Cancer and Genetics:Cancer and Genetics:What’s the Connection?What’s the Connection?

Supported by a grant from Supported by a grant from the National Cancer Institutethe National Cancer Institute

1R25CA934261R25CA93426

Administered through the Administered through the Oncology Nursing SocietyOncology Nursing Society

Part IPart IDNA, Chromosomes, DNA, Chromosomes,

and Genesand Genes

Figure from the National Cancer Institute@ http://press2.nci.nih.gov/sciencebehind

Figure from the National Cancer Institute@ http://press2.nci.nih.gov/sciencebehind

Figure from the National Human Genome Research Institute (NIH)

Loosely coiledDNA

Tightly supercoiled DNAcondensed and packedinto a chromosomestructure.

DNA:DNA:Deoxyribonucleic acid. The genetic Deoxyribonucleic acid. The genetic material in a cell that contains genes. material in a cell that contains genes. Most Most DNADNA is in the nucleus. Some DNA is is in the nucleus. Some DNA is extranuclear, present in other cell extranuclear, present in other cell organelles such as the mitochondria. organelles such as the mitochondria. When the DNA represents all of the genes When the DNA represents all of the genes for the species, it is referred to as the for the species, it is referred to as the “genome.”“genome.”

DNA:DNA:DNA in humans is a linear, double-DNA in humans is a linear, double-stranded structure composed of multiplestranded structure composed of multipleunits of four different nitrogenous bases, each units of four different nitrogenous bases, each attached to a sugar molecule. The bases in attached to a sugar molecule. The bases in each strand are connected together by each strand are connected together by phosphate groups. The two individual strands phosphate groups. The two individual strands are held together (loosely) by hydrogen bonds are held together (loosely) by hydrogen bonds interacting between the base pairs of the interacting between the base pairs of the strands.strands.These double strands are divided into 46 These double strands are divided into 46 separate chunks, one “chunk” for each separate chunks, one “chunk” for each chromosome. chromosome.

Figure from the National Human Genome Research Institute (NIH)

Figure from the Roche Genetics Education Program CollectionFigure from the Roche Genetics Education Program Collection

Figure from the National Human Genome Research Institute (NIH)

Bases:Bases:Nucleoproteins created from amino acids Nucleoproteins created from amino acids as nitrogenous chemicals. Bases may be as nitrogenous chemicals. Bases may be single ring structures (pyrimidines) or single ring structures (pyrimidines) or double-ringed structures (purines). double-ringed structures (purines). These bases form the essential elementsThese bases form the essential elementsof nucleic acids.of nucleic acids.

Bases:Bases:A (adenine)A (adenine)

G (guanine)G (guanine) Purines Purines

T (thymine)T (thymine)

C (cytosine)C (cytosine) Pyrimidines Pyrimidines

NNHH

OO

NN

NHNH22

Cytosine:Cytosine:(Nitrogenous base - pyrimidine)(Nitrogenous base - pyrimidine)

NN

NN

NHNH22

Adenine:Adenine:(Nitrogenous base - purine)(Nitrogenous base - purine)

NNHH

NN

G

A

CC

Adenine

Guanine Cytosine

ThyminePurines

Pyrimidines

T

Nucleoside:Nucleoside:A nitrogenous base of adenine, guanine,A nitrogenous base of adenine, guanine,cytosine, or thymine attached to a five-cytosine, or thymine attached to a five-sided sugar (pentose sugar).sided sugar (pentose sugar).

The four bases of DNA converted to nucleosides by attaching a deoxyribose sugar (DR).

T

G

A

CC

DR

DRDR

DR

Nucleotide:Nucleotide:

A nucleoside (nitrogenous base attached A nucleoside (nitrogenous base attached to a five-sided sugar) connected to a to a five-sided sugar) connected to a phosphate group. It is these structures phosphate group. It is these structures that assemble into a single strand of that assemble into a single strand of DNA.DNA.

The four nucleosides of DNA converted to nucleotides by attaching a phosphate groups (P).

