, and 50% reduced GerA abundance within dormant spores containing the ylbC null

mutation [7]. This additional study was performed to understand the specific mechanism by which

YlbC alters GerA-mediated spore germination. In the Tn-seq germination screen, Tn insertions were

significantly underrepresented in ylbB (p=0.014) however it did not qualify for the 2-fold difference

in reads cutoff used in that study [7]. ylbC and ylbB are expressed as a part of a bicistronic operon

under the control of a forespore-specific sigma factor, σF [8]. There are two conserved CBS domains

in YlbB which may be involved in binding of ligands such as ATP [11]. ylbB also has a paralogous gene

yhcV which is under the control of σG [8, 10]. Hence, ylbB may be functioning in conjunction with

ylbC or as a sensor for ylbC and potentially in a redundant manner with yhcV.

It could be theorized that YlbC is either acting positively on the transcription of gerA

and/or positively on GerA production (Figure 4.7). Alternatively, YlbC may act negatively on some

intermediate regulators (repressors) of gerA transcription such as YlyA, hence a ylbC would

result in a reduced gerA expression and thus reduced levels of GerA (Figure 4.8). The role of

YlbB/YhcV with respect to YlbC is uncertain; YlbB/YhcV could be acting upstream or downstream

of YlbC or completely independently (Figure 4.8). The potential role of YlbB/YhcV was studied

using both single and double mutants of ylbB, yhcV, and ylbC. If YlbB/YhcV is activating YlbC and

has an overall positive effect, ∆ylbB and ∆yhcV would in turn result in downregulation of gerA

and reduced GerA production. Alternatively, if YlbB/YhcV has a negative effect on YlbC or acts as

125

a negative regulator of GerA, then a ∆ylbB and ∆yhcV would result in more GerA production.

Germination with L-valine revealed that single mutants of ylbB and yhcV had a significantly

greater germination rate in comparison to the wildtype suggesting that YlbB/YhcV may have a

negative effect on either GerA or YlbC.

If YlbB/YhcV functions upstream of YlbC, then ∆ylbB ∆ylbC and ∆yhcV ∆ylbC spores should

behave the same as ∆ylbC spores. If YlbB/YhcV functions downstream of YlbC, ∆ylbB ∆ylbC and

∆yhcV ∆ylbC spores should behave the same as ∆ylbB spores. The germination assay of the

double mutants revealed that YlbB/YhcV may be acting upstream of YlbC. To rule out any polar

effect on the expression of ylbC in our ylbB::kan strain,ylbC transcription was studied using a lacZ

transcriptional fusion. Surprisingly, ∆ylbB produced a significantly lower level of ylbC expression

in comparison to ∆ylbB::kan, despite having similar germination rates suggesting that the

germination is not affected by YlbC levels in ylbB mutant strains instead could be through another

YlbB function. Apart from ∆ylbC, none of the single mutants showed any significant change in

gerA transcription and GerA production, suggesting that YlbB/YhcV may not be affecting GerA

mediated germination directly. Microscopy revealed that only strains with a ylbC deletion failed

to initiate germination.

To further investigate if YlbB has a negative effect on YlbC or GerA, ylbB was

overexpressed under the control of a sigma F-dependent promoter (dacFp). If YlbB has a negative

effect on YlbC, then overexpression of ylbB would result in poor germination in a ylbC+ strain and

would have no effect on the germination of the ylbC deletion mutant, which already has a

germination defect. Alternatively, if YlbB has a negative effect on GerA then overexpression of

ylbB would result in poor germination in a ylbC+ strain and the germination rate should be worse

in a ylbC- strain with ylbB overexpression than in the ylbC deletion mutant. Overexpression of

126

ylbB did not affect wildtype spore germination rate but significantly reduced the rate of

germination of ∆ylbC spores, indicating that ylbB overexpression may only have an inhibitory

effect in the presence of reduced amounts of GerA.

The exact mechanism by which YlbC affects transcription and protein production of GerA

still remains unclear as there is no clear connection between ylbC and other known genes in

altering the production of GerA. However, YlbC and YlbB may be acting independently of each

other despite being expressed in the same operon.

127

REFERENCES

1. Setlow P. 1994. Mechanisms which contribute to the long-term survival of spores of Bacillus species. J Appl Bacteriol Sympos Suppl 76:49S-60S.

2. Errington J. 1993. Bacillus subtilis sporulation: Regulation of gene expression and control of morphogenesis. Microbiol Rev 57:1-33.

3. Piggot PJ, Hilbert DW. 2004. Sporulation of Bacillus subtilis. Curr Opin Microbiol 7:579-86.

4. Paidhungat M, Setlow P. 2000. Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. J Bacteriol 182:2513-2519.

5. Setlow P. 2003. Spore germination. Curr Opin Microbiol 6:550-556. 6. Setlow P. 2014. Germination of spores of Bacillus species: what we know and do not

know. J Bacteriol 196:1297-305. 7. Sayer CV, Barat B, Popham DL. 2019. Identification of L-Valine-initiated-germination-

active genes in Bacillus subtilis using Tn-seq. PLoS One 14:e0218220. 8. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R,

Eichenberger P. 2006. The forespore line of gene expression in Bacillus subtilis. J Mol Biol 358:16-37.

9. Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F, Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Geer LY, Bryant SH. 2017. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res 45:D200-D203.

10. Steil L, Serrano M, Henriques AO, Volker U. 2005. Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiol 151:399-420.

11. Zhou R, Cusumano C, Sui D, Garavito RM, Kroos L. 2009. Intramembrane proteolytic cleavage of a membrane-tethered transcription factor by a metalloprotease depends on ATP. Proc Natl Acad Sci USA 106:16174-9.

