Biochimica et Biophysica Actapikweb/reprints.s/Wendte and PIkaard... · Review The RNAs of...

Biochimica et Biophysica Acta xxx (2016) xxx–xxx

BBAGRM-01072; No. of pages: 9; 4C: 2

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r .com/ locate /bbagrm

Review

The RNAs of RNA-directed DNA methylation☆

Jered M. Wendte a, Craig S. Pikaard a,b,⁎a Department of Biology and Department of Molecular and Cellular Biochemistry, Indiana University, 915 E. Third Street, Bloomington, IN 47405, USAb Howard Hughes Medical Institute, Indiana University, Bloomington, IN 47405, USA

Abbreviations: AGO1, ARGONAUTE 1; AGO2, ARGCHROMOMETHYLASE 3; CTD, carboxy-terminal domainDMS11/ATMORC6, DEFECTIVE IN MERISTEM SILENCINGMETHYLTRANSFERASE 3; DRD1, DEFECTIVE IN RNA-DIREHISTONE DEACETYLASE 6; HEN1, HUA ENHANCER 1; IMETHYLATION 1; IDP2/IDNL2/FDM2, IDN2 PARALOG 2/MET1, DNA METHYLTRANSFERASE 1; miRNA, micro RNRDR2 dependent RNA; piRNA, piwi-associated RNA; Pol IRNA-directed DNA Methylation; RDM1, RNA DIRECTED DRRP6-LIKE 1; siRNA, short interfering RNA; SPT4, SUPRESUVH2, SU(VAR)3-9 HOMOLOG 2; SUVH4, SU(VAR)3-9 HSWITCH SUBUNIT 3B.☆ This article is part of a Special Issue entitled: Plant Ge⁎ Corresponding author.

E-mail address: [email protected] (C.S. Pikaard).

http://dx.doi.org/10.1016/j.bbagrm.2016.08.0041874-9399/© 2016 Elsevier B.V. All rights reserved.

Please cite this article as: J.M.Wendte, C.S. Pik10.1016/j.bbagrm.2016.08.004

a b s t r a c t
a r t i c l e i n f o
Article history:Received 6 June 2016Received in revised form 5 August 2016Accepted 6 August 2016Available online xxxx

RNA-directed chromatin modification that includes cytosinemethylation silences transposable elements in bothplants and mammals, contributing to genome defense and stability. In Arabidopsis thaliana, most RNA-directedDNA methylation (RdDM) is guided by small RNAs derived from double-stranded precursors synthesized atcytosine-methylated loci by nuclear multisubunit RNA Polymerase IV (Pol IV), in close partnership with theRNA-dependent RNA polymerase, RDR2. These small RNAs help keep transposons transcriptionally inactive.However, if transposons escape silencing, and are transcribed by multisubunit RNA polymerase II (Pol II), theirmRNAs can be recognized and degraded, generating small RNAs that can also guide initial DNA methylation,thereby enabling subsequent Pol IV-RDR2 recruitment. In both pathways, the small RNAs find their target sitesby interacting with longer noncoding RNAs synthesized by multisubunit RNA Polymerase V (Pol V). Despite adecade of progress, numerous questions remain concerning the initiation, synthesis, processing, size and featuresof the RNAs that drive RdDM. Here, we review recent insights, questions and controversies concerning RNAsproduced by Pols IV and V, and their functions in RdDM. We also provide new data concerning Pol V transcript5′ and 3′ ends. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks.

© 2016 Elsevier B.V. All rights reserved.

Keywords:RNA silencingEpigenetic regulationCytosine methylationChromatin modificationGene regulationNoncoding RNA

1. Overview of RNA-directed DNA methylation (RdDM) andmultisubunit RNA Polymerases IV and V

RNA-directed chromatin modification is used throughout eukaryotesas a means to prevent the transcription and movement of transposableelements, thereby protecting the genome frommutation and instability.In eukaryotes that do not methylate their DNA, such as fission yeast,fruit flies or nematodes, small noncoding RNAs (RNAs that do not encodeproteins) can guide histone modifications that help establish chromatinstates refractive to transcription by RNA polymerases I, II or III. Thesesame repressive histone modifications occur in species that utilize RNAto direct DNA methylation, including plants and humans, with cytosine

ONAUTE 2; AGO4, ARGONAUTE 4; DCL1, DICER-LIKE 1; DCL2, DICER11/MICRORCHIDIA 6; DMS3, DEFECCTED DNA METHYLATION 1; DRM2,DN2, INVOLVED IN DE NOVO 2; IDINVOLVED IN DE NOVO 2-LIKE 1/FAA; NRPD1, NUCLEAR RNA POLYMERV, Plant NUCLEAR MULTISUBUNIT RNA METHYLATION 1; RDR2, RNA-DSSOR OF TY4; SPT5L/KTF1, SUPRESSOMOLOG 4; SUVH5, SU(VAR)3-9 HO

ne Regulatory Mechanisms and Netw

aard, The RNAs of RNA-direct

methylation serving as an additional, important layer of regulation(reviewed in [32,57,90]).

In plants, noncoding RNAs can direct the methylation of previouslyunmodified cytosines in any sequence context (CG, CHG, CHH; whereH=A, C or T). The DNA methyltransferase enzyme that carries outthis de novo cytosine methylation is DRM2. Importantly, DRM2 is anortholog of human DNMT3a/b, reflecting their descent from a progeni-tor enzyme present in a common ancestor of plants and animals[11–13]. Once cytosines have been methylated de novo by DNMT3 orDRM2, other DNA methyltransferases can maintain specific DNAmeth-ylation patterns following each round of DNA replication, and do so inan RNA-independent manner. For instance, CG methylation patterns,

; AGO6, ARGONAUTE 6; CLSY1, CLASSY 1; CMT2, CHROMOMETHYLASE 2; CMT3,-LIKE 2; DCL3, DICER-LIKE 3; DCL4, DICER-LIKE 4; DDR, DRD1-DMS3-RDM1 complex;TIVE IN MERISTEM SILENCING 3; DNMT1, DNA METHYLTRANSFERASE 1; DNMT3, DNADOMAINS REARRANGED METHYLTRANSFERASE 2; dsRNA, double stranded RNA; HDA6,P1/IDNL1/FDM1, IDN2 PARALOG 1/INVOLVED IN DE NOVO 2-LIKE 1/FACTOR OF DNACTOR OF DNA METHYLATION 1; IGN, Intergenic non-coding RNA; JMJ14, JUMONJI 14;ASE IV, subunit 1; NRPE1, NUCLEAR RNA POLYMERASE V, subunit 1; P4R2 RNA, Pol IV-NA POLYMERASE IV; Pol V, Plant NUCLEAR MULTISUBUNIT RNA POLYMERASE V; RdDM,EPENDENT RNA POLYMERASE 2; RDR6, RNA DEPENDENT RNA POLYMERASE 6; RRP6L1,OR OF TY INSERTION 5-LIKE / KOW DOMAIN-CONTAINING TRANSCRIPTION FACTOR 1;MOLOG 5; SUVH6, SU(VAR)3-9 HOMOLOG 6; SUVH9, SU(VAR)3-9 HOMOLOG 9; SWI3B,

orks.

ed DNAmethylation, Biochim. Biophys. Acta (2016), http://dx.doi.org/

http://dx.doi.org/10.1016/j.bbagrm.2016.08.004

mailto:[email protected]

Journal logo


http://www.sciencedirect.com/science/journal/18749399

www.elsevier.com/locate/bbagrm



2 J.M. Wendte, C.S. Pikaard / Biochimica et Biophysica Acta xxx (2016) xxx–xxx

which are symmetric on the two strands of DNA, are maintained inmammals and plants (and other eukaryotes) by DNMT1 and MET1, re-spectively, which again are orthologous enzymes [26,82]. Plants also en-code plant-specific cytosine methyltransferases, named CMT3 andCMT2, which maintain symmetric CHG methylation (CMT3) or main-tain asymmetric CHH methylation in regions of dense pericentric het-erochromatin (CMT2) [11,12,87,100]. Proteins that recognize thedifferent DNA methylation patterns help recruit chromatin modifyingenzymes that chemically modify the associated histones. Likewise, pro-teins recognizing specific histone modifications can recruit cytosinemethyltransferases (reviewed in [57]). In this way, RNA biogenesis,DNA methylation and histone modification machineries work togetherto reinforce so-called epigenetic states, which can be defined as alterna-tive states of gene activity that are not dictated by DNA sequence alone.

A common theme in eukaryotic RNA-directed chromatin modifica-tion is that small RNAs, such as siRNAs or piRNAs, bound to Argonautefamily proteins, interact with longer chromatin-associated RNAs thatact as scaffolds for assembly of chromatin modifying activities(reviewed in [37]). In Arabidopsis thaliana, the model plant species inwhich RNA-directed DNA methylation (RdDM) is best understood,two plant-specific nuclear multisubunit RNA polymerases, Pol IV andPol V, play major roles as generators of RNAs that program RdDM(reviewed in [29]). Pol IV and Pol V are each composed of twelve sub-units, and mass spectrometry analyses revealed that these subunitsare either identical to, or paralogous to, the twelve subunits of Pol II[28,81], indicating that Pols IV and V evolved as specialized forms ofPol II (see also [33,39,53]). In Arabidopsis, Pols IV and V differ in threeof their subunits, suggesting that these subunits might collectivelymake Pol IV and Pol V activities unique [81]. However, subsequentmass spectrometry analyses in maize have shown that the onlyfundamental difference between Pol IV and Pol V is their use of differentlargest subunits [28]. The catalytic centers of multisubunit RNApolymerases are formed by their two largest subunits [15], and the

Pol IV

CLSY1

Po

mm A

5’

RDM1

Pol IV-RDR2 & Pol V transcription

DR

D1

DMS3

RDM1

m

m

m

SU

V9H

2/9

Pol IV

5’

5’

H3K9me2

SHH1

HDA6

MET1

DMS11(MORC6)

Fig. 1. RNA-directed DNA methylation in Arabidopsis. It is useful to consider RdDM as having theterochromatin formation. CG maintenance methylation, requiring the histone deacetylase,lysine 9 (H3K9me2). The Pol IV partner protein, SHH1 binds H3K9me2, helping recruit Pol IVtranscription, generating short transcripts in partnership with RDR2 and the putative ATP-deMET1-dependent CG maintenance methylation also plays a role in Pol V recruitment via SUwhich associates with the DDR complex (DRD1, DMS3, RDM1) known to be required for pRDM1 has single-stranded DNA binding activity, suggesting that DRD1 may act as a helicastranscripts, as do SPT4/5, the IDN-IDP, and SWI/SNF complexes, helping facilitate protein-promodifying enzymes, resulting in extensive cytosine methylation and heterochromatin formatio

Please cite this article as: J.M.Wendte, C.S. Pikaard, The RNAs of RNA-direct10.1016/j.bbagrm.2016.08.004

second-largest subunits of Pols IV and V are the same. Thus, any differ-ences in Pol IV and Pol V activity are presumably explained by aminoacid differences in their distinctive largest subunits.

