Boosting Secretion of Extracellular Protein by Escherichia colivia Cell Wall Perturbation

Haiquan Yang,a Xiao Lu,a Jinyuan Hu,a Yuan Chen,a Wei Shen,a Long Liua

aThe Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University,Wuxi, China

ABSTRACT Escherichia coli is one of the most widely used host microorganisms forrecombinant protein expression and metabolic engineering, but it cannot efficientlysecrete recombinant proteins to extracellular space. Here, extracellular protein secre-tion was enhanced in E. coli by deleting two D,D-carboxypeptidase genes (dacA anddacB, single and double deletions) to perturb the cell wall peptidoglycan network.Deletion of dacA and dacB enhanced the accumulation of intracellular soluble pepti-doglycan in E. coli and affected cell morphology, resulting in a more irregular cellshape and the appearance of transparent bulges. Deletion of dacA and dacB appearsto disrupt the normal rigid structure, presumably due to perturbation and destruc-tion of the cell wall peptidoglycan network. The extracellular green fluorescent protein(GFP) fluorescence intensity of deletion mutants was increased by �2.0-fold comparedwith that of control cells, and that of the double deletion mutant was increased by 2.7-fold. Extracellular recombinant fibroblast growth factor receptor 2 (FGFR2) and collagenE4 secretion in deletion mutants was also enhanced compared with that in the controlcells. Additionally, the extracellular recombinant amylase activity of single-deletion mu-tants BL21 ΔdacA pETDuet-amyk and BL21 ΔdacB pETDuet-amyk was increased 2.5- and3.1-fold, respectively. The extracellular distribution of �-galactosidase by deletion mu-tants was also increased by �2.0-fold. Deletion of dacA and dacB increased outer mem-brane permeability, which could explain the enhanced extracellular protein secretion.

IMPORTANCE Cell surface structure stabilization is important for extracellular se-cretion of proteins in Escherichia coli. As the main constituent of the cell wall,peptidoglycan contributes to cell structure robustness and stability. Here, weperturbed the peptidoglycan network by deleting dacA and dacB genes encod-ing D,D-carboxypeptidase enzymes to improve extracellular protein secretion. Thisnew strategy could enhance the capacity of E. coli as a microbial cell factory forextracellular secretion of proteins and chemicals.

KEYWORDS D,D-carboxypeptidase, gene deletion, extracellular secretion, cell wall,Escherichia coli

Escherichia coli is one of the most important host microorganisms used for recom-binant protein expression and metabolic engineering due to several advantages,

including the ability to achieve high expression levels and rapid growth. Extracellularsecretion is desirable for many proteins to avoid intracellular proteolytic degradationand to facilitate simpler purification (1–4). Moreover, when substrates, such as toxicpollutants, are not adequately taken up by E. coli cells, extracellular secretion ofrecombinant enzymes is also useful for metabolic engineering (4). However, mostrecombinant proteins are transported into the periplasmic space, except for sometoxins and erythrocytolysin, which are immediately secreted into the extracellularenvironment (5).

E. coli uses two strategies to introduce proteins into the extracellular medium (6).

Received 6 June 2018 Accepted 20 July 2018

Accepted manuscript posted online 10August 2018

Citation Yang H, Lu X, Hu J, Chen Y, Shen W, LiuL. 2018. Boosting secretion of extracellular proteinby Escherichia coli via cell wall perturbation. ApplEnviron Microbiol 84:e01382-18. https://doi.org/10.1128/AEM.01382-18.

Editor Isaac Cann, University of Illinois atUrbana-Champaign

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Haiquan Yang,haiquanyang@jiangnan.edu.cn, or Long Liu,longliu@jiangnan.edu.cn.

ENZYMOLOGY AND PROTEIN ENGINEERING

crossm

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 1Applied and Environmental Microbiology

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

One strategy involves transport through E. coli membranes by active transport, asoccurs in pathogenic E. coli and other Gram-negative bacteria (6–8). The other strategyis a two-stage translocation process involving active transporters in the cytoplasmicmembrane that transport proteins into the periplasmic space, followed by secretion bypassive transport into the extracellular medium through outer membrane proteins (6).External or internal destabilization of E. coli structural components can result in passivetransport. There are several methods that can partially break the outer membrane orcell wall to release periplasmic proteins via selective permeabilization or disruption,including chemical methods (e.g., Triton X-100), enzymatic treatments (e.g., lysozyme),and mechanical methods (e.g., ultrasound) (2, 5, 6, 9).

Peptidoglycan is the main constituent of the cell wall and contributes to cellstructure robustness and stability (10). Bacterial L-forms, representing the most drasticexample of disturbing the cell surface structure, have been used to improve thesecretion of murein staphylokinase and penicillin G acylase (11, 12). Bacterial L-formsare formed by completely deleting the cell wall through natural or artificial induction(e.g., by penicillin) (13). However, since bacterial L-forms have several limitations, suchas low protein expression levels, slow growth, and poor robustness, they are not usedwidely in industrial production (14, 15). Twelve penicillin binding proteins (PBPs) havebeen characterized in E. coli, and they are divided into high-molecular-weight (HMW)and low-molecular-weight (LMW) classes (16, 17). The HMW PBPs PBP1a, PBP1b, PBP2,and PBP3 possess both D-alanyl–D-alanine transpeptidase (D,D-transpeptidase) andtransglycosidase activity, and are essential for cell growth, whereas none of the LMWPBPs are essential for E. coli growth. The LMW PBPs PBP4, PBP5, PBP6, and PBP6b,known as D-alanyl–D-alanine carboxypeptidases (D,D-carboxypeptidases; Dac) DacB,DacA, DacC, and DacD, respectively (18), play important roles in the synthesis andmaintenance of the E. coli cell wall by mediating peptidoglycan crosslinking, structurestabilization, and cell wall modification (19).

In the present work, the D,D-carboxypeptidase genes dacA and dacB in E. coli weredeleted to perturb the cell wall peptidoglycan network (Fig. 1). We investigated theeffects of deleting the D,D-carboxypeptidase genes dacA and dacB on extracellularsecretion of recombinant proteins in E. coli by using recombinant green fluorescentprotein (GFP; 26.8 kDa), recombinant fibroblast growth factor receptor 2 (FGFR2; 28.2kDa), recombinant collagen E4 (12.8 kDa), and recombinant amylase (AmyK; 62.8 kDa)as model proteins. Cell growth, morphology, intracellular soluble peptidoglycan accu-mulation, extracellular distribution of �-galactosidase, and outer membrane permea-bility were also evaluated.

RESULTSEffects of dacA and dacB deletion on cell growth. D,D-Carboxypeptidase genes

dacA and dacB in E. coli BL21 were deleted using the Red homologous recombinationsystem (Fig. 1), and two single-deletion mutants, BL21 ΔdacA and BL21 ΔdacB, and onedouble-deletion mutant, BL21 ΔdacA ΔdacB, were constructed (see supplementalmaterial). We investigated the effects of deleting dacA and dacB on E. coli cell growth(Fig. 2). Deletion of dacA did not significantly inhibit cell growth, whereas the highestdry cell weight (DCW) of BL21 ΔdacB was 6.9 g/liter, compared with 11.4 g/liter forcontrol cells (Fig. 2A), and the highest specific growth rate was decreased from 1.8 h�1

for control cells to 1.0 h�1 for BL21 ΔdacB (Fig. 2B). Meanwhile, after deleting dacA anddacB, the cell growth of BL21 ΔdacA ΔdacB was also inhibited compared with that ofcontrol cells, indicating that dacB is more critical than dacA for the growth of E. coliBL21. The BL21 ΔdacA ΔdacB double-deletion mutant grew faster than the dacBsingle-deletion mutant.

