School of Biological Sciences

Amino Acid Transport and Metabolism by Rhizobium leguminosarum.

By

James White

Submitted in partial fulfilment of the requirement for the degree of Doctor of Philosophy 2006.

II

For Jenny and my Grandfather.

III

I declare that this thesis is my own account of my research and that this work has not

previously been submitted for a degree in another university. However, I would like to

acknowledge the contribution made by Arthur Hosie and Seonag Kinghorn in providing

some of the strains and plasmids used in this work, as attributed in the text. I would also

like to acknowledge Kim Findlay for the light micrograph and electron micrograph work on

plant nodules sections.

James White

IV

Acknowledgements.

I would like to take this opportunity to thank those people who have made

significant contributions during my time in the lab. In particular Arthur Hosie for guidance

within the first few months of my PhD, Marc Fox for help with transduction and Tn5 work,

KK for his molecular cloning protocols, Vinoy for help with qRT-PCR and Alx Bourdés for

help with plant experiments and enzyme assays. I would also like to thank Philip Poole for

providing me with the opportunity to carry out this work and the BBSRC for the

sponsorship to do so.

On a personal note I would like to thank everyone who helped me through the

course of my PhD, but in particular those last few months of lab work and writing up. I

would like to express my gratitude for the support shown by friends, my own family and

also that of Jenny’s.

Finally this is for Jenny Nicholson whose love, support and inspiration throughout

make this work as much hers as mine.

V

Abstract.

Symbiotic nitrogen fixation involves the supply of dicarboxylates to the bacteroid to

fuel nitrogenase for the supply of ammonium to the plant. It was recently proposed that

ammonium assimilation may be shut down in the bacteroid because of amino acid cycling

(Lodwig et al., 2003). It has long been known that glutamate supplied to isolated bacteroids

stimulates secretion of aspartate and alanine (Appels and Haaker, 1991; Rosendahl et al.,

1992). Conclusive evidence for the importance of amino acid cycling was demonstrated by

mutation of the two principal broad range amino acid transporters; the general amino acid

permease (Aap) and the branched chain amino acid permease (Bra) (Lodwig et al., 2003).

They predicted a new model for symbiotic nitrogen fixation where malate and glutamate

were supplied to bacteroids, allowing ammonium assimilation to shutdown, with

ammonium and aspartate returned to the plant. However, the exact amino acids that move

via the Aap and Bra remained undetermined, as both permeases are broad range amino acid

transporters. This works demonstrates that mutation of the AapJ and BraC leads to a

narrowing of amino acid uptake solute specificity. This is because an alternative solute

binding protein (BraC3) can replace BraC for uptake of aliphatic amino acids through

interaction with the expressed Bra membrane complex. A strain mutated in aapJ and braC

inoculated onto pea plants was capable of eliciting a Fix+ phenotype indicating alanine

transport alone as being necessary for effective plant growth. The further triple mutation in

all SBPs abolished this Fix+ phenotype indicating one of any three SBPs is the minimum

requirement for amino acid cycling.

The strategies employed above excluded transport of aspartate and glutamate via

Aap / Bra so any transaminating donor would have to enter via another transport system.

The alternative is that alanine is synthesised de novo from ammonium and a 2-keto acid.

Whilst mutation in the principal ammonium assimilation pathway GS / GOGAT was

detrimental to bacteroid differentiation this could be overcome by complementation in trans

with other amino acid transporters to increase the rate of uptake into cells. A double mutant

of GOGAT and AldA was able to Fix N2 indicating the bacteroid does not need to

assimilate ammonium. This suggests that a complete amino acid cycle between plant and

bacteroid occurs.

The high intracellular concentration of GABA in pea nodules indicates that this

amino acid may have role in symbiotic nitrogen fixation (Scharff et al., 2003). Bacteroid

activities of enzymes for GABA catabolism are also highly expressed in pea bacteroids,

most notably two GABA transaminases (Prell et al., 2002). A GABA specific transporter

VI

was identified that is not expressed in free-living wild-type strains but may be nodule

specific. Whilst mutation of this transport system had no effect on the symbiotic phenotype

other homologues of Gst are present in the genome of R. leguminosarum indicating a

GABA alanine cycle may occur between the plant and bacteroid.

VII

Abbreviations.

Aap General amino acid permease

AatA Aspartate aminotransferase

ABC ATP-binding cassette

ACN Aconitase

ADH / AldA Alanine dehydrogenase

AIB 2-Amino-isobutyric acid

ALA δ -Aminolevulinic acid

AlCl3 Aluminium chloride

AMA Acid minimal agar

amp Ampicillin

AMS Acid minimal salts

APE Atom percentage excess

APT Aspartate pyruvate transaminase

ATP Adenosine triphosphate

BAP Bacterial alkaline phosphatase

bp Base pair

Bra Branched chain amino acid permease

bv. biovar

cfu Colony forming units

Ci Curie

CuCl2 Copper chloride

CS Citrate synthase

Dct Dicarboxylate transport system

DNA Deoxyribonucleic acid

dNTP 2’-deoxynucleoside 5’-triphosphate

EDTA Ethylenediaminetetraacetic acid

EPS Exopolysaccharide

et al. et alii

Fix Fixation

Fix+ Nitrogen fixing phenotype

Fix- Non-nitrogen fixing phenotype

FUM Fumarase

GABA γ-amino-n-butryic Acid

VIII

GC Gas chromatography

GDC Glutamate decarboxylase

GDH Glutamate dehydrogenase

gen Gentamycin

GFP Green fluorescent protein

Glc Glucose

GOGAT Glutamine – 2-oxoglutarate aminotransferase (glutamate synthase)

GOT Glutamate oxaloacetate transaminase

GPT Glutamate pyruvate transaminase

GS Glutamine synthetase

GUS β –glucuronidase

HAAT Hydrophobic amino acid transporter family

HEPES N-[2-hydroxyethyl]piperazine-N’-[2-ethanesulphonic acid]

ICDH Isocitrate dehydrogenase

ICL Isocitrate lyase

IMP Integral membrane permease

IS50 Insertion sequence 50

IT Infection thread

kan Kanamycin

Kb Kilobase (pairs)