12. Baugh L, Gallagher LA, Patrapuvich R, Clifton MC, Gardberg AS, Edwards TE, Armour B, Begley DW, Dieterich SH, Dranow DM, Abendroth J, Fairman JW, Fox D, 3rd, Staker BL, Phan I, Gillespie A, Choi R, Nakazawa-Hewitt S, Nguyen MT, Napuli A, Barrett L, Buchko GW, Stacy R, Myler PJ, Stewart LJ, Manoil C, Van Voorhis WC. 2013. Combining functional and structural genomics to sample the essential Burkholderia structome. PLoS One 8:e53851.

13. Traag BA, Ramirez-Peralta A, Wang Erickson AF, Setlow P, Losick R. 2013. A novel RNA polymerase-binding protein controlling genes involved in spore germination in Bacillus subtilis. Mol Microbiol 89:113-22.

14. Gilmore ME, Bandyopadhyay D, Dean AM, Linnstaedt SD, Popham DL. 2004. Production of muramic delta-lactam in Bacillus subtilis spore peptidoglycan. J Bacteriol 186:80-9.

15. Popham DL, Setlow P. 1994. Cloning, nucleotide sequence, mutagenesis, and mapping of the Bacillus subtilis pbpD gene, which codes for penicillin-binding protein 4. J Bacteriol 176:7197-7205.

16. Ghosh S, Scotland M, Setlow P. 2012. Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. J Bacteriol 194:2221-7.

17. Paidhungat M, Setlow B, Driks A, Setlow P. 2000. Characterization of spores of Bacillus subtilis which lack dipicolinic acid. J Bacteriol 182:5505-5512.

18. Feavers IM, Foulkes J, Setlow B, Sun D, Nicholson W, Setlow P, Moir A. 1990. The regulation of transcription of the gerA spore germination operon of Bacillus subtilis. Molec Microbiol 4:275-282.

19. Zuberi AR, Moir A, Feavers IM. 1987. The nucleotide sequence and gene organization of the gerA spore germination operon of Bacillus subtilis 168. Gene 51:1-11.

128

20. Leighton TJ. 1971. The stability of messenger ribonucleic acid during sporulation in Bacillus subtilis. J Biol Chem 246(10):3189-95.

21. Koo, B.M., Kritikos, G., Farelli, J.D., Todor, H., Tong, K., Kimsey, H., Wapinski, I., Galardini, M., Cabal, A., Peters, J.M. and Hachmann, A.B. 2017. Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell Syst 4:291-305 e297.

129

50

60

70

80

90

100

0 5 10 15 20 25 30

% I

NIT

IAL

OD

TIME (MINUTES)

AWild type ylbC::mls ylbB::kan yhcV::kan ylyA::kan ylbB

50

60

70

80

90

100

0 5 1 0 15 20 25 30

% IN

ITIA

L O

D

TIME (MINUTES)

BWild type ylbc::mls ylbB::kan ylbB::kan ylbC::mls

130

Figure 4.1 (A-C). Germination rates of B. subtilis strains. Purified spores of B. subtilis wild type and

mutant strains were heat activated, stimulated to germinate with 10 mM L-valine, and shaken at

37°C, during which the OD600 values were monitored. Values are averages of three assays and error

bars are standard deviations.

50

60

70

80

90

100

0 5 10 15 20 25 30

% IN

ITIA

L O

D

TIME (MINUTES)

C Wild type ylbC::mls ylbB::kan

yhcV::kan ylyA::kan ylbC::mls ylbB::kan

ylbC::mls yhcV::kan ylbb::mls yhcV::kan ylbC::mls ylyA::kan

ylbC::mls ylbB::kan yhcV ylbB

131

ylbC::mls ylbB::kan yhcV

Figure 4.2. Phase-contrast microscopy of germinating B. subtilis spore populations. Purified

spores of B. subtilis mutant strains were heat-activated and stimulated to germinate by addition

of 10 mM L-Val followed by incubation at 37°C for 60 mins.

132

Figure 4.3. Expression of ylbC-lacZ transcriptional fusion. Purified spores of mutant strains with a

ylbC-lacZ transcriptional fusion were assayed for β-galactosidase activity, and the fluorescence of the

hydrolysed MUG was calculated for all the mutant strains as described and compared to that of the

wildtype. Values are averages of triplicate assays and error bars are standard deviations. * indicates

p ≤ 0.05.

133

Figure 4.4. Expression of gerA-lacZ transcriptional fusion. Purified spores of mutant strains with a

gerA-lacZ transcriptional fusion were assayed for β-galactosidase activity, and the fluorescence of

the hydrolysed MUG was calculated for all the mutant strains as described and compared to that of

the wildtype. Values are averages of triplicate assays and error bars are standard deviations.

0

20

40

60

80

100

120

140

Wild type ylbC::mls ylbB::kan ylbB yhcV::kan ylyA::kan

% a

ctiv

ity

in t

he

Wild

typ

e

Strain

134

A gerA gerB 1.0 gerB 1.0 gerB ylbB 1.0 gerB 0.5 gerB ylbB 0.5

B gerA gerB 1.0 gerB 1.0 gerB ylbB::Kn 1.0 gerB 0.5 gerB ylbB::Kn 0.5

C gerA gerB 1.0 gerB 1.0 gerB yhcV::Kn 1.0 gerB 0.5 gerB yhcV::Kn 0.5

Figure 4.5. Quantitative anti-GerAC western blots of ylbB, ylbB::kan and yhcV::kan (A-C) with

graphical representation. Mutant spores in equal concentrations were decoated, broken and

proteins extracts were obtained and run on SDS-PAGE, followed by transfer to PVDF membrane as

described previously [7]. After membrane transfer, protein load between lanes was normalized using

Bio Rad Stain Free technology. The membrane was probed with anti-GerAC antibodies as shown and

quantitative western blot analysis was done using BioRad Image Lab 6.0. Representation of three

replicative blots for each strain relative to wildtype. Values are averages of triplicate assays and error

bars are standard deviations.

