![Supplementary Materials for - Science Advances · Supplementary Materials for Thiacalix[4]arene: New protection for metal nanoclusters Zong-Jie Guan, Jiu-Lian Zeng, Zi-Ang Nan, Xian-Kai](https://static.fdocuments.us/doc/165x107/5eda6896b3745412b5714a97/supplementary-materials-for-science-advances-supplementary-materials-for-thiacalix4arene.jpg)
Antineuroinflammatory Effects of Modified Wu-Zi-Yan-Zong...
11
Research Article Antineuroinflammatory Effects of Modified Wu-Zi-Yan-Zong Prescription in -Amyloid-Stimulated BV2 Microglia via the NF-B and ERK/p38 MAPK Signaling Pathways Qian Yu, 1 Fang-Jiao Song, 1 Jin-Feng Chen, 2 Xin Dong, 2 Yong Jiang, 2 Ke-Wu Zeng, 1,2 Peng-Fei Tu, 2 and Xue-Mei Wang 1 1 Research Studio of Integration of Traditional and Western Medicine, First Hospital, Peking University, Beijing 100034, China 2 State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University, Beijing 100191, China Correspondence should be addressed to Ke-Wu Zeng; [email protected], Peng-Fei Tu; [email protected], and Xue-Mei Wang; [email protected] Received 7 February 2017; Revised 8 April 2017; Accepted 9 May 2017; Published 17 July 2017 Academic Editor: Ching-Liang Hsieh Copyright © 2017 Qian Yu et al. is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Modified Wu-Zi-Yan-Zong prescription (MWP), a traditional Chinese medicinal decoction, has possessed the neuroprotective and anti-inflammatory properties. e mechanisms associated with these properties, however, are not completely understood. We designed the experiments to elucidate the antineuroinflammatory property of MWP in BV2 microglia activated by -amyloid (A), which is a characteristic feature of Alzheimer’s disease (AD). e composition of MWP was studied using HPLC. BV2 microglia cells were then treated with A in the presence or absence of MWP. e effects of MWP treatment on A-activated neuroinflammation were determined using PCR, western blotting, and immunofluorescence staining. MWP significantly inhibited the mRNA expression of inflammatory mediators such as IL-1, IL-6, TNF-, and MCP-1, as well as the expression of inducible nitric oxide synthase (iNOS) in A-activated BV2 microglia. MWP also inhibited the nuclear translocation and signaling pathway of nuclear factor kappa B (NF-B) by suppressing inhibitor of nuclear factor-B (IB) degradation and downregulating IB kinase (IKK) phosphorylation. Moreover, MWP decreased extracellular regulated protein kinase (ERK)/p38 mitogen-activated protein kinase (MAPK) phosphorylation, which is an important signaling pathway for proinflammatory gene expression. We concluded that MWP could suppress neuroinflammatory responses in A-activated BV2 microglia via the NF-B and ERK/p38 MAPK signaling cascades and could prove an effective therapeutic agent for the prevention and treatment of neuroinflammatory diseases such as AD. 1. Introduction Alzheimer’s disease is a common neurodegenerative disease characterized by -amyloid peptide, neurofibrillary tangles enriched with abnormally phosphorylated tau protein, and neuronal degeneration [1]. Neuroinflammation is a main factor in AD pathogenesis [2–4]. Microglia cells are a type of macrophage located in the CNS, which contribute to the inflammatory reactions occurring during AD pathogenesis by binding to soluble amyloid (A) oligomers and A fibrils via cell-surface receptors [5]. Neuroinflammation is a mani- festation of CNS damage and could activate microglia cells and astrocytes to release inflammatory factors and cytokines, invade the immune system, and activate the complement system [6]. Inflammatory factors such as TNF-, IL-6, and IL-1 are released by activated microglia cells and astrocytes [7–9]. e stage of neuroinflammation is therefore significant in the study of AD. -Amyloid peptides originate from proteolysis of the amyloid precursor protein in amyloidogenic processing which is initiated by beta-site amyloid precursor protein- cleaving enzyme 1 (BACE-1) and successively cleaved by - secretase, a protein complex with presenilin 1 at its catalytic core [10]. In AD, A-a small peptide composed by 39–43 Hindawi Evidence-Based Complementary and Alternative Medicine Volume 2017, Article ID 8470381, 10 pages https://doi.org/10.1155/2017/8470381
Transcript of Antineuroinflammatory Effects of Modified Wu-Zi-Yan-Zong...
Research ArticleAntineuroinflammatory Effects of ModifiedWu-Zi-Yan-Zong Prescription in 120573-Amyloid-StimulatedBV2 Microglia via the NF-120581B and ERKp38 MAPKSignaling Pathways
Qian Yu1 Fang-Jiao Song1 Jin-Feng Chen2 Xin Dong2 Yong Jiang2
Ke-Wu Zeng12 Peng-Fei Tu2 and Xue-Mei Wang1
1Research Studio of Integration of Traditional and Western Medicine First Hospital Peking University Beijing 100034 China2State Key Laboratory of Natural and Biomimetic Drugs School of Pharmaceutical Sciences Peking University Beijing 100191 China
Correspondence should be addressed to Ke-Wu Zeng ZKWbjmueducn Peng-Fei Tu pengfeituvip163comand Xue-Mei Wang 170305356qqcom
Received 7 February 2017 Revised 8 April 2017 Accepted 9 May 2017 Published 17 July 2017
Academic Editor Ching-Liang Hsieh
Copyright copy 2017 Qian Yu et alThis is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
Modified Wu-Zi-Yan-Zong prescription (MWP) a traditional Chinese medicinal decoction has possessed the neuroprotectiveand anti-inflammatory properties The mechanisms associated with these properties however are not completely understood Wedesigned the experiments to elucidate the antineuroinflammatory property of MWP in BV2 microglia activated by 120573-amyloid(A120573) which is a characteristic feature of Alzheimerrsquos disease (AD) The composition of MWP was studied using HPLC BV2microglia cells were then treated with A120573 in the presence or absence of MWP The effects of MWP treatment on A120573-activatedneuroinflammation were determined using PCR western blotting and immunofluorescence stainingMWP significantly inhibitedthe mRNA expression of inflammatory mediators such as IL-1120573 IL-6 TNF-120572 and MCP-1 as well as the expression of induciblenitric oxide synthase (iNOS) in A120573-activated BV2 microglia MWP also inhibited the nuclear translocation and signaling pathwayof nuclear factor kappa B (NF-120581B) by suppressing inhibitor of nuclear factor-120581B (I120581B) degradation and downregulating I120581B kinase120573 (IKK120573) phosphorylationMoreoverMWPdecreased extracellular regulated protein kinase (ERK)p38mitogen-activated proteinkinase (MAPK) phosphorylation which is an important signaling pathway for proinflammatory gene expression We concludedthat MWP could suppress neuroinflammatory responses in A120573-activated BV2 microglia via the NF-120581B and ERKp38 MAPKsignaling cascades and could prove an effective therapeutic agent for the prevention and treatment of neuroinflammatory diseasessuch as AD
1 Introduction
Alzheimerrsquos disease is a common neurodegenerative diseasecharacterized by 120573-amyloid peptide neurofibrillary tanglesenriched with abnormally phosphorylated tau protein andneuronal degeneration [1] Neuroinflammation is a mainfactor in AD pathogenesis [2ndash4] Microglia cells are a typeof macrophage located in the CNS which contribute to theinflammatory reactions occurring during AD pathogenesisby binding to soluble amyloid120573 (A120573) oligomers andA120573fibrilsvia cell-surface receptors [5] Neuroinflammation is a mani-festation of CNS damage and could activate microglia cells
and astrocytes to release inflammatory factors and cytokinesinvade the immune system and activate the complementsystem [6] Inflammatory factors such as TNF-120572 IL-6 andIL-1120573 are released by activated microglia cells and astrocytes[7ndash9]The stage of neuroinflammation is therefore significantin the study of AD120573-Amyloid peptides originate from proteolysis of the
amyloid precursor protein in amyloidogenic processingwhich is initiated by beta-site amyloid precursor protein-cleaving enzyme 1 (BACE-1) and successively cleaved by 120574-secretase a protein complex with presenilin 1 at its catalyticcore [10] In AD A120573-a small peptide composed by 39ndash43
HindawiEvidence-Based Complementary and Alternative MedicineVolume 2017 Article ID 8470381 10 pageshttpsdoiorg10115520178470381
2 Evidence-Based Complementary and Alternative Medicine
Table 1 Composition of modified Wu-Zi-Yan-Zong prescription(MWP)
Herbal composition Part used Amounts used (g)Lycium barbarum L Fruit 400Cuscuta chinensis Lam Fruit 400Rubus chingiiHu Fruit 200Schisandra chinensis (Turcz) Baill Fruit 50Plantago asiatica L Fruit 100Epimedium brevicornumMaxim Herb 400
amino acids forms long insoluble amyloid fibrils whichaccumulate in sphericalmicroscopic deposits known as senileplaques [11] A120573 deposition alone might be sufficient toinduce an inflammatory reaction that subsequently con-tributes to cognitive decline and disease development [5] A120573is also therefore of considerable interest in the study of AD
Several signaling pathways including the nuclear fac-tor kappa B (NF-120581B) and mitogen-activated protein kinase(MAPK) pathways are associated with neuroinflammation[12 13] NF-120581B signaling pathway mediates the proceedingof neuroinflammation and nuclear translocation to releasethe production of inflammatory mediators [14] The MAPKsignaling pathway induces strong expression of neuronalchemokines and presents potential therapeutic targets for thetreatment of inflammation-mediated CNS disorders [15]
Modified Wu-Zi-Yan-Zong prescription (MWP) is adecoction which is originated from Wu-Zi-Yan-Zong pillin Tang Dynasty and prepared following the principles oftraditional Chinese medicine It consists of 6 Chinese herbsLycium barbarum L Cuscuta chinensis Lam Rubus chingiiHu Schisandra chinensis (Turcz) Baill Plantago asiaticaL and Epimedium brevicornum Maxim The compositionof MWP is shown in Table 1 The application of MWPhas manifested the remarkable and effective impact in theregulation of the occurrence of AD in different mecha-nisms it inhibits the phosphorylation of tau protein underthe stimulation of A120573 alleviates the neurofibrillary tanglesin the brain and reduces functional neuron damage torelieve dementia [16] Moreover MWP could suppress theinflammatory response in LPS-stimulated BV2 microglia todecrease the production of inflammatory factors [17] Parts ofthe flavonoids and polysaccharides in MWP could penetratethe blood-brain barrier and prevent nerve injury followingA120573 stimulation [18] In addition it has been proved thatMWP and its flavonoid and polysaccharide componentsshowed the protective function to the recession of study andmemory ability of AD mice due to the damage of centralcholinergic system and the deposition of A120573 [19ndash21] Lastbut not least the compounds in MWP also showed thepowerful antineuroinflammatory effect in LPS-activated BV2cells [17] AlthoughMWPhas neuroprotective properties themechanisms underlying its antineuroinflammatory activityin A120573-activated BV2 microglia remain unclear The aim ofthis study was to observe the effect of MWP to A120573-inducedBV2 microglia and elucidate the antineuroinflammatorymechanisms of this traditional Chinese prescription
