“The best way to find yourself is to lose yourself in the service of...

“The best way to find yourself is to lose yourself in the service of others”

“Happiness is when what you think, what you say, and what you do are in

harmony”

“The weak can never forgive; forgiveness is the attribute of the strong”

…Mahatma Gandhi…Mahatma Gandhi…Mahatma Gandhi…Mahatma Gandhi

From the desk of Hon’ble the Acting Chief Justice Shree Subhro Kamal Mukherjee

Growing workload volume and new problems may have overwhelmed Courts that have historically

had successful programs. Court systems require effective leadership and management practices to respond to

important issues, such as, public trust and confidence, Court and community collaboration, and timeliness and

consistency. The demand for increased services from Courts, along with proper strategic planning and team

building, can be more easily forecasted and implemented when sound leadership, planning, and

organizational change management are in place.

Technology offers Courts crucial commodity Information that can help Judicial System make better and

quicker decisions, communicate with partner agencies (Prosecutors, Counsels, Service Agencies) and track

case outcomes, by building state-of-the-art computer applications.

I welcome Information Technology (IT) as a means to improve the administration of justice, for its contribution

to the improvement of access to justice, case-management and for its central role in providing information to

Judges, lawyers and other stakeholders in the justice delivery system as well as to the public.

We often look back at advances made in the past and project forward from them, presuming that new

advances will occur at the same rate. But, our belief that computers advance at this linear rate is wrong; in

fact, they are advancing exponentially. As we ride this exponential curve, we cannot perceive that our

exponential rate of technological advance in the next five years will by far outstrip that of our past five years--

even in our Courts, which may not grasp just how fast computer technology is advancing. This rapid advance is

likely to continue prompting Courts to adopt new technologies to meet the public's growing expectations for

increased efficiency and accessibility.

I encourage the use of all aspects of IT to promote the important role of the Judiciary in guaranteeing the rule

of law in a democratic state; advantages in the use of IT, in terms of efficiency, speed and cost, access to legal

information and as service to citizens.

eeee----NewsletterNewsletterNewsletterNewsletter Volume IIVolume IIVolume IIVolume II PagePagePagePage 1

High Court of KarnatakaHigh Court of KarnatakaHigh Court of KarnatakaHigh Court of Karnataka

IIIIIIIInnnnnnnn tttttttthhhhhhhheeeeeeee nnnnnnnneeeeeeeewwwwwwwwssssssss

TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg &&&&&&&& IIIIIIIInnnnnnnndddddddduuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn PPPPPPPPrrrrrrrrooooooooggggggggrrrrrrrraaaaaaaammmmmmmmmmmmmmmmeeeeeeee ffffffffoooooooorrrrrrrr nnnnnnnneeeeeeeewwwwwwwwllllllllyyyyyyyy aaaaaaaappppppppppppppppooooooooiiiiiiiinnnnnnnntttttttteeeeeeeedddddddd SSSSSSSSooooooooffffffffttttttttwwwwwwwwaaaaaaaarrrrrrrreeeeeeee TTTTTTTTeeeeeeeecccccccchhhhhhhhnnnnnnnniiiiiiiicccccccciiiiiiiiaaaaaaaannnnnnnnssssssss iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee SSSSSSSSttttttttaaaaaaaatttttttteeeeeeee

FFFFFFFFeeeeeeeeeeeeeeeeddddddddbbbbbbbbaaaaaaaacccccccckkkkkkkk TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg PPPPPPPPrrrrrrrrooooooooggggggggrrrrrrrraaaaaaaammmmmmmmmmmmmmmmeeeeeeee ffffffffoooooooorrrrrrrr MMMMMMMMaaaaaaaasssssssstttttttteeeeeeeerrrrrrrrssssssss TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnneeeeeeeerrrrrrrrssssssss oooooooonnnnnnnn UUUUUUUUBBBBBBBBUUUUUUUUNNNNNNNNTTTTTTTTUUUUUUUU////////CCCCCCCCIIIIIIIISSSSSSSS