KCl Potassium chloride

LA Luria-Bertani agar

LB Luria-Bertani broth

LPS Lipopolysaccharide

MDH Malate dehydrogenase

ME Malic enzyme

MgCl2 Magnesium chloride

MgSO4 Magnesium sulphate

MGT Mean generation time

MOPS 3-[N-morpholino]propanesulfonic acid

mRNA Messenger ribonucleic acid

MS Malate synthase

N-free Nitrogen free

NaCl Sodium chloride

NAD+ Nicotinamide adenine dinucleotide (oxidised form)

IX

NADH Nicotinamide adenine dinucleotide (reduced form)

NADP+ Nicotinamide adenine dinucleotide phosphate (oxidised form)

NADPH Nicotinamide adenine dinucleotide phosphate (reduced form)

nal Naladixic acid

NBD Nucleotide binding domain

neo Neomycin

nH2O Nanopure water

NH4+ Ammonium

Nod Nodulation

nys Nystatin

OD Optical density

ODC 2-oxoglutarate carboxylase

OGDH 2-oxoglutarate dehydrogenase

ORF Open reading frame

PAAT Polar amino acid transporter family

PBM Peribacteroid membrane

PBS Peribacteroid space

PBU Peribacteroid unit

PCR Polymerase chain reaction

PDH Pyruvate dehydrogenase

PEP Phosphoenolpyruvate

PEPCK Phosphoenolpyruvate carboxykinase

PHB Polyhydroxybutyrate

PNPG ρ -nitrophenyl β -D-galacto pyranoside

pSym Symbiotic plasmid

PYC Pyruvate carboxylase r Resistant

RBS Ribosome binding site

RMS Rhizobium minimal salts

rpm Revolutions per minute

RNA Ribonucleic acid

RNase Ribonuclease s Sensitive

SBP Solute binding protein

spc Spectinomycin

X

SCS Succinyl-CoA synthetase

SEM Standard error mean

SDH Succinate dehydrogenase

SDS Sodium dodecyl sulphate

SS Sucrose synthase

SSDH Succinic semialdehyde dehydrogenase

str Streptomycin

TAE Tris acetate EDTA

TCA Tricarboxylic acid

tet Tetracyclin

Tn5 Kanamycin / Neomycin resistant transposon

TnB61 Tn5 based transposon carrying tac promoter

TRIS 2-amino-2-(hydroxymethyl)-1,3-propanediol

TY Tryptone-Yeast media

UV Ultraviolet

wt Wild-type

v/v Volume for volume

w/v Weight for volume

X-Gal 5-bromo-4-chloro-3-indolyl-β -D-galactoside

X-Glc-A 5-bromo-4-chloro-3-indolyl-β -D-glucuronide

ZnCl2 Zinc chloride

XI

Contents.

Chapter 1:- Literature Review.

1.1 The Rhizobia and Regulation of Symbiotic Nitrogen Fixation. 2

1.1.1 Introduction. 2

1.1.2 Taxonomy and genetic structure. 2

1.1.3 Regulation of the nod genes. 7

1.1.4 Nod factors. 9

1.1.5 Nod factor perception and signal transduction. 10

1.1.6 Nodule formation and structure. 14

1.1.7 The fix genes and bacteroid differentiation. 18

1.1.7 The nif genes and nitrogenase biosynthesis. 20 1.2 Carbon Metabolism by the Bacteroid. 24

1.2.1 Carbon provision to the bacteroid. 24

1.2.2 The dicarboxylate transport system (Dct). 26

1.2.3 Tricarboxylic acid (TCA) cycle. 28

1.2.4 Maintaining bacteroid metabolism. 33 1.3 Nitrogen Metabolism by the Bacteroid. 36

1.3.1 Glutamate and glutamine metabolism. 36

1.3.2 Aspartate and asparagine metabolism. 39

1.3.3 Alanine metabolism. 41

1.3.4 Nitrogen provision to the plant and amino acid cycling. 41 1.4 ATP Binding Cassette (ABC) Transporters. 46

1.4.1 Structure and function. 46

1.4.2 The General amino acid permease (Aap). 48

1.4.3 Branched chain amino acid permease (Bra). 51 1.5. Research Aims. 52

Chapter 2:- Methods.

2.1 Bacterial Strains, Plasmids and Media. 55

2.1.1 Culture conditions. 55

2.1.2 Bacterial strains and phage. 56

XII

2.1.3 Plasmids. 61 2.2 Molecular Techniques. 65

2.2.1 DNA isolation. 65

2.2.2 Agarose gel electrophoresis. 65

2.2.3 Cloning and transformation. 65

2.2.4 Polymerase chain reaction (PCR). 66

2.2.5 RNA isolation and quantification. 69

2.2.6 qRT-PCR. 69

2.2.7 Conjugation. 71

2.2.8 Sac mutagenesis and direct gene replacement. 71

2.2.9 Transposon mutagenesis of Rhizobium. 72

2.2.10 Transposon mutagenesis of plasmid DNA. 73

2.2.11 General transduction. 74 2.3 Plant Experiments. 75

2.3.1 Nodulation phenotype and plant dry weights. 75

2.3.2 Nitrogenase activity. 75

2.3.3 Nodule microscopy. 76 2.4 General Techniques and Enzyme Assays. 77

2.4.1 Cell disruption. 77

2.4.2 Protein determination. 77

2.4.3 Glutamine 2-oxoglutarate aminotransferase (GOGAT). 77

2.4.4 Alanine dehydrogenase (ADH). 78

2.4.5 Amino acid uptake. 78

2.4.6 β-galactosidase. 79

2.4.7 Alkaline phosphatase. 79

2.4.8 β-glucuronidase. 80

2.4.9 GFP-UV fluorescence. 80

2.4.10 Glutamate determination. 81

2.4.11 Alanine determination. 81

2.4.12 Aspartate determination. 82

Chapter 3:- Aliphatic Amino Acid Transport by the Bacteroid Drives Symbiotic Nitrogen Fixation.