T

G

A

CC

P

P

P

P

P

P

DRDR

DRDR

Figure from the National Human Genome Research Institute (NIH)

Base Pairs:Base Pairs:

Nucleotides that pair up loosely togetherNucleotides that pair up loosely togetherwhen DNA is double-stranded. They arewhen DNA is double-stranded. They areheld together with the relatively weak forcesheld together with the relatively weak forcesof hydrogen bonds. Normally, adenine andof hydrogen bonds. Normally, adenine andthymine form a pair by sharing 2 hydrogenthymine form a pair by sharing 2 hydrogenbonds; cytosine and guanine form a basebonds; cytosine and guanine form a basepair sharing 3 hydrogen bonds. pair sharing 3 hydrogen bonds.

Two short DNA strand held loosely together by hydrogen bonds forming complementary base pairs.

T

G

A

CC

P

P

P

P

P

P

A-T complementary base pair

G-C complementary base pair

DRDR

DRDR

Complementary Bases:Complementary Bases:The nitrogenous bases that normally pairThe nitrogenous bases that normally pairusing hydrogen bonds. Adenine and using hydrogen bonds. Adenine and thymine are complementary to each thymine are complementary to each other. Cytosine and guanine are other. Cytosine and guanine are complementary to each other.complementary to each other.Because these pairs are complementaryBecause these pairs are complementary(and faithful), if the sequence of bases(and faithful), if the sequence of basesfor one strand of DNA is known, thefor one strand of DNA is known, thecomplementary strand can be predicted.complementary strand can be predicted.

Loosely coiled helix of a section of DNA

Figure from the Roche Genetics Education Program CollectionFigure from the Roche Genetics Education Program Collection

DNA:DNA:During the GDuring the G00 phase of the cell’s life, phase of the cell’s life,

the two DNA strands are loosely coiled. the two DNA strands are loosely coiled. This DNA structure is not visible with This DNA structure is not visible with standard light microscopy. During cell standard light microscopy. During cell division, DNA replicates itself & then division, DNA replicates itself & then compacts down into chromosome compacts down into chromosome structures that can “split” in the mitosis structures that can “split” in the mitosis phase of cell division, with each half of the phase of cell division, with each half of the chromosome going to the 2 different chromosome going to the 2 different new daughter cells.new daughter cells.

Figure from the National Human Genome Research Institute (NIH)

Loosely coiledDNA

Tightly supercoiled DNAcondensed and packedinto a chromosomestructure.

Chromosome:Chromosome:A temporary but consistent state of cellular A temporary but consistent state of cellular DNA tightly condensed & coiled into dense DNA tightly condensed & coiled into dense bodies that take up stain and are visible under bodies that take up stain and are visible under standard light microscopy during metaphase standard light microscopy during metaphase of mitosis. of mitosis.

Humans have 46 chromosomes divided into Humans have 46 chromosomes divided into 23 pairs. This number is known as the 23 pairs. This number is known as the "diploid" number of chromosomes for "diploid" number of chromosomes for humans. These 46 chromosomes contain all humans. These 46 chromosomes contain all the nuclear DNA of a human cell.the nuclear DNA of a human cell.

Chromosome

Centromere Chromatid

“q arm”

“p arm”

Telomeres

With every cell division, telomeres are shortened by about 100 bases.When telomeres are gone, cell death (apoptosis) ensues.The enzyme, telomerase, extends the life of the telomere.Many cancer cells have a lot of telomerase and their telomeres do not

shorten with cell division, contributing to their “immortality.”

3,000 – 20,0000 bases

These are the extreme ends or “tips” of aThese are the extreme ends or “tips” of achromosome. Within these structures arechromosome. Within these structures aremultiple repeat sequences. As a personmultiple repeat sequences. As a personages, the telomeric areas become shorter. ages, the telomeric areas become shorter. These play a role in cancer development in These play a role in cancer development in that many cancer cells retain their telomeric that many cancer cells retain their telomeric lengths and have minimal limits placed on lengths and have minimal limits placed on their reproductive capacity. The enzyme their reproductive capacity. The enzyme responsible for maintaining the responsible for maintaining the telomeres is telomerase. telomeres is telomerase.