The RNA products of Pols IV and V have distinct roles in separatesteps of the RdDM pathway. In the conventional model, Pol IV initiatesRdDM by producing precursors that are processed into small RNAs[51,79]. Pol IV physically associates with RNA-DEPENDENT RNA POLY-MERASE 2 (RDR2) [30,58]. Together, these enzymes make double-stranded RNAs that are diced into 24 nt siRNAs by DICER-LIKE 3(DCL3) [97], 2′-O-methylated at their 3′ ends by HEN1 [59] (which sta-bilizes the RNAs by preventing their uridylation and turnover), andloaded into an Argonaute protein, primarily AGO4 [111] or AGO6[106]. Pol V then works downstream in the pathway by producingRNA scaffolds that recruit AGO4-siRNA complexes to the chromatin tar-get sites [93,94]. AGO4 interaction with Pol V transcripts subsequentlyrecruits the de novo methyltransferase, DRM2 [10,27,108]. As summa-rized in the model of Fig. 1, resulting DRM2-mediated de novo cytosinemethylation of the adjacent DNA, accompanied by histone modifica-tions that include histone deacetylation (by HDA6) [1], histone H3lysine 9 methylation (by SUVH4, SUVH5 and SUVH6) [21,22,41,42]and histone H3 lysine 4 demethylation (by JMJ14) [17,84] all ensue,resulting in a chromatin environment refractive to conventional genetranscription by RNA Polymerases I, II or III (the RdDM pathway hasbeen reviewed in [29,66]) (see Fig. 1).

Thus, amajor difference betweenRNA-directed chromatinmodifica-tion in plants compared to other eukaryotes is that both the siRNA pre-cursors and scaffold RNAs are produced by specialized polymerasesrather than the ubiquitous polymerase, Pol II. Moreover, Pol II is anessential enzyme whereas Pols IV and V are dispensable for viability(at least in Arabidopsis), making plants valuable model systems inwhich to study the specific roles of multisubunit RNA polymerasesand their RNA products in the epigenetic regulation of gene expression.In this review, we discuss recent advances in our understanding of Pol

l V

AGO4/6

m

GO4

m m m

5’

m

m

m

Heterochromatinformation

SP

T5L

/4

IDN2-IDPcomplex

SWI/SNF complex

SUVH 4/5/6

DRM2 m

CG, CHG, CHHmethylation

RDM1

RDM1

HDA6

m

JMJ14Pol Vtranscript

CTD

SU

V9H

2/9

m

AGO6

Pol II/RDR6dependent siRNAs

hree major aspects: RNA synthesis (by Pol IV, RDR2 and Pol V), cytosine methylation, andHDA6 and cytosine methyltransferase, MET1 is linked to dimethylation of histone H3 onto the chromatin to be transcribed. Pol IV somehow gains access to the DNA and initiatespendent DNA translocase, CLSY1 (or related CLSY proteins), whose function is unknown.VH2 or SUVH9, which bind to methylated CG motifs and interact with MORC6/DMS11,roduction of Pol V-transcribed RNAs. DRD1 is an ATP-dependent DNA translocase, ande to provide Pol V with a single-stranded template. AGO4-siRNA complexes bind Pol Vtein interactions that recruit the de novo cytosine methyltransferase, DRM2 and histonen.

edDNAmethylation, Biochim. Biophys. Acta (2016), http://dx.doi.org/



3J.M. Wendte, C.S. Pikaard / Biochimica et Biophysica Acta xxx (2016) xxx–xxx

IV and V transcriptional regulation and transcript processing and func-tion, as well as challenges that lie ahead in our quest to understandthe RNAs of RdDM.

2. Pol IV and V transcript function

2.1. Pol IV transcript function: precursors for siRNAs

The requirement of Pol IV for the accumulation of 24 nt siRNAsin vivowas one of thefirst phenotypes identified in the initial character-ization of this enzyme [35,73]. However, the Pol IV-dependent precur-sors that give rise to siRNAs have only been described recently, basedon their accumulation when DICER-LIKE 3 (DCL3), the endonucleaseprimarily responsible for 24 nt siRNA processing, is mutated [8,60,98,99,101]. Mutations in DCL2 and DCL4 further increase the abundance ofthese RNAs by blocking alternative routes of dicing into 21 or 22 ntsiRNAs. Incubating RNAs that accumulate in dcl3 mutants with purifiedDCL3 in vitro results in cleavage of the RNAs into 24 nt RNA products,consistent with the longer RNAs being direct precursors of 24 nt siRNAs[8]. Moreover, the sequences of 24 nt siRNAs tend to perfectly matchthe sequences of precursor RNAs beginning at either the 5′ ends or 3′ends of the precursors, suggesting that individual precursors give rise tosiRNAs by single DCL3 cleavage eventsmeasured from either end [8,101].

Pol IV-dependent precursor RNAs that accumulate in dcl3 mutantsare also fully dependent on RDR2, thus we refer to them as PolIV-RDR2 transcripts (abbreviated as P4R2 RNAs) [8,60,101]. Notably,however, Pol IV affinity-purified from rdr2 null mutant plants istranscriptionally active in vitro [30]. Likewise, recombinant RDR2 istranscriptionally active in vitro [68], showing that Pol IV-RDR2 interac-tion is not obligatory for the fundamental catalytic activities of eitherenzyme. Therefore, it is currently unclear why both enzymes are re-quired for making either strand of siRNA precursors in vivo.

One of the most intriguing recent findings came from whole-genome bisulfite sequencing experiments that indicate that P4R2RNAs can guide RNA-directed DNA methylation without being dicedinto siRNAs [98,99]. This deduction stems from the detection of Pol IVand RDR2-dependent cytosine methylation that persists in quadrupledicer mutants that are null for dcl2, dcl3 and dcl4, and hypomorphicfor dcl1 (a hypomorphic mutation was needed due to the lethality ofdcl1 null mutants). This raises the question of whether siRNAs aretruly needed for RdDM, a provocative idea.

2.2. Pol V transcript function: scaffolds for recruitment of chromatinmodifying complexes

Pol V-dependent transcripts were first identified through a simple,trial and error approach that consisted of identifying RT-PCR productsthat were detected in wild type plants but absent in Pol V mutants.These non-coding transcripts were found to be derived from regionsof the genome associated with siRNAs and DNA methylation, andwere shown to extend from intergenic regions into the promoterregions of adjacent transposons, correlating with the silencing of thesepromoters. Importantly, the intergenic (IGN) transcripts could becross-linked to Pol V, were generated at loci occupied by Pol V, andwere no longer generated if the Pol V active site was mutated [93].Collectively, these lines of evidence indicated that IGN RNAs are thedirect transcription products of Pol V.

The major functions of Pol V transcripts are to serve as scaffolds forrecruitment of proteins to chromatin. As noted above (Fig. 1), siRNA-AGO complexes find their target sites as a consequence of Pol V tran-scription [94,105]. This process is best understood in the context ofAGO4-medaited RdDM. AGO4 association with chromatin is lost if thecatalytic site of the Pol V largest subunit (NRPE1) ismutated, preventingPol V transcription but not Pol V subunit assembly [94]. These observa-tions suggest that siRNA-Pol V transcript basepairing is the primarymode of AGO4 recruitment to target sites. However, protein-protein


interactions between AGO4 and the C-terminal domain (CTD) of thePol V largest subunit [23,34] and between AGO4 and SPT5L/KTF1 (aparalog of the Pol II elongation factor SPT5 that binds Pol V and Pol Vtranscripts, as a heterodimer with SPT4) likely generate a metastablemultimeric complex [7,34,52,83].

An additional protein that binds Pol V scaffold transcripts and helpsmediate RdDM is the RNA binding protein, IDN2 [10]. IDN2 is related toSGS3, an RNA binding protein involved in dsRNA synthesis by RDR6,which generates precursors for DCL4-mediated 21 nt siRNA production[69]. However, IDN2 is not involved in 24 nt siRNA production, yet is re-quired for DNA methylation at a subset of RdDM target loci [3,107].IDN2 preferentially binds dsRNA molecules with 5′ overhangs in vitro[3], but the significance of this activity in vivo is unclear. Importantly,IDN2 forms a complex with the paralogous proteins, IDP1 (also knownas IDNL1 or FDM1) and IDP2 (also known as IDNL2 or FDM2,) mutantsof which have RdDM phenotypes partially redundant with those ofIDN2 [2,95,96,102].

IDN2's binding to Pol V transcripts in vivo occurs in an AGO4-dependent manner [10,110]. This binding event is subsequently re-quired for the direct or indirect association of DRM2with the Pol V scaf-fold transcripts, providing a mechanistic link between IDN2-RNAinteractions and DNA methylation at loci that are dependent on IDN2[2,10]. Exactly how IDN2 is recruited downstream of AGO4 and howDRM2 is recruited downstream of IDN2 is unclear, given that there ap-pears to be no direct physical interaction between IDN2 and AGO4 orDRM2 [2,96,102]. But at least one of the IDN2 interacting proteins,IDP1 (IDNL1/FDM1), has been shown to be capable of interacting withDNA as well as RNA [96], suggesting that the IDN2 complex mightbind to both Pol V scaffold transcripts and their DNA templates, possiblystabilizing AGO4-DRM2 effector complexes and promoting DNAmethylation [2,10]. In vitro reconstitution or structural analyses ofcomplexes involving RNA, IDN2, AGO4, and DRM2 would no doubt beenlightening.