0

20

40

60

80

100

120

Ave

rage

% G

erA

co

mp

ared

to

wild

typ

e

Mutant Strains

ylbB

ylbB::kan

yhcV::kan

135

Figure 4.6. Germination rates of B. subtilis strains with ylbB overexpression. Purified spores of

B. subtilis wild type and mutant strains with and without ylbB overexpression were heat

activated, stimulated to germinate with 10 mM L-valine, and shaken at 37°C, during which the

OD600 values were monitored. Values are averages of three assays and error bars are standard

deviations. Each assay was performed on three replicate spore preparations.

50

60

70

80

90

100

110

0 5 10 15 20 25 30

% IN

ITIA

L O

D

TIME (MINUTES)

Wildtype

Wildtype ylbBoverexpression

ylbC

ylbC ylbBoverexpression

136

Figure 4.7. Hypothetical model A. YlbC acts positively on gerA transcription and/or positively on

GerA production.

137

Figure 4.8. Hypothetical model B. YlbC acts negatively on certain repressors of gerA

transcription such as SpoVT or YlyA. YlbB could have an overall positive or negative effect on

GerA and can act either upstream or downstream of YlbC.

138

Table 4.1: Response of B. subtilis strains to 10mM L-valine

Genotype % OD Loss % phase dark spores

L-valine (30 mins) L-valine (60 mins)

Wild type 28 ± 3 91

ylbC::mls 13 ± 5* 27

ylbB::kan 36 ± 3* 92

ylbB 37 ± 1* 91

yhcV::kan 35 ± 1* 92

ylyA::kan 19 ± 8* 74

ylbC::mls

ylbB::kan

7 ± 4 ** 26

ylbC::mls

yhcV::kan

6 ± 5** 25

ylbC::mls ylyA 9 ± 2* 26

ylbB::mls

yhcV::kan

28 ± 3 90

ylbC ylbB yhcV 10 ± 2* 25

Values are indicative of averages and standard deviations of three biological

replicates.

* indicates p ≤ 0.05 in comparison to the Wild type; * indicates p ≤ 0.05 in

comparison to ∆ylbC

139

Table 4.2: ylbC-lacZ expression of sporulating cells

Time PS832 ylbC-lacZ

nM MU/ml/OD

ylbB::kan ylbC-lacZ

nM MU/ml/OD

ylbB ylbC-lacZ

nM MU/ml/OD

T0 7756 7965 6352

T0.5 7730 8013 6566

T1 7744 8031 7321

T1.5 7848 8193 7562

T2 7910 8111 7650

T2.5 7977 7989 7678

T3 7744 7917 7378

T3.5 7320 7561 6967

T4 7312 7633 6808

T4.5 7211 7358 6018

T5 6842 7311 5464

T20 2491 6220 1626 a Values are from a single determination for each strain.

140

Table 4.3: Germination response of B. subtilis strains to 10 mM L-valine

Genotype % OD loss with L-valine (30 mins)

Wildtype 36 ± 0.5

Wildtype with ylbB overexpression 34 ± 4.3

∆ylbC 19 ± 2.0*

∆ylbC with ylbB overexpression 14 ± 0.6**

a Values are indicative of averages and standard deviations of three biological replicates.

* indicates p ≤ 0.05 in comparison to ∆ylbC ; * indicates p ≤ 0.05 in comparison to the Wildtype

141

Chapter 5

Final Discussion

142

Sporulation and spore germination have been extensively studied for decades using B.

subtilis as a model system. Spores have a very different structure than growing cells, with several

distinctive features. The spore layers starting from the inside and moving outward include the

core, inner membrane, germ cell wall, cortex, outer membrane, and coat [1]. The extremely

resilient structure of spores confers resistance to most standard bactericidal agents [2].

Therefore, there is a critical need for efficient and cheaper spore decontamination strategies. By

understanding the underlying mechanisms of spore germination, it can be exploited to either

facilitate triggering of germination to easily kill the resulting sensitive germinated spores or to

prevent spore germination involved in disease pathogenesis. However, there are still substantial

gaps in our understanding of spore germination such as the signaling cascade from the germinant

receptors to trigger spore germination and the regulation of germination-specific lytic enzymes.

By furthering the characterization and understanding of the mechanism of a substantial number

of unknown proteins involved in spore germination, it could provide key insights into the

germination network that may become targets to stimulate or block spore germination.

The work presented in this dissertation seeks to characterize proteins for their roles in

the spore formation and germination processes. Chapter 2 describes the role of putative ion

transporters in B. subtilis spores that had been identified from a proteomic analysis of the spore

membrane [5]. Metal ions have a distinct role as catalytic activators of various enzymes involved

in sporulation and cations such as K+, Ca2+, Mn2+, Mg2+ and Zn2+ are accumulated within the spore

core during the late stages of sporulation, contributing to spore heat resistance and stability. High

levels of dipicolinic acid (DPA) within the spore core forms a complex with Ca2+ and contributes

significantly to the spore resistance to heat. The early stage of spore germination is characterized

by the rapid release of monovalent and divalent ions along with DPA. Putative cation transporters

143

may be involved either in the uptake of ions during sporulation and/or rapid efflux of ions during

spore germination. B. subtilis strains with a yloB deletion produced a subpopulation of unstable

spores that were less resistant to heat and did not retain refractility, possibly due to a

nonfunctional high-affinity transporter for Ca2+. These mutant strains appeared to have a defect

in the transport of Ca2+ from the mother cell into the forespore. Hence, a fraction of these spores

failed to attain normal Ca2+-DPA amounts that is required for spore stability and critical enzymatic

activity resulting in the production of phase-dark spores. The subpopulation of spores that

remained phase-bright in these mutant strains and may have reached a threshold Ca2+-DPA

content were not completely normal because they demonstrated a significant decrease in heat

resistance and rate of germination. The germination defect could be attributed to the loss of

activity of some important germination-active proteins involved in Stage I of germination due to

an overall defect in dormancy and stabilization of the spore.