CCCCCCCChhhhhhhhiiiiiiiieeeeeeeeffffffff JJJJJJJJuuuuuuuussssssssttttttttiiiiiiiicccccccceeeeeeee ooooooooffffffff NNNNNNNNeeeeeeeeppppppppaaaaaaaallllllll vvvvvvvviiiiiiiissssssssiiiiiiiitttttttteeeeeeeedddddddd tttttttthhhhhhhheeeeeeee HHHHHHHHiiiiiiiigggggggghhhhhhhh CCCCCCCCoooooooouuuuuuuurrrrrrrrtttttttt ooooooooffffffff KKKKKKKKaaaaaaaarrrrrrrrnnnnnnnnaaaaaaaattttttttaaaaaaaakkkkkkkkaaaaaaaa aaaaaaaannnnnnnndddddddd tttttttthhhhhhhheeeeeeee CCCCCCCCoooooooommmmmmmmppppppppuuuuuuuutttttttteeeeeeeerrrrrrrr BBBBBBBBrrrrrrrraaaaaaaannnnnnnncccccccchhhhhhhh

CCCCCCCCrrrrrrrreeeeeeeeaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff TTTTTTTTeeeeeeeelllllllleeeeeeeepppppppphhhhhhhhoooooooonnnnnnnneeeeeeee DDDDDDDDiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttoooooooorrrrrrrryyyyyyyy

AAAAAAAA WWWWWWWWeeeeeeeebbbbbbbb--------bbbbbbbbaaaaaaaasssssssseeeeeeeedddddddd AAAAAAAApppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee CCCCCCCCoooooooommmmmmmmppppppppuuuuuuuutttttttteeeeeeeerrrrrrrr TTTTTTTTyyyyyyyyppppppppiiiiiiiinnnnnnnngggggggg TTTTTTTTeeeeeeeesssssssstttttttt

FFFFFFFFuuuuuuuurrrrrrrrtttttttthhhhhhhheeeeeeeerrrrrrrr DDDDDDDDeeeeeeeevvvvvvvveeeeeeeellllllllooooooooppppppppmmmmmmmmeeeeeeeennnnnnnnttttttttssssssss oooooooonnnnnnnn PPPPPPPPoooooooolllllllliiiiiiiicccccccceeeeeeee &&&&&&&& TTTTTTTTrrrrrrrraaaaaaaaffffffffffffffffiiiiiiiicccccccc IIIIIIIITTTTTTTT IIIIIIIInnnnnnnntttttttteeeeeeeeggggggggrrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn wwwwwwwwiiiiiiiitttttttthhhhhhhh CCCCCCCCIIIIIIIISSSSSSSS

VVVVVVVViiiiiiiiddddddddeeeeeeeeoooooooo CCCCCCCCoooooooonnnnnnnnffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnncccccccceeeeeeee FFFFFFFFaaaaaaaacccccccciiiiiiiilllllllliiiiiiiittttttttyyyyyyyy ttttttttoooooooo aaaaaaaallllllllllllllll CCCCCCCCoooooooouuuuuuuurrrrrrrrttttttttssssssss aaaaaaaannnnnnnndddddddd JJJJJJJJaaaaaaaaiiiiiiiillllllllssssssss iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee SSSSSSSSttttttttaaaaaaaatttttttteeeeeeee

OOOOOOOOnnnnnnnnlllllllliiiiiiiinnnnnnnneeeeeeee RRRRRRRReeeeeeeeccccccccrrrrrrrruuuuuuuuiiiiiiiittttttttmmmmmmmmeeeeeeeennnnnnnntttttttt iiiiiiiinnnnnnnn DDDDDDDDiiiiiiiissssssssttttttttrrrrrrrriiiiiiiicccccccctttttttt CCCCCCCCoooooooouuuuuuuurrrrrrrrtttttttt KKKKKKKKaaaaaaaallllllllaaaaaaaabbbbbbbbuuuuuuuurrrrrrrraaaaaaaaggggggggiiiiiiii

Knowledge is power. Information is liberating. Education is the premise of progress, in every society, in every family.

In vain have you acquired knowledge if you have not imparted it to others, share your knowledge; it’s a way to achieve immortality.