2 Materials and Methods
21 Materials and Reagents All herbs were purchased fromTong Ren Tang Chinese Medicine Co Ltd (Beijing China)and carefully authenticated by Dr P F Tu Pharmacog-nosist according to Chinese Pharmacopoeia (The Phar-macopoeia Commission of PRC 2010) A120573 (1ndash42) wereobtained from GL Biochem (Shanghai) Ltd iNOS p-I120581BI120581B p-IKK120573 IKK120573 p-NF-120581B (p65) NF-120581B p-ERK ERKp-JNK JNK p-p38 p38 GAPDH 120572-tubulin Histone 3Hpolyclonal antibodies and HRP conjugated anti-rabbit IgGwere obtained from Cell Signaling Technology (Boston MAUSA) SuperSignal West Femto Stable Peroxide substrateand AlexaFluor594-labeled goat anti-rabbit IgG antibodywere obtained from Thermo Scientific (San Jose CA USA)410158406-Diamidino-2-phenylindole (DAPI) was purchased fromMacgene (China)
22 Preparation of MWP Extracts MWP consists of sixmedicinal components (Table 1) The MWP water extractwas prepared as described in a previous report [22] Thevoucher specimen was deposited at the Modern ResearchCenter for Traditional Chinese Medicine Peking UniversityHealth Science Center Beijing China
23 HPLC Analysis MWP extracts were analyzed usinga Shimadzu prominence liquid chromatography platform(Kyoto Japan) equipped with two LC-20AT pumps CTO-20A column oven DGU-20A5R degasser SIL-20A autosam-pler and SPD20AD detector Chromatographic separationwas conducted on a AichromBond-AQC18 column (250mmtimes 46mm 5120583m Abel Industries Ltd Canada) protectedby a Phenomenex C18 guard cartridge (3 times 4mm 5 120583mTorrance CA USA) The mobile phase consisted of ACN(A) and 01 aqueous formic acid (B) and was delivered at10mLsdotminminus1 with the following gradient program 0ndash25min0ndash3 B 25ndash70min 3ndash22 B 70ndash85min 22ndash35 B85ndash95min 35-35 B 95ndash100min 35ndash100 B 100ndash105min100-100 B The column was maintained at 40∘C At the endof each run the delivery of 100Awas performed for another14min for system reequilibration The monitor wavelengthwas set at 235 nm 254 nm and 280 nm respectively Figure 1and Table 2 show the HPLC fingerprint and the extracts ofMWP
24 Cell Culture BV2 microglia were obtained from PekingUnion Medical College Cell Bank (Beijing China) andmaintained in DMEM (Macgene China) supplemented with10 fetal bovine serum (Biowest France) and 1 Penicillin-Streptomycin (100x Macgene China) in a humidified incu-bator containing 95 air and 5 CO
2at 37∘C
25 RNA Isolation and Real-Time Polymerase Chain Reaction(PCR)Analysis BV2microgliawere treatedwithA120573 (20120583M)in the absence or the presence of different concentrationsof MWP (50 100 and 200mgL) for 6 h Total RNA wasextracted using the RNAprep pure Cell Kit (Tiangen BiotechCo Ltd China) Reverse transcription was performed usingthe TIANScript RT Kit (Tiangen Biotech Co Ltd China) to
Evidence-Based Complementary and Alternative Medicine 3
Table 2 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) Characterization of compounds in MWP by HPLC analysis lowastEbEpimedium brevicornum Maxim Rc Rubus chingii Hu PA Plantago asiatica L CC Cuscuta chinensis Lam LB Lycium barbarum L SCSchisandra chinensis (Turcz) Baill
Number Rt (min) Identification Constituent herbslowast
Eb Rc PA SC CC LB1 45 L-Glycero-O-galactoheptitol-36-anhydro-O-glucoside +2 53 2-120572-Nigerosylglucose +3 74 L-Ascorbic acid-O-glucoside +4 185 Guanosine + +5 389 Quinic acid-O-caffeoyl-O-glucoside +6 415 Chlorogenic acid +7 445 Quinic acid-O-caffeoyl-O-glucoside +8 449 Limocitrol-O-glucoside +9 462 Cinnamoylquinic acid +10 512 Caffeoylquinic acid +11 515 Caffeoylquinic acid +12 555 BenzenepropanamideN-[3-[[4-[(3-aminopropyl)amino] butyl]amino]minuspropyl]-34-dihydroxy +13 582 Cinnamoylquinic acid +14 619 Kaempferol-di-O-glucoside + + + + +15 624 Quinic acid-tri-O-glucoside +16 678 Quercetin-O-glucosyl-O-xyloside + + + + +17 816 Desmethylicaritin-O-rhamnosyl-O-glucoside +18 821 Epimedoside E +19 854 Hydroxyisocupressoside B + + +20 872 Sagittasine C +21 879 Icariine +22 886 Epimedin B +23 895 Icaritin-O-rhamonosyl-O-rutinoside +24 909 Epimediside A +25 929 8-Dihydroprenylquercetin-O-methyl-tri-O-acetyl-O-rutinoside +26 935 8-Dihydroprenylquercetin-di-O-cinnamoyl-O-glucoside +27 992 Epimedin K +28 1002 Icaritin-tri-O-methyl-O-rutinoside +
24
1
15000
50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950(min)
0250050007500
1000012500
17500
(uV
)
5 6
7
8 9
10
11 1213
2021
22
23
242526
272819181514 16317
1
minus2500
Figure 1 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) HPLC fingerprint of MWP (see Table 2)
4 Evidence-Based Complementary and Alternative Medicine
Table 3MWP inhibits themRNA expression of inflammatorymediators as well as the protein expression of iNOS inA120573-activated BV2microgliaThe PCR primer of mRNA is shown in the table
TNF-120572 51015840-31015840 (forward) AGTGACAAGCCTGTAGCCCACGT51015840-31015840 (reverse) CCATCGGCTGGCACCACTAGTT
MCP-1 51015840-31015840 (forward) CTTCTGGGCCTGCTGTTCACAGTT51015840-31015840 (reverse) TTCTTGGGGTCAGCACAGACCTCT
IL-1120573 51015840-31015840 (forward) TGGAGAAGCTGTGGCAGCTACCT51015840-31015840 (reverse) GAACGTCACACACCAGCAGGTT
IL-6 51015840-31015840 (forward) ACAAAGCCAGAGTCCTTCAGAGAGA51015840-31015840 (reverse) TGGTCTTGGTCCTTAGCCACTCCT
GAPDH 51015840-31015840 (forward) GGTGAAGGTCGGTGTGAACG51015840-31015840 (reverse) CTCGCTCCTGGAAGATGGTG
obtain cDNA Real-time PCR was performed in an ABI7500real-time PCR instrument (Applied Biosystems) with theSYBR Green qPCR SuperMix and the transcripts wereamplified in a tube containing 1 120583g of cDNA and 01 120583molof each forward and reverse primer The PCR amplificationprocedure was as follows 95∘C for 10min followed by 40cycles of 95∘C for 30 seconds 54∘C for 30 seconds 72∘C for 60seconds and a final extension at 95∘C for 30 seconds 55∘C for30 seconds and 95∘C for 30 seconds Melting curve analysiswas carried out after amplification to verify the accuracy ofthe amplicon
26 Western Blot Analysis Total cell proteins were separatedby SDS-PAGE and transferred onto polyvinylidene fluo-ride (PVDF) membranes The PVDF membranes were thenblocked with 5 nonfat milk and incubated with primaryantibodies at 4∘C overnight The membranes were washedwith PBST (phosphate-buffered saline 01 Tween 20) forthree times and incubated with secondary antibodies at roomtemperature for 1 h The membranes were washed with PBSTfor another three times and visualized using ImmobilonWesternChemiluminescentHRP SubstrateThe relative opti-cal densities were scanned using the Kodak Digital ImagingSystem (Gel Logic 2200Pro Kodak USA)
27 Immunofluorescence Analysis BV2 microglia wereseeded onto glass cover slips and treated with A120573 in theabsence or the presence of MWP for 1 h The cells werefixed with cold 4 paraformaldehyde for 20min andpermeabilized with 05 Triton X-100 for 30min Thecells were then blocked with 5 BSA for 1 h and incubatedwith a primary antibody overnight at 4∘C The cells werewashed with PBS for three times and secondary antibodylabeled with Alexa Fluor-594 was added and incubated for1 h The cells were then washed another three times DAPI(50 120583gmL) was added for 20min at 37∘C in dark and thecoverslips were sealed The cells were visualized using aconfocal microscope (Leica TCS SP8 MP FCS Germany)
28 Statistical Analysis Data were represented as the meanplusmn SD for each group and were assessed by one-way analysisof variance (ANOVA) by using the SPSS 160 software (IBMCorp USA) 119875 lt 005 compared with control group wasconsidered statistically significant
3 Results
31 Identification of the Components of MWP Extract HPLCanalysis was used to identify the ingredients of the MWPextract Twenty-eight compounds were identifiedTheHPLCfingerprint of theMWP extracts and the characterization andsources of these compounds are shown and listed in Figure 1and Table 2
32 MWP Inhibits the mRNA Expression of InflammatoryMediators and the Protein Expression of iNOS in A120573-ActivatedBV2 Microglia We tested the effects of MWP on the mRNAlevels of IL-1120573 IL-6 TNF-120572 and MCP-1 by RT-PCR TheqPCR primer sequences of mRNA and the results are shownin Figures 2(a)ndash2(d) and Table 3 Stimulation with A120573(20120583M) for 6 h upregulated IL-1120573 IL-6 TNF-120572 and MCP-1 gene expression However MWP treatment resulted ina concentration-dependent decrease of IL-1120573 IL-6 TNF-120572and MCP-1 mRNA expression in BV2 microglia Further asshown in Figure 2(e) treatment with A120573 (20120583M) caused anincrease in the protein expression of iNOS MWP treatmentsignificantly inhibited the increase of iNOS expression ina concentration-dependent manner Thus MWP showedinhibitory effects on A120573-challenged BV2microglia activationvia the downregulation of different inflammatory mediatorsand inflammation-related proteins
33 MWP Inhibits NF-120581B (p65) Nuclear Translocation in A120573-Activated BV2 Microglia To further study the mechanism ofaction ofMWPwe investigated the effects ofMWPon crucialinflammatory signaling pathways NF-120581B a key transcriptionfactor was activated by A120573 and translocated to the nucleusWe first examined the nuclear translocation of NF-120581B in BV2microglia by using NF-120581B-specific fluorescence staining andfound that A120573-stimulation induced obvious NF-120581B accumu-lation (purple fluorescence) in the nucleus MWP treatmentsignificantly reversed NF-120581B nuclear translocation cytoplas-mic retention ofNF-120581Bwasmore prominent inMWP-treatedBV2 microglia than in A120573-treated cells (Figure 3(a)) NF-120581Bnuclear translocation was blocked by MWP at a dosage of200mgL in BV2 microglia (Figure 3(b))