Previously, it has been reported that SpoVV transports DPA that is produced within the

mother cell across the outer forespore membrane [3] and it is transported across the inner

forespore membrane by SpoVA [4]. A similar mechanism may be involved in Ca2+ transport

wherein YloB may be involved in the high-affinity transport of Ca2+ across one forespore

membrane and other Ca2+ transporters may be present in the other forespore membrane. There

is not enough evidence to suggest whether yloB is expressed in the mother cell or in the

forespore, and therefore it is unclear if this protein might be involved in transport across the

inner or outer forespore membrane. This could be answered by studying the localization of YloB

during spore formation using fluorescence microscopy or immunoelectron microscopy. The

sextuple mutant of B. subtilis (∆znuA ∆yflS ∆ycnl ∆yloB ∆yugS::mls ∆chaA::spec) that lacked six

putative ion transporter genes showed an additional increase in Mg2+ and Mn2+ levels in the

144

phase bright spore population. This could be due to deletion of genes involved in export of these

ions, or perhaps larger amounts of Mg2+ and Mn2+ are accumulated in response to diminished

Ca2+ transport. It was also observed that K+ and Mg2+ were released rapidly within the first few

minutes of germination whereas Mn2+ was released slowly, similar to Ca2+-DPA. This suggests

that the excess Mg2+ is not associated with DPA while the excess Mn2+ may be bound to DPA as

is the case for Ca2+. Further characterization of the phase dark spores in these mutant strains by

using an alternate isolation method could shed light on diminished ion content and achieve a

better understanding of the interplay of the other ion transporters.

Chapter 3 aims to address questions surrounding additional proteins that contribute to

germination initiation by the implementation of a Tn-Seq approach. Previous genetic studies of

spore germination identified germination mutants using methods such as screening the Ger

response of sporulated colonies, which required a very large change in germination efficiency to

detect a phenotypic change. Using Tn-Seq it is possible to identify genes that produce an

important but more subtle effect on spore germination. An initial list of 61 genes was narrowed

down to 14 genes by comparison to inner membrane proteome lists [5]. Several of the 14 genes

of interest were previously shown to be involved in protein quality control or phosphate

metabolism but most were uncharacterized, with none of them being previously implicated to

having a role in spore germination. Spore germination starts with the interaction of a germinant

receptor in the inner membrane with nutrients known as germinants and progresses through

rehydration of the core and breakdown of the cortex. The germination process can be inhibited

by defects in germinant receptors and related proteins such as Ca2+-dipicolinic acid channels and

cortex-lytic enzymes. Mutations in the 14 genes demonstrated significantly reduced germination

initiation in response to L-valine and in certain cases in response to AGFK and 2xYT. This indicated

145

that these genes may be involved in the transfer of signal from the germinant receptors that

initiates spore germination. Further investigation revealed that the germination defect in all the

mutant strains seemed to be due to a defect in initiation of spore germination rather than a

specific defect in Stage I or Stage II of germination. The various phenotypic and biochemical

assays showed that most of the mutant strains had a decrease in GerA receptor function. Certain

mutants appeared to have decreased gerA transcription while others appeared to be defective

in GerA production, stability, or membrane incorporation. The overexpression of GerA receptor

resulted in reversion of the germination defect in majority of the mutant strains except in ∆ytxG.

This suggested that the decreased GerA abundance was responsible for the decreased

germination efficiency rather than a possible interruption in the signaling cascade. In the case of

∆ytxG, a defect in membrane morphology [6] may affect the assembly of the germination

apparatus and render Ger receptors nonfunctional irrespective of their expression level. Some

mutant phenotypes, such asthose in the skfE, ylbC, or hfq mutants, suggested defects in addition

to decreased GerA receptor function that could be attributed to post-transcriptional effects on

production of various germination active proteins or a defect in transduction of signal from the

nutrient receptors to the downstream germination apparatus. Although the focus for these

mutant strains has largely been on their effect on germination, several of these genes may be

involved in the sporulation pathway and the mutations may alter the expression of germination-

specific protein coding genes, ultimately manifested as a germination defect . Some of the genes

(dnaJ, ylbC, yqeF, yqhL, yybT) also have 5’ untranslated regions in their mRNAs that could be post-

transcriptional regulation sites. Future work needs to focus on determining the mechanisms by

which these mutants affect gerA transcription and GerA abundance.

146

In Chapter 3, it was reported that YlbC-deficient spores demonstrated a >50-fold

reduction in germination rate, a 30% reduction in gerA transcription, and 50% reduced GerA

abundance relative to those of wild-type spores. In Chapter 4, to further explore the mechanism

by which GerA-mediated spore germination is affected, we focused on the interaction of ylbC

with other known genes. The primary focus was on potential cooperation between ylbC and ylbB,

which were both expressed in the same operon under the control of a forespore-specific sigma

factor, σF [7], as well as yhcV which is paralogous to ylbB and σG- dependent [7, 8]. The data in

Chapter 4 indicate that YlbB/YhcV may be acting as negative regulators of GerA-mediated

germination and may be acting upstream of YlbC. Overexpression of YlbB revealed that excess

YlbB may have an inhibitory effect on GerA, but only in the presence of reduced amounts of GerA.

Thus, the negative effect of YlbB on GerA-dependent spore germination seems to be due a YlbB

function, and YlbC and YlbB seem to act independently of each other. It would be interesting to

see if there is any effect on YlbC protein abundance in the absence of YlbB by epitope tagging of

YlbC and performing quantitative western blots. Further screening of proteins that might interact

with YlbC using a two-hybrid library screening approach or biotin-based proximity labeling

methods that allows mapping of protein-protein interactions in a radius of 20 nm [9] may help to

achieve a full understanding of the underlying mechanism by which YlbC affects GerA

transcription and translation.

The results from the studies presented here will further understanding of the intriguing

process of spore germination and help develop more effective spore decontamination methods.