TrainingTrainingTrainingTraining and Induction and Induction and Induction and Induction Programme Programme Programme Programme for newly appointed for newly appointed for newly appointed for newly appointed Software Software Software Software Technicians in the StateTechnicians in the StateTechnicians in the StateTechnicians in the State

Three days Training and Induction Programme for 25 newly appointed Software Technicians was conducted on 23rd 24th & 25th of March 2015 in Karnataka Judicial Academy, inaugurated by Hon’ble Shri Justice Ram Mohan Reddy. In his address to the trainees, he said that the first and foremost attribute of a successful Software Technician is Honesty and Integrity, then comes Domain Knowledge, Timely Responsiveness, Application of Mind, Discipline & Punctuality. He stressed the importance of Constant & Continuous Learning, keeping abreast with latest developments in related fields, Periodical Training Programmes, Updating Sessions.

Smt.Manjula, imparting training on CIS to 25 newly

appointed Software Technicians in the state

Further his lordship stressed the need for inculcating the four Course behaviour namely 1. Decide & Act, 2. Connect & Collaborate, 3. Innovate & Improve and 4. Grow & Engage. The Modules covered in the training included Structure of Courts and Indian Judiciary, Courts in Karnataka, Functions of the Courts, General Procedures in all branches of the Courts, functions of Judicial Officers, Technical aspects included Operating System, Case Information System (CIS), National Judicial Data Grid (NJDG)

Undated Cases, Uploading of Cases. Central Project Coordinator (CPC), System Administrator, and all the existing Software Technicians were part of the 3 days programme. Expert Trainers from

Software Technicians in Training Session in Karnataka Judicial Academy

NIC, who assumed an active role in the session, were Shri. Subramanian Sr.Tecnical Director NIC, Bengaluru, Shri. Nagaraj Prl. System Analyst, NIC, Bengaluru. Training Programme culminated with a Valedictory function which was addressed by Hon’ble Shri Justice Ram Mohan Reddy and Hon’ble Shri Justice Aravind Kumar.

The trainees visited Complexes of City Civil Court, CMM Court and Mayo Hall Court for practical know how of functioning of Courts and IT Systems

Feedback TraininFeedback TraininFeedback TraininFeedback Training Prograg Prograg Prograg Programme for mme for mme for mme for Masters Trainers on Masters Trainers on Masters Trainers on Masters Trainers on UBUNTUUBUNTUUBUNTUUBUNTU/CIS/CIS/CIS/CIS

There was a Feedback Training Programme for 22 Masters Trainers on UBUNTU/CIS, conducted on 02nd and 03rd April 2015, in the Karnataka Judicial Academy, inaugurated by Hon’ble Shri Justice Ram Mohan Reddy, to prepare Training Modules for imparting training sessions to all the Judicial Officers and Staff in the State.

Master Trainers having undergone exhaustive Training Programme in Chennai Judicial Academy on UBUNTU UBUNTU UBUNTU UBUNTU 14.0414.0414.0414.04 (Latest Version Operating System) and on CISCISCISCIS, conducted one day Refresher Course on UBUNTU/CIS in all District Head Quarters for all the Judicial Officers in the respective District Units., whence 200 Judicial officers actively participated, out of whom, capable and interested were identified and a list prepared.




IIIIIIIInnnnnnnnaaaaaaaauuuuuuuugggggggguuuuuuuurrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff IIIIIIIInnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn KKKKKKKKIIIIIIIIOOOOOOOOSSSSSSSSKKKKKKKK iiiiiiiinnnnnnnn MMMMMMMMaaaaaaaayyyyyyyyoooooooo--------HHHHHHHHaaaaaaaallllllllllllllll CCCCCCCCoooooooouuuuuuuurrrrrrrrtttttttt uuuuuuuunnnnnnnniiiiiiiitttttttt,,,,,,,, BBBBBBBBeeeeeeeennnnnnnnggggggggaaaaaaaalllllllluuuuuuuurrrrrrrruuuuuuuu