34 MWP Inhibits NF-120581B Signaling by Preventing the Phos-phorylation of IKK120573 I120581B and NF-120581B in A120573-Activated BV2Microglia After confirming that MWP inhibits NF-120581B (p65)
Evidence-Based Complementary and Alternative Medicine 5
400
500
300
200
100
0lowastlowast
lowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive T
NF-
120572m
RNA
expr
essio
n (fo
lds o
f con
trol)
(a)
400
800
600
200
0 lowastlowast
lowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive I
L-6
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(b)
40
80
100
60
20
0lowastlowastlowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive I
L-1120573
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(c)
100
200
150
50
0
lowastlowastlowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
expr
essio
n (fo
lds o
f con
trol)
Relat
ive M
CP-1
mRN
A
(d)
iNOSGAPDH
iNOS
GAPDH
2
4
5
3
1
0
lowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
(e)
Figure 2 MWP inhibits the mRNA expression of inflammatory mediators as well as the protein expression of iNOS in A120573-activated BV2microglia BV2 microglia were incubated with A120573 (20120583M) in the presence or absence of MWP (50 100 and 200mgL) for 6 h mRNAexpressions of IL-6 TNF-120572 IL-1120573 and MCP-1 were tested (andashd) BV2 microglia were incubated with A120573 (20 120583M) in the presence or absenceofMWP for 24 h Total protein of the cells was extracted and used to detect the expression of iNOS bywestern blot (e) All values are expressedas mean plusmn standard deviation of triplicate tests 119875 lt 001 and 119875 lt 005 relative to the control group lowast119875 lt 005 and lowastlowast119875 lt 001 relative tothe A120573 group (see Table 3)
nuclear translocation in A120573-activated BV2 microglia weinvestigated the effects of MWP on the activation of NF-120581B As shown in Figure 4 A120573 (20120583M) treatment markedlyinduced NF-120581B phosphorylation which was significantlyreversed by MWP Next we studied two crucial upstreamproteins of the NF-120581B signaling pathway I120581B kinase (IKK)and nuclear factor-120581B (I120581B) As shown in Figure 4 IKK120573and I120581B were phosphorylated after A120573 treatment MWPdownregulated IKK120573 phosphorylation and inhibited I120581Bdegradation in a concentration-dependent manner Theseresults indicated that the NF-120581B signaling pathway is apotential therapeutic target in activated BV2 microglia
35 MWP Inhibits ERKp38 MAPK Signaling in A120573-ActivatedBV2 Microglia We investigated the effects of MWP on themitogen-activated protein kinase (MAPK) signaling pathwayto determine whether MWP suppresses the inflammatoryresponse in BV2 microglia via this pathway As shown inFigure 5 A120573 (20120583M) treatment increased the phosphory-lation of extracellular regulated protein kinase (ERK) andp38 in BV2 microglia which was significantly inhibitedby MWP in a concentration-dependent manner Howeversimilar results were not observed with another MAPK familymember c-Jun NH2-terminal kinase (JNK) Thus MWPcould inhibit ERKp38MAPK signaling pathway in activatedBV2 microglia
4 Discussion
To date there have been relatively few studies on the effects oftraditional Chinese medicine on neuroinflammation How-ever the extensive usage of Chinese herbs [17 22] hasmade such studies necessary Our team has been committedto the research of the anti-inflammatory function of thecompound extracted from traditional Chinese medicine andthe effect has been verified [23] The result could also beenconsidered the positive exploration of the pharmacologicalactivity of traditional ChinesemedicineMWP is a traditionalChinese medicine prescription In our previous work weshowed that MWP could protect rat astrocytes from damagedue to neuroinflammation induced by LPS [22] In thisstudy we aimed to determine whether MWP could inhibitneuroinflammation in A120573-activated BV2 microglia and themechanisms of its action
AD is associated with upregulation of proinflammatorycytokines which can initiate plaque production and enhancenerve cell degeneration [24] Inflammatory factors are impli-cated in dementia-related peripheral disease and cerebralnervous system diseases [25] Cerebral A120573 accumulation isthe primary influence in AD [26] Overactivated microgliacould stimulate the immune system which is overwhelmedby A120573 deposition Inflammation then becomes chronic andadverse resulting in accelerated neurodegeneration [7 10] Inour study the stimulation by A120573 (20120583M) could increase the
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
2 Evidence-Based Complementary and Alternative Medicine
Table 1 Composition of modified Wu-Zi-Yan-Zong prescription(MWP)
Herbal composition Part used Amounts used (g)Lycium barbarum L Fruit 400Cuscuta chinensis Lam Fruit 400Rubus chingiiHu Fruit 200Schisandra chinensis (Turcz) Baill Fruit 50Plantago asiatica L Fruit 100Epimedium brevicornumMaxim Herb 400
amino acids forms long insoluble amyloid fibrils whichaccumulate in sphericalmicroscopic deposits known as senileplaques [11] A120573 deposition alone might be sufficient toinduce an inflammatory reaction that subsequently con-tributes to cognitive decline and disease development [5] A120573is also therefore of considerable interest in the study of AD
Several signaling pathways including the nuclear fac-tor kappa B (NF-120581B) and mitogen-activated protein kinase(MAPK) pathways are associated with neuroinflammation[12 13] NF-120581B signaling pathway mediates the proceedingof neuroinflammation and nuclear translocation to releasethe production of inflammatory mediators [14] The MAPKsignaling pathway induces strong expression of neuronalchemokines and presents potential therapeutic targets for thetreatment of inflammation-mediated CNS disorders [15]
Modified Wu-Zi-Yan-Zong prescription (MWP) is adecoction which is originated from Wu-Zi-Yan-Zong pillin Tang Dynasty and prepared following the principles oftraditional Chinese medicine It consists of 6 Chinese herbsLycium barbarum L Cuscuta chinensis Lam Rubus chingiiHu Schisandra chinensis (Turcz) Baill Plantago asiaticaL and Epimedium brevicornum Maxim The compositionof MWP is shown in Table 1 The application of MWPhas manifested the remarkable and effective impact in theregulation of the occurrence of AD in different mecha-nisms it inhibits the phosphorylation of tau protein underthe stimulation of A120573 alleviates the neurofibrillary tanglesin the brain and reduces functional neuron damage torelieve dementia [16] Moreover MWP could suppress theinflammatory response in LPS-stimulated BV2 microglia todecrease the production of inflammatory factors [17] Parts ofthe flavonoids and polysaccharides in MWP could penetratethe blood-brain barrier and prevent nerve injury followingA120573 stimulation [18] In addition it has been proved thatMWP and its flavonoid and polysaccharide componentsshowed the protective function to the recession of study andmemory ability of AD mice due to the damage of centralcholinergic system and the deposition of A120573 [19ndash21] Lastbut not least the compounds in MWP also showed thepowerful antineuroinflammatory effect in LPS-activated BV2cells [17] AlthoughMWPhas neuroprotective properties themechanisms underlying its antineuroinflammatory activityin A120573-activated BV2 microglia remain unclear The aim ofthis study was to observe the effect of MWP to A120573-inducedBV2 microglia and elucidate the antineuroinflammatorymechanisms of this traditional Chinese prescription
2 Materials and Methods
21 Materials and Reagents All herbs were purchased fromTong Ren Tang Chinese Medicine Co Ltd (Beijing China)and carefully authenticated by Dr P F Tu Pharmacog-nosist according to Chinese Pharmacopoeia (The Phar-macopoeia Commission of PRC 2010) A120573 (1ndash42) wereobtained from GL Biochem (Shanghai) Ltd iNOS p-I120581BI120581B p-IKK120573 IKK120573 p-NF-120581B (p65) NF-120581B p-ERK ERKp-JNK JNK p-p38 p38 GAPDH 120572-tubulin Histone 3Hpolyclonal antibodies and HRP conjugated anti-rabbit IgGwere obtained from Cell Signaling Technology (Boston MAUSA) SuperSignal West Femto Stable Peroxide substrateand AlexaFluor594-labeled goat anti-rabbit IgG antibodywere obtained from Thermo Scientific (San Jose CA USA)410158406-Diamidino-2-phenylindole (DAPI) was purchased fromMacgene (China)
22 Preparation of MWP Extracts MWP consists of sixmedicinal components (Table 1) The MWP water extractwas prepared as described in a previous report [22] Thevoucher specimen was deposited at the Modern ResearchCenter for Traditional Chinese Medicine Peking UniversityHealth Science Center Beijing China
23 HPLC Analysis MWP extracts were analyzed usinga Shimadzu prominence liquid chromatography platform(Kyoto Japan) equipped with two LC-20AT pumps CTO-20A column oven DGU-20A5R degasser SIL-20A autosam-pler and SPD20AD detector Chromatographic separationwas conducted on a AichromBond-AQC18 column (250mmtimes 46mm 5120583m Abel Industries Ltd Canada) protectedby a Phenomenex C18 guard cartridge (3 times 4mm 5 120583mTorrance CA USA) The mobile phase consisted of ACN(A) and 01 aqueous formic acid (B) and was delivered at10mLsdotminminus1 with the following gradient program 0ndash25min0ndash3 B 25ndash70min 3ndash22 B 70ndash85min 22ndash35 B85ndash95min 35-35 B 95ndash100min 35ndash100 B 100ndash105min100-100 B The column was maintained at 40∘C At the endof each run the delivery of 100Awas performed for another14min for system reequilibration The monitor wavelengthwas set at 235 nm 254 nm and 280 nm respectively Figure 1and Table 2 show the HPLC fingerprint and the extracts ofMWP
24 Cell Culture BV2 microglia were obtained from PekingUnion Medical College Cell Bank (Beijing China) andmaintained in DMEM (Macgene China) supplemented with10 fetal bovine serum (Biowest France) and 1 Penicillin-Streptomycin (100x Macgene China) in a humidified incu-bator containing 95 air and 5 CO
2at 37∘C
25 RNA Isolation and Real-Time Polymerase Chain Reaction(PCR)Analysis BV2microgliawere treatedwithA120573 (20120583M)in the absence or the presence of different concentrationsof MWP (50 100 and 200mgL) for 6 h Total RNA wasextracted using the RNAprep pure Cell Kit (Tiangen BiotechCo Ltd China) Reverse transcription was performed usingthe TIANScript RT Kit (Tiangen Biotech Co Ltd China) to
Evidence-Based Complementary and Alternative Medicine 3
Table 2 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) Characterization of compounds in MWP by HPLC analysis lowastEbEpimedium brevicornum Maxim Rc Rubus chingii Hu PA Plantago asiatica L CC Cuscuta chinensis Lam LB Lycium barbarum L SCSchisandra chinensis (Turcz) Baill