In addition to being required for recruitment of DRM2, IDN2 interac-tions with Pol V transcripts are also required for recruitment of theSWI-SNF chromatin remodeling complexes to regions via directphysical interaction with the SWI/SNF subunit, SWI3b, which stabilizesnucleosomes at RdDM target loci [110]. The function of nucleosomestabilization is not entirely clear but has been proposed to provideDRM2 with stably positioned target cytosines around the nucleosome[110]. Alternatively, nucleosome stabilization may be related to IDN2'sinteraction with the MORC6/DMS11 ATPase protein (which alsointeracts with SWI3b) that functions in transcriptional silencingdownstream of DNA methylation [62].

Other Argonaute proteins in the cell, including AGO2, AGO6, andAGO9, have also been shown to bind siRNAs and participate in RdDM[31,72,78]. These AGO-siRNA complexes are presumably recruited tochromatin through interactions with Pol V transcripts in a mannersimilar to AGO4. Both AGO6 and AGO9 transgenes, when placed underthe native AGO4 promoter, can partially rescue ago4 mutants [31].Moreover, AGO2 and AGO6 have been shown to be required for DNAmethylation at loci that also require Pol V [19,25,31,67,71,78,106] andare capable of interacting with the AGO-hookmotifs of the Pol V largestsubunit's C-terminal domain [78]. Additionally, AGO6 recruitment tochromatin has been shown to be dependent on Pol V both in the contextof Pol IV-derived, 24 nt siRNA-mediated RdDM and RDR6-derived,21–22 nt siRNA-mediated RdDM [67]. These data indicate that Pol Vtranscription can be used to recruit diverse, specialized AGO-siRNAcomplexes, and not necessarily for RdDM. For instance, AGO2 recruit-ment by Pol V is implicated in DNA double-strand break (DSB) repairbecause DSBs are associated with production of 21 and 24 nt siRNAsbound by AGO2, and both AGO2 and Pol V are required for efficientDSB repair [91]. However, it is not yet clear if Pol V transcribes DSBloci to produce scaffold RNAs to which AGO2 complexes bind. Nonethe-less, the possibility that small RNA- Pol V scaffold RNA interactionsguide a variety of processes in the nucleus is intriguing.





3. How do Pols IV and V know where to transcribe?

Given the importance of Pols IV and V in RNA-directed DNAmethyl-ation and gene silencing, a critical question is: how do these polymer-ases target specific loci? DNA sequences associated with Pol IV and PolV have been identified genome-wide by chromatin immunoprecipita-tion followed by deep sequencing (ChIP-seq) [56,92,109]. No consensussequences that are highly correlated with Pol IV or Pol V-associatedregions have been identified. This suggests that Pol IV and Pol Vrecruitment may not involve conventional promoter sequences thatare recognized by sequence specific DNA-binding proteins, althoughuse of diverse, or sequence-tolerant, promoter elements could makesuch sequences difficult to identify.

Instead, evidence has accumulated that chromatinmarks play an im-portant role in specifying sites of Pol IV and Pol V transcription. Pol IVand Pol V are both recruited to sites modified by HDA6-dependent his-tone deacetylation, maintenance methylation (by MET1 and/or CMT3),and histone H3K9 dimethylation (H3K9me2), a histone modificationknown to occur in crosstalk with maintenance cytosine methylation[9,47,56,58,103]. This realization has come from experimental evidencegenerated bymultiple laboratories. For instance, in studies investigatingthe role of HDA6 in RdDM, Blevins et al. found a surprising requirementfor HDA6 in Pol IV recruitment and 24nucleotide siRNA biogenesis atmany loci [9]. Interestingly, siRNA biogenesis lost in hda6 mutants isnot regained at these loci simply by restoring HDA6 activity, indicatingthat a heritable epigenetic memory required for Pol IV recruitment iserased in hda6 mutants, and is not easily regained once lost. Knowingthat HDA6 is required for CG and CHG maintenance methylation atrRNA genes [20], as well as other loci, met1 null mutants were testedand found to have the same loss of siRNA biogenesis and loss ofepigenetic memory observed in hda6mutants. Thus, MET1-dependentmaintenance methylation can account for the heritable epigeneticmemory that marks loci for Pol IV recruitment and silencing by RdDM,establishing a chromatin state responsible for a region's “silent locusidentity” [9].

In independent studies, the Jacobsen and Zhu labs found that aprotein that physically interacts with Pol IV, SHH1/DTF1, binds histonesdisplaying the repressive H3K9me2 mark, and Pol IV association withmany of its sites of action genome-wide are lost in shh1 mutants [56,58,103]. It has long been known that a subset of heterochromatinregions displaying MET1-dependent cytosine methylation is enrichedfor H3K9me2, a histone mark that can be lost when mutation of met1leads to transcriptional derepression [45,86]. Mechanistically, therelationship between H3K9 methylation and cytosine methylation isbest understood in relation to CHG methylation, which is the sequencecontext that is specifically bound by the SUVH4 histonemethyltransfer-ase [46]. Thus it is possible that met1 effects on H3K9 methylation arerelated to decreases in non-CG rather than CGmethylation—a hypothe-sis that has been supported by genome-wide cytosinemethylation anal-yses [87]. H3K9methylation is also highly correlated with maintenancemethylation established by CMT3, which methylates DNA in the CHGcontext and specifically binds to methylated H3K9, thus forming apositive-feedback loop with SUVH4 [18,87]. Mutations in cmt3 alsocause a loss of H3K9 methylation and Pol IV-SHH1 dependent siRNAs[87], but whether Pol IV occupancy fails to be regained uponre-introduction of a wild type CMT3 gene, similar to MET1 or HDA6,remains to be tested. Collectively, the observations of the differentlaboratories fit the hypothesis that maintenance DNA methylationallows for the inheritance of an epigenetic signal that is translatedinto H3K9 dimethylation, providing a docking site for SHH1-Pol IVcomplexes (see Fig. 1). Consistent with this hypothesis, RdDM locidependent on HDA6, MET1 and SHH1 significantly overlap [9].

Pol V recruitment also requires maintenance methylation by MET1[47]. However, in this case, the methylated DNA is recognized directlyby the methylcytosine binding proteins, SUVH2 and SUVH9 [44,47,48,61,62]. These proteins are members of the histone methyltransferase


family that have SRA domains for binding methylated DNA as well asdomains for methylating histone H3 within associated nucleosomes.Interestingly, amino acid changes have rendered SUVH2 and SUVH9non-functional as histone methyltransferases, yet they retain theirability to bind methylated cytosines [47]. Pol V recruitment to its sitesof action is impaired in suvh2/9mutants—an interaction that is presum-ably mediated by bridging proteins. In the studies that first identifiedPol V transcripts [93,94], production of the RNAs was shown to requireDRD1, a putative ATP-dependent DNA translocase [49], and DMS3, aprotein related to the hinge domains of cohesins and condensins [50].DRD1 andDMS3were subsequently shown to associatewith one anoth-er and with a single-stranded DNA binding protein, RDM1 to form theso-called DDR complex [55,63]. A protein that interacts with the DDRcomplex is the MORC ATPase, DMS11 [63], also known as AtMORC6.For DRD1, DMS3, and DMS11/MORC6, there is evidence for directphysical interaction with SUVH2 and/or SUVH9 in vivo [47,61]. Collec-tively, these observations suggest that methylated DNA is recognizedby SUVH2 or SUVH9, recruiting the DDR-DMS11/MORC6 complex thatfacilitates Pol V transcription, via mechanisms that remain unclear.We have speculated that the DDR complex, and its associated proteins,may play a role in unwinding DNA to facilitate Pol V transcription,analogous to the helix unwinding that occurs at DNA replication forks[76]. However, direct biochemical tests of this hypothesis are stillneeded.

Although themajority of RdDM is mediated by the 24 nt siRNAs thataccount for approximately 90% of all siRNAs present in Arabidopsis cells,an important role for 21–22 nt siRNAs in the early establishment ofRdDM has come to light in recent years [85]. Transposon-derived tran-scripts synthesized by Pol II are recognized by the cell, in part by cellularmicroRNAs (miRNAs) that basepairwith the transposon RNAs in associ-ation with AGO1, which then slices the mRNAs [16]. Via mechanismsthat remain biochemically undefined, sliced mRNAs become templatesfor dsRNA synthesis by the RNA-dependent RNA polymerase, RDR6,and these dsRNAs are then cut, primarily by DCL4, into 21 nt secondarysiRNAswhich can further directmRNA slicing in associationwith AGO1.In this way, messenger RNAs encoding transposon proteins are degrad-ed, thus curtailing transposon activity. However, genetic and genomicevidence also indicate that RDR6-dependent siRNAs can associate withAGO6 and direct de novo cytosinemethylation of targeted transposons'DNA [67,71,74]. In this way, methylationmarks that can potentiate sub-sequent Pol IV and Pol IV recruitment can be established. The ensuingPol IV-RDR2 and Pol V transcription, and 24 nt siRNA-mediated RdDM,can then maintain silencing.

4. P4R2 and Pol V transcript characteristics

Because Pols IV and V are evolutionarily derivatives of Pol II, mighttheir transcripts undergo processing like Pol II derived mRNAs? Majorprocessing steps for Pol II transcripts include the addition of a 7-methylguanosine cap on the 5′ end, a 3′ poly-A tail, and splicing ofintronic sequences. All of these modifications are mediated by protein-protein interactions between Pol II and processing enzymes. Of particularimportance is the C-terminal domain (CTD) of the Pol II largest subunit,which interacts with components of the splicing, capping, and cleavage/polyadenylation complexes, allowing co-transcriptional processing(reviewed in [6,36,38]). Other Pol II domains can also interact with RNAprocessing factors, including the foot domain of the largest subunit,which interacts with the capping complex [88], and the flap loop domainof the second-largest subunit, which interacts with both the cleavage/polyadenylation and capping machineries [65,75]. Intriguingly, the PolIV and Pol V largest subunits, NRPD1 and NRPE1, have CTDs whosesequences have completely diverged from the CTD of the Pol II largestsubunit, NRPB1 [29,40,79,89]. Moreover, NRPD1 and NRPE1 are missingthe foot domain [64,79]. Likewise, the second largest subunit, NRPD/E2,which is shared by Pols IV and V, is missing the flap loop domain. Theflap loop domain is also absent in Pols I and III, which has been suggested





to at least partially explain why Pol I and III transcripts do not undergocapping (Fig. 2A) [65]. Collectively, the amino acid sequence divergenceof Pol IV and V subunits, compared to Pol II subunits, suggests thatthese polymerasesmay have lost the ability to interact with the RNA pro-cessing factors that modify Pol II transcripts.