XIII

3.1 Introduction. 84 3.2 Results. 86

3.2.1 Mutation in aapJ and braC. 86

3.2.2 Identification and mutation of braC3. 91

3.2.3 Structural comparison of both Bra SBPs. 101

3.2.4 Symbiotic phenotype of aap bra SBP mutants. 107

3.2.5 Complementation of aap bra mutation with P. aeruginosa Bra. 114

3.2.6 Mutation in genes encoding alanine catabolic enzymes. 119

3.2.7 Regulation of Aap and Bra in response to intracellular amino 126 acid concentrations. 3.3 Discussion. 134

Chapter 4:- Symbiotic Nitrogen Fixation is Independent of Bacteroid Ammonium Assimilation.

4.1 Introduction. 138 4.2 Results. 141

4.2.1 Mutation of gltB, the large subunit of glutamine 2-oxoglutarate 141 aminotransferase.

4.2.2 Complementation and regulation of gltBD. 145

4.2.3 Growth phenotype of R. leguminosarum gltB mutants. 147

3.2.4 Symbiotic properties of gltB mutants. 165

4.2.5 Complementation of Fix- phenotype of gltB mutants. 173

4.3 Discussion. 179

Chapter 5:- Characterisation of a GABA Specific ABC Transport System in R. leguminosarum.

5.1 Introduction 183 5.2 Results. 185

5.2.1 Selection of rapid growth on GABA by a R. leguminosarum 185 aap bra mutant strain.

5.2.2 Tn5 mutagenesis to identify the Gst transport operon. 194

5.2.3 Ligand recognition properties of the Gst. 209

5.2.4 Regulation of the gst operon. 219

XIV

5.2.5 Symbiotic phenotype of mutation in gst. 228 5.3 Discussion. 236

Chapter 6:- General Discussion.

6.1 Future Work. 243

Chapter 7:- References

1

Chapter 1:- Literature Review.

2

1.1 The Rhizobia and Regulation of Symbiotic Nitrogen Fixation.

1.1.1 Introduction.

Nitrogen is an essential nutrient for plant growth and as such fertilisers are

frequently used in commercial crop growth to enhance the nitrogen supply available to the

plant. Biofertilizers, microbial inoculants capable of nitrogen fixation to supplement the

nitrogen requirement of plants, are also being used to replace chemical fertilizers in

sustainable agriculture. As concerns mount to the growing input of reactive nitrogen into

our environment, as part of a “nitrogen cascade”, an increased need to understanding

biological nitrogen fixation has become of paramount importance.

Nitrogen fixation, the reduction of gaseous nitrogen (N2) to ammonia (NH3) via

action of the enzyme nitrogenase, is confined to the prokaryotes (diazotrophs) and is

widespread amongst both the eubacteria and proteobacteria (Zehr et al., 2003). Nitrogenase

is an oxygen-labile enzyme and so most diazotrophs fix nitrogen only under anaerobic or

microaerobic conditions, rhizobia are obligate microaerophiles. Whereas the ability for free-

living prokaryotes to fix nitrogen is reasonably widespread only a few bacteria have

evolved the ability to form nitrogen-fixing symbioses with higher plants. The rhizobia

sonsist of several genera of gram-negative bacteria that are a members of the family

Rhizobiaceae, an α-subdivision of proteobacteria that are common in soil and can incite

root nodule formation with certain leguminous plants to facilitate nitrogen fixation.

Nitrogen fixation by Rhizobium-legume symbiosis contributes about 50% of the available

nitrogen in the biosphere and is the largest single input into the nitrogen cycle (Tate, 1995;

Vitousek et al., 1997; Batut et al., 2004). This mutualistic association occurs in nodules,

found on the roots of members of the Leguminosae, where nitrogenase-forming strains of

rhizobia differentiate to form membrane enclosed pleomorphic cells, referred to as

bacteroids. This symbiotic association works on the principal that the bacteroids fix

nitrogen in an energy expensive process and supply it to the plant in the form of ammonia,

whilst the plant reduces carbon dioxide and uses the photosynthate to provide the bacteroid

with a carbon and energy source.

1.1.2 Taxonomy and genetic structure.

The rhizobia generally consist of at least five principal genera; Rhizobium,

Sinorhziobium, Mesorhziobium, Bradyrhizobium and Azorhziobium. Taxonomic

classification was originally based on classical phylogenetic observations, such as growth

phenotype and host range (Long, 1989). However, more modern criteria such as 16S

3

ribosomal RNA sequencing and DNA restriction fragment length polymorphisms (RFLP)

have further refined this classification (Graham et al., 1991) (Figure 1.1.1.).

4

Figure 1.1.1. Phylogeny of completely sequenced genomes of selected α-proteobacteria based on concatenated sequences of 648 gene orthologous proteins. Neighbor-Joining method with % bootstrap support indicated (Young et al., 2006)

Rhizobium species can be further subdivided into biovars that are distinguishable

from one another only by the plants with which they are capable of eliciting symbiosis. R.

leguminosarum can be subdivided into biovar trifolii, biovar phaesoli and biovar viciae

according to whether they nodulate clover, peas or beans respectively (Table 1.1.1.). These

are genetically similar, in that they share a chromosomal background, but differ among

isolates according to the plasmid number, size and host compatibility (Laguerre et al., 1992;

MartinezRomero and CabelleroMellado, 1996; Palmer and Young, 2000;). The genetic

similarity between biovar is reflected by the fact that a strain cured of its own Sym plasmid

can acquire the nodulation characteristics of another biovar by conjugation of another Sym

plasmid (Downie, Unpublished).

5

Species Genera Biovar Host

Bradyrhizobium B. elkanii Glycine max B. japonicum Glycine max B.liaoningense Glycine max

B. yuanmingense Lespedeza, Medicago, Melilotus

Mesorhizobium M. amorphae Amorpha fruticosa M. chacoense Prosopis alba M. ciceri Cicer arietinum M. huakuii Astragalus sinicus, Acacia M. loti Lotus corniculatus M. mediterraneum Cicer arietinum