147

REFERENCES

1. Piggot PJ, Hilbert DW. 2004. Sporulation of Bacillus subtilis. Curr Opin Microbiol 7:579-

86. 2. Setlow P. 2014. Spore Resistance Properties. Microbiology Spectrum 2. 3. Ramirez-Guadiana FH, Meeske AJ, Rodrigues CDA, Barajas-Ornelas RDC, Kruse

AC, Rudner DZ. 2017. A two-step transport pathway allows the mother cell to nurture the developing spore in Bacillus subtilis. PLoS Genet 13:e1007015.

4. Tovar-Rojo F, Chander M, Setlow B, Setlow P. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. J Bacteriol 184:584-587.

5. Chen Y, Barat B, Ray WK, Helm RF, Melville SB, Popham DL. 2019. Membrane Proteomes and Ion Transporters in Bacillus anthracis and Bacillus subtilis Dormant and Germinating Spores. J Bacteriol 201(6).

6. Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ. 2016. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS Biol 14:e1002341.

7. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P. 2006. The forespore line of gene expression in Bacillus subtilis. J Mol Biol 358:16-37.

8. Steil L, Serrano M, Henriques AO, Volker U. 2005. Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiol 151:399-420.

9. Liu Q, Zheng J, Sun W, Huo Y, Zhang L, Hao P, Wang H, Zhuang M. 2018. A proximity-tagging system to identify membrane protein–protein interactions. Nature methods 15(9):715-22.

148

APPENDIX A

Supplementary Materials for Chapter 2

149

Table S1. Oligonucleotides used in this work.

Name Sequence (5’-3’) Use

DLP668 AGTAGCCCGGCATTTTTAGC PCR verification of znuA

DLP669 TAGCGGCCTGACTGAACAAG PCR verification of znuA

DLP670 CCGAACCTTGCGCTGATGTC PCR verification of ycnL

DLP671 GCCGCCTTGCTGCTGTTCTT PCR verification of ycnL

DLP672 TCAAGCGGGTGCGGGTAAAT PCR verification of yflS

DLP673 TGTATGCTGAACGGCTAACG PCR verification of yflS

DLP676 GTTCGCTTGGATTTTCATAA PCR verification of yloB

DLP677 CACCCAATTCTTCCCTGTTC PCR verification of yloB

DLP687 GATCCGACTGCCATTCCTGC Construction of chaA::spec

DLP688 CAATAAACCCTTGCCCTCGCTACGCAGAAAGCGGAACACCGGCC Construction of chaA::spec

DLP689 CGTTACGTTATTAGCGAGCCAGTCATGTCATTATGGCGATCGGC Construction of chaA::spec

DLP690 CCAGCCTTGCAGTAAGACGG Construction of chaA::spec

DLP683 ATCGGTACGCAGCTGGCGGC Construction of yugS::mls

DLP684 CGATTATGTCTTTTGCGCAGTCGGCACCATAAATGGTAAGGGGCC Construction of yugS::mls

DLP685 GAGGGTTGCCAGAGTTAAAGGATCCCTCGACGCCGAAGATCACC Construction of yugS::mls

DLP686 GCTTCTTTTGCAGCGACGCC Construction of yugS::mls

DLP675 CTGCTTTTTCGCGTGGATGG PCR verification of chaA::spec

DLP677 CGTAGCGAGGGCAAGGGTTTATTGTTTTCTAAAATCTG PCR verification of chaA::spec

DLP679 CTACGGCTTCCTTCCACCAA PCR verification of yugS::mls

DLP565 GCCGACTGCGCAAAAGACATAATCG PCR verification of yugS::mls

150

Figure S1. Growth and sporulation of putative ion transporter mutant strains of B. subtilis. A) Strains

were grown with shaking in 2xSG medium at 370C and O.D.600 was measured. Time 0 was the estimated

151

time of initiation of sporulation (T0) for each strain. B) Samples were collected for measuring GDH activity

as previously described [1]. Values are averages of three assays and error bars are standard deviations.

C) Samples were removed starting at T3 for measurement of DPA accumulation. DPA was quantified using

a colorimetric assay as previously described [1]. Values are averages of three assays and error bars are

standard deviations.

152

APPENDIX B

Supplementary Materials for Chapter 3

153

Table S2. B. subtilis strains used in this study.