P4R2 RNAs are relatively short, double-stranded RNAs typicallyranging in size from ~26–45 bp, with the peak of their size distributionoccurring at approximately 30 bp [8,98,99,101]. This short size likelyprecludes splicing. Furthermore, consideration of P4R2 RNA clusters at

A. Flap Loop

Pol II

Pol III Pol I

Pol IV/V

5' CAP

5' PPP

5' P

3'

3'

3'

5' HO 3'

Total RNA 5' end possibilities:

5' P

5' P

5' P

3'

3'

3'

5' HO 3'

5' CAP

5' P

5' P

3'

3'

3'

5' HO 3'

5' CAP

5' PPP

5' P

3'

3'

3'

5' HO 3'

Treatment A: Treatment B: Treatment C:1. Tobacco Acid Pyrophosphatase

1. 5' Polyphosphatase 1. No Enzyme

2. Terminator exonuclease



5' HO 3'

5' CAP 3'

5' HO 3'

5' CAP

5' PPP

3'

3'

5' HO 3'

RT-PCR

C. D.

Fig. 2. Pol V transcripts lack the poly A tails and 7-methylguanosine caps of Pol II transcribed mvarious species, highlighting theflap-loop domain. This domain of Pol II is absent in Pols I, III, anIV and V. For Pol II, the flap loop domain is important for interactionswith both the capping andDm: Drosophilamelanogaster; At: Arabidopsis thaliana; Pt: Populus trichocarpa; Vv: Vitis vinifera;dT bead fractionation of total RNA, followed by qRT-PCR. Histograms display the average ratio(supernatant) fraction for three biologic replicates (error bars are one standard deviation fromin the Poly-A fraction compared to the Pol II-dependent transcripts ACT2 and TUB8, suggestingdistinguish if Pol V transcripts possess a 7-methylguanosine cap, triphosphate, or monophosphTobacco Acid Pyrophosphatase (TAP) to convert any 5′ caps or 5′ triphosphate groups to monowith a 5′monophosphate group, but has no effect on RNAmolecules with 5′ caps or triphosphaverts 5′ triphosphates intomonophosphates, but has no effect on 5′ caps, followed by a treatmenuclease only. As a control, an equal amount of total RNA was also subjected to each treatmequantitative RT-PCR and ratios of transcript levels in treatment (+) enzyme : treatment (−) enacross at least three biologic replicates, with error bars showing one standard deviation from themost severely depleted by Treatment A and relatively resistant to Treatments B and C. A transcriB and resistant to C,whereas, a transcriptwith a 5′monophosphate should be equally depleted iACT2 and TUB8, which were significantly more depleted by Treatment A than Treatments B anprimary state, was equally depleted by Treatments A and B. The Pol V transcripts assayed weresuggesting the majority of the Pol V transcript population is characterized by a 5′ triphosphate


the loci from which they are derived revealed no evidence for disconti-nuities consistent with splicing of longer precursors [60].

Currently, our knowledge of Pol V transcription units is limited toregions that have been amplified by reverse transcription and PCR(RT-PCR), generally limited to intervals of ~200 bp or less [10,83,92–94,104,105,109,110]. Thus far, RT-PCR product sizes have matchedthe sizes predicted from the DNA template, with no unexpected smallerproducts attributable to splicing. Clearly, this does not rule out thepossibility of splicing, but at present there is no evidence for it.

B.

***p<0.001

******

RNAs. A) Amino acid alignment of the second-largest subunits of Pols I, II, III, and IV/V ind IV/V. Note that the same protein, NRP(D/E)2 serves as the second-largest subunits of Polspolyadenylationmachinery. Sc: Saccharomyces cerevisiae; Sp: Schizosaccharomyces pombe;Zm: Zeamays; Os:Oryza sativa; Pc: Pinus canariensis; Cr: Cycas revoluta. B) Results of oligo-of transcript levels in the Poly-A enriched (bead) fraction relative to the Poly-A depletedthemean). Note that Pol V-dependent transcripts are enriched at significantly lower levelsthey Pol V transcripts are not polyadenylated. C) Schematic of enzyme treatments used toate group on the 5′ terminal nucleotide. Treatment A consisted of an initial treatment withphosphates, followed by a treatment with Terminator exonuclease, which degrades RNAte groups. Treatment B included an initial treatment with 5′ Polyphosphatase, which con-ntwith Terminator exonuclease. Treatment C consisted of treatmentwith Terminator exo-nt step with no enzyme added. D) After treatments, transcript levels were measured byzyme were compared for each treatment group, A, B, and C (shown are the average ratiosmean).With this treatment scheme,we predicted that a transcript with a 5′ cap should beptwith a 5′ triphosphate groupwas predicted to be ~equally depleted by Treatments A andnall treatments.We found these predictions to be accurate for our Pol II control transcripts,d C. Also, the Pol I control transcript, 45S, which is characterized by a 5-triphosphate in itsalso equally depleted by Treatments A and B, which had a greater effect than Treatment C,.

ed DNAmethylation, Biochim. Biophys. Acta (2016), http://dx.doi.org/




The 3′ ends of P4R2RNAs are notmodifiedwith apoly-A tail, but oftencontain one or two untemplated nucleotides [8,60,98,101]. Differentopinions exist as to how the 3′ ends of P4R2 RNAs are generated, andwhy the RNAs are so short (~30 bp). One hypothesis is that cytosinemethylation in the DNA template can cause misincorporation of a nucle-otide other than G in the RNA, inducing Pol IV termination and thus lim-iting the size of Pol IV transcripts [101]. However, Pol IV transcriptsgenerated in vitro using unmethylated single-stranded bacteriophageM13 DNA as the template, are similar in size to P4R2 RNAs madein vivo, albeit slightly longer [8]. This suggests that the short size ofP4R2 RNAs reflects an intrinsically poor processivity of Pol IV comparedto other known RNA polymerases, even on non-methylated DNA. More-over, RDR2 has terminal transferase activity that will add one or twonon-templated nucleotides to the ends of an RNA molecule, suggestingan alternative explanation for non-templated nucleotides at the ends ofP4R2 RNAs, as opposed to Pol IV mis-incorporation [8]. Another recentpaper has suggested that the 3′ ends of P4R2 RNAs might be producedby sequential exonuclease action that removes one nucleotide at a timefrom longer transcripts, resulting in P4R2 RNAs that can have the same5′ end, but variable 3′ ends [99]. This hypothesis stems from the observa-tion that defects in RdDM are observed in mutants for RRP6-LIKE 1(RRP6L1), an ortholog of a yeast enzyme known to be a 3′exoribonuclease. However, as the authors themselves point out, there isno direct evidence that RRP6L1 trims P4R2 RNAs, such that the effectsof RRP6L1 on RdDM may not be related to small RNA biosynthesis. Be-cause Pol IV transcripts generated in vitro have variable 3′ end positions[8], random termination rather than sequential exonuclease action mayprovide an alternative explanation for 3′ ends that can differ by incre-ments of single nucleotides.

Pol V transcript 3′ ends have been characterized, to a limited extent,relative to Pol II-derived mRNAs [93]. Upon fractionation of RNA intopoly-A enriched and poly-A depleted fractions, Pol V IGN5 transcriptswere detected only in the poly-A depleted fraction, suggesting that PolV transcripts lack a 3′ poly-A tail [93]. An expanded examination ofPol V transcripts from other loci indicates that the lack of a poly-A tailis a general characteristic of these RNAs (Fig. 2B).

P4R2 RNAs tend have a purine (A or G) at their 5′ ends (the +1position), with a pyrimidine (C or T) present in the DNA at -1 [8,101].This is a conserved signature of transcripts generated by all knownmultisubunit RNA polymerases, from bacteria to archaea to eukaryotes[4], thereby implicating Pol IV rather than RDR2. However, as firstnoted by Li et al., the P4R2 RNAs lack triphosphate groups at their 5′ends, as is expected for an initiating nucleotide; instead the RNAs have5′ monophosphates [60]. This raises the possibility that 5′ ends ofP4R2 RNAs might be generated by processing, perhaps involving anendonuclease that cleaves RNA between adjacent pyrimidine-purinemotifs. However, transcripts generated in vitro using affinity purifiedPol IV (isolated in an rdr2 mutant background) from long single-stranded DNA templates also obey the −1 pyrimidine/+1 purine ruleat their 5′ ends [8] arguing against P4R2 end consensus sequencesarising through processing. Instead, an unknown activity that removesa terminal pyrophosphate group of P4R2 RNAs is implicated.

Pol V transcripts at the IGN5 locus were found to have purines attheir 5′ ends [93]. Furthermore, full-length Pol V IGN5 transcriptswere deduced to have either 5′ caps or triphosphate moities [93], buttests to distinguish between these possibilities were not conducted.Thus, we have revisited this question by using three enzyme treatmentschemes that can distinguish between a 5′ cap, a 5′ triphosphate, or a 5′monophosphate (Fig. 2C). Treatment A consisted of an initial treatmentwith Tobacco Acid Pyrophosphatase (TAP), which will convert 5′ capsor 5′ triphosphate groups to 5′monophosphates, followed by treatmentwith Terminator exonuclease, which specifically degrades RNAsthat have 5′ monophosphates. In Treatment B, an initial treatmentwith 5′ polyphosphatase, which converts 5′ triphosphates intomonophosphates, but has no effect on 5′ caps, was followed by treat-mentwith Terminator exonuclease. Treatment C consisted of treatment


with Terminator exonuclease only (Fig. 2C). As a control, an equalamount of total RNA was also subjected to each treatment step, butwith no enzyme added. After the treatments, transcript levels were de-termined using quantitative RT-PCR and ratios of transcript levels intreated versus untreated samples were compared for treatments A, B,or C.