Telomeres:Telomeres:

A set of stained metaphase chromosomes exactly as how they appear for chromosomal analysis under the microscope.

Karyotype:Karyotype:An organized arrangement of all of theAn organized arrangement of all of themetaphase chromosomes within one cell.metaphase chromosomes within one cell.The chromosomes are first collected intoThe chromosomes are first collected intopairs and then lined up according to size pairs and then lined up according to size (largest first) and centromere position.(largest first) and centromere position.This gross representation of DNA can be This gross representation of DNA can be used to determine missing or extra whole used to determine missing or extra whole chromosomes and some large chromosomes and some large structural rearrangements.structural rearrangements.

Metaphase chromosomes from one cell arranged in a“karyotype” from largest to smallest and most metacentric to least metacentric.

Karyotype:Karyotype:Because many chromosomes are of the same Because many chromosomes are of the same approximate size and shape, it can be difficult approximate size and shape, it can be difficult to differentiate specific chromosome pairs. to differentiate specific chromosome pairs. A modification technique is to use an enzyme A modification technique is to use an enzyme that selectively strips some of the surrounding that selectively strips some of the surrounding proteins away from the chromosomes, allowing proteins away from the chromosomes, allowing a “banding” pattern to be seen after staining. a “banding” pattern to be seen after staining. The “bands” or stripes are unique to eachThe “bands” or stripes are unique to eachchromosome pair and increase the accuracy chromosome pair and increase the accuracy of individual chromosome identification.of individual chromosome identification.

Karyotype:Karyotype:

When a karyotype shows the normalWhen a karyotype shows the normalnumber of chromosomes for human cells,number of chromosomes for human cells,the chromosome number is said to bethe chromosome number is said to beeuploideuploid. If the karyotype shows more. If the karyotype shows moreor less than the normal number, or hasor less than the normal number, or hasdiscernable structural abnormalities,discernable structural abnormalities,it is said to be it is said to be aneuploidaneuploid. Most cancer . Most cancer cells express some degree of chromosome cells express some degree of chromosome aneuploidy. aneuploidy.

An aneuploid tumor karyotype of a Wilm’s tumor showing multiple abnormalities of chromosome number and/or structure

Autosomes:Autosomes:The 22 pairs of human chromosomes that do The 22 pairs of human chromosomes that do not code for the sexual differentiation of the not code for the sexual differentiation of the individual. These chromosomes contain the individual. These chromosomes contain the genes that code for all the structures and genes that code for all the structures and regulatory proteins needed for normal regulatory proteins needed for normal function.function.

Sex Chromosomes:Sex Chromosomes:The pair of chromosomes that contain the The pair of chromosomes that contain the genes that code for the sexual differentiation of genes that code for the sexual differentiation of the individual. In males, the sex chromosomes the individual. In males, the sex chromosomes are an X and a Y. In females, the sex are an X and a Y. In females, the sex chromosomes are two XXs.chromosomes are two XXs.

All chromosomes underlined in red constitute the “autosomes.”The chromosomes circles in green are the sex chromosomes.

Karyotype Exercise

• http://www.biology.arizona.edu/human_bio/activities/karyotyping/karyotyping.html

Chromosome Function:Chromosome Function:Chromosomes are actually large “chunks” Chromosomes are actually large “chunks” of DNA that has been replicated duringof DNA that has been replicated duringDNA synthesis. The structure of a DNA synthesis. The structure of a chromosome, with 2 chromatids, allows thechromosome, with 2 chromatids, allows thereplicated DNA to be “pulled apart” during replicated DNA to be “pulled apart” during cell division so that each new daughter cell cell division so that each new daughter cell inherits exactly the right amount of DNA. So, inherits exactly the right amount of DNA. So, a major purpose of packing DNA into the a major purpose of packing DNA into the shapes of the 46 chromosomes is to ensure shapes of the 46 chromosomes is to ensure preciseprecise delivery of DNA to the next delivery of DNA to the next cell generation.cell generation.