Effects of dacA and dacB deletion on intracellular soluble peptidoglycan accu-mulation. Peptidoglycan is an essential cell wall component of nearly all bacteria,which protects the cell from bursting due to turgor pressure (20, 21). In the first stageof peptidoglycan synthesis, soluble precursors are synthesized in the cytoplasm (22).The growth of the peptidoglycan sacculus is a dynamic process, and soluble fragments

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 2

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

removed from the sacculus are reused by an efficient peptidoglycan recycling pathway(23). Peptidoglycan of the E. coli cell wall is a polymer consisting of alternatingN-acetylglucosamine and N-acetylmuramic acid residues, to which peptide side chainsare linked to form the sacculus network. D,D-Carboxypeptidases DacA and DacB play animportant role in peptidoglycan synthesis (23). In this work, we determined theglucosamine concentration of soluble peptidoglycan to investigate changes in intra-cellular soluble peptidoglycan concentration in the different strains. Glucosamineconcentrations of dacA or dacB single-deletion mutants and the double-deletionmutant were 132.8, 46.7, and 54.2 mg/g (DCW), respectively, at 8 h, compared with only32.4 mg/g (DCW) for control cells (Fig. 3). These results indicated that deletion of dacA

FIG 1 E. coli peptidoglycan synthesis and D,D-carboxypeptidase gene deletion. (A) The peptidoglycan biosynthesis pathway of E. coli. UDP-GlcNAc, UDP-N-acetylglucosamine; UDP-MurNAc, UDP-N-acetylmuramate; MurA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase; MurB, UDP-N-acetylmuramate dehydrogenase;MurC, UDP-N-acetylmuramate-alanine ligase; MurD, UDP-N-acetylmuramoylalanine–D-glutamate ligase; MurE, UDP-N-acetylmuramoyl-L-alanyl–D-glutamate-2,6-diaminopimelate ligase; MurF, UDP-N-acetylmuramoyl-tripeptide-D-alanyl–D-alanine ligase; MraY, phospho-N-acetylmuramoyl-pentapeptide-transferase; MurG, UDP-N-acetylglucosamine–N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase; MtgA, monofunctional glycosyltransferase;ClassA PBP, penicillin-binding protein 1A; ClassA/B PBP, penicillin-binding protein 1A and penicillin-binding protein 2; DD-CPase, D,D-carboxypeptidases. (B) Nascentpeptidoglycan chain synthesis with DD-CPase in the periplasm. During peptidoglycan synthesis, D,D-carboxypeptidases delete the C-terminal D-Ala from the majorityof peptidoglycan precursor pentapeptide stem molecules. (C) Deletion of DD-CPase genes dacA and dacB (detailed gene deletion methods and data are included inthe supplemental material). 1, BL21 ΔdacA ΔdacB; 2, BL21 ΔdacA ΔdacB::kan; 3, BL21 ΔdacB; and M, standard molecular weight markers.

FIG 2 Effects of dacA and dacB deletion on cell growth. (A) Dry cell weight (DCW). Asterisks indicate a significantdifference compared with control cells (none, P � 0.05; *, P � 0.05; and **, P � 0.01). (B) Specific growth rate, alsoknown as relative growth rate (RGR), exponential growth rate, and continuous growth rate. RGR was calculatedusing the following equation from Hoffmann and Poorter (43): RGR � (lnW2 � lnW1)/(t2 � t1) where ln � naturallogarithm, t1 � time 1 (e.g., in days), t2 � time 2 (e.g., in days), W1 � size at time 1, and W2 � size at time 2. Control,wild-type E. coli; ΔdacA, BL21 ΔdacA; ΔdacB, BL21 ΔdacB; and ΔdacA ΔdacB, BL21 ΔdacA ΔdacB.

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 3

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

and dacB promoted the accumulation of intracellular soluble peptidoglycan, whichaccumulated to a greater extent in the double-deletion mutant than in the dacBsingle-deletion mutant.

Effects of dacA and dacB deletion on cell morphology. Fluorescence-activatedcell sorting (FACS) can be used to quantify differences in E. coli cell shape (24). Here, thecell population distribution of mutant strains was investigated using forward-scatteredand side-scattered light at a cell density of 1.0 � 104. The population of mutant E. colistrains clustered in a two-dimensional scatter plot of forward- versus side-scatteredlight (Fig. 4A to D). However, the actual densities of data points for mutant strains were

FIG 3 Analysis of glucosamine concentration. The y axis represents the glucosamine concentration ofsoluble peptidoglycan to indicate changes in intracellular soluble peptidoglycan concentration indifferent stains. Control, BL21-pETDuet; ΔdacA, BL21 ΔdacA pETDuet; ΔdacB, BL21 ΔdacB pETDuet; ΔdacAΔdacB, BL21 ΔdacA ΔdacB pETDuet. Asterisks indicate a significant difference compared with control cells(none, P � 0.05; *, P � 0.05; and **, P � 0.01).

FIG 4 Effects of dacA and dacB deletion on cell morphology. (A through D) Dot plot of cells using forward-scattered light (x axis) andside-scattered light (y axis). (E through H) Numbers of cells (y axis) according to the amount of forward-scattered light (x axis). (I through L) Effectof dacA and dacB deletion on cell morphology assessed by transmission electron microscopy (TEM). (A, E, and I) BL21-pETDuet (control cells). (B,F, and J) BL21 ΔdacA pETDuet. (C, G, and K) BL21 ΔdacB pETDuet. (D, H, and L) BL21 ΔdacA ΔdacB pETDuet.

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 4

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

not truly reflected in the scatter plots. Meberg et al. found that differences in E. coli cellshape are visualized most easily by graphing only the distribution of forward-scatteredlight (24). The cell population distribution of mutant E. coli strains lacking dacA anddacB displayed a forward-scattered light range between 0 and 5.0 � 104, which waschanged significantly compared with that of control cells (Fig. 4E to H). FACS gates canbe drawn to give a relative comparison of cell distribution among gates, and differencesgenerally become more evident after this quantification (24). Fractions give the distri-bution (proportion [%]) of cells within a FACS gate among total cells. The fractions ofdacA and dacB single-deletion mutants and the double-deletion mutant falling withinthe gates were 58.9, 63.0, and 65.1%, respectively, compared with only 55.0% forcontrol cells (Fig. 4E to H). As shown in Fig. 4I to L, the cell shape of dacA and dacBsingle-deletion mutants was more irregular than that of control cells, with a wider cellwidth and the appearance of localized transparent bulges at cell poles in the case of thedacB single deletion. Double deletion of dacA and dacB resulted in transparent globularswelling in E. coli cells (Fig. 4L).

Effects of dacA and dacB deletion on extracellular recombinant GFP, FGFR2,and E4 secretion. Recombinant GFP (26.8 kDa) was used to investigate the effects ofdeleting dacA and dacB on extracellular protein secretion in E. coli. The recombinantplasmid pETDuet-gfp was transformed into mutant strains BL21 ΔdacA, BL21 ΔdacB,and BL21 ΔdacA ΔdacB to generate recombinant mutant strains BL21 ΔdacA pETDuet-gfp, BL21 ΔdacB pETDuet-gfp, and BL21 ΔdacA ΔdacB pETDuet-gfp. As shown in Fig. 5,deletion of dacA and dacB increased the extracellular GFP concentration of BL21 ΔdacApETDuet-gfp, BL21 ΔdacB pETDuet-gfp, and BL21 ΔdacA ΔdacB pETDuet-gfp comparedwith control cells. The extracellular GFP fluorescence intensity of BL21 ΔdacA pETDuet-gfp, BL21 ΔdacB pETDuet-gfp, and BL21 ΔdacA ΔdacB pETDuet-gfp was 179.7, 190.0,and 233.5 AU/g (DCW)/liter, respectively, compared with 87.5 AU/g (DCW)/liter forcontrol cells (Fig. 5A). The extracellular protein concentration of BL21 ΔdacA pETDuet-gfp, BL21 ΔdacB pETDuet-gfp, and BL21 ΔdacA ΔdacB pETDuet-gfp were also enhancedcompared with that of control cells (see Table S1 in the supplemental material). Theconcentrations of extracellular recombinant GFP of mutants and control cells werefurther analyzed by SDS-PAGE (Fig. 5B) and was higher than that of control cells, furtherverifying that extracellular secretion of recombinant GFP was enhanced after deletionof dacA and dacB. The effects of deleting dacA and dacB on extracellular recombinantFGFR2 and E4 secretion were also determined by SDS-PAGE (see Fig. S2 in thesupplemental material), and extracellular secretion of both proteins was enhanced inthe deletion mutants compared with that in the control cells.