We predicted that a transcript with a 5′ cap should bemost severelydepleted by TreatmentA butwould be relatively resistant to TreatmentsB and C. By contrast, transcripts with 5′ triphosphate groups should beequally depleted by Treatments A and B, but resistant to C. Transcriptswith a 5′ monophosphate group should be equally depleted in alltreatments. These predictions hold true for actin and tubulin (ACT2and TUB8)mRNA controls, transcribed by Pol II, whichwere significant-ly more depleted by Treatment A than by Treatments B or C, consistentwith these mRNAs bearing 7-methylG caps (Fig. 2D). By contrast, a PolI-transcribed control transcript, 45S pre-rRNA, which is expected tohave a 5′ triphosphate [5], was equally depleted by Treatments A andB, as expected for RNAs with triphosphate groups at their 5′ ends, andwas less depleted by Treatment C (Fig. 2D). Pol V transcribed RNAsrespond similar to the Pol I 45S pre-rRNA control, being equallydepleted by Treatments A and B, and less depleted by Treatment C(Fig. 2D). This indicates that themajority of Pol V transcripts have a 5′ tri-phosphate, as expected of a primary transcript, and are not modified byaddition of a 7-methyguanosine cap. A portion of the Pol V transcripts(averaging ~30%) tested have 5′ monophosphate groups (Fig. 2D), pre-sumably generated by cleavage or partial degradation.

Collectively, the evidence suggests that P4R2 and Pol V transcriptsdo not undergo RNA processing steps characteristic of Pol II derivedmRNAs, namely capping, splicing or polyadenylation. This is consistentwith the amino acid changes, relative to Pol II, in domains that interactwith processing enzymes, as discussed previously.

5. Outstanding questions for Pol IV and Pol V dependent RNAs

As noted above, Pol IV and RDR2 are both capable of transcription in-dependently of one another in vitro, yet both are equally required forthe accumulation of P4R2 RNAs in vivo. Thus, a major question remain-ing for P4R2 RNAs is the extent to which Pol IV and RDR2 each contrib-ute to the population of precursor RNAs present in vivo. The presence ofa 5′ monophosphate on P4R2 RNAs strongly suggests there are addi-tional steps in P4R2 RNA processing that are yet to be discovered. In-deed, a recent study described a role for RNaseIII-like enzyme, RTL2, incleaving a subset of P4R2 RNAs prior to processing by Dicers [24]. Iden-tification of additional P4R2 RNA processing factors may allow for anexperimental uncoupling of Pol IV and RDR2 in vivo and provide insightto their individual roles.

Since their initial discovery and characterization [93], the number ofknown Pol V-transcribed loci has increased substantially, due largely togenome-wide Pol V localization by ChIP-seq [92,109]. However, onlytens of Pol V-produced RNAs have been confirmed by RT-PCR and nofull-length primary transcripts of Pol V have yet been described. An un-derstanding of Pol V transcription start and termination sites, thus de-fining the lengths of Pol V transcripts and the sequences that flankthem, is sorely needed. Such informationwould also assist efforts to de-termine the fates of Pol V transcripts following transcription, includingtheir potential cleavage and degradation.

There are currently only two proteins with potential ribonucleaseactivity that have been identified as interactors with Pol V transcripts,AGO4 and RRP6L1 [94,104]. AGO4 is capable of slicing RNA in vitro,and this activity is at least partially required for RdDM in vivo [80]. How-ever, it is not clear that AGO4 slices Pol V transcripts, nor is it clear whatthe consequences of Pol V transcript slicingmight be. An initial hypoth-esis was that Pol V transcript slicing may contribute to Pol V dependentsiRNA production [80]. However, recent studies in yeast have shownthat, at least in S. pombe, ago slicer activity is dispensable for secondarysiRNA amplification [43]. RRP6L1 is a putative 3′ to 5′ exoribonuclease





related to the yeast nuclear exosome component, Rrp6 [54], which onemight think would make it an excellent candidate for an enzymeinvolved in Pol V transcript degradation and turnover. However,contrary to this hypothesis, a recent study has demonstrated that PolV transcripts, are less stable in rrp6L1 mutants, not more stable [104].

Mass spectrometry analyses in maize indicate that the distinctlargest subunits of Pols IV andV are the only fundamental difference be-tween the two enzymes [28]. The major difference between the largestsubunits of Pols IV and V is the presence of a long C-terminal domain(CTD) in the Pol V largest subunit and a short CTD in the Pol IV largestsubunit. The Pol II CTD plays a critical role in all aspects of Pol IItranscription [6,36,38]. Although the long Pol V CTD has no amino acidsequence similarity with the Pol II CTD , structural features reminiscentof the Pol II CTD are present, including a (predicted) unstructured seriesof peptide repeats and multiple amino acid residues that could poten-tially be subjected to post-translational modification, such as phosphor-ylation [29,40,79,89]. Targeted investigations of Pol IV and Pol V CTDdomains to explore their roles in RdDM and Pol V transcription, theirpost-translationalmodification, or their interactionswith other proteinsseems likely to provide new insights into the unique functions of thesefascinating and enigmatic enzymes.

6. Methods

6.1. RNA extraction and RT-PCR

Total RNA was extracted from 2–2.5 week old above-ground tissueof Col-0 WT or nrpe1–11 [77] using Trizol and RT-PCR was conductedas described in [93]. Primers for IGN22 (RT: 5′ CGGGTCCTTGGACTCCTGAT 3′; PCR: 5′ TCGTGACCGGAATAATTAAATGG 3′), IGN23 (RT: 5′GCCATTAGTTTTAGATGGACTGCAA 3′; PCR: 5′ GGGCGAACCTGGAGAAAGTT 3′), IGN25 (RT: 5′ CTTCTTATCGTGTTACATTGAGAACTCTTTCC 3′;PCR: 5′ ATTCGTGTGGGCTTGGCCTCTT 3′), and IGN26 (RT: 5′ CGTGACATTAGAAGCTCTACGAGAA 3′; PCR: 5′ TTCCTGGCCGTTGATTGGT 3′)are from [83]. Primers for IGN24 (RT: 5′ CGCATACGATGGTCGGAGAGTT 3′; PCR: 5′ GCTTATCATTATCCAAACTTGATCCTATCCTAAA 3′) arefrom [92]. Primers for IGN29 (RT: 5′ CATGTGTTGTTGTGTGTTTCACTAT3′; PCR: 5′ TAAAACTTTTCCCGCCAACCA 3′) are from this study and[110]. Primers for IGN34 (RT: 5′ CCCTTTCATCGACACTGACA 3′; PCR: 5′ATGAATAACAAATTTGGAGTCGTC 3′), IGN35 (RT: 5′ GACGGACCAAACGATTTCAT 3′; PCR: 5′ TTCCTCTTTGAGCTTGACCA 3′), IGN36 (RT: 5′CAGTTTTGGGTGCGGTTTAT 3′; PCR: 5′ GACAAAAATTGCTTTAGACCATGA 3′) are from [10]. Primers for 45S rRNA (RT: 5′ CAAGCAAGCCCATTCTCCTC 3′; PCR: 5′GAGTCTGGGCAGTCCGTGG3′) are from [14]. Primersfor ACT2 (RT: 5′ CTGTACTTCCTTTCAGGTGGT 3′; PCR: 5′ GCTGACCGTATGAGCAAAGA 3′) and TUB8 (RT: 5′ TCGAATCGATCCCGTGCT 3′; PCR:5′ TCACATACAAGGTGGCCAATG 3′) are from this study.

6.2. Poly-A fractionation and 5′ ends analysis of RNA

RNAwas fractionated into Poly-A enriched and Poly-A depleted frac-tions using the Sigma FastTrack MAG mRNA Isolation Kit according tothe manufacturer's instructions. RNA was precipitated from the Poly-Adepleted fraction using 2 vol 100% ethanol and 1/10th volume sodiumacetate (pH 5.2). RT-PCR products from each fraction were quantifiedby running 10 μl on a 2% agarose gel stained with ethidium bromide,followed bymeasuring band intensitieswithQuantity One software. Ra-tios of band intensities in the Poly-A enriched and Poly-A depleted frac-tions were calculated for each target transcript across at least 3 biologicreplicates.

To characterize 5′ ends, RNA was subjected to three enzyme treat-ment schemes. To target RNAs with a 5′ cap, 5′ triphosphate, or 5′monophosphate group RNA was first treated with Tobacco AcidPyrophosphatase, followed by a treatment with Terminator exonucle-ase. To target RNAs with a 5′ triphosphate or 5′ monophosphate, RNAwas treated with 5′ polyphosphatase, followed by a treatment with


Terminator exonuclease. To target only 5′ monophosphate RNAs, RNAwas treated with Terminator exonuclease only. All enzymes were ob-tained from Epicentre and treatments were conducted according tothe manufacturer's instructions. After each treatment step, RNA wascleaned using the Zymogen RNA Clean and Concentrate Kit. As a controlRNA was subjected to each treatment step with no enzyme added. Foreach treatment scheme, RT-PCR products were quantified by running10 μl on a 2% agarose gel stained with ethidium bromide, followed bymeasuring band intensities with Quantity One software. Ratios ofband intensities in the treatment (+) enzyme and treatment (−) en-zyme fractions were calculated for each target transcript across atleast 3 biologic replicates for each treatment scheme.

6.3. Amino Acid sequence alignments

Amino acid sequences for the second largest subunits of Pols I, II, III,and IV/V for eachof the species listed in Fig. 2were obtained frompublicdatabases and [40]. Sequences were aligned using T-Coffee [70].

Acknowledgements

Research in the Pikaard lab is supported by National Institutes ofHealth grant GM077590 (to C.S.P.) and support to C.S.P. as an Investiga-tor of the Howard Hughes Medical Institute and the Gordon and BettyMoore Foundation. JMW received support from the NIH departmentaltraining Grant, T32GM007757, and the National Institute of GeneralMedical Sciences of the NIH under Award Number F31GM116346. Thecontent of this work is solely the responsibility of the authors anddoes not necessarily represent the official views of the NationalInstitutes of Health.

References

[1] W. Aufsatz, M.F. Mette, J. van derWinden,M.Matzke, A.J. Matzke, HDA6, a putativehistone deacetylase needed to enhance DNA methylation induced by double-stranded RNA, EMBO J. 21 (2002) 6832–6841.

[2] I. Ausin, M.V. Greenberg, D.K. Simanshu, C.J. Hale, A.A. Vashisht, S.A. Simon, T.F. Lee,S. Feng, S.D. Espanola, B.C. Meyers, et al., INVOLVED IN DE NOVO 2-containingcomplex involved in RNA-directed DNA methylation in Arabidopsis, Proc. Natl.Acad. Sci. U. S. A. 109 (2012) 8374–8381.