M. plurifarium Acacia senegal, Prosopis juriflora, Leucaena

M. septentrionale Astragalus adsurgens M. temperatum Astragalus adsurgens

M. tianshanense Glycyrrhiza pallidflora, Swansonia, Glycine, Caragana, Sophora

Rhizobium R. etli Phaseolus vulgaris, Mimosa affinis

R. galegae Galega orientalis, G.officinalis

R. gallicum Phaseolus vulgaris, Leucaena, Macroptilium, Onobrychis

R. giardini Phaseolus vulgaris, Leucaena, Macroptilium

R. hainanense Desmodium sinuatum, Stylosanthes, Vigna, Arachis, Centrosema

R. huautlense Sesbania herbacea R. indigoferae Indigofera bv. trifolii Trifolium

bv. viciae Lathyrus, Lens, Pisum, and Vicia

R. leguminosarum

bv. phaseoli Phaseolus vulgaris

R. mongolense Medicago ruthenica, Phaseolus vulgaris

R. sullae Hedysarum coronarium

R. tropici Phaseolus vulgaris, Dalea, Leucaena, Macroptilium, Onobrychis

R. yanglingense Amphicarpaea trisperma, Coronilla varia, Gueldenstaedtia multiflora

Sinorhizobium S. abri Abrus precatorius

6

S. adhaerens Unknown S. americanus Acacia spp.

S. arboris Acacia senegal, Prosopis chilensis

S. fredii Glycine max S. indiaense Sesbania rostrata

S. kostiense Acacia senegal, Prosopis chilensis

S. kummerowiae Kummerowia stipulacea

S. medicae Medicago truncatula, M. polymorpha, M.orbicularis

S. meliloti Medicago, Melilotus, Trigonella

S. morelense Leucaena leucocephala S. sahelense Acacia, Sesbania bv. acaciae Acacia

S. terangae bv. sesbaniae Sesbania

S. xinjiangense Glycine max

Table 1.1.1. Major Genera and Species of rhizobia and their hosts (Adapted from Zakhia and de Lajudie, 2001; Fox, 2005)

The α-proteobacteria with the largest genomes tend to be members of the rhizobia

reflecting their metabolic diversity and need for versatility, as they are found both in both

free-living environments as well as differentiated bacteroids in symbiotic association.

Genomes for five species from different rhizobia genera have been sequenced to date, B.

japonicum, S. meliloti, M. loti and most recently R. leguminosarum and R. etli (Kaneko et

al., 2000; Galibert et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006; Young et al.,

2006). The genome of R. leguminosarum biovar viciae 3841 is 7,751,309bp and has 7236

protein coding genes. The genome architecture consists of one circular chromosome,

comprising 65% of its genes, and six large plasmids of which pRL10 is the symbiotic

plasmid and is transferable by conjugation. The genomes of A. tumefaciens, M. loti, S.

meliloti and R. leguminosarum share a core genome of 2056 genes that have a higher than

average G+C content and are predominantly located on the chromosome. There are also a

large number of non-core genes that are conserved amongst rhizobia, but absent in A.

tumefaciens, which can be seen as an accessory component with a lower G+C and a

sporadic distribution (Young et al., 2006).

7

1.1.3 Regulation of the nod genes.

The root systems of leguminous plants secrete compounds such as flavonoids and

betaines, produced via the isopropanoid pathway, into the rhziosphere that trigger in

rhizobia the induction of nod genes essential to initiate symbiosis (Broughton et al., 2000;

Perret et al., 2000). The nod genes are fundamental for determining host range and except

for nodABC vary between species (Sharma et al., 1993). The genetic organisation of the nod

genes is such that they are found either as part of a sym island on the chromosome or on a

separate transmissible sym plasmid. In R. leguminosarum the 13 nod genes are grouped into

five distinct operons all found on the Sym plasmid pRL10; nodABCIJ, nodD, nodFEL,

nodMNT and nodO, (Downie and Surin, 1990; van Rhijn and Vanderleyden, 1995; Young

et al., 2006).

NodD protein has been shown to localise to the cytoplasmic membrane of R.

leguminosarum and act as both sensor and transcriptional regulator for the other nod

operons and production of Nod factor (Mulligan and Long, 1985; Squartini et al., 1988;

Schlaman et al., 1989; Schlaman et al., 1992). NodD is a member of the LysR

transcriptional regulator family and in response to flavones positively regulates transcription

of approximately 25 genes required for bacterial synthesis and export of Nod factor (Schell

et al., 1993; Gage, 2004). The N-terminus of NodD is highly conserved and believed to be

involved in DNA-binding, whereas the C-terminus is comparatively variable and thought to

be the regulatory domain that senses flavonoids or other inducers (Shearman et al., 1986;

Hong et al., 1987). NodD is a trans-acting regulator that binds to a cis-regulatory element,

the “nod box”, preceding the transcriptional start site of genes associated in the nod

response (Kondorosi et al., 1989; Feng et al., 2003). The typical nod box is located -25 to -

75 of the relative transcriptional start site, and contains two half-sites containing the

imperfect repeat ATC-N9-GAT-N16-ATC-N9-AAT that is critical for NodD binding (Spaink

et al., 198b7; Goethals et al., 1992; Feng et al., 2003). NodD is a homo-tetramer that folds

by action of the chaperone GroEL to form a dimer of dimers. This arrangement confers a V-

shape where interactions between the four DNA-binding motifs of the subunits and the two

target repeats of the nod box bend the DNA to form a V-shape also (Ansari et al., 1995;

Shin et al., 2003; Chen et al., 2005). Whilst the DNA-binding of most NodDs in vitro

occurs independently of flavonoids it has been shown that compatible inducer molecules

must interact with the DNA bound NodD to initiate transcription of nod genes (Burn et al.,

1987; McIver et al., 1989; Fisher and Long, 1993). In R. leguminosarum the response of

NodD to the binding of inducer molecules is to activate transcription by facilitating a

sharpening of the bend in the nod box target DNA that forms the V-shape on interaction

8

with NodD. Whether this sharper bend enables RNA-polymerase to form an open complex

or if it merely aids removal of a repressor molecule that is bound to the DNA where the

RNA polymerase would otherwise bind is unknown (Feng et al., 2003; Chen et al., 2005).