FIG 5 Effects of dacA and dacB deletion on extracellular recombinant green fluorescent protein (GFP) secretion. (A)Extracellular specific fluorescence intensity. AU, arbitrary units. Asterisks indicate a significant difference comparedwith control cells (none, P � 0.05; *, P � 0.05; and **, P � 0.01). (B) Sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) analysis. M, standard molecular weight markers; arrow, GFP; control, E. coli BL21-pETDUET-gfp (extracellular); ΔdacA, BL21 ΔdacA pETDuet-gfp; ΔdacB, BL21 ΔdacB pETDuet-gfp; ΔdacA ΔdacB, BL21ΔdacA ΔdacB pETDuet-gfp; P-control, E. coli BL21-pETDuet-gfp (positive control, intracellular); N-control, E. coliBL21-pETDuet (negative control, intracellular).

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 5

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Effects of dacA and dacB deletion on extracellular recombinant amylase secre-tion. Recombinant amylase AmyK (62.8 kDa) was also used to study the effects ofdeleting dacA and dacB on extracellular protein secretion in E. coli. As shown in Fig. 6A,the extracellular amylase activity of E. coli was improved by deleting dacA and dacB,especially by single deletion of dacA or dacB. The specific activity of extracellularamylase of BL21 ΔdacA pETDuet-amyk and BL21 ΔdacB pETDuet-amyk reached 1,492.9and 1,857.4 U/g (DCW), respectively, following isopropyl-�-D-thiogalactopyranoside (IPTG)induction for 36 h, compared with only 592.7 U/g (DCW) for control cells (see Table S2in the supplemental material). SDS-PAGE was also used to analyze effects of dacA anddacB deletion on extracellular recombinant amylase secretion (Fig. 6B). Apparentprotein bands corresponding to the molecular mass (62.8 kDa) of AmyK were observedin deletion mutants, further indicating that extracellular secretion of recombinantamylase was enhanced by deletion of dacA and dacB. Meanwhile, as shown in Table S1in the supplemental material, the extracellular protein concentrations of mutantslacking dacA and dacB was also significantly enhanced compared with that of controlcells. The specific production rates of extracellular amylase of mutants was investigated,and deletion of dacA and dacB increased extracellular secretion of amylase in E. coliBL21, especially in the case of dacB deletion (Fig. 6C). The specific production rates ofextracellular amylase of BL21 ΔdacA pETDuet-amyk, BL21 ΔdacB pETDuet-amyk, andBL21 ΔdacA ΔdacB pETDuet-amyk were significantly boosted compared with that ofcontrol cells, and the rate was highest for BL21 ΔdacB pETDuet-amyk (Fig. 6C), reaching0.17 U/(ml · h).

FIG 6 Effects of dacA and dacB deletion on extracellular recombinant amylase secretion. (A) Specific activity of extracellular amylase.Asterisks indicate a significant difference compared with control cells (none, P � 0.05; *, P � 0.05; and **, P � 0.01). (B) SDS-PAGE analysisof extracellular amylase. M, standard molecular weight markers; arrow, amylase; control, E. coli BL21-pETDuet-amy (extracellular); P-control,E. coli BL21-pETDuet-amy (positive control, intracellular); N-control, E. coli BL21-pETDuet (negative control, intracellular). (C) Extracellularamylase production rate. (D) Percentage of extracellular activity of total amylase activity. ΔdacA, BL21 ΔdacA pETDuet-amy; ΔdacB, BL21ΔdacB pETDuet-amy; ΔdacA ΔdacB, BL21 ΔdacA ΔdacB pETDuet-amy.

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 6

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

The distribution of extracellular amylase was also determined to analyze the effectof deleting dacA and dacB on extracellular protein secretion in E. coli (Fig. 6D).Extracellular secretion of recombinant amylase in E. coli was enhanced by deletion ofdacA and dacB. Compared with that of control cells, the extracellular amylase distribu-tion for BL21 ΔdacA pETDuet-amyk, BL21 ΔdacB pETDuet-amyk, and BL21 ΔdacA ΔdacBpETDuet-amyk was increased from 63.7% for control cells to 78.5, 88.6, and 78.6%,respectively, at 36 h. However, the total amylase activity of BL21 ΔdacA ΔdacB pETDuet-amyk was not high compared with that of control cells (Table S2), indicating thatdouble deletion (both dacA and dacB) might not be advantageous for heterologousexpression of amylase in E. coli.

Effects of dacA and dacB deletion on extracellular �-galactosidase activity. Theextracellular distribution of �-galactosidase, an intracellular enzyme in E. coli, wasalso determined in order to investigate the effect of deleting dacA and dacB onextracellular protein secretion in E. coli. As shown in Fig. 7A, the extracellular�-galactosidase activity of mutants was boosted compared with that of controlcells. Extracellular �-galactosidase activity of mutant strains BL21 ΔdacA pETDuet,BL21 ΔdacB pETDuet and BL21 ΔdacA ΔdacB pETDuet was 14.0, 14.8, and 21.4U/g(DCW), respectively, compared with only 6.9 U/g (DCW) for control cells.

Effects of dacA and dacB deletion on cell outer membrane permeability. Theeffect of dacA and dacB deletion on cell outer membrane permeability was alsoinvestigated. Loh et al. previously used N-phenyl-�-naphthylamine (NPN) as a probe toassess outer membrane permeability (25). NPN fluoresces weakly in an aqueous envi-ronment, and its intensity increases in a nonpolar or hydrophobic environment. Dele-tion of dacA and dacB caused an increase in the fluorescence intensity of NPN boundto E. coli cells, especially to cells of the double-deletion mutant (Fig. 7B). The NPNfluorescence intensity of the double-deletion mutant was 8.1 � 104 AU, representing anincrease of 1.3-fold compared with that of control cells. These results suggest thatdeletion of dacA and dacB increased the permeability of the cell outer membrane,which could explain the enhanced extracellular secretion of recombinant proteins indeletion mutants.

DISCUSSION

In this work, two D,D-carboxypeptidase genes, dacA and dacB, were successfullydeleted from the E. coli BL21 parent strain. Cell growth was not significantly inhibitedby deleting dacA. Similarly, Broome-Smith constructed a double-deletion E. coli mutantlacking dacA and dacC, and the growth rate was comparable to that of the wild-typestrain (26). However, although D,D-carboxypeptidases DacA and DacB are not essential

FIG 7 Effects of dacA and dacB deletion on extracellular �-galactosidase activity and outer membrane permeability. (A) Effects ofdacA and dacB deletion on extracellular �-galactosidase activity. (B) Effects of dacA and dacB deletion on outer membranepermeability. Control, BL21-pETDuet; ΔdacA, BL21 ΔdacA pETDuet; ΔdacB, BL21 ΔdacB pETDuet; ΔdacA ΔdacB, BL21 ΔdacA ΔdacBpETDuet. Asterisks indicate a significant difference compared with control cells (none, P � 0.05; *, P � 0.05; and **, P � 0.01).

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 7

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

for bacterial survival (27), deletion of dacB in the present study did result in a lowergrowth rate compared to that of control cells. The BL21 ΔdacA ΔdacB double-deletionmutant grew faster than the dacB single-deletion strain. There are at least four LMWPBPs with D,D-carboxypeptidase activity in E. coli, namely, DacA, DacB, DacC, and DacD,but there are at least two LMW PBPs (DacB and PBP7) with D,D-endopeptidase activity.The roles of LMW PBPs are less clear than those of HMW PBPs (19). It has been reportedthat DacA, DacC, and DacD are monofunctional D,D-carboxypeptidases, and DacB is abifunctional enzyme (endopeptidase and D,D-carboxypeptidase) (19, 24, 27, 28). PBP7appears to be a D,D-endopeptidase with no known D,D-carboxypeptidase activity (19) forone of the DacB isozymes. E. coli is a Gram-negative bacterium encoding multipleD,D-carboxypeptidase isozymes (24), including DacA, DacB, DacC, and DacD. It waspresumed that the D,D-carboxypeptidase activity of DacA D,D-carboxypeptidaseisozymes and the endopeptidase activity of DacB D,D-endopeptidase isozymes in thedouble-deletion mutant might be in better equilibrium for cell growth in LB mediumcompared with that in the dacB single-deletion mutant, since the double-deletionmutant grew faster.