[3] I. Ausin, T.C. Mockler, J. Chory, S.E. Jacobsen, IDN1 and IDN2 are required for denovo DNA methylation in Arabidopsis thaliana, Nat. Struct. Mol. Biol. 16 (2009)1325–1327.

[4] R.S. Basu, B.A. Warner, V. Molodtsov, D. Pupov, D. Esyunina, C. Fernandez-Tornero,A. Kulbachinskiy, K.S. Murakami, Structural basis of transcription initiation bybacterial RNA polymerase holoenzyme, J. Biol. Chem. 289 (2014) 24549–24559.

[5] B. Batts-Young, H.F. Lodish, Triphosphate residues at the 5′ ends of rRNA precursorand 5S RNA from Dictyostelium discoideum, Proc. Natl. Acad. Sci. U. S. A. 75 (1978)740–744.

[6] D.L. Bentley, Coupling mRNA processing with transcription in time and space, Nat.Rev. Genet. 15 (2014) 163–175.

[7] N. Bies-Etheve, D. Pontier, S. Lahmy, C. Picart, D. Vega, R. Cooke, T. Lagrange,RNA-directed DNA methylation requires an AGO4-interacting member of theSPT5 elongation factor family, EMBO Rep. 10 (2009) 649–654.

[8] T. Blevins, R. Podicheti, V. Mishra, M. Marasco, H. Tang, C.S. Pikaard, Identificationof Pol IV and RDR2-dependent precursors of 24 nt siRNAs guiding de novo DNAmethylation in Arabidopsis, Elife 4 (2015), e09591.

[9] T. Blevins, F. Pontvianne, R. Cocklin, R. Podicheti, C. Chandrasekhara, S. Yerneni, C.Braun, B. Lee, D. Rusch, K. Mockaitis, et al., A two-step process for epigeneticinheritance in Arabidopsis, Mol. Cell 54 (2014) 30–42.

[10] G. Bohmdorfer, M.J. Rowley, J. Kucinski, Y. Zhu, I. Amies, A.T. Wierzbicki, RNA-directed DNA methylation requires stepwise binding of silencing factors to longnon-coding RNA, Plant J. 79 (2014) 181–191.

[11] X. Cao, W. Aufsatz, D. Zilberman, M.F. Mette, M.S. Huang, M. Matzke, S.E. Jacobsen,Role of the DRM and CMT3 methyltransferases in RNA-directed DNA methylation,Curr. Biol. 13 (2003) 2212–2217.

[12] X. Cao, S. Jacobsen, Locus-specific control of asymmetric and CpNpG methylationby the DRM and CMT3 methyltransferase genes, Proc. Natl. Acad. Sci. U. S. A. 99(Suppl. 4) (2002) 16491–16498.

[13] X. Cao, S.E. Jacobsen, Role of the Arabidopsis DRM methyltransferases in de novoDNA methylation and gene silencing, Curr. Biol. 12 (2002) 1138–1144.

[14] C. Chandrasekhara, G. Mohannath, T. Blevins, F. Pontvianne, C.S. Pikaard,Chromosome-specific NOR inactivation explains selective rRNA gene silencingand dosage control in Arabidopsis, Genes Dev. 30 (2016) 177–190.


http://refhub.elsevier.com/S1874-9399(16)30171-7/rf0005












































[15] P. Cramer, K.J. Armache, S. Baumli, S. Benkert, F. Brueckner, C. Buchen, G.E.Damsma, S. Dengl, S.R. Geiger, A.J. Jasiak, et al., Structure of eukaryotic RNA poly-merases, Annu. Rev. Biophys. 37 (2008) 337–352.

[16] K.M. Creasey, J. Zhai, F. Borges, F. Van Ex, M. Regulski, B.C. Meyers, R.A.Martienssen,miRNAs trigger widespread epigenetically activated siRNAs from transposons inArabidopsis, Nature 508 (2014) 411–415.

[17] A. Deleris, M.V. Greenberg, I. Ausin, R.W. Law, G. Moissiard, D. Schubert, S.E.Jacobsen, Involvement of a Jumonji-C domain-containing histone demethylase inDRM2-mediatedmaintenance of DNAmethylation, EMBO Rep. 11 (2010) 950–955.

[18] J. Du, X. Zhong, Y.V. Bernatavichute, H. Stroud, S. Feng, E. Caro, A.A. Vashisht, J.Terragni, H.G. Chin, A. Tu, et al., Dual binding of chromomethylase domains toH3K9me2-containing nucleosomes directs DNA methylation in plants, Cell 151(2012) 167–180.

[19] C.G. Duan, H. Zhang, K. Tang, X. Zhu, W. Qian, Y.J. Hou, B. Wang, Z. Lang, Y. Zhao, X.Wang, et al., Specific but interdependent functions for Arabidopsis AGO4 and AGO6in RNA-directed DNA methylation, EMBO J. 34 (2015) 581–592.

[20] K.W. Earley, F. Pontvianne, A.T. Wierzbicki, T. Blevins, S. Tucker, P. Costa-Nunes, O.Pontes, C.S. Pikaard, Mechanisms of HDA6-mediated rRNA gene silencing: sup-pression of intergenic Pol II transcription and differential effects on maintenanceversus siRNA-directed cytosine methylation, Genes Dev. 24 (2010) 1119–1132.

[21] M.L. Ebbs, L. Bartee, J. Bender, H3 lysine 9 methylation is maintained on a tran-scribed inverted repeat by combined action of SUVH6 and SUVH4 methyltransfer-ases, Mol. Cell. Biol. 25 (2005) 10507–10515.

[22] M.L. Ebbs, J. Bender, Locus-specific control of DNA methylation by the ArabidopsisSUVH5 histone methyltransferase, Plant Cell 18 (2006) 1166–1176.

[23] M. El-Shami, D. Pontier, S. Lahmy, L. Braun, C. Picart, D. Vega, M.A. Hakimi, S.E.Jacobsen, R. Cooke, T. Lagrange, Reiterated WG/GW motifs form functionally andevolutionarily conserved ARGONAUTE-binding platforms in RNAi-related compo-nents, Genes Dev. 21 (2007) 2539–2544.

[24] E. Elvira-Matelot, M. Hachet, N. Shamandi, P. Comella, J. Saez-Vasquez, M. Zytnicki,H. Vaucheret, Arabidopsis RNASE THREE LIKE2 modulates the expression ofprotein-coding genes via 24-nucleotide small interfering RNA-directed DNAmeth-ylation, Plant Cell 28 (2016) 406–425.

[25] C. Eun, Z.J. Lorkovic, U. Naumann, Q. Long, E.R. Havecker, S.A. Simon, B.C. Meyers, A.J.Matzke, M. Matzke, AGO6 functions in RNA-mediated transcriptional gene silencingin shoot and root meristems in Arabidopsis thaliana, PLoS One 6 (2011), e25730.

[26] E.J. Finnegan, E.S. Dennis, Isolation and identification by sequence homology of aputative cytosine methyltransferase from Arabidopsis thaliana, Nucleic Acids Res.21 (1993) 2383–2388.

[27] Z. Gao, H.L. Liu, L. Daxinger, O. Pontes, X. He, W. Qian, H. Lin, M. Xie, Z.J. Lorkovic, S.Zhang, et al., An RNA polymerase II- and AGO4-associated protein acts in RNA-directed DNA methylation, Nature 465 (2010) 106–109.

[28] J.R. Haag, B. Brower-Toland, E.K. Krieger, L. Sidorenko, C.D. Nicora, A.D. Norbeck, A.Irsigler, H. LaRue, J. Brzeski, K. McGinnis, et al., Functional diversification of maizeRNA polymerase IV and V subtypes via alternative catalytic subunits, Cell Rep. 9(2014) 378–390.

[29] J.R. Haag, C.S. Pikaard, Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing, Nat. Rev. Mol. Cell Biol. 12 (2011) 483–492.

[30] J.R. Haag, T.S. Ream, M. Marasco, C.D. Nicora, A.D. Norbeck, L. Pasa-Tolic, C.S.Pikaard, In vitro transcription activities of Pol IV, Pol V, and RDR2 reveal couplingof Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing, Mol. Cell 48(2012) 811–818.

[31] E.R. Havecker, L.M. Wallbridge, T.J. Hardcastle, M.S. Bush, K.A. Kelly, R.M. Dunn, F.Schwach, J.H. Doonan, D.C. Baulcombe, The Arabidopsis RNA-directed DNAmethyl-ation argonautes functionally diverge based on their expression and interactionwith target loci, Plant Cell 22 (2010) 321–334.

[32] X.J. He, T. Chen, J.K. Zhu, Regulation and function of DNAmethylation in plants andanimals, Cell Res. 21 (2011) 442–465.

[33] X.J. He, Y.F. Hsu, O. Pontes, J. Zhu, J. Lu, R.A. Bressan, C. Pikaard, C.S. Wang, J.K. Zhu,NRPD4, a protein related to the RPB4 subunit of RNA polymerase II, is a componentof RNA polymerases IV and V and is required for RNA-directed DNA methylation,Genes Dev. 23 (2009) 318–330.

[34] X.J. He, Y.F. Hsu, S. Zhu, A.T. Wierzbicki, O. Pontes, C.S. Pikaard, H.L. Liu, C.S. Wang,H. Jin, J.K. Zhu, An effector of RNA-directed DNA methylation in Arabidopsis is anARGONAUTE 4- and RNA-binding protein, Cell 137 (2009) 498–508.

[35] A.J. Herr, M.B. Jensen, T. Dalmay, D.C. Baulcombe, RNA polymerase IV directs silenc-ing of endogenous DNA, Science 308 (2005) 118–120.

[36] S. Hocine, R.H. Singer, D. Grunwald, RNA processing and export, Cold Spring Harb.Perspect. Biol. 2 (2010) a000752.

[37] D. Holoch, D. Moazed, RNA-mediated epigenetic regulation of gene expression,Nat. Rev. Genet. 16 (2015) 71–84.

[38] J.P. Hsin, J.L. Manley, The RNA polymerase II CTD coordinates transcription andRNA processing, Genes Dev. 26 (2012) 2119–2137.

[39] L. Huang, A.M. Jones, I. Searle, K. Patel, H. Vogler, N.C. Hubner, D.C. Baulcombe, Anatypical RNA polymerase involved in RNA silencing shares small subunits withRNA polymerase II, Nat. Struct. Mol. Biol. 16 (2009) 91–93.