IIIIIIIInnnnnnnnaaaaaaaauuuuuuuugggggggguuuuuuuurrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff MMMMMMMMuuuuuuuullllllllttttttttiiiiiiii PPPPPPPPooooooooiiiiiiiinnnnnnnntttttttt HHHHHHHHiiiiiiiigggggggghhhhhhhh DDDDDDDDeeeeeeeeffffffffiiiiiiiinnnnnnnniiiiiiiittttttttiiiiiiiioooooooonnnnnnnn VVVVVVVViiiiiiiiddddddddeeeeeeeeoooooooo CCCCCCCCoooooooonnnnnnnnffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnncccccccceeeeeeee FFFFFFFFaaaaaaaacccccccciiiiiiiilllllllliiiiiiiittttttttyyyyyyyy bbbbbbbbeeeeeeeettttttttwwwwwwwweeeeeeeeeeeeeeeennnnnnnn CCCCCCCCoooooooouuuuuuuurrrrrrrrttttttttssssssss &&&&&&&& JJJJJJJJaaaaaaaaiiiiiiiillllllllssssssss

PPPPPPPPrrrrrrrrooooooooppppppppoooooooosssssssseeeeeeeedddddddd TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg SSSSSSSScccccccchhhhhhhheeeeeeeedddddddduuuuuuuulllllllleeeeeeee oooooooonnnnnnnn UUUUUUUUbbbbbbbbuuuuuuuunnnnnnnnttttttttuuuuuuuu--------LLLLLLLLiiiiiiiinnnnnnnnuuuuuuuuxxxxxxxx 1111111144444444........0000000044444444 vvvvvvvveeeeeeeerrrrrrrrssssssssiiiiiiiioooooooonnnnnnnn ttttttttoooooooo JJJJJJJJuuuuuuuuddddddddiiiiiiiicccccccciiiiiiiiaaaaaaaallllllll OOOOOOOOffffffffffffffffiiiiiiiicccccccceeeeeeeerrrrrrrrssssssss aaaaaaaaccccccccrrrrrrrroooooooossssssssssssssss tttttttthhhhhhhheeeeeeee SSSSSSSSttttttttaaaaaaaatttttttteeeeeeee






22 Master Trainer Judicial Officers in the State

The Hon’ble Chairman, Committee for Computerisation recommended that an exhaustive Training Programme, with the attributes of Training and on particular Subjects especially on UBUNTU/CIS be extended to Judicial Officers to be trained as Master Trainers.

Training helps employees to get a clear view of their job.

Central Project Co-ordinator Shri T G

Shivashankaregowda imparting training

Training is a performance development process to foster learning new techniques and methods to perform duties with fullest efficiency and effectiveness. Out of four major stages of the training cycle: Viz; Identifying Training Needs, Plan and Design Training, Delivering Training, Feedback Training (Evaluating Training Outcomes). Feedback Training though last stage is very crucial. It is a process of gathering information after the implementation of training program, which helps to design effective training program, as training is the most effective intervention of organizational development and change.

Main purposes of Training Main purposes of Training Main purposes of Training Main purposes of Training evaluationevaluationevaluationevaluation

� Improve quality of training activities.

� Feedback: on the effectiveness of the training activities.

� Enhance method of training. � Intervention: into the organizational

processes that affect training. � Improved ability of the trainers to

relate to inputs and outputs. � Better discrimination of training

activities. The two words 'information' and 'communication' are often used interchangeably, but they signify quite different things. Information is giving out; communication is getting through Computer has improved the world in just about every area you can think of. Amazing developments in communications, collaboration and efficiencies. New kind of entertainment and social media. Access to information and the ability to give a voice to people who would never have been heard.

Chief Justice of Nepal visited the High Chief Justice of Nepal visited the High Chief Justice of Nepal visited the High Chief Justice of Nepal visited the High Court of Karnataka and the Court of Karnataka and the Court of Karnataka and the Court of Karnataka and the Computer Computer Computer Computer BranchBranchBranchBranch

The Chief Justice of Nepal Shri. Ramkumar Prasad Shah along with a delegation of Registrars and IT Team, visited High Court of Karnataka and the Computer branch as a part of his Study

Hon’ble Shri Justice N.Kumar with Hon’ble Chief Justice of Nepal Shri Ram Kumar Prasad Shah

tour of Indian Judiciary, to view the latest trends in Judicial reforms, His lordship visited all branches of the High Court of Karnataka like Filing Section, Scrutiny Branch, Pending Branches, Computer Branch, Server rooms, Board Branch, Court Halls, functioning of KIOSKS, Display Boards, Websites of High Court of Karnataka and District Courts, CIS Software. New trends, development of justice delivery system and new norms for judicial reforms were discussed in the












meeting. In his Lordship’s opinion, Nepal is highly inspired by the role of India’s Judicial System in setting new norms for Judicial Reforms. CreationCreationCreationCreation of Telephone Directoryof Telephone Directoryof Telephone Directoryof Telephone Directory