Synthesis of peptidoglycan includes three overall stages (23); first, soluble, activatednucleotide precursors are synthesized in the cytoplasm (22); second, the lipid-anchoreddisaccharide-pentapeptide monomer subunit is formed by assembling nucleotide pre-cursors (after flipping across the membrane) with undecaprenyl phosphate (29, 30); andthird, glycan chains are inserted into the peptidoglycan sacculus (23). The D,D-carboxypeptidases DacA and DacB play important roles in peptidoglycan synthesis byremoving excess pentapeptide donors in newly synthesized peptidoglycan (23). Dele-tion of dacA and dacB increased the intracellular soluble peptidoglycan concentrationin E. coli at 8 h, especially in the dacA single-deletion mutant. Soluble peptidoglycan inthe double-deletion mutant accumulated to a greater extent than in the dacB single-deletion strain. It was therefore presumed that deletion of dacA and dacB affected thesynthesis and metabolic stability of the peptidoglycan network in E. coli, especiallysingle deletion of dacA. DacB possesses endopeptidase activity and can degradesubunits crosslinked to monomeric muropeptides, the lifetimes of which may beprolonged after deleting DacB (24). D,D-Carboxypeptidases can remove the terminalD-alanine from pentapeptide side chains and excess pentapeptide donors in newlysynthesized peptidoglycan (23, 24). DacA is one of the main D,D-carboxypeptidases inE. coli, and in the absence of DacA, pentapeptide peptidoglycan subunits (muropep-tides) accumulate to higher levels than in wild-type strains (31).

In order to investigate the effects of dacA and dacB deletion on cell morphology,FACS analysis was employed in this work. The results of FACS analysis indicated thatdeleting dacA and dacB affected E. coli cell morphology. Maintenance of cell shape istightly regulated by the growth of the mesh-like peptidoglycan sacculus between innerand outer membranes, which provides mechanical strength to resist osmotic pressure(23, 32). D,D-Carboxypeptidases are crucial peptidoglycan synthases that help to main-tain bacterial cell shape. Huang et al. (2008) found that deleting D,D-carboxypeptidasegenes damaged the cell wall in Gram-negative bacteria (33), and Nelson and Young(2000) reported that loss of D,D-carboxypeptidase DacA altered the cell diameter andcontour of E. coli cells and caused morphological defects (34).

In order to further analyze the effects of deleting dacA and dacB on E. coli cellmorphology and perturbation of the cell wall peptidoglycan network structure, trans-mission electron microscopy (TEM) was also employed. Compared with control cells,the deletion mutants adopted a more irregular shape, and local transparent bulges atthe poles of the dacB deletion strain became evident. Meanwhile, transparent globularswelling occurred with the double-deletion mutant. The D,D-carboxypeptidases DacAand DacB are involved in maintaining cell morphology (17). In Gram-negative bacteria,the peptidoglycan network is responsible for cell wall tensile strength, and it isnecessary to maintain cell robustness in the face of intracellular stress (19, 35). The rigidstructure of native E. coli cells was not maintained in the dacA or dacB deletion mutants,indicating perturbation and destruction of the cell wall peptidoglycan network.

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 8

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

The extracellular GFP fluorescence intensity of deletion mutants BL21 ΔdacA pETDuet-gfp, BL21 ΔdacB pETDuet-gfp, and BL21 ΔdacA ΔdacB pETDuet-gfp was increased by 2.1-,2.2-, and 2.7-fold, respectively, compared with that of the control cells. Extracellular secre-tion of recombinant FGFR2 and E4 in deletion mutants was also improved compared withthat of control cells. Similarly, the extracellular amylase activity of single-deletion mutantsBL21 ΔdacA pETDuet-amyk and BL21 ΔdacB pETDuet-amyk was significantly increased by2.5- and 3.1-fold, respectively, compared with that of control cells. However, the extracel-lular amylase activity of the BL21 ΔdacA ΔdacB pETDuet-amyk double-deletion mutant wasonly increased by 1.1-fold from that of control cells, indicating that simultaneous deletionof both dacA and dacB inhibited extracellular amylase secretion compared with that ofsingle-deletion mutants. Furthermore, the extracellular amylase specific production rate ofdeletion mutants was increased compared with that of control cells.

The proportion of extracellular enzyme activity relative to total enzyme activity isoften used to characterize cell integrity (4). The proportion of extracellular amylase indeletion mutants was also improved compared with that of control cells, furtherindicating that deletion of dacA and dacB improved extracellular secretion of amylasein E. coli. However, it was presumed that double deletion (both dacA and dacB) mightinhibit production of amylase in E. coli. This amylase does not have an N-terminal signalpeptide targeting translocation across both the inner and outer cell membranes intothe extracellular space under osmotic stress and translation stress conditions (36). Thetemporal expression of DacA and DacB in native strains occurs during log phase andearly log phase (19). In the absence of DacA and DacB, the amount of specificcrosslinked products might increase, and their lifetimes might be prolonged (24). Lessefficient activation of PBPs in double-deletion mutant might lead to high peptidoglycandensity during the early phase (e.g., early log phase) of cell growth (23), resulting insmaller peptidoglycan pores than in control cells, which could inhibit extracellularsecretion of the HMW recombinant amylase during the early phase. This hypothesis isconsistent with the results (shown in Fig. 6C) that the specific production rate ofextracellular amylase in the double-deletion mutant was low during the early phase(�16 h). A decrease in extracellular secretion of recombinant amylase during the earlyphase presumably inhibited the production of amylase in the double-deletion mutant.

Meanwhile, the extracellular distribution of �-galactosidase, an intracellularenzyme in E. coli, was significantly improved by deleting dacA and dacB. Theextracellular �-galactosidase activity of mutant strains BL21 ΔdacA pETDuet, BL21ΔdacB pETDuet, and BL21 ΔdacA ΔdacB pETDuet was increased by 2.0-, 2.2-, and3.1-fold, respectively, compared with that of control cells, suggesting that doubledeletion (dacA and dacB) more significantly increased extracellular �-galactosidaseactivity than single deletion (dacA or dacB). It was therefore presumed that deletingdacA and dacB destroyed the integrity and stability of the peptidoglycan networkto favor the extracellular secretion of proteins in E. coli.

D,D-Carboxypeptidases DacA and DacB cleave the terminal D-alanine of the penta-peptide side chains (L-Ala–D-iso-Glu–m-Dap–D-Ala–D-Ala for E. coli; m-Dap, meso-diamino-pimelic acid) of murein components of the cell wall peptidoglycan sacculus (18, 20, 27).The meshlike peptidoglycan sacculus consists of glycan chains crosslinked by shortpeptides with synthases (23). DacA is membrane-anchored and presumably acts to trimpeptidoglycan (17). DacB has an active site that differs slightly from those of otherD,D-carboxypeptidases (37, 38). E. coli DacB is not directly related to DacBs fromGram-positive bacteria, which are functionally equivalent to DacA from E. coli (17). DacBpossesses both D,D-endopeptidase and D,D-carboxypeptidase activities and is responsiblefor breaking crosslinks to facilitate insertion of new glycan chains (39). Here, deleting dacAand dacB disrupted the cell wall integrity of E. coli, resulting in enhanced extracellularprotein secretion. Similarly, Horne et al. (1977) found that inhibition of peptidoglycansynthesis in Staphylococcus epidermidis and Bacillus subtilis resulted in the secretion of lipidsinto the extracellular medium (40), and Shin and Chen (2008) improved extracellularrecombinant protein secretion in E. coli by deleting the lpp gene (4).