Number Rt (min) Identification Constituent herbslowast
Eb Rc PA SC CC LB1 45 L-Glycero-O-galactoheptitol-36-anhydro-O-glucoside +2 53 2-120572-Nigerosylglucose +3 74 L-Ascorbic acid-O-glucoside +4 185 Guanosine + +5 389 Quinic acid-O-caffeoyl-O-glucoside +6 415 Chlorogenic acid +7 445 Quinic acid-O-caffeoyl-O-glucoside +8 449 Limocitrol-O-glucoside +9 462 Cinnamoylquinic acid +10 512 Caffeoylquinic acid +11 515 Caffeoylquinic acid +12 555 BenzenepropanamideN-[3-[[4-[(3-aminopropyl)amino] butyl]amino]minuspropyl]-34-dihydroxy +13 582 Cinnamoylquinic acid +14 619 Kaempferol-di-O-glucoside + + + + +15 624 Quinic acid-tri-O-glucoside +16 678 Quercetin-O-glucosyl-O-xyloside + + + + +17 816 Desmethylicaritin-O-rhamnosyl-O-glucoside +18 821 Epimedoside E +19 854 Hydroxyisocupressoside B + + +20 872 Sagittasine C +21 879 Icariine +22 886 Epimedin B +23 895 Icaritin-O-rhamonosyl-O-rutinoside +24 909 Epimediside A +25 929 8-Dihydroprenylquercetin-O-methyl-tri-O-acetyl-O-rutinoside +26 935 8-Dihydroprenylquercetin-di-O-cinnamoyl-O-glucoside +27 992 Epimedin K +28 1002 Icaritin-tri-O-methyl-O-rutinoside +
24
1
15000
50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950(min)
0250050007500
1000012500
17500
(uV
)
5 6
7
8 9
10
11 1213
2021
22
23
242526
272819181514 16317
1
minus2500
Figure 1 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) HPLC fingerprint of MWP (see Table 2)
4 Evidence-Based Complementary and Alternative Medicine
Table 3MWP inhibits themRNA expression of inflammatorymediators as well as the protein expression of iNOS inA120573-activated BV2microgliaThe PCR primer of mRNA is shown in the table
TNF-120572 51015840-31015840 (forward) AGTGACAAGCCTGTAGCCCACGT51015840-31015840 (reverse) CCATCGGCTGGCACCACTAGTT
MCP-1 51015840-31015840 (forward) CTTCTGGGCCTGCTGTTCACAGTT51015840-31015840 (reverse) TTCTTGGGGTCAGCACAGACCTCT
IL-1120573 51015840-31015840 (forward) TGGAGAAGCTGTGGCAGCTACCT51015840-31015840 (reverse) GAACGTCACACACCAGCAGGTT
IL-6 51015840-31015840 (forward) ACAAAGCCAGAGTCCTTCAGAGAGA51015840-31015840 (reverse) TGGTCTTGGTCCTTAGCCACTCCT
GAPDH 51015840-31015840 (forward) GGTGAAGGTCGGTGTGAACG51015840-31015840 (reverse) CTCGCTCCTGGAAGATGGTG
obtain cDNA Real-time PCR was performed in an ABI7500real-time PCR instrument (Applied Biosystems) with theSYBR Green qPCR SuperMix and the transcripts wereamplified in a tube containing 1 120583g of cDNA and 01 120583molof each forward and reverse primer The PCR amplificationprocedure was as follows 95∘C for 10min followed by 40cycles of 95∘C for 30 seconds 54∘C for 30 seconds 72∘C for 60seconds and a final extension at 95∘C for 30 seconds 55∘C for30 seconds and 95∘C for 30 seconds Melting curve analysiswas carried out after amplification to verify the accuracy ofthe amplicon
26 Western Blot Analysis Total cell proteins were separatedby SDS-PAGE and transferred onto polyvinylidene fluo-ride (PVDF) membranes The PVDF membranes were thenblocked with 5 nonfat milk and incubated with primaryantibodies at 4∘C overnight The membranes were washedwith PBST (phosphate-buffered saline 01 Tween 20) forthree times and incubated with secondary antibodies at roomtemperature for 1 h The membranes were washed with PBSTfor another three times and visualized using ImmobilonWesternChemiluminescentHRP SubstrateThe relative opti-cal densities were scanned using the Kodak Digital ImagingSystem (Gel Logic 2200Pro Kodak USA)
27 Immunofluorescence Analysis BV2 microglia wereseeded onto glass cover slips and treated with A120573 in theabsence or the presence of MWP for 1 h The cells werefixed with cold 4 paraformaldehyde for 20min andpermeabilized with 05 Triton X-100 for 30min Thecells were then blocked with 5 BSA for 1 h and incubatedwith a primary antibody overnight at 4∘C The cells werewashed with PBS for three times and secondary antibodylabeled with Alexa Fluor-594 was added and incubated for1 h The cells were then washed another three times DAPI(50 120583gmL) was added for 20min at 37∘C in dark and thecoverslips were sealed The cells were visualized using aconfocal microscope (Leica TCS SP8 MP FCS Germany)
28 Statistical Analysis Data were represented as the meanplusmn SD for each group and were assessed by one-way analysisof variance (ANOVA) by using the SPSS 160 software (IBMCorp USA) 119875 lt 005 compared with control group wasconsidered statistically significant
3 Results
31 Identification of the Components of MWP Extract HPLCanalysis was used to identify the ingredients of the MWPextract Twenty-eight compounds were identifiedTheHPLCfingerprint of theMWP extracts and the characterization andsources of these compounds are shown and listed in Figure 1and Table 2
32 MWP Inhibits the mRNA Expression of InflammatoryMediators and the Protein Expression of iNOS in A120573-ActivatedBV2 Microglia We tested the effects of MWP on the mRNAlevels of IL-1120573 IL-6 TNF-120572 and MCP-1 by RT-PCR TheqPCR primer sequences of mRNA and the results are shownin Figures 2(a)ndash2(d) and Table 3 Stimulation with A120573(20120583M) for 6 h upregulated IL-1120573 IL-6 TNF-120572 and MCP-1 gene expression However MWP treatment resulted ina concentration-dependent decrease of IL-1120573 IL-6 TNF-120572and MCP-1 mRNA expression in BV2 microglia Further asshown in Figure 2(e) treatment with A120573 (20120583M) caused anincrease in the protein expression of iNOS MWP treatmentsignificantly inhibited the increase of iNOS expression ina concentration-dependent manner Thus MWP showedinhibitory effects on A120573-challenged BV2microglia activationvia the downregulation of different inflammatory mediatorsand inflammation-related proteins
33 MWP Inhibits NF-120581B (p65) Nuclear Translocation in A120573-Activated BV2 Microglia To further study the mechanism ofaction ofMWPwe investigated the effects ofMWPon crucialinflammatory signaling pathways NF-120581B a key transcriptionfactor was activated by A120573 and translocated to the nucleusWe first examined the nuclear translocation of NF-120581B in BV2microglia by using NF-120581B-specific fluorescence staining andfound that A120573-stimulation induced obvious NF-120581B accumu-lation (purple fluorescence) in the nucleus MWP treatmentsignificantly reversed NF-120581B nuclear translocation cytoplas-mic retention ofNF-120581Bwasmore prominent inMWP-treatedBV2 microglia than in A120573-treated cells (Figure 3(a)) NF-120581Bnuclear translocation was blocked by MWP at a dosage of200mgL in BV2 microglia (Figure 3(b))
34 MWP Inhibits NF-120581B Signaling by Preventing the Phos-phorylation of IKK120573 I120581B and NF-120581B in A120573-Activated BV2Microglia After confirming that MWP inhibits NF-120581B (p65)
Evidence-Based Complementary and Alternative Medicine 5
400
500
300
200
100
0lowastlowast
lowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive T
NF-
120572m
RNA
expr
essio
n (fo
lds o
f con
trol)
(a)
400
800
600
200
0 lowastlowast
lowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive I
L-6
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(b)
40
80
100
60
20
0lowastlowastlowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive I
L-1120573
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(c)
100
200
150
50
0
lowastlowastlowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
expr
essio
n (fo
lds o
f con
trol)
Relat
ive M
CP-1
mRN
A
(d)
iNOSGAPDH
iNOS
GAPDH
2
4
5
3
1
0
lowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
(e)
Figure 2 MWP inhibits the mRNA expression of inflammatory mediators as well as the protein expression of iNOS in A120573-activated BV2microglia BV2 microglia were incubated with A120573 (20120583M) in the presence or absence of MWP (50 100 and 200mgL) for 6 h mRNAexpressions of IL-6 TNF-120572 IL-1120573 and MCP-1 were tested (andashd) BV2 microglia were incubated with A120573 (20 120583M) in the presence or absenceofMWP for 24 h Total protein of the cells was extracted and used to detect the expression of iNOS bywestern blot (e) All values are expressedas mean plusmn standard deviation of triplicate tests 119875 lt 001 and 119875 lt 005 relative to the control group lowast119875 lt 005 and lowastlowast119875 lt 001 relative tothe A120573 group (see Table 3)
nuclear translocation in A120573-activated BV2 microglia weinvestigated the effects of MWP on the activation of NF-120581B As shown in Figure 4 A120573 (20120583M) treatment markedlyinduced NF-120581B phosphorylation which was significantlyreversed by MWP Next we studied two crucial upstreamproteins of the NF-120581B signaling pathway I120581B kinase (IKK)and nuclear factor-120581B (I120581B) As shown in Figure 4 IKK120573and I120581B were phosphorylated after A120573 treatment MWPdownregulated IKK120573 phosphorylation and inhibited I120581Bdegradation in a concentration-dependent manner Theseresults indicated that the NF-120581B signaling pathway is apotential therapeutic target in activated BV2 microglia
35 MWP Inhibits ERKp38 MAPK Signaling in A120573-ActivatedBV2 Microglia We investigated the effects of MWP on themitogen-activated protein kinase (MAPK) signaling pathwayto determine whether MWP suppresses the inflammatoryresponse in BV2 microglia via this pathway As shown inFigure 5 A120573 (20120583M) treatment increased the phosphory-lation of extracellular regulated protein kinase (ERK) andp38 in BV2 microglia which was significantly inhibitedby MWP in a concentration-dependent manner Howeversimilar results were not observed with another MAPK familymember c-Jun NH2-terminal kinase (JNK) Thus MWPcould inhibit ERKp38MAPK signaling pathway in activatedBV2 microglia
4 Discussion
To date there have been relatively few studies on the effects oftraditional Chinese medicine on neuroinflammation How-ever the extensive usage of Chinese herbs [17 22] hasmade such studies necessary Our team has been committedto the research of the anti-inflammatory function of thecompound extracted from traditional Chinese medicine andthe effect has been verified [23] The result could also beenconsidered the positive exploration of the pharmacologicalactivity of traditional ChinesemedicineMWP is a traditionalChinese medicine prescription In our previous work weshowed that MWP could protect rat astrocytes from damagedue to neuroinflammation induced by LPS [22] In thisstudy we aimed to determine whether MWP could inhibitneuroinflammation in A120573-activated BV2 microglia and themechanisms of its action