Software Technicians of the Computer Branch devised an Application Software named Telephone Directory, for easy accessibility of telephone numbers of Judges, Courts, branches and departments in Courts in Karnataka, beneficial to all the Judges & Staff of the Hon’ble High Court and to the Judges & Staff across all the Courts in the State, Currently telephone numbers are in the word format file and in a telephone directory, while the application is designed to maintain telephone numbers and details online.

Screenshot of Telephone Directory

In current system telephone numbers are maintained & addition or updating the same is being done by staff members of the respective branches in an inhomogeneous manner. At times it is difficult to obtain or retrieve telephone numbers of Court or official. The Application storing all the numbers paves way for easy access to intended Court/ Official at the click of the button, without any hassle. Any Phone number can be accessed by either Town Name or Judge Name in the search box as of now, going forward it will be extended by each branch name. The said application gives access control for any new addition or changes to be made only to the designated official. Others can only access the numbers but cannot modify. A WebA WebA WebA Web----based based based based Application for the Application for the Application for the Application for the Computer Typing TestComputer Typing TestComputer Typing TestComputer Typing Test

A Typewriter is a hand operated printer;

the matter you have typed is permanent

and cannot be edited/altered. As reusable

ribbon is used it is very economical. Paper

has to be manually inserted and is possible

to create only one copy at a time. For

recruitment of Typists a typing test

software, a Web-Based Application

simulating the manual Type Writer, was

developed using tools like front end page in

PHP 5.5, database, My SQL 5.5. This was

done to conduct type writing examination

for more than 450 candidates at a time. It

is so designed that, otherwise, it could not

have been possible to conduct test for large

number of candidates at a time using

Manual Type Writer Machines.

As soon as the user logs in, he is presented with the user’s detail and a box within which typing can be done.

A Web-based Computer Typing Test – Simulating Type Writer

The typing environment is modified so as to simulate typing on a typewriter. The user can type in the box provided. After finishing he has to click on End typing test button. The start time and end time are automatically reckoned, hence manual work is reduced.

FeaturesFeaturesFeaturesFeatures

1. Candidates data will be maintained in the database

2. Calculating accuracy of the Typing Speed for 15 minutes.

3. Software can be used through Intranet and Internet

4. As typing test can be held without a physical typewriter, facilitates cost saving as also servicing is not required

5. Many candidates can take the test, at a time & the time required for conducting the test is less and hence both the institution & candidates are benefitted.

6. As the typed data is saved in database it can be retrieved at any point of time.












Further Developments on Further Developments on Further Developments on Further Developments on PolicePolicePolicePolice & & & & Traffic Traffic Traffic Traffic IT Integration IT Integration IT Integration IT Integration with CISwith CISwith CISwith CIS The integration of Case Information System (CIS) with Police IT (Data) intended to fetch FIR and related data (information) directly from the Police IT Database to the Court’s Database, Pulling of data related to FIR from Police IT server to High Court and subsequently to all District/Taluka Courts is now completed & implemented successfully in all districts.

Police IT Integration with CIS

Pulling of the Scanned Images of FIR & Charge Sheet and other documents annexed to the FIR and Charge Sheet is taken on pilot basis in districts of Mandya & Mysore, and after successful completion, the process will be replicated in all Districts in the State. Pushing CC No (Criminal Case No) to police IT from High Court Server is in progress and very soon it will also be completed. In Bangalore Traffic Courts, data related

to Plead Guilty cases is pulled from Police

(Traffic) IT Server to Central Server at High Court and subsequently pushed to

all Traffic Courts in Bangalore. Pushing

the CC No (Criminal Case No) of Traffic

Court Cases to Police (Traffic) IT from

High Court Server is in progress and will

be completed in a fortnight.