Deletion of dacA and dacB caused an increase in fluorescence intensity of NPN

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 9

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

bound to E. coli cells, especially to cells of the double-deletion mutant. The fluorescenceintensity of NPN is increased in a nonpolar or hydrophobic environment (25). Thestress-bearing peptidoglycan sacculus of bacterial cells provides mechanical strength toresist osmotic pressure (23, 32). Thus, deletion of dacA and dacB could disrupt thepeptidoglycan network, resulting in an incomplete cell wall and increasing the perme-ability of the cell outer membrane, especially in the case of the double-deletion mutant.This could explain the enhanced extracellular secretion of recombinant proteins in dacAand dacB deletion strains compared with that of the parent strain.

MATERIALS AND METHODSStrains and vectors. Strains, plasmids, and primers used in this work are listed in Tables 1 and 2. E.

coli JM109 was used as the host for plasmid construction, and E. coli BL21 was used as the parent strainfrom which mutants were derived. The pMD19-T vector was used for TA cloning. The kanamycinresistance gene was cloned from plasmid pKD13. The temperature-sensitive pKD46 helper plasmid wasused to express Red recombinases, and the helper plasmid pCP20 was used to express FLP recombinaseto delete the resistance gene. The pETDuet plasmid was used to express GFP (GenBank accession no.U70496) and amylase AmyK (GenBank accession no. KF751392).

Gene deletion. The Red homologous recombination system was used to delete D,D-carboxype-ptidase genes dacA and dacB in E. coli BL21 (41). Gene knockout cassettes (ΔdacA::kan and ΔdacB::kan),flanked by Flp recombination target (FRT) sites and homologous arms of target genes, were constructedby PCR amplification, using plasmid pKD13 as the template and the primers listed in Table 2. PrimeSTARHS DNA polymerase (TaKaRa, Dalian, China) was used for PCR, following the standard procedure of the

TABLE 1 Plasmids and strains used in this work

Plasmid or strain Relevant genotype and/or characteristic(s) Source or reference

PlasmidspMD19-T vector TA cloning TaKaRapKD13 R6KY ori, Kanr, Ampr, Cmr CGSCpKD46 Ampr, helper plasmid CGSCpCP20 Ampr, Cmr, helper plasmid CGSCpETDuet T7 promoters, pBR322 ori, Ampr NovagenpET28a T7 promoters, pBR322 ori, Kanr NovagenpETDuet-gfp pETDuet derivate with gfp cloned This workpET28a-amy pET28a derivate with amy cloned This work

Gene knockout cassettesΔdacA::kan Kanr, knockout of gene dacA This workΔdacA::kan= Kanr, knockout of gene dacA of BL21 ΔdacB to obtain double deletion

mutantThis work

ΔdacB::kan Kanr, knockout of gene dacB This work

StrainsE. coli JM109 Cloning host NovagenE. coli BL21 Wild-type E. coli BL21(DE3) NovagenBL21-pETDuet E. coli BL21 with plasmid pETDuet This workBL21-pETDuet-gfp E. coli BL21 with plasmid pETDuet-gfp This workBL21-pETDuet-amy E. coli BL21 with plasmid pETDuet-amy This workBL21-pKD46 E. coli BL21(DE3) derivate, including plasmid pKD46, Ampr This workBL21 ΔdacA::kan pKD46 BL21-pKD46 derivate, deleting dacA This workBL21 ΔdacB::kan pKD46 BL21-pKD46 derivate, deleting dacB This workBL21 ΔdacA ΔdacB::kan pKD46 BL21 ΔdacB pKD46 derivate, deleting ΔdacA ΔdacB This workBL21 ΔdacA::kan BL21 ΔdacA::kan pKD46 derivate, deleting plasmid pKD46 This workBL21 ΔdacB::kan BL21 ΔdacB::kan pKD46 derivate, deleting plasmid pKD46 This workBL21 ΔdacA ΔdacB::kan BL21 ΔdacA ΔdacB::kan pKD46 derivate, deleting plasmid pKD46 This workBL21 ΔdacA BL21 ΔdacA::kan derivate, deleting plasmid pKD46 and Kanr This workBL21 ΔdacB BL21 ΔdacB::kan derivate, deleting plasmid pKD46 and Kanr This workBL21 ΔdacA ΔdacB BL21 ΔdacA ΔdacB::kan derivate, deleting plasmid pKD46 and Kanr This workBL21 ΔdacA pETDuet BL21 ΔdacA derivate with plasmid pETDuet This workBL21 ΔdacB pETDuet BL21 ΔdacB derivate with plasmid pETDuet This workBL21 ΔdacA ΔdacB pETDuet BL21 ΔdacA ΔdacB derivate with plasmid pETDuet This workBL21 ΔdacA pETDuet-gfp BL21 ΔdacA derivate with plasmid pETDuet-gfp This workBL21 ΔdacB pETDuet-gfp BL21 ΔdacB derivate with plasmid pETDuet-gfp This workBL21 ΔdacA pETDuet-amy BL21 ΔdacA derivate with plasmid pETDuet-amy This workBL21 ΔdacB pETDuet-amy BL21 ΔdacB derivate with plasmid pETDuet-amy This workBL21 ΔdacA ΔdacB pETDuet-gfp BL21 ΔdacA ΔdacB derivate with plasmid pETDuet-gfp This workBL21 ΔdacA ΔdacB pETDuet-amy BL21 ΔdacA ΔdacB derivate with plasmid pETDuet-amy This work

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 10

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

PrimeSTAR HS DNA polymerase kit. Plasmid pKD46 containing exo, bet, and gam genes from �

bacteriophage was used for homologous recombination of gene knockout cassettes in the E. coli BL21genome. Gene knockout cassettes were electroporated into E. coli BL21 cells harboring plasmid pKD46expressing Red recombinases (see supplemental material). Verified plasmids were introduced intocompetent E. coli cells by the CaCl2 method (see supplemental material). Positive clones were selectedusing ampicillin and kanamycin antibiotics and confirmed by PCR analysis. The temperature-sensitiveplasmid pKD46 was removed by overnight growth at 37°C, and the kanamycin resistance gene wassubsequently removed from the chromosome with FLP recombinase from plasmid pCP20.

Construction of recombinant plasmids. The gfp gene was amplified by PCR with primers GFP-FWand GFP-RV (Table 2). Recombinant plasmid pUC57-gfp containing the gfp gene (synthesized by SangonBiotech Co., Ltd.) was used as a PCR template. Conditions for PCR were as follows: 94°C for 4 min,followed by 30 circles at 98°C for 10 s, 55°C for 15 s, 72°C for 48 s, and a final extension at 72°C for 10min. The gfp sequence was ligated into plasmid pETDuet between the EcoRI and BglII restriction enzymesites to construct pETDuet-gfp. The amy gene was amplified by PCR with primers Amy-FW and Amy-RV(Table 2). Recombinant plasmid pUC57-amy, harboring the amy gene synthesized by Sangon Biotech Co.,Ltd., was used as a PCR template. Conditions for PCR were as follows: 94°C for 4 min, followed by 30cycles at 98°C for 10 s, 61°C for 15 s, 72°C for 96 s, and a final elongation at 72°C for 10 min. The amysequence was ligated into plasmid pETDuet between the EcoRI and XhoI sites to construct pETDuet-amy.Verified plasmids were introduced into competent E. coli cells by the CaCl2 method (see supplementalmaterial). PrimeSTAR HS DNA polymerase (TaKaRa) was used for PCR with standard conditions. Recom-binant plasmids pETDuet-gfp and pETDuet-amy did not include a signal peptide. DNA ligase solution Iwas used to ligate amplified protein-encoding genes into plasmids. All constructed plasmids wereverified by restriction enzyme analysis and DNA sequencing.