AD is associated with upregulation of proinflammatorycytokines which can initiate plaque production and enhancenerve cell degeneration [24] Inflammatory factors are impli-cated in dementia-related peripheral disease and cerebralnervous system diseases [25] Cerebral A120573 accumulation isthe primary influence in AD [26] Overactivated microgliacould stimulate the immune system which is overwhelmedby A120573 deposition Inflammation then becomes chronic andadverse resulting in accelerated neurodegeneration [7 10] Inour study the stimulation by A120573 (20120583M) could increase the
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 3
Table 2 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) Characterization of compounds in MWP by HPLC analysis lowastEbEpimedium brevicornum Maxim Rc Rubus chingii Hu PA Plantago asiatica L CC Cuscuta chinensis Lam LB Lycium barbarum L SCSchisandra chinensis (Turcz) Baill
Number Rt (min) Identification Constituent herbslowast
Eb Rc PA SC CC LB1 45 L-Glycero-O-galactoheptitol-36-anhydro-O-glucoside +2 53 2-120572-Nigerosylglucose +3 74 L-Ascorbic acid-O-glucoside +4 185 Guanosine + +5 389 Quinic acid-O-caffeoyl-O-glucoside +6 415 Chlorogenic acid +7 445 Quinic acid-O-caffeoyl-O-glucoside +8 449 Limocitrol-O-glucoside +9 462 Cinnamoylquinic acid +10 512 Caffeoylquinic acid +11 515 Caffeoylquinic acid +12 555 BenzenepropanamideN-[3-[[4-[(3-aminopropyl)amino] butyl]amino]minuspropyl]-34-dihydroxy +13 582 Cinnamoylquinic acid +14 619 Kaempferol-di-O-glucoside + + + + +15 624 Quinic acid-tri-O-glucoside +16 678 Quercetin-O-glucosyl-O-xyloside + + + + +17 816 Desmethylicaritin-O-rhamnosyl-O-glucoside +18 821 Epimedoside E +19 854 Hydroxyisocupressoside B + + +20 872 Sagittasine C +21 879 Icariine +22 886 Epimedin B +23 895 Icaritin-O-rhamonosyl-O-rutinoside +24 909 Epimediside A +25 929 8-Dihydroprenylquercetin-O-methyl-tri-O-acetyl-O-rutinoside +26 935 8-Dihydroprenylquercetin-di-O-cinnamoyl-O-glucoside +27 992 Epimedin K +28 1002 Icaritin-tri-O-methyl-O-rutinoside +
24
1
15000
50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950(min)
0250050007500
1000012500
17500
(uV
)
5 6
7
8 9
10
11 1213
2021
22
23
242526
272819181514 16317
1
minus2500
Figure 1 HPLC analysis of modified Wu-Zi-Yan-Zong prescription (MWP) HPLC fingerprint of MWP (see Table 2)
4 Evidence-Based Complementary and Alternative Medicine
Table 3MWP inhibits themRNA expression of inflammatorymediators as well as the protein expression of iNOS inA120573-activated BV2microgliaThe PCR primer of mRNA is shown in the table
TNF-120572 51015840-31015840 (forward) AGTGACAAGCCTGTAGCCCACGT51015840-31015840 (reverse) CCATCGGCTGGCACCACTAGTT
MCP-1 51015840-31015840 (forward) CTTCTGGGCCTGCTGTTCACAGTT51015840-31015840 (reverse) TTCTTGGGGTCAGCACAGACCTCT
IL-1120573 51015840-31015840 (forward) TGGAGAAGCTGTGGCAGCTACCT51015840-31015840 (reverse) GAACGTCACACACCAGCAGGTT
IL-6 51015840-31015840 (forward) ACAAAGCCAGAGTCCTTCAGAGAGA51015840-31015840 (reverse) TGGTCTTGGTCCTTAGCCACTCCT
GAPDH 51015840-31015840 (forward) GGTGAAGGTCGGTGTGAACG51015840-31015840 (reverse) CTCGCTCCTGGAAGATGGTG
obtain cDNA Real-time PCR was performed in an ABI7500real-time PCR instrument (Applied Biosystems) with theSYBR Green qPCR SuperMix and the transcripts wereamplified in a tube containing 1 120583g of cDNA and 01 120583molof each forward and reverse primer The PCR amplificationprocedure was as follows 95∘C for 10min followed by 40cycles of 95∘C for 30 seconds 54∘C for 30 seconds 72∘C for 60seconds and a final extension at 95∘C for 30 seconds 55∘C for30 seconds and 95∘C for 30 seconds Melting curve analysiswas carried out after amplification to verify the accuracy ofthe amplicon
26 Western Blot Analysis Total cell proteins were separatedby SDS-PAGE and transferred onto polyvinylidene fluo-ride (PVDF) membranes The PVDF membranes were thenblocked with 5 nonfat milk and incubated with primaryantibodies at 4∘C overnight The membranes were washedwith PBST (phosphate-buffered saline 01 Tween 20) forthree times and incubated with secondary antibodies at roomtemperature for 1 h The membranes were washed with PBSTfor another three times and visualized using ImmobilonWesternChemiluminescentHRP SubstrateThe relative opti-cal densities were scanned using the Kodak Digital ImagingSystem (Gel Logic 2200Pro Kodak USA)
27 Immunofluorescence Analysis BV2 microglia wereseeded onto glass cover slips and treated with A120573 in theabsence or the presence of MWP for 1 h The cells werefixed with cold 4 paraformaldehyde for 20min andpermeabilized with 05 Triton X-100 for 30min Thecells were then blocked with 5 BSA for 1 h and incubatedwith a primary antibody overnight at 4∘C The cells werewashed with PBS for three times and secondary antibodylabeled with Alexa Fluor-594 was added and incubated for1 h The cells were then washed another three times DAPI(50 120583gmL) was added for 20min at 37∘C in dark and thecoverslips were sealed The cells were visualized using aconfocal microscope (Leica TCS SP8 MP FCS Germany)
28 Statistical Analysis Data were represented as the meanplusmn SD for each group and were assessed by one-way analysisof variance (ANOVA) by using the SPSS 160 software (IBMCorp USA) 119875 lt 005 compared with control group wasconsidered statistically significant
3 Results
31 Identification of the Components of MWP Extract HPLCanalysis was used to identify the ingredients of the MWPextract Twenty-eight compounds were identifiedTheHPLCfingerprint of theMWP extracts and the characterization andsources of these compounds are shown and listed in Figure 1and Table 2
32 MWP Inhibits the mRNA Expression of InflammatoryMediators and the Protein Expression of iNOS in A120573-ActivatedBV2 Microglia We tested the effects of MWP on the mRNAlevels of IL-1120573 IL-6 TNF-120572 and MCP-1 by RT-PCR TheqPCR primer sequences of mRNA and the results are shownin Figures 2(a)ndash2(d) and Table 3 Stimulation with A120573(20120583M) for 6 h upregulated IL-1120573 IL-6 TNF-120572 and MCP-1 gene expression However MWP treatment resulted ina concentration-dependent decrease of IL-1120573 IL-6 TNF-120572and MCP-1 mRNA expression in BV2 microglia Further asshown in Figure 2(e) treatment with A120573 (20120583M) caused anincrease in the protein expression of iNOS MWP treatmentsignificantly inhibited the increase of iNOS expression ina concentration-dependent manner Thus MWP showedinhibitory effects on A120573-challenged BV2microglia activationvia the downregulation of different inflammatory mediatorsand inflammation-related proteins
33 MWP Inhibits NF-120581B (p65) Nuclear Translocation in A120573-Activated BV2 Microglia To further study the mechanism ofaction ofMWPwe investigated the effects ofMWPon crucialinflammatory signaling pathways NF-120581B a key transcriptionfactor was activated by A120573 and translocated to the nucleusWe first examined the nuclear translocation of NF-120581B in BV2microglia by using NF-120581B-specific fluorescence staining andfound that A120573-stimulation induced obvious NF-120581B accumu-lation (purple fluorescence) in the nucleus MWP treatmentsignificantly reversed NF-120581B nuclear translocation cytoplas-mic retention ofNF-120581Bwasmore prominent inMWP-treatedBV2 microglia than in A120573-treated cells (Figure 3(a)) NF-120581Bnuclear translocation was blocked by MWP at a dosage of200mgL in BV2 microglia (Figure 3(b))
34 MWP Inhibits NF-120581B Signaling by Preventing the Phos-phorylation of IKK120573 I120581B and NF-120581B in A120573-Activated BV2Microglia After confirming that MWP inhibits NF-120581B (p65)
Evidence-Based Complementary and Alternative Medicine 5
400
500
300
200
100
0lowastlowast
lowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive T
NF-
120572m
RNA
expr
essio
n (fo
lds o
f con
trol)
(a)
400
800
600
200
0 lowastlowast
lowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive I
L-6
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(b)
40
80
100
60
20
0lowastlowastlowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive I
L-1120573
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(c)
100
200
150
50
0
lowastlowastlowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
expr
essio
n (fo
lds o
f con
trol)
Relat
ive M
CP-1
mRN
A
(d)
iNOSGAPDH
iNOS
GAPDH
2
4
5
3
1
0
lowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
(e)
Figure 2 MWP inhibits the mRNA expression of inflammatory mediators as well as the protein expression of iNOS in A120573-activated BV2microglia BV2 microglia were incubated with A120573 (20120583M) in the presence or absence of MWP (50 100 and 200mgL) for 6 h mRNAexpressions of IL-6 TNF-120572 IL-1120573 and MCP-1 were tested (andashd) BV2 microglia were incubated with A120573 (20 120583M) in the presence or absenceofMWP for 24 h Total protein of the cells was extracted and used to detect the expression of iNOS bywestern blot (e) All values are expressedas mean plusmn standard deviation of triplicate tests 119875 lt 001 and 119875 lt 005 relative to the control group lowast119875 lt 005 and lowastlowast119875 lt 001 relative tothe A120573 group (see Table 3)
nuclear translocation in A120573-activated BV2 microglia weinvestigated the effects of MWP on the activation of NF-120581B As shown in Figure 4 A120573 (20120583M) treatment markedlyinduced NF-120581B phosphorylation which was significantlyreversed by MWP Next we studied two crucial upstreamproteins of the NF-120581B signaling pathway I120581B kinase (IKK)and nuclear factor-120581B (I120581B) As shown in Figure 4 IKK120573and I120581B were phosphorylated after A120573 treatment MWPdownregulated IKK120573 phosphorylation and inhibited I120581Bdegradation in a concentration-dependent manner Theseresults indicated that the NF-120581B signaling pathway is apotential therapeutic target in activated BV2 microglia
35 MWP Inhibits ERKp38 MAPK Signaling in A120573-ActivatedBV2 Microglia We investigated the effects of MWP on themitogen-activated protein kinase (MAPK) signaling pathwayto determine whether MWP suppresses the inflammatoryresponse in BV2 microglia via this pathway As shown inFigure 5 A120573 (20120583M) treatment increased the phosphory-lation of extracellular regulated protein kinase (ERK) andp38 in BV2 microglia which was significantly inhibitedby MWP in a concentration-dependent manner Howeversimilar results were not observed with another MAPK familymember c-Jun NH2-terminal kinase (JNK) Thus MWPcould inhibit ERKp38MAPK signaling pathway in activatedBV2 microglia