Regulation of the nod genes is strictly maintained for symbiosis and strong

expression has been shown to inhibit nodulation (Knight et al., 1986; Schlaman et al., 1991;

Hogg et al., 2002). Differing strategies for regulation have evolved but all centre on the

regulation of transcription by NodD. Species such as R. leguminosarum bv. viciae and bv.

trifolii have only one copy of nodD whereas species of other rhizobia, such as B. japonicum

and S. meliloti, encode two and three copies respectively (Spaink et al., 1987a; Van Rhijn et

al., 1993). In R. leguminosarum nodD expression is constitutive but autoregulates its

expression. Transcription of nodD occurs divergently from nodA and binding of NodD to

the nod box upstream of nodA competes with RNA polymerase binding at its own promoter

(Egelhoff et al., 1985; Mao et al., 1994; Hu et al., 2000). In S. meliloti NodD1, NodD2 and

NodD3 all act as positive regulators of the nod genes and mutation of all three is required to

abolish nodulation (Honma and Ausubel, 1987; Honma et al., 1990; Schlaman et al., 1998).

Transcription of nodD1 and nodD2 appears constitutive but regulation occurs through

repression by NolR binding to the nodD1, nodD2 and nodA promoter regions (Mulligan and

Long, 1985; Kondorosi et al., 1991a; Cren et al., 1995). Transcription of nodD3 is

positively regulated by another LysR regulator syrM in response to NodD2, so repression of

nodD2 by NolR also silences the expression of nodD3 (Kondorosi et al., 1991b; Swanson et

al., 1993; Barnett and Long, 1997). In B. japonicum NodD1 and NodD2 have very distinct

functions. Unlike in other species transcription of nodD1 is not constitutive but is induced

in response to flavonoids (Banfalvi et al., 1988; Gottfert et al., 1992). NodD1 functions as a

positive regulator for transcription of the nod genes, whereas NodD2 has a negative effect

on nodABC transcription and acts as a repressor of nodD1 transcription (Fellay et al., 1998;

Loh and Stacey, 2001). Expression of nodD2 occurs in response to the MerR like positive

regulator NolA whose transcription in turn is regulated in response to an as yet unknown

plant derived inducer (Garcia et al., 1996; Fellay et al., 1998). However, NodD1 mutants of

B. japonicum still show ability to nodulate and this led to the characterisation of the two-

component sensor regulator NodVW that is also capable of initiating transcription of nodA

in response to flavonoids (Sanjuan et al., 1994). Mutation of nodVW allowed only

nodulation to occur only with soybean demonstrating that nodVW provides B. japonicum

with the flexibility to nodulate a number of plants such as cowpea, mungbean and sirato

(Gottfert et al., 1990; Loh and Stacey, 2001).

9

1.1.4 Nod factors.

Nod factors are lipo-chitooligosaccharides with a conserved β-1,4-linked acetyl-

glucosamine backbone of usually 4 or 5 residues with an n-acyl chain attached to the C-2

position of the non-reducing terminal glucosamine (LeRouge et al., 1990). Depending on

the Rhizobium species Nod factors vary through differences in the structure of this acyl

chain as well as substitutions to the reducing and non-reducing terminal glucosamine

residues, which include addition of sulphuryl, methyl, carbamoyl, acetyl, fucosyl and

arabinosyl groups to various positions on the Nod factor backbone (Denarie et al, 1996;

Long, 1996). Synthesis of Nod factors, as well as modifications and additions, are a major

determinant of host range and production is mediated by proteins encoded by other nod

genes. The nodABC genes are those conserved among rhizobia and encode an acyl-

transferase (NodA), a deacetylase (NodB) and a N-acetylglucosaminyltransferase (NodC),

which function together to catalyze the synthesis of the core Nod factor structure required in

nodule formation (Rohrig et al., 1994; Roche et al., 1996). Also conserved among species

are nodIJ which are co-trancribed with nodABC. These encode a putative ABC-transport

system that facilitates secretion of Nod factor (Evans and Downie, 1986; Cardenas et al.,

1996; Barran et al., 2002).

Whilst nodABCIJ are the conserved nod genes, other accessory nod genes differ in

both combination as well as action between species to achieve variation in Nod factor and

so host range. R. leguminosarum lacks genes nodH and nodPQ, which when mutated in

S.meliloti lead to a loss of the ability to activate early host responses. NodH, NodP and

NodQ bring about the 6-O-sulfation of the reducing terminal glucosamine that is essential

for host plant perception, as R. leguminosarum lacks nodH and nodPQ its Nod factor is

non-sulphated (Faucher et al., 1988; Roche et al., 1991; Ehrhardt et al., 1995). The

homology of nodFE between species is greater than that of nodABC, so it would appear that

NodF and NodE of both R. leguminosarum and S. meliloti would have a similar function in

the conversion of Nod factor. However, whilst a change to the acyl chain of Nod factor is

facilitated by nodEF and nodL in both species, the nature of the change differs between

species. Mutation of nodF and nodL of S. meliloti produces mutants able to initiate an early

plant response but are not capable of forming infection threads (Ardourel et al., 1994). S.

meliloti double mutants in nodF and nodH produce Nod factor with a C18:1 N-acyl

attachment rather than the C16:2 group usually secreted (Demont et al., 1993). Similarly, in

R. leguminosarum mutation of nodE produces Nod factor with the C18:1 N-acyl attachment.

Modification of the acyl chain is mediated by NodE, NodF and NodL to produce the

mixture of C18:1 and C18:4 groups produced by wild-type, which changes the biovar

10

specificity in R. leguminosarum from clover to pea (Spaink et al., 1991). However mutation

of nodE alone in R. leguminosarum is not sufficient to bring about a reversion in plant

nodulation phenotype. Mutation of both nodE and nodO is required in R. leguminosarum to

abolish nodulation as single mutations of both have no effect (Walker and Downie, 2000).

Finally, NodO forms ion-selective channels regulated by Ca2+ concentrations that

allow the movement of monovalent cations (K+ and Na+) across membranes (Sutton et al.,

1994). The exact reasons as to why only single mutation in either nodE or nodO does not

abolish infection thread formation is unknown. It has been suggested that NodO has some

role in the plant uptake of Nod Factor or induces lipooligosaccharide depolarisation of the

plasma membrane of leguminous plants.