Media and culture conditions. Luria-Bertani (LB) medium comprising 5 g/liter yeast extract, 10g/liter tryptone, and 10 g/liter NaCl was used to cultivate E. coli JM109 and E. coli BL21 cells. Terrific broth(TB) medium was comprised of 24 g/liter yeast extract, 10 g/liter tryptone, 4 g/liter glycerol, 2.31 g/literKH2PO4, and 12.54 g/liter K2HPO4·H2O. Ampicillin and kanamycin were used at final concentrations of 50and 30 �g/ml, respectively. After culturing recombinant E. coli BL21 cells for 8 h in LB medium at 37°C,an aliquot was inoculated into TB medium to 1% (vol/vol) in a shake flask (25 ml/250 ml) and culturedat 37°C to an optical density at 600 nm (A600) of 0.8. Protein expression was induced with 1 mM isopropyl�-D-thiogalactoside (IPTG) at 25°C.

Cell density determination. E. coli culture broth (5 ml) was centrifuged at 1.0 � 104 � g for 10 min at4°C to determine the dry cell weight (DCW). Harvested cells were washed with 10 mM phosphate-bufferedsaline (PBS; Na2HPO4, NaH2PO4, and NaCl [pH 7.4]). After washing, cells were centrifuged at 1.0 � 104 � g for10 min at 4°C and dried to a constant weight at 105°C for 2 h.

Intracellular and extracellular sample preparation. E. coli cultures were centrifuged at 1.0 � 104 �g for 10 min at 4°C. The supernatant was used for extracellular GFP concentration determination andenzyme activity assays. Cells were harvested to assay the outer membrane permeability, intracellularenzyme activity, GFP concentration, and soluble peptidoglycan concentration. Harvested cells werewashed, resuspended in 10 mM PBS, and lysed using a JXFSTPRP automatic sample rapid grindingmachine (Shanghai Jingxin Industrial Development Co., Ltd., Shanghai, China) at 70 Hz for 11 min. Lysedcells were centrifuged at 1.5 � 104 � g for 15 min at 4°C, and the supernatant was used for intracellularenzyme activity, GFP concentration, and soluble peptidoglycan concentration assays.

Glucosamine concentration assay. Glucosamine was used to generate a standard curve fromknown concentrations of 0, 5.0, 10.0, 15.0, and 20.0 mg/liter (wt/vol). Glucosamine and acetylacetone

TABLE 2 Nucleotide sequences of primers

Oligonucleotide primer or purposea Sequence (5= to 3=)b

Plasmid constructionGFP-FW CGGAATTCATGAGTAAAGGAGAAGAACTTTTCGFP-RV GAAGATCTTTATTTGTATAGTTCATCCATGCAmy-FW CCGGAATTCATGAGCGAGCTGCCGCAAATCAmy-RV CCGCTCGAGTTAAAAACCGCCATTGAAGGACG

Gene knockoutΔdacA-FW GGCTCTTTGCACAGCCTTTATCTCTGCTGCACATGCCGATGACCTGAATAGTGTAGGCTGGAGCTGCTTCΔdacA-RV CGAAGAAGTTACCTTCCGGGATTTCTTGCAGTACAACCAACGGGCGTTGTATTCCGGGGATCCGTCGACCΔdacB-FW GATTACCACAGTCAGCAGATGGCGCAGCCCGCCAGTACGCAGAAAGTGATGTGTAGGCTGGAGCTGCTTCΔdacB-RV CATCCACGCCCGCCTGATGCAGACCTGCACGGTACTGCAAAGAGCCGTCAATTCCGGGGATCCGTCGACCΔdacA=-1-FWc GCTCTTTGCACAGCCTTTATCTΔdacA=-1-RV GAAGCAGCTCCAGCCTACACGAGGAACATCAGCGAAGAACCΔdacA=-2-FW GGTTCTTCGCTGATGTTCCTCGTGTAGGCTGGAGCTGCTTCΔdacA=-2-RV CAGTCGCAGAAGCAACAAGGATTCCGGGGATCCGTCGACCΔdacA=-3-FW GGTCGACGGATCCCCGGAATCCTTGTTGCTTCTGCGACTGΔdacA=-3-RV GTTACCTTCCGGGATTTCTTG

aFW, forward primer; RV, reverse primer.bItalicized letters represent the restriction enzyme sites. Underlined letters represent homologous sequences used for gene knockout.cPrimers ΔdacA=-1 through ΔdacA=-3 were used to delete dacA of BL21 ΔdacB, and were redesigned in order to improve the efficiency of deletion. ΔdacA=-1, ΔdacA=-3,and ΔdacA=-2 were used to amplify forward and reverse homologous sequences and the Kanr gene.

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 11

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

solutions (1 ml) were mixed and boiled for 25 min, and para-dimethylaminobenzaldehyde (1 ml) andabsolute ethyl alcohol (1 ml) were added and incubated at 20°C for 1 h. The A440 was determined. E. colicell walls were disrupted using five freeze-thaw cycles and ultrasonication for 10 min, and lysed cellswere centrifuged at 1.0 � 104 � g for 20 min. The supernatant was freeze dried, and 2 mg was dissolvedin 6 M hydrochloric acid (1.5 ml) and boiled for 1 h. The solution was cooled and neutralized with NaOH,and distilled water was added to 10 ml. The glucosamine concentration of the solution was measuredbased on the glucosamine standard curve.

Fluorescence-activated cell sorting (FACS) assay. Recombinant E. coli cells were cultured in TBmedium at 37°C in a shake flask (25 ml/250 ml). When the optical density at 600 nm (OD600) reached 0.8,protein expression was induced by 1 mM IPTG and culturing continued at 25°C for 8 h. E. coli cells (30ml) were collected by centrifugation at 1.0 � 104 � g for 10 min at 4°C. Harvested cells were washed andresuspended in 30 ml 10 mM PBS. The solution was diluted to an OD600 of 1.6 � 10�2, and a FACSCaliburFlow Cytometer (BD Accuri C6; Becton Dickinson, NJ, USA) was used for cell counting.

Transmission electron microscopy (TEM) assay. Recombinant E. coli cells were cultured in LBmedium at 200 rpm and 37°C for 8 h in a shake flask (25 ml/250 ml). A 20-�l aliquot of the culture wasdiluted and spread on the surface of an LB medium plate, and expression was induced by 1 mM IPTG for24 h. A Hitachi H-7650 (Hitachi, Tokyo, Japan) was used for TEM analysis.

GFP assay. Recombinant strains were cultured in LB medium at 37°C for 8 h, and 1.0% (vol/vol) wasinoculated into TB medium in a shake flask (25 ml/250 ml) for expression of recombinant GFP. When theOD600 reached 0.8, recombinant GFP was induced by 1 mM IPTG, and culturing was continued at 25°Cfor 4 h. A Cytation 3 multimode microplate reader (BioTek Instruments, Inc., Winooski, VT) and a 96-wellplate were used to measure the GFP fluorescence intensity. Excitation and absorption wavelengths were488 and 533 nm, respectively.

Enzyme activity assay. Amylase activity was determined by a modified method based on measuringreducing sugars during the hydrolysis of soluble starch (1). One unit (U) of amylase was defined as the amountof enzyme required to release 1 �mol of reducing sugar (glucose) from starch per min at 50°C and pH 9.5. Thereaction mixture contained 28 mM glycine-NaOH buffer (pH 9.5) and 7.4 g/liter (wt/vol) soluble starchpreheated at 50°C for 5 min. After adding the enzyme solution to the preheated mixture, the sample (1.35 ml)was incubated at 50°C for an additional 5 min. Reducing sugars released were measured using a modifieddinitrosalicylic acid (DNS) method (42). The DNS solution consisted of 6.5 g/liter (wt/vol) 3,5-dinitrosalicylicacid and 45.0 g/liter (wt/vol) glycerin. Glucose standard concentrations were 0, 1.1, 2.2, 3.3, 4.4, and 5.5 mM.The mixture containing 1.0 ml DNS solution and 1.0 ml reaction solution was boiled for 15 min and cooledin ice water. Deionized water was added to the mixture until the total volume reached 10 ml, and the A540

was determined using a BioTek Cytation 3 microplate reader.One unit of �-galactosidase activity was defined as the amount of enzyme required to liberate 1

�mol of paranitrophenol per min under the conditions described. A 1.0% (vol/vol) sample of each of therecombinant strains cultured in LB medium at 37°C for 8 h was inoculated into TB medium in a shakeflask (25 ml/250 ml). When the OD600 reached 0.8, 1 mM IPTG was added and strains were cultured at25°C for a further 4 h. The �-galactosidase reaction mixture contained 100 �l enzyme solution, 50 �lo-nitrophenyl �-D-galactopyranoside (10 mM, wt/vol), and 50 �l citrate buffer (pH 5.8; 100 mM [wt/vol]).Reaction mixtures were incubated at 45°C for 15 min, and 3 ml of 0.25 mM (wt/vol) NaCO3 solution wasadded to stop the reaction. The absorbance at 400 nm was measured and compared with a standardcurve made using 0.2, 0.4, 0.6, 0.8, and 1.0 mM paranitrophenol standards (Shanghai Aladdin Bio-ChemTechnology Co., Ltd., Shanghai, China) prepared in 100 mM citrate buffer (pH 5.8).