Video Conference Facility to all Video Conference Facility to all Video Conference Facility to all Video Conference Facility to all Courts and Jails in the StateCourts and Jails in the StateCourts and Jails in the StateCourts and Jails in the State

To augment the existing VC facility in 33 Criminal Courts, Video Conference Facility will be extended to all criminal Courts, connected with respective Prisons in the State. There was a high-level meeting convened, headed by the Chairman, Committee for Computerisation, Hon’ble Shri Justice Ram Mohan Reddy, with members of

Computerisation Committee Hon’ble Shri Justice Anand Byrareddy, Hon’ble Shri Justice Ashok B Hinchigeri, Hon’ble Shri Justice A S Bopanna, Hon’ble Shri Justice A.N.Venugopala Gowda, Hon’ble Shri Justice Ravi Malimath, Hon’ble Shri Justice Aravind Kumar, Prof. Muralidharan, IISC, Bengaluru, Dr. Debabrata Das, Professor IIIT, Bengaluru, other members present in the meeting included Additional Home Secretary Shri S K Patnaik, Shri Baskar Rao ADGP (Police Computer Wing), Shri Kamal Pant ADGP (Prisons), Shri Ratan Kelkar CEO, (CeG) State IT, where in it was resolved to connect all Criminal Courts to Prisons vide Video Conference Facility, The meeting deliberated on the need for renovating outdated system, providing 10 mbps connectivity through (KSWAN).

High Definition Video Conference Facility

The proposed VC facility along with its underlying benefits reduces the cost involved for the movement & maintenance of under trials to court and vice-versa; deployment of police personnel for escorting under trial; and saves time, as also encourages the Legal aid services in obviating the commutation of lawyers/public prosecutors to meet the under trials in prisons, without which the under trials would be deprived of their entitlement. Video Conference and digitisation of Courts speed up the prosecution and cut down the costs. VC will be the order of future Courts.

Implementation of oImplementation of oImplementation of oImplementation of online Recruitment nline Recruitment nline Recruitment nline Recruitment in District Court Kalaburagiin District Court Kalaburagiin District Court Kalaburagiin District Court Kalaburagi

High Court of Karnataka has accorded permission to use SMS gateway and e-mail gateway services of Recruitment Software for District Court at Kalaburagi for on-line recruitment. Prl. District and Sessions Judge, Kalaburagi Shri.B.V.Patil took initiative in commencing the first on-line












recruitment process in the District Judiciary at Kalaburagi, with recruitment of “Group C” Posts. It is now implemented and operating successfully, further it is proposed to be rolled out at Dakshina Kannada (Mangaluru) District.

On-line Recruitment at Kalaburagi District Court

Following are the Benefits of Online Following are the Benefits of Online Following are the Benefits of Online Following are the Benefits of Online RecruitmentRecruitmentRecruitmentRecruitment

1. The lengthy process of manual receiving of applications or through Post can be avoided.

2. The use of man power for the process of scrutiny is minimised

3. There would be less use of paper in online recruitment, there would be saving of papers which is environmental friendly process and which is also the aim of e-governance. Whereas in manual process wastage of paper and manpower is significantly more as the process of preparing Interview list throughout finalising merit list.

4. The recruitment process could be completed at the earliest, compared to manual process of recruitment.

5. Due to transparency in the On-line Recruitment Process, unnecessary complaints may be avoided and the process will be hassle free, which ultimately also achieves the aim of e-governance.

Inauguration of Information KIOSK in Inauguration of Information KIOSK in Inauguration of Information KIOSK in Inauguration of Information KIOSK in MayoMayoMayoMayo----Hall Court unit, BengaluruHall Court unit, BengaluruHall Court unit, BengaluruHall Court unit, Bengaluru

As a part of computerisation of subordinate Courts in the state, Chairman Committee for Computerisation, Hon’ble Shri Justice Ram Mohan Reddy on 01/July/2015 inaugurated new Information-KIOSKs in the premises of Mayo-Hall Court in the presence of Shri Shivaramu H C, President Advocates Association, and other Advocates.

Hon’ble Shri Justice Ram Mohan Reddy Inaugurating

Information KIOSKs at Mayo-Hall Court Unit

These Information KIOSKs provide for access to the Case Status & information. The Self Service Interactive KIOSK assist advocates and litigant public, where in they can access and know their Case-Status, Status of Certified Copies, Application Filing details, Caveat details, Parties name for given case number and Vice Versa, Causelist by Court hall number.