1.1.5 Nod factor perception and signal transduction.

Attachment of the rhizobia to the root hair occurs by adhesins and cellulose fibrils

(Smit et al., 1992). In response to molecular recognition of Nod factor root hairs undergo a

radical developmental change with root hairs swelling and becoming deformed as a result of

altered growth. Root hairs begin to curl shortly after and this is accompanied by activation

of plant nodulation genes. The root hair tip curls by gradual and constant reorientation of

the growth direction of the root hair to trap the rhizobia within the pocket of the curl (Yao

and Vincent, 1969; Limpens and Bisseling, 2003). Whilst purified Nod factor has been

shown to elicit root hair curling they are not sufficient to bring about the tightly curled

“shepherds crooks” that are the usual sites of entry for rhizobia (Denarie and Cullimore,

1993). It has been suggested that prolonged, localised Nod factor production and sensing is

required to redirect the off axis tip growth to bring about tight curling (Van Batenburg et al.,

1986; Esseling et al., 2003; Gage, 2004).

The rapid and specific response of root hair and epidermal cells to Nod factors

indicate that these cells directly perceive them through very specific receptors, as

concentrations as low as 10-12 M can induce responses (Long, 2001). Nod factor perception

has been proposed to occur as a two-event lock and key mechanism. Initial Nod factor

recognition is less stringent and brings about root hair curling whilst the other is more

stringent and allows initiation of infection threads and activation of plant nodulation genes

(Figure 1.1.2.) (Ardourel et al., 1994; Limpens et al., 2003; Radutoiu et al., 2003).

Advances in microarray analysis of early plant nodulation events as well as characterised

mutant phenotypes has led to the unravelling of 46 genes that are differentially regulated or

proposed to play a role in the plants early Nod factor response (Mitra et al., 2004a). The

early less stringent recognition event in L. japonicus is facilitated by a heterodimer

11

consisting of two LysM serine / threonine receptor-like kinases NFR1 and NFR5 specific to

perception of M. loti Nod factor. These LysM receptor-like kinases are membrane spanning

with each containing three extracellular receiver domains as well as an intracellular kinase

domain (Madsen et al., 2003). The extracellular domains show high similarity to the LysM

binding domains of chitin and peptidoglycan binding proteins suggesting involvement in

recognition of the Nod factor backbone (Radutoiu et al., 2003). L. japonicus mutated in

either NFR1 or NFR5 were shown to be non-nodulating and also unresponsive to purified

Nod factor (Radutoiu et al., 2003; Madsen et al., 2003; Miwa et al., 2006). NFR5 was

shown to have orthologs in both P. sativum and M. trunculata, SYM10 and NFP

respectively whilst orthologs of NFR1 were identified first in P.sativum as SYM2 and later

in M.truncatula as LYK3 and LYK4 (Limpens et al., 2003; Madsen et al., 2003; Amor et al.,

2003; Oldroyd and Downie, 2004). This suggests that the early stage less stringent response

of binding to the Nod factor backbone is also conserved between species and would explain

how species can have multiple hosts. However, although it is established that NFR1 and

NFR5 and their orthologues are the initial receptors for Nod factor perception they may also

function in some way at a later stage in conjunction with other more stringent receptors for

Nod factor binding and recognition. An NFR1 deletion mutant of L. japonicus abolished

early nodulation responses whereas gene silencing of LYK3 / LYK4 lead to root hair curling

and entrapment of rhizobia. This root hair initiation was aborted soon after at a still early

stage, indicating that it functions both in initial recognition and the late stage more stringent

response (Madsen et al., 2003; Limpens et al.,2003). The gene silencing method used to

abolish LYK3 / LYK4 expression is not as clean as deletion mutant and subsequently it

appeared that enough residual LYK3 / LYK4 expression remained to allow the early stage

recognition events.

12

Figure 1.1.2. The Nod-factor signalling pathway in legumes. (Oldroyd and Downie, 2004).

Nod factor perception at the later more stringent stage of infection brings about root

hair curling, oscillations in calcium concentration and activation of plant nodulation genes.

The initial nodulation events are induced by the depolarization of cells at the root hair tip by

Ca2+ ion influx, which is thought to influence changes in the actin bundles of root hair cells.

This acts to bring about curling, deformation and also inhibit and the reinitiation of root hair

tip growth (Cardenas et al., 1998; Cardenas et al., 1999; De Ruijter et al., 1999; Walker et

13

al., 2000). It has also been implicated as a way of transducing the Nod factor perception

signal and bring about activation of plant nodulation genes (Shaw and Long, 2003).

Calcium flux has been observed in a variety of legumes and is followed by the efflux of Cl-

and K+ ions causing the cytoplasm to fluctuate in pH and bring about alkinisation (Ehrhardt

et al., 1992; Felle et al., 1996). Calcium flux acts to accentuate the calcium gradient that

occurs down from the root hair tip, where there is a high Ca2+ concentration, and is

important in the later calcium spiking. After the early characteristic nodulation events

observed in a variety of legumes, such as root hair curling and calcium flux, there is a lag

time of approximately 10 minutes before oscillations in the calcium gradient occur. This is

known as calcium spiking (Ehrhardt et al., 1996; Walker et al., 2000; Wais et al., 2002;

Shaw and Long, 2003). Addition of EGTA, a Ca2+ chelator, blocks calcium spiking by

preventing root hair membrane depolarisation and this leads to a subsequent loss of

expression for the plants nodule specific genes, indicating that the modulation of

intracellular calcium concentrations is required for signal transduction (Felle et al., 1998;

Pingret et al., 1998; Felle et al., 1999). The genes required to initiate and respond to

calcium spiking have been characterised in M. truncatula to structure a model of signal

transduction that we can apply to other legumes where orthologs have been identified. M.

truncatula mutants of dmi1, dmi2 still show the initial nodulation events observed in

response to Nod factors, such as root hair swelling, but not the subsequent calcium flux and

early plant nodulation gene expression (Catoira et al., 2000; Wais et al., 2000; Ane et al.,

2002). DMI1 and its orthologues, SYM4 and SYM8 in L. japonicus and P. sativium

respectively, are predicted to be membrane spanning proteins with weak homology to cation

channels. DMI2 and its orthologs, SYM2 and SYM19 in L. japonicus and P. sativium

respectively, are predicted to function as receptor kinases that contain a leucine-rich-repeat

(LRR) domain (Stracke et al., 2002; Endre et al., 2002; Ane et al., 2004). The LRR

domains are proposed to function in protein-protein interactions and after binding of a

ligand could induce a phosphorylation cascade which leads to DMI1 modulating calcium

spiking (Esseling et al., 2004; Oldroyd and Downie, 2004). DMI1 and DMI2 appear to act

in concert to induce calcium spiking as mutation in either abolishes induction of plant

nodulation genes. Therefore it is proposed that DMI2 acts as a sensor for Nod factor

perception and DMI1 acts as a cation transporter that brings about calcium flux and spiking.