SDS-PAGE assay. The effect of deleting dacA and dacB genes on extracellular proteins secretionwere also investigated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).Molecular weight protein markers were purchased from TaKaRa. The cell density (OD600) of the fermen-tation broth was diluted to 5.0 with 10 mM PBS. After centrifugation at 1.0 � 104 � g and 4°C for 10 min,equal volumes of supernatants containing extracellular proteins were separated by SDS-PAGE. Samplesof 8 �l were mixed with 2 �l of 5� sample buffer (Beyotime Biotech Co., Ltd., Shanghai, China) andmixtures were incubated at 100°C for 10 min. SDS-PAGE was performed with a 12% separating gel, a 5%stacking gel, and a Mini-PROTEAN Tetra electrophoresis tank (Bio-Rad, California, USA). Gels were stainedusing Coomassie brilliant blue R250 (1.2 g/liter) in 10% (vol/vol) acetic acid and 45% (vol/vol) methanolat 25°C for 2 h. Stained gels were destained with destaining solution consisting of 10% (vol/vol) aceticacid and 45% (vol/vol) methanol at 25°C for 10 h.

Cell outer membrane permeability assay. N-Phenyl-�-naphthylamine (NPN) can be used to analyzeouter membrane permeability (25). Here, 100 mM NPN (20 �l, Shanghai Aladdin Bio-Chem TechnologyCo., Ltd.) was mixed with 200 �l of cell suspension (OD600 � 5.0 � 10�1). The fluorescence intensity ofthe mixture was immediately determined using a BioTek Cytation 3 microplate reader. The intensity ofthe fluorescence emitted was measured at excitation and absorption wavelengths of 350 nm and 420nm, respectively.

Statistical analysis. All experiments were independently performed at least three times. Data areexpressed as means � standard deviation (SD). Statistical analyses were performed using the Student ttest, and a P value � 0.05 was considered statistically significant. The F test was conducted first to identifyoverall significant differences, and, if those were detected, the t test was used to determine differencesbetween mutants and the parent strain. Once the t value and degrees of freedom are determined, a Pvalue can be ascribed using the table of values from the Student t test distribution (see https://en.wikipedia.org/wiki/Student%27s_t-distribution#Table_of_selected_values).

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 12

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01382-18.

SUPPLEMENTAL FILE 1, PDF file, 0.9 MB.

ACKNOWLEDGMENTSThis work, including the efforts of H.Y., X.L., J.H., Y.C., W.S., and L.L., was funded by

the National Natural Science Foundation of China (grant 21406089), the Natural ScienceFoundation of Jiangsu Province (grant BK20140152), the Open Project Program of theKey Laboratory of Industrial Biotechnology, Ministry of Education, China (grant KLIB-KF201509), the Open Project Program of the Key Laboratory of Carbohydrate Chemistryand Biotechnology, Ministry of Education, China (grants KLCCB-KF201607 and KLCCB-KF201802), and the 111 Project (grant 111-2-06).

REFERENCES1. Ma YF, Shen W, Chen XZ, Liu L, Zhou ZM, Xu F, Yang HQ. 2016.

Significantly enhancing recombinant alkaline amylase production inBacillus subtilis by integration of a novel mutagenesis-screening strategywith systems-level fermentation optimization. J Biol Eng 10:13. https://doi.org/10.1186/s13036-016-0035-2.

2. Mergulhao F, Summers D, Monteiro G. 2005. Recombinant protein se-cretion in Escherichia coli. Biotechnol Adv 23:177–202. https://doi.org/10.1016/j.biotechadv.2004.11.003.

3. Gottesman S. 1996. Proteases and their targets in Escherichia coli. AnnuRev Genet 30:465–506. https://doi.org/10.1146/annurev.genet.30.1.465.

4. Shin HD, Chen RR. 2008. Extracellular recombinant protein productionfrom an Escherichia coli lpp deletion mutant. Biotechnol Bioeng 101:1288 –1296. https://doi.org/10.1002/bit.22013.

5. Choi J, Lee S. 2004. Secretory and extracellular production of recombi-nant proteins using Escherichia coli. Appl Microbiol Biotechnol 64:625– 635. https://doi.org/10.1007/s00253-004-1559-9.

6. Shokri A, Sandén A, Larsson G. 2003. Cell and process design for target-ing of recombinant protein into the culture medium of Escherichia coli.Appl Microbiol Biotechnol 60:654 – 664. https://doi.org/10.1007/s00253-002-1156-8.

7. Sauvonnet N, Vignon G, Pugsley AP, Gounon P. 2000. Pilus formationand protein secretion by the same machinery in Escherichia coli. EMBOJ 19:2221–2228. https://doi.org/10.1093/emboj/19.10.2221.

8. Stathopoulos C, Hendrixson DR, Thanassi DG, Hultgren SJ, St GemeJW, Curtiss R. 2000. Secretion of virulence determinants by thegeneral secretory pathway in Gram-negative pathogens: an evolvingstory. Microbes Infect 2:1061–1072. https://doi.org/10.1016/S1286-4579(00)01260-0.

9. Bao RM, Yang HM, Yu CM, Zhang WF, Tang JB. 2016. An efficient protocolto enhance the extracellular production of recombinant protein from Esch-erichia coli by the synergistic effects of sucrose, glycine, and Triton X-100.Protein Expr Purif 126:9–15. https://doi.org/10.1016/j.pep.2016.05.007.

10. Lee M, Hesek D, Llarrull LI, Lastochkin E, Pi H, Boggess B, Mobashery S.2013. Reactions of all Escherichia coli lytic transglycosylases with bacte-rial cell wall. J Am Chem Soc 135:3311–3314. https://doi.org/10.1021/ja309036q.

11. Hoischen C, Fritsche C, Gumpert J, Westermann M, Gura K, Fahnert B.2002. Novel bacterial membrane surface display system using cell wall-less L-forms of Proteus mirabilis and Escherichia coli. Appl Environ Micro-biol 68:525–531. https://doi.org/10.1128/AEM.68.2.525-531.2002.

12. Gumpert J, Hoischen C. 1998. Use of cell wall-less bacteria (L-forms) forefficient expression and secretion of heterologous gene products. Curr OpinBiotechnol 9:506–509. https://doi.org/10.1016/S0958-1669(98)80037-2.

13. Taubeneck U. 1962. Susceptibility of Proteus mirabilis and its stableL-forms to erythromycin and other macrolides. Nature 196:195–196.

14. Kujau M, Hoischen C, Riesenberg D, Gumpert J. 1998. Expression andsecretion of functional miniantibodies McPC603scFvDhlx in cell-wall-lessL-form strains of Proteus mirabilis and Escherichia coli: a comparison of thesynthesis capacities of L-form strains with an E. coli producer strain. ApplMicrobiol Biotechnol 49:51–58. https://doi.org/10.1007/s002530051136.