The user interface is kept simple and the components in the User Interface are made touch Screen friendly. Context based On-screen keypad is used to enable the user to input the data. KIOSKS also provide an option to visit all District Court Website through e-Courts Website. The application can be used with the touch of the screen as the only input mechanism and there is no need for mouse and key-board for normal operation by the end user. Context based on-screen keypad is used to enable the user to input the data. Since the keyboard is not provided, an on screen keypad is provided to enter the data.












Inauguration of Multi Point High Inauguration of Multi Point High Inauguration of Multi Point High Inauguration of Multi Point High DDDDefinition Video Confefinition Video Confefinition Video Confefinition Video Conference Facility erence Facility erence Facility erence Facility between Courtsbetween Courtsbetween Courtsbetween Courts & Jails& Jails& Jails& Jails Hon’ble Chief Justice of Karnataka High Court Justice Mr. Subhro Kamal Mukherjee has inaugurated the pilot Multi Point High Definition Video Conference between Court Halls and Jails. This pilot launch is done as part of Digital India Week. The pilot launch includes 2 Courts namely City Civil Court, Bengaluru and district Court, Mangalore and 6 District Jails namely, Mysuru, Dharwad, Kalaburgi, Belagavi, Vijayapura and Ballary.

Hon’ble Chief Justice Shree Subhro Kamal Mukherjee Inaugurating the High Definition VC Facility Connecting Jails to Courts

The project is to provide Multi Point High Definition VC facility to all the Jails and Courts in the state of Karnataka. The project is going to revolutionize the criminal justice system in speedy disposal of the cases. The video conferencing system will be provided within the Court Hall itself, so that the under trails need not be physically produced in the Courts. It reduces the expenditure of transport of under trails with escort. There is significant delay in physical production of under trails in Courts due to shortage of escort personnel. The VC facility will enable to reduce the delay significantly. Video Conferencing facility also eliminate the risk of escape of the under trails during their transportation to Courts.

Proposed Training Schedule on Proposed Training Schedule on Proposed Training Schedule on Proposed Training Schedule on UbuntuUbuntuUbuntuUbuntu----Linux 14.04 version to Linux 14.04 version to Linux 14.04 version to Linux 14.04 version to Judicial Officers across the StateJudicial Officers across the StateJudicial Officers across the StateJudicial Officers across the State