[40] Y. Huang, T. Kendall, E.S. Forsythe, A. Dorantes-Acosta, S. Li, J. Caballero-Perez, X.Chen, M. Arteaga-Vazquez, M.A. Beilstein, R.A. Mosher, Ancient origin and recentinnovations of RNA polymerase IV and V, Mol. Biol. Evol. 32 (2015) 1788–1799.

[41] J.P. Jackson, L. Johnson, Z. Jasencakova, X. Zhang, L. PerezBurgos, P.B. Singh, X.Cheng, I. Schubert, T. Jenuwein, S.E. Jacobsen, Dimethylation of histone H3 lysine9 is a critical mark for DNA methylation and gene silencing in Arabidopsis thaliana,Chromosoma 112 (2004) 308–315.

[42] J.P. Jackson, A.M. Lindroth, X. Cao, S.E. Jacobsen, Control of CpNpG DNA methyla-tion by the KRYPTONITE histone H3 methyltransferase, Nature 416 (2002)556–560.


[43] R. Jain, N. Iglesias, D. Moazed, Distinct functions of argonaute slicer in siRNAmaturation and heterochromatin formation, Mol. Cell (2016).

[44] Y. Jing, H. Sun, W. Yuan, Y. Wang, Q. Li, Y. Liu, Y. Li, W. Qian, SUVH2 and SUVH9couple two essential steps for transcriptional gene silencing in Arabidopsis, Mol.Plant (2016).

[45] L. Johnson, X. Cao, S. Jacobsen, Interplay between two epigeneticmarks. DNAmeth-ylation and histone H3 lysine 9 methylation, Curr. Biol. 12 (2002) 1360–1367.

[46] L.M. Johnson, M. Bostick, X. Zhang, E. Kraft, I. Henderson, J. Callis, S.E. Jacobsen, TheSRA methyl-cytosine-binding domain links DNA and histone methylation, Curr.Biol. 17 (2007) 379–384.

[47] L.M. Johnson, J. Du, C.J. Hale, S. Bischof, S. Feng, R.K. Chodavarapu, X. Zhong, G.Marson, M. Pellegrini, D.J. Segal, et al., SRA- and SET-domain-containing proteinslink RNA polymerase V occupancy to DNAmethylation, Nature 507 (2014) 124–128.

[48] L.M. Johnson, J.A. Law, A. Khattar, I.R. Henderson, S.E. Jacobsen, SRA-domainproteins required for DRM2-mediated de novo DNA methylation, PLoS Genet. 4(2008), e1000280.

[49] T. Kanno,W. Aufsatz, E. Jaligot, M.F. Mette, M. Matzke, A.J. Matzke, A SNF2-like pro-tein facilitates dynamic control of DNAmethylation, EMBO Rep. 6 (2005) 649–655.

[50] T. Kanno, E. Bucher, L. Daxinger, B. Huettel, G. Bohmdorfer, W. Gregor, D.P. Kreil, M.Matzke, A.J. Matzke, A structural-maintenance-of-chromosomes hinge domain-containing protein is required for RNA-directed DNA methylation, Nat. Genet. 40(2008) 670–675.

[51] T. Kanno, B. Huettel, M.F. Mette, W. Aufsatz, E. Jaligot, L. Daxinger, D.P. Kreil, M.Matzke, A.J. Matzke, Atypical RNA polymerase subunits required for RNA-directed DNA methylation, Nat. Genet. 37 (2005) 761–765.

[52] K. Kollen, L. Dietz, N. Bies-Etheve, T. Lagrange, M. Grasser, K.D. Grasser, The zinc-finger protein SPT4 interacts with SPT5L/KTF1 and modulates transcriptional si-lencing in Arabidopsis, FEBS Lett. 589 (2015) 3254–3257.

[53] S. Lahmy, D. Pontier, E. Cavel, D. Vega, M. El-Shami, T. Kanno, T. Lagrange,PolV(PolIVb) function in RNA-directed DNA methylation requires the conservedactive site and an additional plant-specific subunit, Proc. Natl. Acad. Sci. U. S. A.106 (2009) 941–946.

[54] H. Lange, S. Holec, V. Cognat, L. Pieuchot, M. Le Ret, J. Canaday, D. Gagliardi, Degra-dation of a polyadenylated rRNA maturation by-product involves one of the threeRRP6-like proteins in Arabidopsis thaliana, Mol. Cell. Biol. 28 (2008) 3038–3044.

[55] J.A. Law, I. Ausin, L.M. Johnson, A.A. Vashisht, J.K. Zhu, J.A. Wohlschlegel, S.E.Jacobsen, A protein complex required for polymerase V transcripts and RNA- di-rected DNA methylation in Arabidopsis, Curr. Biol. 20 (2010) 951–956.

[56] J.A. Law, J. Du, C.J. Hale, S. Feng, K. Krajewski, A.M. Palanca, B.D. Strahl, D.J. Patel, S.E.Jacobsen, Polymerase IV occupancy at RNA-directed DNA methylation sites re-quires SHH1, Nature 498 (2013) 385–389.

[57] J.A. Law, S.E. Jacobsen, Establishing, maintaining and modifying DNA methylationpatterns in plants and animals, Nat. Rev. Genet. 11 (2010) 204–220.

[58] J.A. Law, A.A. Vashisht, J.A. Wohlschlegel, S.E. Jacobsen, SHH1, a homeodomain pro-tein required for DNAmethylation, as well as RDR2, RDM4, and chromatin remod-eling factors, associate with RNA polymerase IV, PLoS Genet. 7 (2011), e1002195.

[59] J. Li, Z. Yang, B. Yu, J. Liu, X. Chen, Methylation protects miRNAs and siRNAs from a3′-end uridylation activity in Arabidopsis, Curr. Biol. 15 (2005) 1501–1507.

[60] S. Li, L.E. Vandivier, B. Tu, L. Gao, S.Y. Won, S. Li, B. Zheng, B.D. Gregory, X. Chen, De-tection of Pol IV/RDR2-dependent transcripts at the genomic scale inArabidopsis re-veals features and regulation of siRNA biogenesis, Genome Res. 25 (2015) 235–245.

[61] Z.W. Liu, C.R. Shao, C.J. Zhang, J.X. Zhou, S.W. Zhang, L. Li, S. Chen, H.W. Huang, T.Cai, X.J. He, The SET domain proteins SUVH2 and SUVH9 are required for Pol V oc-cupancy at RNA-directed DNA methylation loci, PLoS Genet. 10 (2014), e1003948.

[62] Z.W. Liu, J.X. Zhou, H.W. Huang, Y.Q. Li, C.R. Shao, L. Li, T. Cai, S. Chen, X.J. He, Twocomponents of the RNA-directed DNA methylation pathway associate withMORC6 and silence loci targeted by MORC6 in Arabidopsis, PLoS Genet. 12(2016), e1006026.

[63] Z.J. Lorkovic, U. Naumann, A.J. Matzke, M. Matzke, Involvement of a GHKL ATPasein RNA-directed DNA methylation in Arabidopsis thaliana, Curr. Biol. 22 (2012)933–938.

[64] J. Luo, B.D. Hall, A multistep process gave rise to RNA polymerase IV of land plants,J. Mol. Evol. 64 (2007) 101–112.

[65] F.W. Martinez-Rucobo, R. Kohler, M. van deWaterbeemd, A.J. Heck, M. Hemann, F.Herzog, H. Stark, P. Cramer, Molecular basis of transcription-coupled pre-mRNAcapping, Mol. Cell 58 (2015) 1079–1089.

[66] M.A. Matzke, R.A. Mosher, RNA-directed DNA methylation: an epigenetic pathwayof increasing complexity, Nat. Rev. Genet. 15 (2014) 394–408.

[67] A.D. McCue, K. Panda, S. Nuthikattu, S.G. Choudury, E.N. Thomas, R.K. Slotkin,ARGONAUTE 6 bridges transposable element mRNA-derived siRNAs to the estab-lishment of DNA methylation, EMBO J. 34 (2015) 20–35.

[68] Mishra V. and Pikaard C.S., unpublished.[69] P. Mourrain, C. Beclin, T. Elmayan, F. Feuerbach, C. Godon, J.B. Morel, D. Jouette,

A.M. Lacombe, S. Nikic, N. Picault, et al., Arabidopsis SGS2 and SGS3 genes arerequired for posttranscriptional gene silencing and natural virus resistance, Cell101 (2000) 533–542.

[70] C. Notredame, D.G. Higgins, J. Heringa, T-coffee: a novel method for fast andaccurate multiple sequence alignment, J. Mol. Biol. 302 (2000) 205–217.

[71] S. Nuthikattu, A.D. McCue, K. Panda, D. Fultz, C. DeFraia, E.N. Thomas, R.K. Slotkin,The initiation of epigenetic silencing of active transposable elements is triggeredby RDR6 and 21–22 nucleotide small interfering RNAs, Plant Physiol. 162 (2013)116–131.

[72] V. Olmedo-Monfil, N. Duran-Figueroa, M. Arteaga-Vazquez, E. Demesa-Arevalo, D.Autran, D. Grimanelli, R.K. Slotkin, R.A. Martienssen, J.P. Vielle-Calzada, Control offemale gamete formation by a small RNA pathway in Arabidopsis, Nature 464(2010) 628–632.
















































































































































































[73] Y. Onodera, J.R. Haag, T. Ream, P. Costa Nunes, O. Pontes, C.S. Pikaard, Plant nuclearRNA polymerase IV mediates siRNA and DNA methylation-dependent heterochro-matin formation, Cell 120 (2005) 613–622.

[74] K. Panda, R.K. Slotkin, Proposed mechanism for the initiation of transposableelement silencing by the RDR6-directed DNA methylation pathway, Plant Signal.Behav. 8 (2013).

[75] E. Pearson, C. Moore, The evolutionarily conserved Pol II flap loop contributes toproper transcription termination on short yeast genes, Cell Rep. 9 (2014) 821–828.

[76] C.S. Pikaard, J.R. Haag, O.M. Pontes, T. Blevins, R. Cocklin, A transcription forkmodelfor Pol IV and Pol V-dependent RNA-directed DNA methylation, Cold Spring Harb.Symp. Quant. Biol. (2013).