15. Ray MV, Meenan CP, Consalvo AP, Smith CA, Parton DP, Sturmer AM,Shields PP, Mehta NM. 2002. Production of salmon calcitonin by direct

expression of a glycine-extended precursor in Escherichia coli. ProteinExpr Purif 26:249 –259. https://doi.org/10.1016/S1046-5928(02)00523-5.

16. Denome SA, Elf PK, Henderson TA, Nelson DE, Young KD. 1999. Esche-richia coli mutants lacking all possible combinations of eight penicillinbinding proteins: viability, characteristics, and implications for pepti-doglycan synthesis. J Bacteriol 181:3981–3993.

17. Kishida H, Unzai S, Roper DI, Lloyd A, Park SY, Tame JR. 2006. Crystalstructure of penicillin binding protein 4 (dacB) from Escherichia coli, bothin the native form and covalently linked to various antibiotics. Biochem45:783–792. https://doi.org/10.1021/bi051533t.

18. Baquero MR, Ayala JA, Moreno F. 1996. dacD, an Escherichia coli geneencoding a novel penicillin-binding protein (PBP6b) with DD-carboxypeptidase activity. J Bacteriol 178:7106 –7111. https://doi.org/10.1128/jb.178.24.7106-7111.1996.

19. Ghosh AS, Chowdhury C, Nelson DE. 2008. Physiological functions ofD-alanine carboxypeptidases in Escherichia coli. Trends Microbiol 16:309 –317. https://doi.org/10.1016/j.tim.2008.04.006.

20. Egan AJ, biboy J, van ’t Veer I, Breukink E, Vollmer W. 2015. Activities andregulation of peptidoglycan synthases. Philos Trans R Soc Lond B Biol Sci370:20150031. https://doi.org/10.1098/rstb.2015.0031.

21. Vollmer W, Blanot D, de Pedro MA. 2008. Peptidoglycan structure andarchitecture. FEMS Microbiol Rev 32:149 –167. https://doi.org/10.1111/j.1574-6976.2007.00094.x.

22. Barreteau H, Kovac A, Boniface A, Sova M, Gobec S, Blanot D. 2008.Cytoplasmic steps of peptidoglycan biosynthesis. FEMS Microbiol Rev32:168 –207. https://doi.org/10.1111/j.1574-6976.2008.00104.x.

23. Typas A, Banzhaf M, Gross CA, Vollmer W. 2011. From the regulation ofpeptidoglycan synthesis to bacterial growth and morphology. Nat RevMicrobiol 10:123–136. https://doi.org/10.1038/nrmicro2677.

24. Meberg BM, Paulson AL, Priyadarshini R, Young KD. 2004. Endopeptidasepenicillin-binding proteins 4 and 7 play auxiliary roles in determininguniform morphology of Escherichia coli. J Bacteriol 186:8326 – 8336.https://doi.org/10.1128/JB.186.24.8326-8336.2004.

25. Loh B, Grant C, Hancock R. 1984. Use of the fluorescent probe 1-N-phenylnaphthylamine to study the interactions of aminoglycoside anti-biotics with the outer membrane of Pseudomonas aeruginosa. Antimi-crob Agents Chemother 26:546 –551. https://doi.org/10.1128/AAC.26.4.546.

26. Broome-Smith JK. 1985. Construction of a mutant of Escherichia coli thathas deletions of both the penicillin-binding protein 5 and 6 genes. J GenMicrobiol 131:2115–2118.

27. Nelson DE, Young KD. 2001. Contributions of PBP 5 and DD-carboxypeptidase penicillin binding proteins to maintenance of cellshape in Escherichia coli. J Bacteriol 183:3055–3064. https://doi.org/10.1128/JB.183.10.3055-3064.2001.

28. Sauvage E, Kerff F, Terrak M, Ayala JA, Charlier P. 2008. The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis.FEMS Microbiol Rev 32:234 –258. https://doi.org/10.1111/j.1574-6976.2008.00105.x.

29. Bouhss A, Trunkfield AE, Bugg TD, Mengin-Lecreulx D. 2008. The bio-synthesis of peptidoglycan lipid-linked intermediates. FEMS MicrobiolRev 32:208 –233. https://doi.org/10.1111/j.1574-6976.2007.00089.x.

Boosting Extracellular Protein Secretion Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 13

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

30. Mohammadi T, Van Dam V, Sijbrandi R, Vernet T, Zapun A, Bouhss A,Diepeveen-de Bruin M, Nguyen-Distèche M, de Kruijff B, Breukinka E.2011. Identification of FtsW as a transporter of lipid-linked cell wallprecursors across the membrane. EMBO J 30:1425–1432. https://doi.org/10.1038/emboj.2011.61.

31. Kraus W, Holtje J-V. 1987. Two distinct transpeptidation reactions duringmurein synthesis in Escherichia coli. J Bacteriol 169:3099 –3103. https://doi.org/10.1128/jb.169.7.3099-3103.1987.

32. Typas A, Banzhaf M, van Saparoea BV, Verheul J, Biboy J, Nichols RJ,Zietek M, Beilharz K, Kannenberg K, von Rechenberg M, Breukink E, denBlaauwen T, Gross CA, Vollmer W. 2010. Regulation of peptidoglycansynthesis by outer-membrane proteins. Cell 143:1097–1109. https://doi.org/10.1016/j.cell.2010.11.038.

33. Huang KC, Mukhopadhyay R, Wen B, Gitai Z, Wingreen NS. 2008. Cell shapeand cell-wall organization in Gram-negative bacteria. Proc Natl Acad SciU S A 105:19282–19287. https://doi.org/10.1073/pnas.0805309105.

34. Nelson DE, Young KD. 2000. Penicillin binding protein 5 affects celldiameter, contour, and morphology of Escherichia coli. J Bacteriol 182:1714 –1721. https://doi.org/10.1128/JB.182.6.1714-1721.2000.

35. Dmitriev B, Toukach F, Ehlers S. 2005. Towards a comprehensive view ofthe bacterial cell wall. Trends Microbiol 13:569 –574. https://doi.org/10.1016/j.tim.2005.10.001.

36. Morra R, Del Carratore F, Muhamadali H, Horga LG, Halliwell S, GoodacreR, Breitling R, Dixon N. 2018. Translation stress positively regulates

MscL-dependent excretion of cytoplasmic proteins. mBio 9:e02118-17.https://doi.org/10.1128/mBio.02118-17.

37. Nakagawa J, Tamaki S, Tomioka S, Matsuhashi M. 1984. Functionalbiosynthesis of cell wall peptidoglycan by polymorphic bifunctionalpolypeptides. Penicillin-binding protein 1Bs of Escherichia coli withactivities of transglycosylase and transpeptidase. J Biol Chem 259:13937–13946.

38. Spratt BG, Pardee AB. 1975. Penicillin-binding proteins and cell shape inE. coli. Nature 254:516 –517. https://doi.org/10.1038/254516a0.

39. Burman LG, Park JT. 1984. Molecular model for elongation of themurein sacculus of Escherichia coli. Proc Natl Acad Sci U S A 81:1844 –1848.

40. Horne D, Hakenbeck R, Tomasz A. 1977. Secretion of lipids induced byinhibition of peptidoglycan synthesis in Streptococci. J Bacteriol 132:704 –717.

41. Yang C, Ye L, Gu J, Yang X, Li A, Yu H. 2017. Directed evolution ofmandelate racemase by a novel high-throughput screening method.Appl Microbiol Biotechnol 101:1063–1072. https://doi.org/10.1007/s00253-016-7790-3.

42. Voigt CA, Martinez C, Wang ZG, Mayo SL, Arnold FH. 2002. Proteinbuilding blocks preserved by recombination. Nat Struct Biol 9:553–558.https://doi.org/10.1038/nsb805.

43. Hoffmann WA, Poorter H. 2002. Avoiding bias in calculations of relativegrowth rate. Ann Bot 90:37– 42. https://doi.org/10.1093/aob/mcf140.

Yang et al. Applied and Environmental Microbiology

October 2018 Volume 84 Issue 20 e01382-18 aem.asm.org 14

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from