4 Discussion
To date there have been relatively few studies on the effects oftraditional Chinese medicine on neuroinflammation How-ever the extensive usage of Chinese herbs [17 22] hasmade such studies necessary Our team has been committedto the research of the anti-inflammatory function of thecompound extracted from traditional Chinese medicine andthe effect has been verified [23] The result could also beenconsidered the positive exploration of the pharmacologicalactivity of traditional ChinesemedicineMWP is a traditionalChinese medicine prescription In our previous work weshowed that MWP could protect rat astrocytes from damagedue to neuroinflammation induced by LPS [22] In thisstudy we aimed to determine whether MWP could inhibitneuroinflammation in A120573-activated BV2 microglia and themechanisms of its action
AD is associated with upregulation of proinflammatorycytokines which can initiate plaque production and enhancenerve cell degeneration [24] Inflammatory factors are impli-cated in dementia-related peripheral disease and cerebralnervous system diseases [25] Cerebral A120573 accumulation isthe primary influence in AD [26] Overactivated microgliacould stimulate the immune system which is overwhelmedby A120573 deposition Inflammation then becomes chronic andadverse resulting in accelerated neurodegeneration [7 10] Inour study the stimulation by A120573 (20120583M) could increase the
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
4 Evidence-Based Complementary and Alternative Medicine
Table 3MWP inhibits themRNA expression of inflammatorymediators as well as the protein expression of iNOS inA120573-activated BV2microgliaThe PCR primer of mRNA is shown in the table
TNF-120572 51015840-31015840 (forward) AGTGACAAGCCTGTAGCCCACGT51015840-31015840 (reverse) CCATCGGCTGGCACCACTAGTT
MCP-1 51015840-31015840 (forward) CTTCTGGGCCTGCTGTTCACAGTT51015840-31015840 (reverse) TTCTTGGGGTCAGCACAGACCTCT
IL-1120573 51015840-31015840 (forward) TGGAGAAGCTGTGGCAGCTACCT51015840-31015840 (reverse) GAACGTCACACACCAGCAGGTT
IL-6 51015840-31015840 (forward) ACAAAGCCAGAGTCCTTCAGAGAGA51015840-31015840 (reverse) TGGTCTTGGTCCTTAGCCACTCCT
GAPDH 51015840-31015840 (forward) GGTGAAGGTCGGTGTGAACG51015840-31015840 (reverse) CTCGCTCCTGGAAGATGGTG
obtain cDNA Real-time PCR was performed in an ABI7500real-time PCR instrument (Applied Biosystems) with theSYBR Green qPCR SuperMix and the transcripts wereamplified in a tube containing 1 120583g of cDNA and 01 120583molof each forward and reverse primer The PCR amplificationprocedure was as follows 95∘C for 10min followed by 40cycles of 95∘C for 30 seconds 54∘C for 30 seconds 72∘C for 60seconds and a final extension at 95∘C for 30 seconds 55∘C for30 seconds and 95∘C for 30 seconds Melting curve analysiswas carried out after amplification to verify the accuracy ofthe amplicon
26 Western Blot Analysis Total cell proteins were separatedby SDS-PAGE and transferred onto polyvinylidene fluo-ride (PVDF) membranes The PVDF membranes were thenblocked with 5 nonfat milk and incubated with primaryantibodies at 4∘C overnight The membranes were washedwith PBST (phosphate-buffered saline 01 Tween 20) forthree times and incubated with secondary antibodies at roomtemperature for 1 h The membranes were washed with PBSTfor another three times and visualized using ImmobilonWesternChemiluminescentHRP SubstrateThe relative opti-cal densities were scanned using the Kodak Digital ImagingSystem (Gel Logic 2200Pro Kodak USA)
27 Immunofluorescence Analysis BV2 microglia wereseeded onto glass cover slips and treated with A120573 in theabsence or the presence of MWP for 1 h The cells werefixed with cold 4 paraformaldehyde for 20min andpermeabilized with 05 Triton X-100 for 30min Thecells were then blocked with 5 BSA for 1 h and incubatedwith a primary antibody overnight at 4∘C The cells werewashed with PBS for three times and secondary antibodylabeled with Alexa Fluor-594 was added and incubated for1 h The cells were then washed another three times DAPI(50 120583gmL) was added for 20min at 37∘C in dark and thecoverslips were sealed The cells were visualized using aconfocal microscope (Leica TCS SP8 MP FCS Germany)
28 Statistical Analysis Data were represented as the meanplusmn SD for each group and were assessed by one-way analysisof variance (ANOVA) by using the SPSS 160 software (IBMCorp USA) 119875 lt 005 compared with control group wasconsidered statistically significant
3 Results
31 Identification of the Components of MWP Extract HPLCanalysis was used to identify the ingredients of the MWPextract Twenty-eight compounds were identifiedTheHPLCfingerprint of theMWP extracts and the characterization andsources of these compounds are shown and listed in Figure 1and Table 2
32 MWP Inhibits the mRNA Expression of InflammatoryMediators and the Protein Expression of iNOS in A120573-ActivatedBV2 Microglia We tested the effects of MWP on the mRNAlevels of IL-1120573 IL-6 TNF-120572 and MCP-1 by RT-PCR TheqPCR primer sequences of mRNA and the results are shownin Figures 2(a)ndash2(d) and Table 3 Stimulation with A120573(20120583M) for 6 h upregulated IL-1120573 IL-6 TNF-120572 and MCP-1 gene expression However MWP treatment resulted ina concentration-dependent decrease of IL-1120573 IL-6 TNF-120572and MCP-1 mRNA expression in BV2 microglia Further asshown in Figure 2(e) treatment with A120573 (20120583M) caused anincrease in the protein expression of iNOS MWP treatmentsignificantly inhibited the increase of iNOS expression ina concentration-dependent manner Thus MWP showedinhibitory effects on A120573-challenged BV2microglia activationvia the downregulation of different inflammatory mediatorsand inflammation-related proteins
33 MWP Inhibits NF-120581B (p65) Nuclear Translocation in A120573-Activated BV2 Microglia To further study the mechanism ofaction ofMWPwe investigated the effects ofMWPon crucialinflammatory signaling pathways NF-120581B a key transcriptionfactor was activated by A120573 and translocated to the nucleusWe first examined the nuclear translocation of NF-120581B in BV2microglia by using NF-120581B-specific fluorescence staining andfound that A120573-stimulation induced obvious NF-120581B accumu-lation (purple fluorescence) in the nucleus MWP treatmentsignificantly reversed NF-120581B nuclear translocation cytoplas-mic retention ofNF-120581Bwasmore prominent inMWP-treatedBV2 microglia than in A120573-treated cells (Figure 3(a)) NF-120581Bnuclear translocation was blocked by MWP at a dosage of200mgL in BV2 microglia (Figure 3(b))
34 MWP Inhibits NF-120581B Signaling by Preventing the Phos-phorylation of IKK120573 I120581B and NF-120581B in A120573-Activated BV2Microglia After confirming that MWP inhibits NF-120581B (p65)
Evidence-Based Complementary and Alternative Medicine 5
400
500
300
200
100
0lowastlowast
lowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive T
NF-
120572m
RNA
expr
essio
n (fo
lds o
f con
trol)
(a)
400
800
600
200
0 lowastlowast
lowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive I
L-6
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(b)
40
80
100
60
20
0lowastlowastlowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive I
L-1120573
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(c)
100
200
150
50
0
lowastlowastlowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
expr
essio
n (fo
lds o
f con
trol)
Relat
ive M
CP-1
mRN
A
(d)
iNOSGAPDH
iNOS
GAPDH
2
4
5
3
1
0
lowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
(e)
Figure 2 MWP inhibits the mRNA expression of inflammatory mediators as well as the protein expression of iNOS in A120573-activated BV2microglia BV2 microglia were incubated with A120573 (20120583M) in the presence or absence of MWP (50 100 and 200mgL) for 6 h mRNAexpressions of IL-6 TNF-120572 IL-1120573 and MCP-1 were tested (andashd) BV2 microglia were incubated with A120573 (20 120583M) in the presence or absenceofMWP for 24 h Total protein of the cells was extracted and used to detect the expression of iNOS bywestern blot (e) All values are expressedas mean plusmn standard deviation of triplicate tests 119875 lt 001 and 119875 lt 005 relative to the control group lowast119875 lt 005 and lowastlowast119875 lt 001 relative tothe A120573 group (see Table 3)
nuclear translocation in A120573-activated BV2 microglia weinvestigated the effects of MWP on the activation of NF-120581B As shown in Figure 4 A120573 (20120583M) treatment markedlyinduced NF-120581B phosphorylation which was significantlyreversed by MWP Next we studied two crucial upstreamproteins of the NF-120581B signaling pathway I120581B kinase (IKK)and nuclear factor-120581B (I120581B) As shown in Figure 4 IKK120573and I120581B were phosphorylated after A120573 treatment MWPdownregulated IKK120573 phosphorylation and inhibited I120581Bdegradation in a concentration-dependent manner Theseresults indicated that the NF-120581B signaling pathway is apotential therapeutic target in activated BV2 microglia
35 MWP Inhibits ERKp38 MAPK Signaling in A120573-ActivatedBV2 Microglia We investigated the effects of MWP on themitogen-activated protein kinase (MAPK) signaling pathwayto determine whether MWP suppresses the inflammatoryresponse in BV2 microglia via this pathway As shown inFigure 5 A120573 (20120583M) treatment increased the phosphory-lation of extracellular regulated protein kinase (ERK) andp38 in BV2 microglia which was significantly inhibitedby MWP in a concentration-dependent manner Howeversimilar results were not observed with another MAPK familymember c-Jun NH2-terminal kinase (JNK) Thus MWPcould inhibit ERKp38MAPK signaling pathway in activatedBV2 microglia
4 Discussion
To date there have been relatively few studies on the effects oftraditional Chinese medicine on neuroinflammation How-ever the extensive usage of Chinese herbs [17 22] hasmade such studies necessary Our team has been committedto the research of the anti-inflammatory function of thecompound extracted from traditional Chinese medicine andthe effect has been verified [23] The result could also beenconsidered the positive exploration of the pharmacologicalactivity of traditional ChinesemedicineMWP is a traditionalChinese medicine prescription In our previous work weshowed that MWP could protect rat astrocytes from damagedue to neuroinflammation induced by LPS [22] In thisstudy we aimed to determine whether MWP could inhibitneuroinflammation in A120573-activated BV2 microglia and themechanisms of its action