In addition to DMI1 and DMI2 a calcium calmodulin protein kinase, DMI3, has also been

identified in M. truncatula, which translates the calcium spiking signal and activates the

cascade of genes required for nodulation (Ane et al., 2002; Mitra et al., 2004b; Levy et al.,

2004). Modification of this Ca2+ / calmodulin-dependent protein kinase lead to

14

autoactivation of the plants nodulation signalling pathway demonstrating its role in the key

regulatory role upstream of later gene responses (Gleason et al., 2006; Tirichine et al.,

2006). It has been proposed that increased bacterial numbers leads to an accumulation of

Nod factor to sufficient levels that activate calcium flux and drive infection thread growth

(Miwa et al., 2006).

1.1.6 Nodule formation and structure.

Bacterial cells that become trapped by the root hair curl initiate infection thread

formation. Infection thread formation occurs either by local degradation of the plant cell

wall or by new cell wall growth around the encompassed bacteria. This invagination grows

down the body of the root hair into the body of dividing epidermal cells, known as the

nodule primordium, within the root cortex. The rhizobia within the infection thread continue

to grow and divide down the infection thread and until they reach the base of the root hair

where cells are released and engulfed by endocytosis to form the symbiosome (Napoli and

Hubbell, 1975; Ridge and Rolfe, 1985; Gage et al., 1996). Growing cells of S. meliloti that

formed infection threads with alfalfa formed two or three columns of sister cells within each

infection thread and growth was restricted to a region approximately 60 µM from the

growing tip (Gage, 2002). The growth of various mutant strains in infection threads

indicates that the plant provides the necessary carbon and nitrogen requirements for

bacterial growth. As bacteria grow down the infection thread they accumulate large PHB

reserves that are lost in phaC mutants indicating they receive a plentiful carbon supply from

the host plant (Lodwig et al., 2005). Amino acid auxotrophs are also able to invade

developing nodules suggesting that the plant provides the necessary amino acids to

complement for growth down the infection thread (Patriarca et al., 2002). Developing

infection threads may fuse with membrane vesicles, similar to that occurring in pollen tube

growth, and provide nutrients that would explain why growth occurs only at the tip

(Whitehead and Day, 1997; Gualtieri and Bisseling, 2000; Patriarca et al., 2002). More

recently this restriction of growth to the tip of the infection thread was proposed to be a

result of hydrogen peroxide mediated solidification of the luminal matrix (Brewin, 2004).

Control of oxidative stress may allow the plant to control the abortion of infection thread

progression and hence control the nodule number (Brewin, 2004; Prell and Poole, 2006).

The release of bacterial cells from the infection thread, to form symbiosomes,

occurs by formation of infection droplets that occur at positions where the cell wall gets

disrupted. Rhizobial cells come into direct contact with the plasma membrane and are

endocytosed (Brewin, 2004). The symbiosome consists of differentiated bacterial cells

15

facilitating nitrogen fixation that are surrounded by a continuous plant membrane

(Robertson et al., 1978a; Robertson et al., 1978b). Formation is either accompanied by

division of the plant membrane, as occurs in pea nodules that results in bacteria becoming

singly enclosed (Figure 1.1.3.), or it does not divide as occurs in bean that gives multiple

cells enclosed by the same membrane. Differentiation of bacterial cells in indeterminate

nodules occurs after several periods of division and the symbiosome membrane is relatively

impermeable to metabolites. Later in the infection process a burst of carbon metabolism by

rhizobia is proposed that is required to convert free-living cells into much larger

differentiated bacteroids (Lodwig et al., 2005).

The plant-derived membrane around the bacterial cells is termed the peri-bacteroid

membrane (PBM) and segregates the bacteroids from plant cytosol, with the intervening

peri-bacteroid space (PBS) (Figure 1.1.3.) (Bergersen and Briggs., 1958; Robertson et al.,

1978; Robertson et al., 1978b; Whitehead and Day., 1997). The peri-bacteroid membrane is

poorly permeable to metabolites leaving the bacteroids reliant on the plant host for

nutrients. Aquaporins, an ammonium channel, a dicarboxylate transporter and an aspartate /

H+ symporter have all been demonstrated are suggested to facilitate transport and control of

metabolites, required by the bacteroid for nitrogen fixation, across the PBS (Fortin et al.,

1987; Udvardi et al., 1988a; Tyerman et al., 1995; Mouritzen and Rosendahl, 1997; Rubeck

et al., 1999; Wienkoop and Saalbach, 2003). In addition H+-ATPases, both P-type and V-

type, have been identified at the PBM that function to pump H+ into the peri-bacteroid

space, which in conjunction with H+ liberated by the bacterial electron transport chain into

the PBS creates an electrochemical and pH gradient between the plant cytosol, PBS and the

baceteroid (Szafran and Haaker, 1995; Saalbach et al., 2002; Wienkoop and Saalbach,

2003). This acidic environment may be important for the movement of ammonia out of the

bacteroid as it promotes formation of NH4+ from NH3 maintaining a diffusion gradient

(O’Hara et al., 1985; Jin et al., 1988; Day et al., 2001). The transport of ammonia and

amino acid across the peri-bacteroid membrane will be addressed further in depth later.

16

Figure 1.1.3. Symbiosome of a pea nodule infected with R. leguminosarum bv. viciae 3841.