Strain Genotype Source/Construction

DPVB724 gerB CmR FB72 [2]→PS832

DPVB726 gerA SpR gerB CmR FB72 [2]→PS832

DPVB747 skfE MLSR BKE01950a→PS832

DPVB748 pcrB MLSR BKE06600a →PS832

DPVB749 ygaC MLSR BKE08680a →PS832

DPVB750 sipT MLSR BKE14410a →PS832

DPVB751 ylbC MLSR BKE14960a →PS832

DPVB752 hfq MLSR BKE17340a →PS832

DPVB753 yqhL MLSR BKE24540a →PS832

DPVB754 dnaJ MLSR BKE25460a →PS832

DPVB755 yqeF MLSR BKE25700a →PS832

DPVB756 phoR MLSR BKE29100a →PS832

DPVB757 phoP MLSR BKE29110a →PS832

DPVB758 ytxG MLSR BKE29780a →PS832

DPVB759 ytpA MLSR BKE30510a →PS832

DPVB760 yybT MLSR BKE40510a →PS832

DPVB761 gerA-lacZ MLSR PS767 [3, 4]→PS832

DPVB763 skfE MLSR gerB CmR DPVB724→DPVB747

DPVB764 pcrB MLSR gerB CmR DPVB724→DPVB748

DPVB765 ygaC MLSR gerB CmR DPVB724→DPVB749

DPVB766 sipT MLSR gerB CmR DPVB724→DPVB750

DPVB767 ylbC MLSR gerB CmR DPVB724→DPVB751

DPVB768 hfq MLSR gerB CmR DPVB724→DPVB752

DPVB769 yqhL MLSR gerB CmR DPVB724→DPVB753

DPVB770 dnaJ MLSR gerB CmR DPVB724→DPVB754

DPVB771 yqeF MLSR gerB CmR DPVB724→DPVB755

DPVB772 phoR MLSR gerB CmR DPVB724→DPVB756

DPVB773 phoP MLSR gerB CmR DPVB724→DPVB757

DPVB774 ytxG MLSR gerB CmR DPVB724→DPVB758

DPVB775 ytpA MLSR gerB CmR DPVB724→DPVB759

DPVB776 yybT MLSR gerB CmR DPVB724→DPVB760

DPVB805 skfE Cre expression for deletion of MLSR

DPVB806 pcrB Cre expression for deletion of MLSR

DPVB807 ygaC Cre expression for deletion of MLSR

DPVB808 sipT Cre expression for deletion of MLSR

DPVB809 ylbC Cre expression for deletion of MLSR

DPVB810 hfq Cre expression for deletion of MLSR

DPVB811 yqhL Cre expression for deletion of MLSR

DPVB812 dnaJ Cre expression for deletion of MLSR

DPVB813 yqeF Cre expression for deletion of MLSR

DPVB814 phoR Cre expression for deletion of MLSR

DPVB815 phoP Cre expression for deletion of MLSR

DPVB816 ytxG Cre expression for deletion of MLSR

DPVB817 ytpA Cre expression for deletion of MLSR

DPVB818 yybT Cre expression for deletion of MLSR

DPVB819 skfE gerA-lacZ MLSR DPVB761→DPVB805

DPVB820 pcrB gerA-lacZ MLSR DPVB761→DPVB806

154

DPVB821 ygaC gerA-lacZ MLSR DPVB761→DPVB807

DPVB822 sipT gerA-lacZ MLSR DPVB761→DPVB808

DPVB823 ylbC gerA-lacZ MLSR DPVB761→DPVB809

DPVB824 hfq gerA-lacZ MLSR DPVB761→DPVB810

DPVB825 yqhL gerA-lacZ MLSR DPVB761→DPVB811

DPVB826 dnaJ gerA-lacZ MLSR DPVB761→DPVB812

DPVB827 yqeF gerA-lacZ MLSR DPVB761→DPVB813

DPVB828 phoR gerA-lacZ MLSR DPVB761→DPVB814

DPVB829 phoP gerA-lacZ MLSR DPVB761→DPVB815

DPVB830 ytxG gerA-lacZ MLSR DPVB761→DPVB816

DPVB831 ytpA gerA-lacZ MLSR DPVB761→DPVB817

DPVB832 yybT gerA-lacZ MLSR DPVB761→DPVB818

DPVB833 PsspD::gerA MLSR PS3476 [5]

DPVB834 skfE PsspD::gerA MLSR DPVB833→DPVB805

DPVB835 pcrB PsspD::gerA MLSR DPVB833→DPVB806

DPVB836 ygaC PsspD::gerA MLSR DPVB833→DPVB807

DPVB837 sipT PsspD::gerA MLSR DPVB833→DPVB808

DPVB838 ylbC PsspD::gerA MLSR DPVB833→DPVB809

DPVB839 hfq PsspD::gerA MLSR DPVB833→DPVB810

DPVB840 yqhL PsspD::gerA MLSR DPVB833→DPVB811

DPVB841 dnaJ PsspD::gerA MLSR DPVB833→DPVB812

DPVB842 yqeF PsspD::gerA MLSR DPVB833→DPVB813

DPVB843 phoR PsspD::gerA MLSR DPVB833→DPVB814

DPVB844 phoP PsspD::gerA MLSR DPVB833→DPVB815

DPVB845 ytxG PsspD::gerA MLSR DPVB833→DPVB816

DPVB846 ytpA PsspD::gerA MLSR DPVB833→DPVB817

DPVB847 yybT PsspD::gerA MLSR DPVB833→DPVB818 a Strain obtained from the Bacillus Genetic Stock Center

155

Table S3. Long-term germination efficiency of B. subtilis mutant strainsa

Strain Colonies after 24 hr

(cfu/mL/OD) New colonies after 48 hr

(cfu/mL/OD)

Wild type 3.5x108 0

dnaJ 9.6x108 0

hfq 3.2x108 0

pcrB 1.7x108 6.0x106

phoP 3.7x108 0

phoR 3.5x108 0

sipT 1.4x108 4.0x106

skfE 9.2x107 1.0x106

ygaC 4.0x108 1.0x107

ylbC 1.4x108 7.0x106

yqeF 1.7x108 0

yqhL 2.5x108 0

ytpA 1.8x108 0

ytxG 1.2x108 0

yybT 2.8x108 1.0x107

a Values are from a single determination for each strain. Purified spores were serially diluted, plated on 2xSG medium, and incubated at 37°C.

156

Table S4. Spore germination in response to diverse germinants following overexpression of gerA.

Genotype

% OD Loss at 60 mins with 1X AGFK % OD Loss at 40 mins with 2xYT

without sspDp-gerA

with sspDp-gerA without

sspDp-gerA with sspDp-gerA

Wild type 13 ± 4 4 ± 1.3* 34 ± 2 34 ± 1

dnaJ 6 ± 3* 1 ± 2* 23 ± 0* 29 ± 2

hfq 9 ± 5 5 ± 1* 33 ± 1 33 ± 2

pcrB 5 ± 1* 0 ± 1* 31 ± 0 36 ± 3

phoP 8 ± 3 1 ± 1* 33 ± 0 30 ± 1

phoR 5 ± 4* 1 ± 1* 32 ± 3 36 ± 4

sipT 6 ± 6* 0 ± 1* 30 ± 6 33 ± 1

skfE 4 ± 5* 3 ± 1* 32 ± 4 35 ± 0

ygaC 10 ± 1* 1 ± 4* 31 ± 3 32 ± 5

ylbC 5 ± 4* 0 ± 1* 16 ± 2* 31 ± 0

yqeF 5 ± 2* 4 ± 2* 33 ± 5 28 ± 3

yqhL 16 ± 5 0 ± 1* 34 ± 4 30 ± 1

ytpA 18 ± 2 13 ± 1 30 ± 1 33 ± 1

ytxG 7 ± 5 0 ± 2* 26 ± 2* 29 ± 8

yybT 17 ± 2 0 ± 0* 29 ± 1 36 ± 4 a Values are averages and standard deviations of assays on three replicate spore preparations.