AD is associated with upregulation of proinflammatorycytokines which can initiate plaque production and enhancenerve cell degeneration [24] Inflammatory factors are impli-cated in dementia-related peripheral disease and cerebralnervous system diseases [25] Cerebral A120573 accumulation isthe primary influence in AD [26] Overactivated microgliacould stimulate the immune system which is overwhelmedby A120573 deposition Inflammation then becomes chronic andadverse resulting in accelerated neurodegeneration [7 10] Inour study the stimulation by A120573 (20120583M) could increase the
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 5
400
500
300
200
100
0lowastlowast
lowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive T
NF-
120572m
RNA
expr
essio
n (fo
lds o
f con
trol)
(a)
400
800
600
200
0 lowastlowast
lowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive I
L-6
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(b)
40
80
100
60
20
0lowastlowastlowastlowast
lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Rela
tive I
L-1120573
mRN
Aex
pres
sion
(fold
s of c
ontro
l)
(c)
100
200
150
50
0
lowastlowastlowastlowast lowastlowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
expr
essio
n (fo
lds o
f con
trol)
Relat
ive M
CP-1
mRN
A
(d)
iNOSGAPDH
iNOS
GAPDH
2
4
5
3
1
0
lowast
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
(e)
Figure 2 MWP inhibits the mRNA expression of inflammatory mediators as well as the protein expression of iNOS in A120573-activated BV2microglia BV2 microglia were incubated with A120573 (20120583M) in the presence or absence of MWP (50 100 and 200mgL) for 6 h mRNAexpressions of IL-6 TNF-120572 IL-1120573 and MCP-1 were tested (andashd) BV2 microglia were incubated with A120573 (20 120583M) in the presence or absenceofMWP for 24 h Total protein of the cells was extracted and used to detect the expression of iNOS bywestern blot (e) All values are expressedas mean plusmn standard deviation of triplicate tests 119875 lt 001 and 119875 lt 005 relative to the control group lowast119875 lt 005 and lowastlowast119875 lt 001 relative tothe A120573 group (see Table 3)
nuclear translocation in A120573-activated BV2 microglia weinvestigated the effects of MWP on the activation of NF-120581B As shown in Figure 4 A120573 (20120583M) treatment markedlyinduced NF-120581B phosphorylation which was significantlyreversed by MWP Next we studied two crucial upstreamproteins of the NF-120581B signaling pathway I120581B kinase (IKK)and nuclear factor-120581B (I120581B) As shown in Figure 4 IKK120573and I120581B were phosphorylated after A120573 treatment MWPdownregulated IKK120573 phosphorylation and inhibited I120581Bdegradation in a concentration-dependent manner Theseresults indicated that the NF-120581B signaling pathway is apotential therapeutic target in activated BV2 microglia
35 MWP Inhibits ERKp38 MAPK Signaling in A120573-ActivatedBV2 Microglia We investigated the effects of MWP on themitogen-activated protein kinase (MAPK) signaling pathwayto determine whether MWP suppresses the inflammatoryresponse in BV2 microglia via this pathway As shown inFigure 5 A120573 (20120583M) treatment increased the phosphory-lation of extracellular regulated protein kinase (ERK) andp38 in BV2 microglia which was significantly inhibitedby MWP in a concentration-dependent manner Howeversimilar results were not observed with another MAPK familymember c-Jun NH2-terminal kinase (JNK) Thus MWPcould inhibit ERKp38MAPK signaling pathway in activatedBV2 microglia
4 Discussion
To date there have been relatively few studies on the effects oftraditional Chinese medicine on neuroinflammation How-ever the extensive usage of Chinese herbs [17 22] hasmade such studies necessary Our team has been committedto the research of the anti-inflammatory function of thecompound extracted from traditional Chinese medicine andthe effect has been verified [23] The result could also beenconsidered the positive exploration of the pharmacologicalactivity of traditional ChinesemedicineMWP is a traditionalChinese medicine prescription In our previous work weshowed that MWP could protect rat astrocytes from damagedue to neuroinflammation induced by LPS [22] In thisstudy we aimed to determine whether MWP could inhibitneuroinflammation in A120573-activated BV2 microglia and themechanisms of its action
AD is associated with upregulation of proinflammatorycytokines which can initiate plaque production and enhancenerve cell degeneration [24] Inflammatory factors are impli-cated in dementia-related peripheral disease and cerebralnervous system diseases [25] Cerebral A120573 accumulation isthe primary influence in AD [26] Overactivated microgliacould stimulate the immune system which is overwhelmedby A120573 deposition Inflammation then becomes chronic andadverse resulting in accelerated neurodegeneration [7 10] Inour study the stimulation by A120573 (20120583M) could increase the
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
6 Evidence-Based Complementary and Alternative Medicine
DA
PIM
erge
d
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
NF-
120581B
(p65
)
0 25(120583m)
(a)
40
10
20
30
0
lowast
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
+ +
+
minus
minus minus
A120573 (20 120583M)MWP (200 mgL)
Relat
ive n
ucle
ar v
ersu
s cyt
opla
sm N
F-120581
B (p
65)
expr
essio
n (fo
lds o
f con
trol)
NF-120581B (p65)(cytoplasm)
120572-Tubulin(cytoplasm)
NF-120581B (p65)(nuclear)
Histone H3(nuclear)
(b)
Figure 3MWP inhibits NF-120581B (p65) nuclear translocation in A120573-activated BV2 microglia BV2 microglia were incubated with A120573 (20 120583M) inthe presence or absence of MWP (200mgL) for 1 h Immunofluorescence analysis using an NF-120581B (p65) antibody was performed We usedconfocal laser scanning microscopy to observe the translocation of NF-120581B (p65 red) into the nucleus (blue scale bar = 25 120583m) (a) Westernblot showed that MWP inhibited the nuclear translocation of NF-120581B (p65) in A120573-activated BV-2 microglia (b) Data are presented as meanplusmn standard deviation from independent experiments performed in triplicate 119875 lt 005 relative to the control group lowast119875 lt 005 relative to theA120573 group
mRNA expression of IL-1120573 IL-6 TNF-120572 and MCP-1 whichare common inflammatory factors However MWP treat-ment could inhibit thismRNA expression in a concentration-dependent manner in BV2 microglia Moreover treatmentwith MWP resulted in concentration-dependent attenuationof iNOS expression in BV2 microglia All these results
confirmed the potential of MWP in preventing neuroinflam-mation
The NF-120581B signaling pathway is canonical in regulatinginflammation The activation of this pathway starts withthe phosphorylation of upstream IKK The protein I120581Bwhich is connected with NF-120581B then degrades and separates
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 7
lowastlowastlowast
lowastlowastlowastlowastlowastlowast lowastlowast
lowastlowastlowastlowast
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)
15
10
5
0
p-IKK120573IKK120573p-I120581BI120581Bp-NF-120581B (p65)NF-120581B (p65)
p-IKK120573
IKK120573
p-I120581B
I120581B
p-NF-120581B (p65)
NF-120581B (p65)
GAPDH + + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)
Figure 4 MWP inhibits the NF-120581B signaling pathway in A120573-activated BV2 microglia BV2 microglia were incubated with or without MWP(50 100 and 200mgL) for 30min and stimulated with A120573 (20 120583M) for another 30min The total protein of the cells was then extracted andanalyzed by western blot Values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 and 119875 lt 001 relative to the controlgroup lowast119875 lt 005 and lowastlowast119875 lt 001 relative to the A120573 group
p-ERK p-ERKERK
p-p38p38
ERK
p-p38
p38
p-JNK
JNK
GAPDH
+ + + +minus
minus minus 50 100 200A120573 (20 120583M)
MWP (mgL)+ + + +minus
minus minus 50 100 200
A120573 (20 120583M)MWP (mgL)
lowast lowast
lowast
1500
1000
500
0
Relat
ive p
rote
in ex
pres
sion
(fold
s of c
ontro
l)Re
lativ
e pro
tein
expr
essio
n(fo
lds o
f con
trol)
10
4
6
8
2
0
Figure 5MWP inhibits the ERKp38MAPK signaling pathway in A120573-activated BV2microglia BV2microglia were incubated with or withoutMWP (50 100 and 200mgL) for 30min and stimulated with A120573 (20120583M) for another 30minThe total protein of the cells was extracted andanalyzed by western blot The values are expressed as mean plusmn standard deviation of triplicate tests 119875 lt 005 relative to the control grouplowast119875 lt 005 relative to the A120573 group
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
8 Evidence-Based Complementary and Alternative Medicine
A120573
IKK120573
IKK120573P
P P
P
P
P
MWP p38 ERK
p38 ERK
Degradation
p65
p65
p50
p65
Nucleus
Inflammation gene expression
(NF-120581B)
ActivationInhibition
I120581 B
I120581 B
Neurotoxicity
Figure 6 Potential antineuroinflammatory mechanisms of MWP activity on activated BV2 microglia A120573 activates BV2 microglia viathe IKK120573I120581BNF-120581B and ERKp38 MAPK signaling pathways resulting in the activation of multiple proinflammatory mediators andthe translocation of NF-120581B (p65) into the nucleus MWP can inhibit the activation of these signaling pathways thereby effectingantineuroinflammatory activity in BV2 microglia
Activated NF-120581B exists as p-NF-120581B and is translocated to thenucleus to regulate the expression of inflammatory factors Asan important transcription factor NF-120581B participates in theregulation of the immune system and inflammatory response[27] NF-120581B binds to DNA and its transcriptional activityregulates several genes which promote neuroinflammation[28] Microglia-mediated inflammation has been linked tothe pathogenesis of CNS diseases [29] Certain Chinese herbsor their extracts suppress the activation of BV2 microgliaby inhibiting NF-120581B signaling [28 30] In our research wefound that A120573 could phosphorylate IKK120573 I120581B and NF-120581B
and induce degradation of I120581B and nuclear translocation ofNF-120581B MWP evidently inhibited the expression of p-IKK120573p-I120581B and p-NF-120581B in a concentration-dependent mannerThe nuclear translocation of NF-120581Bwas also preventedThusMWP could inhibit neuroinflammation by suppressing theactivation of NF-120581B in A120573-activated BV2 microglia