[77] O. Pontes, C.F. Li, P. Costa Nunes, J. Haag, T. Ream, A. Vitins, S.E. Jacobsen, C.S.Pikaard, The Arabidopsis chromatin-modifying nuclear siRNA pathway involves anucleolar RNA processing center, Cell 126 (2006) 79–92.

[78] D. Pontier, C. Picart, F. Roudier, D. Garcia, S. Lahmy, J. Azevedo, E. Alart, M. Laudie,W.M. Karlowski, R. Cooke, et al., NERD, a plant-specific GW protein, defines an ad-ditional RNAi-dependent chromatin-based pathway in Arabidopsis, Mol. Cell 48(2012) 121–132.

[79] D. Pontier, G. Yahubyan, D. Vega, A. Bulski, J. Saez-Vasquez, M.A. Hakimi, S. Lerbs-Mache, V. Colot, T. Lagrange, Reinforcement of silencing at transposons and highlyrepeated sequences requires the concerted action of two distinct RNA polymerasesIV in Arabidopsis, Genes Dev. 19 (2005) 2030–2040.

[80] Y. Qi, X. He, X.J. Wang, O. Kohany, J. Jurka, G.J. Hannon, Distinct catalytic and non-catalytic roles of ARGONAUTE4 in RNA-directed DNA methylation, Nature 443(2006) 1008–1012.

[81] T.S. Ream, J.R. Haag, A.T. Wierzbicki, C.D. Nicora, A.D. Norbeck, J.K. Zhu, G. Hagen,T.J. Guilfoyle, L. Pasa-Tolic, C.S. Pikaard, Subunit compositions of the RNA-silencing enzymes Pol IV and Pol V reveal their origins as specialized forms ofRNA polymerase II, Mol. Cell 33 (2009) 192–203.

[82] M.J. Ronemus, M. Galbiati, C. Ticknor, J. Chen, S.L. Dellaporta, Demethylation-induced developmental pleiotropy in Arabidopsis, Science 273 (1996) 654–657.

[83] M.J. Rowley, M.I. Avrutsky, C.J. Sifuentes, L. Pereira, A.T. Wierzbicki, Independentchromatin binding of ARGONAUTE4 and SPT5L/KTF1 mediates transcriptionalgene silencing, PLoS Genet. 7 (2011), e1002120.

[84] I.R. Searle, O. Pontes, C.W. Melnyk, L.M. Smith, D.C. Baulcombe, JMJ14, a JmjCdomain protein, is required for RNA silencing and cell-to-cell movement of anRNA silencing signal in Arabidopsis, Genes Dev. 24 (2010) 986–991.

[85] M.J. Sigman, R.K. Slotkin, The first rule of plant transposable element silencing:location, location, location, Plant Cell 28 (2016) 304–313.

[86] W.J. Soppe, Z. Jasencakova, A. Houben, T. Kakutani, A. Meister, M.S. Huang, S.E.Jacobsen, I. Schubert, P.F. Fransz, DNA methylation controls histone H3 lysine 9methylation and heterochromatin assembly in Arabidopsis, EMBO J. 21 (2002)6549–6559.

[87] H. Stroud, T. Do, J. Du, X. Zhong, S. Feng, L. Johnson, D.J. Patel, S.E. Jacobsen, Non-CGmethylation patterns shape the epigenetic landscape in Arabidopsis, Nat. Struct.Mol. Biol. 21 (2014) 64–72.

[88] M.H. Suh, P.A. Meyer, M. Gu, P. Ye, M. Zhang, C.D. Kaplan, C.D. Lima, J. Fu, A dualinterface determines the recognition of RNA polymerase II by RNA cappingenzyme, J. Biol. Chem. 285 (2010) 34027–34038.

[89] J.T. Trujillo, M.A. Beilstein, R.A. Mosher, The Argonaute-binding platform of NRPE1evolves through modulation of intrinsically disordered repeats, New Phytol.(2016).

[90] T. Volpe, R.A. Martienssen, RNA interference and heterochromatin assembly, ColdSpring Harb. Perspect. Biol. 3 (2011) a003731.

[91] W. Wei, Z. Ba, M. Gao, Y. Wu, Y. Ma, S. Amiard, C.I. White, J.M. Rendtlew Danielsen,Y.G. Yang, Y. Qi, A role for small RNAs in DNA double-strand break repair, Cell 149(2012) 101–112.

[92] A.T. Wierzbicki, R. Cocklin, A. Mayampurath, R. Lister, M.J. Rowley, B.D. Gregory, J.R.Ecker, H. Tang, C.S. Pikaard, Spatial and functional relationships among Pol


V-associated loci, Pol IV-dependent siRNAs, and cytosine methylation in theArabidopsis epigenome, Genes Dev. 26 (2012) 1825–1836.

[93] A.T.Wierzbicki, J.R. Haag, C.S. Pikaard, Noncoding transcription by RNA polymerasePol IVb/Pol V mediates transcriptional silencing of overlapping and adjacent genes,Cell 135 (2008) 635–648.

[94] A.T. Wierzbicki, T.S. Ream, J.R. Haag, C.S. Pikaard, RNA polymerase V transcriptionguides ARGONAUTE4 to chromatin, Nat. Genet. 41 (2009) 630–634.

[95] M. Xie, G. Ren, P. Costa-Nunes, O. Pontes, B. Yu, A subgroup of SGS3-like proteinsact redundantly in RNA-directed DNA methylation, Nucleic Acids Res. 40 (2012)4422–4431.

[96] M. Xie, G. Ren, C. Zhang, B. Yu, The DNA- and RNA-binding protein factor of DNAmETHYLATION 1 requires XH domain-mediated complex formation for its functionin RNA-directed DNA methylation, Plant J. 72 (2012) 491–500.

[97] Z. Xie, L.K. Johansen, A.M. Gustafson, K.D. Kasschau, A.D. Lellis, D. Zilberman, S.E.Jacobsen, J.C. Carrington, Genetic and functional diversification of small RNA path-ways in plants, PLoS Biol. 2 (2004), E104.

[98] D.L. Yang, G. Zhang, K. Tang, J. Li, L. Yang, H. Huang, H. Zhang, J.K. Zhu, Dicer-independent RNA-directed DNA methylation in Arabidopsis, Cell Res. 26 (2016)66–82.

[99] R. Ye, Z. Chen, B. Lian, M.J. Rowley, N. Xia, J. Chai, Y. Li, X.J. He, A.T. Wierzbicki, Y. Qi,A dicer-independent route for biogenesis of siRNAs that direct DNAmethylation inArabidopsis, Mol. Cell 61 (2016) 222–235.

[100] A. Zemach, M.Y. Kim, P.H. Hsieh, D. Coleman-Derr, L. Eshed-Williams, K. Thao, S.L.Harmer, D. Zilberman, The Arabidopsis nucleosome remodeler DDM1 allows DNAmethyltransferases to access H1-containing heterochromatin, Cell 153 (2013)193–205.

[101] J. Zhai, S. Bischof, H. Wang, S. Feng, T.F. Lee, C. Teng, X. Chen, S.Y. Park, L. Liu, J.Gallego-Bartolome, et al., A one precursor one siRNA model for Pol IV-dependentsiRNA biogenesis, Cell 163 (2015) 445–455.

[102] C.J. Zhang, Y.Q. Ning, S.W. Zhang, Q. Chen, C.R. Shao, Y.W. Guo, J.X. Zhou, L. Li, S.Chen, X.J. He, IDN2 and its paralogs form a complex required for RNA-directedDNA methylation, PLoS Genet. 8 (2012), e1002693.

[103] H. Zhang, Z.Y. Ma, L. Zeng, K. Tanaka, C.J. Zhang, J. Ma, G. Bai, P. Wang, S.W. Zhang,Z.W. Liu, et al., DTF1 is a core component of RNA-directed DNA methylation andmay assist in the recruitment of Pol IV, Proc. Natl. Acad. Sci. U. S. A. 110 (2013)8290–8295.

[104] H. Zhang, K. Tang, W. Qian, C.G. Duan, B. Wang, H. Zhang, P. Wang, X. Zhu, Z. Lang,Y. Yang, et al., An Rrp6-like protein positively regulates noncoding RNA levels andDNA methylation in Arabidopsis, Mol. Cell 54 (2014) 418–430.

[105] Q. Zheng, M.J. Rowley, G. Bohmdorfer, D. Sandhu, B.D. Gregory, A.T. Wierzbicki,RNA polymerase V targets transcriptional silencing components to promoters ofprotein-coding genes, Plant J. 73 (2013) 179–189.

[106] X. Zheng, J. Zhu, A. Kapoor, J.K. Zhu, Role of Arabidopsis AGO6 in siRNA accumula-tion, DNA methylation and transcriptional gene silencing, EMBO J. 26 (2007)1691–1701.

[107] Z. Zheng, Y. Xing, X.J. He, W. Li, Y. Hu, S.K. Yadav, J. Oh, J.K. Zhu, An SGS3-like pro-tein functions in RNA-directed DNAmethylation and transcriptional gene silencingin Arabidopsis, Plant J. 62 (2010) 92–99.

[108] X. Zhong, J. Du, C.J. Hale, J. Gallego-Bartolome, S. Feng, A.A. Vashisht, J. Chory, J.A.Wohlschlegel, D.J. Patel, S.E. Jacobsen, Molecular mechanism of action of plantDRM de novo DNA methyltransferases, Cell 157 (2014) 1050–1060.

[109] X. Zhong, C.J. Hale, J.A. Law, L.M. Johnson, S. Feng, A. Tu, S.E. Jacobsen, DDR complexfacilitates global association of RNA polymerase V to promoters and evolutionarilyyoung transposons, Nat. Struct. Mol. Biol. 19 (2012) 870–875.

[110] Y. Zhu, M.J. Rowley, G. Bohmdorfer, A.T. Wierzbicki, A SWI/SNF chromatin-remodeling complex acts in noncoding RNA-mediated transcriptional silencing,Mol. Cell 49 (2013) 298–309.

[111] D. Zilberman, X. Cao, S.E. Jacobsen, ARGONAUTE4 control of locus-specific siRNAaccumulation and DNA and histone methylation, Science 299 (2003) 716–719.


























































































































Biochimica et Biophysica Actapikweb/reprints.s/Wendte and PIkaard... · Review The RNAs of...

Documents

Transcript of Biochimica et Biophysica Actapikweb/reprints.s/Wendte and PIkaard... · Review The RNAs of...