OD600 of purified spore suspension monitored at the indicated time after addition of 1X AGFK or

2xYT while shaking at 37°. * indicates a significant difference from the wild type without PsspD-

gerA (p<0.05).

157

Figure S2. Germination rates of B. subtilis strains. Purified spores of B. subtilis wild type and

mutant strains were heat activated, stimulated to germinate by addition of 10 mM L-valine, and

shaken at 37°C, during which the OD600 was monitored. Values are averages of three assays and

20%

40%

60%

80%

100%

0 20 40 60 80 100 120 140 160 180

% I

nitia

l O

D

Time (min)

B

20%

40%

60%

80%

100%

0 20 40 60 100 140 180

% I

nitia

l O

D

Time (min)

C

20%

40%

60%

80%

100%

0 20 40 60 80 100 120 140 160 180

% I

nitia

l O

D

Time (min)

A

158

error bars are standard deviations. Each assay was performed on three replicate spore

preparations. A) Wild type ♦, ytxG X, yqhL ▲, ygaC +, dnaJ ■ B) Wild type ♦, phoR X, hfq +,

sipT ■, yybT ● C) Wild type ♦, sfkE X, pcrB ▲, yqeF +, ytpA ■.

159

Figure S3. Release of DPA and NAM by B. subtilis strains. Purified spores were heat activated,

stimulated to germinate by addition of 10 mM L-valine, and shaken at 37°C. Samples were taken

at designated intervals, centrifuged, and the supernatant was saved for later analysis. Values are

0

2

4

6

0 10 20 30 40 50

DP

A (

µg/m

L)

Time (min)

A

0

20

40

60

0 10 20 30 40 50

Norm

aliz

ed

Pe

ak A

rea

Time (min)

D

0

2

4

6

0 10 20 30 40 50

DP

A (

µg/m

L)

Time (min)

B

0

20

40

60

0 10 20 30 40 50

Norm

aliz

ed

Pe

ak A

rea

Time (min)

E

0

2

4

6

0 10 20 30 40 50

DP

A (

µg/m

L)

Time (min)

C

0

20

40

60

0 10 20 30 40 50

No

rmla

ize

d P

ea

k A

rea

Time (min)

F

160

averages of three assays for DPA (panels A-C) and NAM (panels D-F), and error bars are standard

deviations. Each assay was performed on three replicate spore preparations. Panels A and D:

Wild type ♦, ytxG X, yqhL ▲, ygaC +, dnaJ ■, ylbC ●. Panels B and E: Wild type ♦, phoR X,

phoP ▲, hfq +, sipT ■, yybT ●. Panels C and F: Wild type ♦, sfkE X, pcrB ▲, yqeF +, ytpA ■. For

DPA release: dnaJ, ylbC, yqeF, and ytpA strains are significantly different from the wild type at all

time points; hfq, phoP, sipT, ygaC, and yqhL strains are significantly different from 10 min

onwards; and pcrB, phoR, yybT, and ytxG, strains are not significantly different from the wild

type. For NAM release: sipT , ylbC, and ytpA strains are significantly different from the wild type

from 20 min onwards. Some other strains exhibited reduced NAM release, but this was not found

to be significant due to high variability between replicates.

161

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 50 100

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (skfE)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 40 80 120 160

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (pcrB)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 50 100 150

Spore

m

ean p

ixel in

tensity

Spore number (ygaC)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200 300

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (sipT)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number(ylbC)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (hfq)

162

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200 300

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (yqhL)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 50 100 150

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (dnaJ)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 50 100

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number(yqeF)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (phoR)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

50,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (phoP)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200 300

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ytxG)

163

Figure S4. Phase contrast microscopy image pixel intensities during spore germination.

Spores were subjected to germination conditions, 10 mM L-valine at 37°C, for 1 hour. For each

strain, pixel intensities were averaged for each spore detected in three images, including a range

of 127-509 spores (Each dot represents one spore). Blue dots indicate spores classified as phase

bright, which had similar intensities as spores in the initial dormant population, and orange dots

indicate spores classified as phase-dark, in order to determine population percentages in Table

3. Phase bright and phase dark spores are plotted independently on the X-axes.

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ytpA)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

50,000

0 50 100 150

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (yybT)

10,000

15,000

20,000

25,000

30,000

35,000

40,000

45,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (Wild type)

164

Figure S5. Expression of G-dependent genes in B. subtilis mutant strains. Purified spores

carrying lacZ transcriptional fusions were decoated and lysed, and extracts were assayed for β-

galactosidase. Values are expressed as a percentage of that detected in the wild type strain

containing the same lacZ fusion. Values are averages of assays on three (A, pbpF-lacZ) or two (B,

sspB-lacZ) replicate spore preparations and error bars are standard deviations.

0%

20%

40%

60%

80%

100%

120%

140%

160%

Wild type dnaJ sipT ygaC ylbC ytpA

% o

f a

ctivity in

th

e W

ild typ

e

Strain

A

0%

20%

40%

60%

80%

100%

120%

140%

Wild type sipT ygaC ylbC

% o

f a

ctivity in t

he

Wild

typ

e

Strain

B

165

Figure S6. GerAC is reduced in the spores of several B. subtilis mutant strains. Equal quantities

of spore suspensions were decoated and broken, and proteins were extracted, serially diluted,

run on SDS-PAGE, and transferred to PVDF membrane as described previously [6]. The membrane

was probed with anti-GerAC antibodies [7]. Strain genotype (All strains were also gerB) and

sample dilution is indicated above each lane or on the left of each panel.