MAPK is another signaling pathway that has been impli-cated in the mechanism of inflammation ERK p38 andJNK are among the most studied members of the MAPKfamily Injection of A120573 in rat models could induce cognitiveimpairment and neuroinflammation by promoting nuclear
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 9
translocation of NF-120581B and activating the ERKp38 MAPKsignaling pathway [31] Additionally microglia activationand proinflammatory responses occur by the modulationof a series of intracellular signaling pathways includingIKKI120581B and MAPK with the activation of A120573 [32 33]The prescription of herbs could improve A120573-activated cog-nitive deficits through modulation of neuroinflammationby inhibiting ERK JNK and p38 MAPK pathways [34]Thus studies on the MAPK signaling pathway could providea basis for the discovery of therapeutic targets to inhibitneuroinflammation In our study ERK p38 and JNK wereactivated and phosphorylated by A120573 while MWP inhibitedthe expression of p-ERK and p38 However we did notachieve the same result with p-JNK Therefore MWP couldinhibit the activation of ERKp38 MAPK in A120573-activatedBV2 microglia
Although quantities of data have proved the possiblemechanisms ofMWP in regulating the occurrence of AD it isstill a pity that the relevant clinical trials are rarely processedIt would be of great significance to conduct the population-based researches for the further exploration of the traditionalapplication of MWP in remitting the generation and devel-opment of AD
5 Conclusion
The traditional Chinese decoction MWP could effectivelyinhibit neuroinflammatory responses and the release ofinflammatory factors such as IL-1120573 IL-6 TNF-120572 and MCP-1 and the expression of iNOS This function was mainlyobtained by the suppression of the NF-120581B and ERKp38MAPK signaling pathways (Figure 6) All our data indicatedthat MWP is a potential candidate in the treatment ofneuroinflammation and merits further study
Conflicts of Interest
The authors declare that they have no conflicts of interest
Acknowledgments
This work was supported by the National Natural Sci-ence Foundation of China [Grants nos 81173369 8130325381530097 and 81222051] the National Key Technology RampDProgram ldquoNew Drug Innovationrdquo of China [Grants nos2012ZX09301002-002-002 and 2012ZX09304-005] the Natu-ral Science Foundation of Beijing [Grant no 7132210] and theDoctoral Scientific Fund Project of theMinistry of Educationof China [Grant no 20120001110105] The authors would liketo thank the native English speaking scientists of ElixigenCompany (Huntington Beach California) for editing ourmanuscript
References
[1] H Akiyama S Barger S Barnum et al ldquoInflammation andAlzheimerrsquos diseaserdquo Neurobiology of Aging vol 21 no 3 pp383ndash421 2000
[2] L E Santos D Beckman and S T Ferreira ldquoMicroglial dys-function connects depression and Alzheimerrsquos diseaserdquo BrainBehavior and Immunity vol 55 pp 151ndash165 2016
[3] D Krstic and I Knuesel ldquoDeciphering the mechanism under-lying late-onset Alzheimer diseaserdquo Nature Reviews Neurologyvol 9 no 1 pp 25ndash34 2013
[4] Q Alam M Z Alam G Mushtaq et al ldquoInflammatoryprocess in Alzheimerrsquos and Parkinsonrsquos diseases central role ofcytokinesrdquo Current Pharmaceutical Design vol 22 no 5 pp541ndash548 2016
[5] M T Heneka M J Carson J El Khoury et al ldquoNeuroinflam-mation in Alzheimerrsquos diseaserdquo The Lancet Neurology vol 14no 4 pp 388ndash405 2015
[6] A Surendranathan J B Rowe and J T OrsquoBrien ldquoNeuroin-flammation in Lewy body dementiardquo Parkinsonism and RelatedDisorders vol 21 no 12 pp 1398ndash1406 2015
[7] L Malmsten S Vijayaraghavan O Hovatta A Marutleand T Darreh-Shori ldquoFibrillar 120573-amyloid 1-42 alters cytokinesecretion cholinergic signalling and neuronal differentiationrdquoJournal of Cellular and Molecular Medicine vol 18 no 9 pp1874ndash1888 2014
[8] N S Patel D Paris V Mathura A N Quadros F C Crawfordand M J Mullan ldquoInflammatory cytokine levels correlatewith amyloid load in transgenic mouse models of Alzheimerrsquosdiseaserdquo Journal of Neuroinflammation vol 2 no 1 article 92005
[9] L-F Lue R Rydel E F Brigham et al ldquoInflammatory reper-toire of Alzheimerrsquos disease and nondemented elderlymicrogliain vitrordquo Glia vol 35 no 1 pp 72ndash79 2001
[10] H W Querfurth and F M LaFerla ldquoAlzheimerrsquos diseaserdquo TheNew England Journal of Medicine vol 362 no 4 pp 329ndash3442010
[11] C Haass and D J Selkoe ldquoSoluble protein oligomers inneurodegeneration lessons from the Alzheimerrsquos amyloid 120573-peptiderdquo Nature Reviews Molecular Cell Biology vol 8 no 2pp 101ndash112 2007
[12] R Kacimi R G Giffard and M A Yenari ldquoEndotoxin-activated microglia injure brain derived endothelial cells viaNF-120581B JAK-STAT and JNK stress kinase pathwaysrdquo Journal ofInflammation vol 8 article 7 2011
[13] N Origlia O Arancio L Domenici and S S Yan ldquoMAPK 120573-amyloid and synaptic dysfunction the role of RAGErdquo ExpertReview of Neurotherapeutics vol 9 no 11 pp 1635ndash1645 2009
[14] D-K Yu B Lee M Kwon et al ldquoPhlorofucofuroeckol Bsuppresses inflammatory responses by down-regulating nuclearfactor 120581B activation via Akt ERK and JNK in LPS-stimulatedmicroglial cellsrdquo International Immunopharmacology vol 28no 2 pp 1068ndash1075 2015
[15] S Leow-Dyke C Allen A Denes et al ldquoNeuronal toll-likereceptor 4 signaling induces brain endothelial activation andneutrophil transmigration in vitrordquo Journal of Neuroinflamma-tion vol 9 article 230 2012
[16] K W Zeng X M Wang H Fu and G X Liu ldquoModified WuziYanzong prescription inhibited tau protein hyperphosphory-lation induced by A12057325-35 in PC12 cellsrdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 17 no 9 pp159ndash163 2011
[17] F J Song Y X Song K W Zeng P F Tu and X M WangldquoInhibitory effects of modified Wuzi Yanzong prescription onLPS-induced inflammatory Response on BV-2 microglial cellsrdquoChinese Journal of Experimental Traditional Medical Formulaevol 19 no 24 pp 177ndash180 2013
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
10 Evidence-Based Complementary and Alternative Medicine
[18] KW Zeng X MWang H Fu and G X Liu ldquoProtective effectof cerebrospinal fluid containing Jiawei Wuzi Yanzong formulaon 120573-amyloid protein-induced injury of hippocampal neuronsrdquoChinese Journal of Integrative Medicine vol 30 no 8 pp 851ndash856 2010
[19] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription and its components on spatial behaviorin mice with learning and memory disordersrdquo Chinese Journalof Integrated Traditional and Western Medicine in Intensive andCritical Care vol 12 no 5 pp 271ndash274 2005
[20] S L Chu G X Liu and X MWang ldquoEffects of modifiedWuziYanzong prescription on spatial behavior in mice with learningand memory disordersrdquo Tianjin Journal of Traditional ChinesMedicine vol 23 no 3 pp 231ndash233 2006
[21] H Fu X M Wang and G X Liu ldquoEffect of modified WuziYanzong prescription and its components on spatial behaviorin rats induced by 120573-amyloid peptide25-35rdquo Chinese Journal ofExperimental Traditional Medical Formulae vol 15 no 6 pp44ndash47 2009
[22] K-W Zeng T ZhangH Fu G-X Liu andX-MWang ldquoMod-ifiedWu-Zi-Yan-Zong prescription a traditional Chinese poly-herbal formula suppresses lipopolysaccharide-induced neu-roinflammatory processes in rat astrocytes via NF-120581B andJNKp38MAPK signaling pathwaysrdquo Phytomedicine vol 19 no2 pp 122ndash129 2012
[23] Q Yu K Zeng X Ma et al ldquoResokaempferol-mediated anti-inflammatory effects on activated macrophages via the inhi-bition of JAK2STAT3 NF-120581B and JNKp38 MAPK signalingpathwaysrdquo International Immunopharmacology vol 38 pp104ndash114 2016
[24] G Azizi S S Navabi A Al-Shukaili M H SeyedzadehR Yazdani and A Mirshafiey ldquoThe role of inflammatorymediators in the pathogenesis of Alzheimerrsquos diseaserdquo SultanQaboos University Medical Journal vol 15 no 3 pp e305ndashe3162015
[25] P Eikelenboom J J M Hoozemans R Veerhuis E Van ExelA J M Rozemuller and W A Van Gool ldquoWhether when andhow chronic inflammation increases the risk of developing late-onset Alzheimerrsquos diseaserdquoAlzheimerrsquos Research ampTherapy vol4 no 3 article 15 2012
[26] J Hardy and D J Selkoe ldquoThe amyloid hypothesis ofAlzheimerrsquos disease progress and problems on the road totherapeuticsrdquo Science vol 297 no 5580 pp 353ndash356 2002
[27] N D Perkins ldquoThe RelNF-120581B family friend and foerdquo Trendsin Biochemical Sciences vol 25 no 9 pp 434ndash440 2000
[28] U P Okorji R Velagapudi A El-Bakoush B L Fiebichand O A Olajide ldquoAntimalarial drug artemether inhibitsneuroinflammation in BV2 microglia through Nrf2-dependentmechanismsrdquoMolecular Neurobiology vol 53 no 9 pp 6426ndash6443 2016
[29] F Zhang H Wang Q Wu et al ldquoResveratrol protects corticalneurons against microglia-mediated neuroinflammationrdquo Phy-totherapy Research vol 27 no 3 pp 344ndash349 2013
[30] H Hu Z Li X Zhu et al ldquoGua Lou Gui Zhi decoctionsuppresses LPS-induced activation of the TLR4NF-120581Bpathwayin BV-2murinemicroglial cellsrdquo International Journal of Molec-ular Medicine vol 31 no 6 pp 1327ndash1332 2013
[31] H Liu Y Deng J Gao et al ldquoSodium hydrosulfide attenuatesbeta-amyloid-induced cognitive deficits and neuroinflamma-tion via modulation of MAPKNF-120581B pathway in ratsrdquo CurrentAlzheimer Research vol 12 no 7 pp 673ndash683 2015
[32] WYuHWangH Ying et al ldquoDaphnetin attenuatesmicroglialactivation and proinflammatory factor production via multiplesignaling pathwaysrdquo International Immunopharmacology vol21 no 1 pp 1ndash9 2014
[33] S Y Park M L Jin Y H Kim Y Kim and S J Lee ldquoAnti-inflammatory effects of aromatic-turmerone through blockingof NF-120581B JNK and p38 MAPK signaling pathways in amyloid120573-stimulated microgliardquo International Immunopharmacologyvol 14 no 1 pp 13ndash20 2012
[34] M Y Park Y S Jung J H Park et al ldquoPMC-12 a prescriptionof traditional Korean medicine improves amyloid 120573-inducedcognitive deficits through modulation of neuroinflammationrdquoEvidence-Based Complementary and Alternative Medicine vol2015 Article ID 768049 10 pages 2015
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Submit your manuscripts athttpswwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