Gene:Gene:A gene is a A gene is a specificspecific segment(s) of DNA that segment(s) of DNA that contains the genetic code for a specific protein. contains the genetic code for a specific protein. For every human trait or physical characteristic, For every human trait or physical characteristic, there is athere is a pairpair of gene alleles, one on each of the of gene alleles, one on each of the pair of chromosomes that have the locus for that pair of chromosomes that have the locus for that trait. trait. For example, we each have 2 specific gene alleles For example, we each have 2 specific gene alleles for blood type. One of these alleles is on one for blood type. One of these alleles is on one chromosome 9 of the pair, the other allele is chromosome 9 of the pair, the other allele is located on the other number 9 chromosome. One located on the other number 9 chromosome. One allele was inherited from our mothers and the allele was inherited from our mothers and the other allele was inherited from our fathers. other allele was inherited from our fathers.

Gene Function:Gene Function:The purpose of a gene is to code for the The purpose of a gene is to code for the making of a specific protein used by a cell, making of a specific protein used by a cell, tissue, or organ within the individual. tissue, or organ within the individual. For example, the hormone insulin is a protein. For example, the hormone insulin is a protein. When a person’s blood glucose level starts toWhen a person’s blood glucose level starts torise, the beta cells of the pancreas rapidly rise, the beta cells of the pancreas rapidly make insulin to meet the immediate needs of make insulin to meet the immediate needs of the person for blood glucose homeostasis. the person for blood glucose homeostasis.

Ala Phe Val LysSer Leu Gly

Primary Protein Structure

Gene sequence for this seven amino acid protein =

CGAAAGCATTCGTTCAATCCT

Gene Locus:Gene Locus:

The place on a chromosome pair whereThe place on a chromosome pair wherea specific gene resides. For most traits,a specific gene resides. For most traits,the gene locus is the same for all humans.the gene locus is the same for all humans.

Allele:Allele:One of possible alternate forms of a gene One of possible alternate forms of a gene for any trait or protein controlled by afor any trait or protein controlled by asingle gene. single gene. For blood type, there are 3 possible gene For blood type, there are 3 possible gene alleles, A, B, and O. Each person, however, alleles, A, B, and O. Each person, however, only has two of these possible 3 alleles thatonly has two of these possible 3 alleles thatdetermine blood type. Some traits have determine blood type. Some traits have even more than 3 possible gene alleles types, even more than 3 possible gene alleles types, but each person only has 2.but each person only has 2.

Father’s Chromosome PairFather’s Chromosome Pair Mother’s Chromosome PairMother’s Chromosome Pair

Gene locusGene locusFor trait 1For trait 1

1a1a

Father’s Chromosome PairFather’s Chromosome Pair Mother’s Chromosome PairMother’s Chromosome Pair

Gene locusGene locusFor trait 1For trait 1

1b1b 1c1c 1d1d

The individualThe individualcolors for trait 1colors for trait 1indicate 4 differentindicate 4 differentalleles are possiblealleles are possiblefor ear shape.for ear shape.However, anyHowever, anyperson can onlyperson can onlyhave 2 alleleshave 2 allelesfor any one singlefor any one singlegene trait.gene trait.

1a1a 1c1c

Four possible allelic combinations for trait 1Four possible allelic combinations for trait 1among offspring of parents from previous slideamong offspring of parents from previous slide

1a1a 1d1d 1b1b 1b1b1c1c 1d1d

Allele:Allele:If a person has two identical alleles for aIf a person has two identical alleles for asingle gene trait, the person is said to be single gene trait, the person is said to be homozygous homozygous for that trait. So, if a person for that trait. So, if a person has an “A” blood type gene allele on one has an “A” blood type gene allele on one number 9 chromosome, and an “A” blood number 9 chromosome, and an “A” blood type gene allele on the other number type gene allele on the other number 9 chromosome, the person is homozygous 9 chromosome, the person is homozygous for that trait and will express the A blood for that trait and will express the A blood type.type.