166

Figure S7. GerD is not reduced in the spores of B. subtilis germination mutants. Equal quantities

of spore suspensions were decoated and broken, and proteins were extracted, serially diluted,

run on SDS-PAGE, and transferred to PVDF membrane as described previously [6]. The

membrane was probed with anti-GerD antibodies [7] (Panel A). Strain genotype (All strains were

also gerB.) and sample dilution is indicated above each lane or on the left of each panel. Protein

load and transfer to membrane in each lane was normalized as described in Materials and

167

Methods, and the amount of GerD detected in each strain was compared to that found in the

wild type (Panel B). Error bars indicate standard deviations. * indicates a significant difference

from the wild type (p ≤ 0.05).

168

APPENDIX C

Supplementary Materials for Chapter 4

169

1,000

11,000

21,000

31,000

41,000

51,000

0 200 400 600 800

Spore

m

ean p

ixel in

tensity

Spore number (Wild type)

1,000

11,000

21,000

31,000

41,000

51,000

0 100 200 300 400

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbC )

1,000

11,000

21,000

31,000

41,000

51,000

0 200 400 600

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbB)

1,000

11,000

21,000

31,000

41,000

51,000

0 50 100 150

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylyA)

1,000

11,000

21,000

31,000

41,000

51,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbC yhcV)

1,000

11,000

21,000

31,000

41,000

51,000

0 100

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbC ylbB)

170

Figure S8. Phase contrast microscopy image pixel intensities during spore germination. Spores

were subjected to germination conditions, 10 mM L-valine at 37°C, for 1 hour. For each strain,

pixel intensities were averaged for each spore detected in three images, including a total of at

least 100 spores. Blue dots indicate spores classified as phase bright, which had similar intensities

as spores in the initial dormant population, and orange dots indicate spores classified as phase-

dark, in order to determine population percentages.

1,000

11,000

21,000

31,000

41,000

51,000

0 100 200

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbC ylyA )

1,000

11,000

21,000

31,000

41,000

51,000

0 100 200 300 400

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbC ylbB yhcV )

1,000

11,000

21,000

31,000

41,000

51,000

0 200 400

Sp

ore

m

ea

n p

ixe

l in

ten

sity

Spore number (ylbB yhcV )

171

Table S5. B. subtilis strains used in this study

Strain Genotype Source/Construction

DPVB724 gerB CmR FB72 [2]→PS832

DPVB751 ylbC MLSR BKE14960a →PS832

DPVB761 gerA-lacZ MLSR PS767 [3, 4]→PS832

DPVB877 ylbB MLSR BKE14950a →PS832

DPVB878 ylyA MLSR BKE15440a →PS832

DPVB880 yhcV KnR BKK09230a →PS832

DPVB881 ylbB KnR BKK14950a →PS832

DPVB882 ylbC KnR BKK14960a →PS832

DPVB883 ylyA KnR BKK15440a →PS832

DPVB890 ylbC MLSR yhcV KnR DPVB880→DPVB751

DPVB891 ylbC MLSR ylyA KnR DPVB883 →DPVB751

DPVB892 ylbB MLSR yhcV KnR DPVB880 →DPVB877

DPVB898 yhcV Cre expression for deletion of KnR

DPVB909 ylbC MLSR ylbB KnR DPVB881 →DPVB751

DPVB910 yhcV ylbC MLSR ylbB KnR DPVB909→DPVB898

DPVB911 ylbB Cre expression for deletion of KnR

DPVB913 ylbC-lacZ CmR pDPV500 →PS832

DPVB915 ylbB KnR gerA-lacZ MLSR DPVB761→DPVB881

DPVB916 ylbC KnR gerA-lacZ MLSR DPVB761→DPVB882

DPVB917 ylyA KnR gerA-lacZ MLSR DPVB761→DPVB883

DPVB918 yhcV KnR gerA-lacZ MLSR DPVB761→DPVB880

DPVB919 ylbB KnR ylbC-lacZ CmR pDPV500 →DPVB881

DPVB920 ylbB ylbC-lacZ CmR pDPV500→DPVB911

DPVB921 ylbB KnR gerB CmR DPVB724 →DPVB881

DPVB922 yhcV KnR gerB CmR DPVB724 →DPVB880

DPVB929 dacFp::ylbB CmR pDPV498 →PS832

DPVB930 ylbC MLSR dacFp::ylbB CmR pDPV498→DPVB751

DPVB936 ylbB gerB CmR DPVB724→DPVB911

DPVB938 ylbB yhcV KnR DPVB880→DPVB911 a Strain obtained from the Bacillus Genetic Stock Center

172

REFERENCES

1. Nicholson WL, Setlow P. 1990. Sporulation, germination, and outgrowth., p 391-450. In Harwood CR, Cutting SM (ed), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, England.

2. Paidhungat M, Setlow B, Driks A, Setlow P. 2000. Characterization of spores of Bacillus subtilis which lack dipicolinic acid. J Bacteriol 182:5505-5512.

3. Feavers IM, Foulkes J, Setlow B, Sun D, Nicholson W, Setlow P, Moir A. 1990. The regulation of transcription of the gerA spore germination operon of Bacillus subtilis. Molec Microbiol 4:275-282.

4. Zuberi AR, Moir A, Feavers IM. 1987. The nucleotide sequence and gene organization of the gerA spore germination operon of Bacillus subtilis 168. Gene 51:1-11.

5. Cabrera-Martinez RM, Tovar-Rojo F, Vepachedu VR, Setlow P. 2003. Effects of overexpression of nutrient receptors on germination of spores of Bacillus subtilis. J Bacteriol 185:2457-64.

6. Stewart KA, Setlow P. 2013. Numbers of individual nutrient germinant receptors and other germination proteins in spores of Bacillus subtilis. J Bacteriol 195:3575-82.

7. Ramirez-Peralta A, Zhang P, Li YQ, Setlow P. 2012. Effects of sporulation conditions on the germination and germination protein levels of Bacillus subtilis spores. Appl Environ Microbiol 78:2689-97.