Proposed Training Schedule on Ubuntu-Linux 14.04

version, Judicial Officers across the State of Karnataka

S

No District Name

Day one

Training

Date

Day two

Training

Date

1 BENGALURU URBAN 19-Jul-15 26-Jul-15

2 CMM COURT

COMPLEX 19-Jul-15 26-Jul-15

3 SMALL CAUSES

COURT COMPLEX 19-Jul-15 26-Jul-15

4 BENGALURU RURAL 19-Jul-15 26-Jul-15

5 BELAGAVI 19-Jul-15 26-Jul-15

6 CHITRADURGA 19-Jul-15 26-Jul-15

7 SHIVAMOGGA 19-Jul-15 26-Jul-15

8 CHIKMAGALUR 19-Jul-15 26-Jul-15

9 CHIKKABALLAPURA 19-Jul-15 26-Jul-15

10 GADAG 2-Aug-15 06-Sep-15

11 HAVERI 2-Aug-15 06-Sep-15

12 DHARWAD 2-Aug-15 06-Sep-15

13 RAMANAGARA 2-Aug-15 09-Aug-15

14 BAGALKOT 2-Aug-15 06-Sep-15

15 VIJAYAPURA 2-Aug-15 09-Aug-15

16 DAVANAGERE 2-Aug-15 09-Aug-15

17 DAKSHINA KANNADA 2-Aug-15 09-Aug-15

18 KOLAR 2-Aug-15 09-Aug-15

19 KOPPAL 2-Aug-15 09-Aug-15

20 UTTARA KANNADA 2-Aug-15 09-Aug-15

21 CHAMARAJANAGAR 23-Aug-15 30-Aug-15

22 BELLARI 23-Aug-15 30-Aug-15

23 BIDAR 23-Aug-15 30-Aug-15

24 KODAGU 23-Aug-15 30-Aug-15

25 MANDYA 23-Aug-15 30-Aug-15

26 MYSURU 23-Aug-15 30-Aug-15

27 TUMAKURU 23-Aug-15 30-Aug-15

28 UDUPI 23-Aug-15 30-Aug-15

29 KALABURGI 23-Aug-15 30-Aug-15

30 HASSAN 23-Aug-15 30-Aug-15

31 RAICHUR 23-Aug-15 30-Aug-15

32 YADGIRI 23-Aug-15 30-Aug-15

eeee----NewsletterNewsletterNewsletterNewsletter Volume IIVolume IIVolume IIVolume II Page Page Page Page 7777


NewsNewsNewsNews GalleryGalleryGalleryGallery

Hon’ble Shri Justice Ram Mohan Reddy inaugurating the Training Programme for newly appointed Software Technicians in the state

Registrar General Shri B A Patil honouring Shri Justice Ram

Mohan Reddy at the Valedictory Function

Registrar General Shri B A Patil, Registrar Judicial Shri P N Desai, Registrar Recruitment Shri K Natarajan, Registrar Infrastructure &

Maintenance Shri K S Bilagi in the Valedictory Function

Hon’ble Shri Justice Aravind Kumar with Hon’ble Shri Justice Ram Mohan Reddy at the Training Programme Valedictory Function

Registrar Vigilance Shri John Michael Cunha honouring Shri

Justice Aravind Kumar at the Valedictory Function

Central Project Co-ordinator Shri T G Shivashankaregowda, Shri

Shashidhar Shetty in the Valedictory Function



Hon’ble Shri Justice Ram Mohan Reddy inaugurating the Feedback

Training Programme for 22 Masters Trainers in the state

Central Project Co-ordinator, Shri T G Shivashankaregowda & H R

Radha (Ubuntu-CIS National Trainer) imparting Training to Judicial Officers in District – Hassan

UBUNTU/CIS Training to Judicial Officers in District – Bidar

Hon’ble Shri Justice Ram Mohan Reddy addressing the Master

Trainers in the Feedback Training Programme

UBUNTU/CIS Training to Judicial Officers in District - Hassan

UBUNTU/CIS Training to Judicial Officers in District - Kolar



UBUNTU/CIS Training to Judicial Officers in District-Bagalkot

UBUNTU/CIS Training to Judicial Officers in District-Bijapur

UBUNTU/CIS Training to Judicial Officers in District-Raichur

UBUNTU/CIS Training to Judicial Officers in District-Bagalkot

UBUNTU/CIS Training to Judicial Officers in District- (UK) Karwar

UBUNTU/CIS Training to Judicial Officers in District-Mandya



UBUNTU/CIS Training to Judicial Officers in District - Shivamogga

UBUNTU/CIS Training to Judicial Officers in District - Belagavi

UBUNTU/CIS Training to Judicial Officers in District-Tumkur

UBUNTU/CIS Training to Judicial Officers in District - Shivamogga

UBUNTU/CIS Training to Judicial Officers in District-Kalaburagi

UBUNTU/CIS Training to Judicial Officers in District-Tumkur



Hon’ble Chief Justice Shree Subhro Kamal Mukherjee Inaugurating Pilot Project of Multi-Point High Definition Video Conference Facility Connecting Jails to Courts

Hon’ble Judges in the Inauguration Function

Multi - Point High Definition Video Conference Facility Connecting Hon’ble High Court, Bengaluru, Dharwad Bench to City Civil Court Bengaluru, Mangaluru Court, Dharwad, Ballary, Mysuru, and Kalaburagi Central Prisons

Hon’ble Judges in the Inauguration Function of the Pilot Project of Multi-Point High Definition Video Conference Facility connecting Jails to Courts.

Hon’ble Judges in the Inauguration Function

Multi-Point High Definition Video Conference Facility Connecting Vijayapura, Ballary, Mysuru and Kalaburagi Central Prisons to Mangaluru Court & Hon’ble High Court, Bengaluru & Dharwad Bench

“The best way to find yourself is to lose yourself in the service of...

Documents

Transcript of “The best way to find yourself is to lose yourself in the service of...