Allele:Allele:If a person has two different alleles for a single If a person has two different alleles for a single

gene trait, the person is gene trait, the person is heterozygousheterozygous for for that trait. So, if a person has an “A” blood that trait. So, if a person has an “A” blood type gene allele on one number 9 chromosome, type gene allele on one number 9 chromosome, and a “B” blood type gene allele on the other and a “B” blood type gene allele on the other number 9 chromosome, he or she is number 9 chromosome, he or she is heterozygous for that trait and will express the heterozygous for that trait and will express the AB blood type. Because the A and B alleles AB blood type. Because the A and B alleles are equally dominant (are equally dominant (co-dominantco-dominant), they will ), they will both be expressed in the actual blood type.both be expressed in the actual blood type.

Allele:Allele:There are differences in expression of theThere are differences in expression of thealleles for a trait depending on whether analleles for a trait depending on whether anallele is dominant or is recessive. If a person has allele is dominant or is recessive. If a person has an “A” blood type gene allele on one number 9 an “A” blood type gene allele on one number 9 chromosome, and an “O” blood type gene allele chromosome, and an “O” blood type gene allele on the other number 9 chromosome, he or she is on the other number 9 chromosome, he or she is heterozygousheterozygous for that trait and express only the A for that trait and express only the A blood type. Because the A allele is dominant and blood type. Because the A allele is dominant and the O allele is recessive, he or she will not both be the O allele is recessive, he or she will not both be expressed in the actual blood type. Only the expressed in the actual blood type. Only the dominant allele is expressed and the recessive dominant allele is expressed and the recessive allele is “silent.”allele is “silent.”

Genotype:Genotype:The actual gene constitution of a given person. The actual gene constitution of a given person. For example, if a person has type O blood, the For example, if a person has type O blood, the genotype for blood grouping would be the same genotype for blood grouping would be the same as the phenotype (“O”) because type O blood is a as the phenotype (“O”) because type O blood is a recessive trait and requires that bothrecessive trait and requires that bothalleles be the “O” gene to be expressed. The alleles be the “O” gene to be expressed. The widow’s peak, however, is a dominant trait and widow’s peak, however, is a dominant trait and will be expressed even if the person has only one will be expressed even if the person has only one allele for widow’s peak.allele for widow’s peak.

Phenotype:Phenotype:The observable characteristics of a The observable characteristics of a given person. For example, a given person. For example, a person may have the blood type of “O,” person may have the blood type of “O,” and have a widow’s peak hairline. The and have a widow’s peak hairline. The phenotype does not always tell you what phenotype does not always tell you what the genotype of the person is.the genotype of the person is.

Gene Expression:Gene Expression:Activation of a gene leading to Activation of a gene leading to transcription, translation, and synthesis transcription, translation, and synthesis of a specific protein. This process of a specific protein. This process results in the making of a protein to results in the making of a protein to ensure the observable presence of the ensure the observable presence of the trait or condition coded for by the gene.trait or condition coded for by the gene.

Gene Suppression:Gene Suppression:Suppression of the expression of specific Suppression of the expression of specific gene activity through the action of a gene activity through the action of a regulatory gene. The outcome of generegulatory gene. The outcome of geneexpression can be inhibited indirectlyexpression can be inhibited indirectlythrough signal transduction pathwaysthrough signal transduction pathwaysthat operate at the cell level rather than at that operate at the cell level rather than at the gene level. For example, the Tp53 the gene level. For example, the Tp53 gene prevents complete expression of angene prevents complete expression of anoncogene by inhibiting mitosis rather thanoncogene by inhibiting mitosis rather thanby turning off oncogene expression.by turning off oncogene expression.