Rhizobia are capable of forming two distinct types of nodule, determinate and

indeterminate, depending on the host plant. Legumes that form determinate nodules are

typically Glycine max, Phaseolus vulgaris and L. japonicus whereas those that form

indeterminate nodules are M. sativa, M. truncatula, Vicia faba and P. sativum. The main

distinguishing characteristic is that determinate nodules lack a persistent apical meristem

and have no obvious development gradient. The infection thread does not continue to

extend and instead infection occurs via division of pre-infected cells to give evenly

distributed bacteria. Nodule growth occurs by cell enlargement to give nodules a

characteristic round shape. In comparison indeterminate nodules have a persistent apical

meristem caused by elongation and branching of the infection thread that continues to

divide giving rise to a meristematic zone where new cells are subsequently infected to form

new nodule tissue. This causes indeterminate nodules to become elongated and have clear

zones at different stages of development (Figure 1.1.4.). The bacteria-free meristematic

cells and the subsequent infection of them can be seen as zones I and II. The area where the

bacteria begin to differentiate into bacteroids occurs between zones II and III and is

characterised by layers of host cells of high starch content and sees expression of the nif

genes required for nitrogenase. Zone III is the where mature differentiated bacteroids carry

out nitrogen fixation and zone IV is where they begin to show signs of senescence (Vasse et

al., 1990).

Bacterial cell surface polysaccharides of rhizobia consist of capsular

polysaccharides (CPS), exopolysaccharides (EPS), lipid polysaccharides (LPS) and cyclic

PBM

Plant Cytosol

Bacteroid

PBS

17

β-1,2 glucans and are essential for invasion and nodule development (Kannenberg and

Brewin, 1994; Skorupska et al., 2006). The precise role of these cell surface sugars is still

unclear but mutations in EPS of both S. meliloti and R. leguminosarum has demonstrated

that they are essential for nodule formation (Cheng and Walker, 1998; Van Workum et al.,

1998). EPS biosynthesis and modification in R. leguminosarum is carried out by the pss

genes and mutation in a number of these genes has shown to produce strains that are non-

mucoid and produce non-nitrogen fixing nodules. Whilst the strains are capable of eliciting

root hair curling the initiation of an infection thread is abolished suggesting that cell surface

recognition is also required for nodule formation (Ivashina et al., 1994; Van Workum et al.,

1998). To further illustrate this mutations of the genes required for synthesis of the core

element of LPS in R. leguminosarum have been shown to reduce colonization efficiency in

a similar manner (Perotto et al., 1994; Lucas et al., 1996). Plant derived glycoproteins bind

to the cell surface of free-living R. leguminosarum and are also detectable in bacteroids

following isolation from mature nodules. Mutation of the genes required for core LPS

production produces a strain incapable of binding to the plant derived glycoproteins in vitro

(Bolanos et al., 2004). Further evidence for a required interaction is that more subtle

mutations that affect the correct length of the O-antigen side chain produce strains that are

capable of infection thread formation and release but form abnormal symbiosomes. These

abnormal symbiosomes show defects in the synchronized division of bacteroids and peri-

bacteroid membrane suggesting that interaction between plant glycoproteins and LPS is

required (Lucas et al., 1996; Bolanos et al., 2004).

18

Figure 1.1.4. Structure and oxygen distribution of an indeterminate nodule (Arcondeguy et al., 1997)

Nitrogen fixation by mature bacteroids is carried out in a microaerobic environment

and regulation of the oxygen tension in the nodule is essential to balance the oxygen labile

nitrogenase with the need for respiration. The plant cell cytoplasm contains leghaemoglobin

that acts to regulate the supply of oxygen to nodule tissue and gives nodules the

characteristic pink red colour (Figure 1.1.4.) (Robertson et al., 1984). Leghaemoglobin

binds free oxygen and releases it when the concentration drops below a certain level to

provide the bacteria with enough for respiration but maintains a low free oxygen

environment (Appleby., 1984). The oxygen status of the nodule is a key factor in activation

of the nif and fix genes, required for microaerobic respiration and nitrogenase biosynthesis,

with both being transcriptionaly co-ordinated in response to the microaerobic environment

(Szeto et al., 1984; Virts et al., 1988; Reyrat et al., 1993; Soupene et al., 1995).

1.1.7 The fix genes and bacteroid differentiation.

Genes identified as essential for nitrogen fixation were typically characterised either

through their shared homology to those genes required for nitrogen fixation amongst free-

living bacteria, nif genes, or their identification as genes required for nitrogen fixation that

are specific to bacteria that form symbiotic relationships, fix genes (Ruvkun and Ausubel,

1980; Ruvkun and Ausubel, 1981; Ruvkun et al., 1982; Earl et al., 1987). The induction of

19

the fix genes and the switch to microaerobic respiration is one of the most critical

developments in bacteroid differentiation and must occur before nitrogenase biosynthesis,

due to the enzymes oxygen labile nature. The nod, nif and fix genes of R .leguminosarum all

lie within a 36 kb region of the sym plasmid pRL10 with a characteristic low G+C ratio.

The fixABCX genes are transcriptionaly coupled to nifAB and this operon is divergently

transcribed from fixNOQP and fixGHIS. A second copy of fixNOQP and fixGHIS are found

on pRL9 and would appear to be in an operon with the distal regulatory gene fixK2. Also

divergently transcribed from this are the other more orthodox other regulatory genes fixKL

(Schluter et al., 1997; Young et al., 2006). The reason for the presence of two copies of

fixNOQP and fixGHIS is unknown as one intact copy of either is sufficient for effective

nitrogen fixation (Schluter et al., 1997). The fixNOPQ operon is predicted to encode an

alternative terminal oxidase with high oxygen affinity that would be required for bacteroid

respiration in a microaerobic environment, whilst the fixGHIS genes encode a cation pump

and accessory genes required for correct FixNOPQ synthesis (Preisig et al., 1996a; Preisig

et al., 1996b; Schluter et al., 1997).

The two principal regulatory proteins that bring about transcription of the nif and fix

genes are the transcriptional regulators NifA and FixK. Regulation of nifA and fixK in

response to the oxygen status of the nodule was first demonstrated in S. meliloti. The fixL

and fixJ genes encode a two-component regulator in which FixL acts in response to the

oxygen status to phosphorylate the response regulator FixJ (David et al., 1988; Gilles-

Gonzalez et al., 1991; Agron et al., 1993). The phosphorylated FixJ then activates the

expression of the transcriptional regulator FixK, a member of the FNR / CRP family, to

bring about activation of the fix genes and nifA (Ditta et al., 1987; Hertig et al., 1989; De

Philip et al., 1990; Galinier et al., 1994; Green et al., 2001). However, whereas in S.

meliloti the FixLJ cascade regulates expression of both nifA and fixK it was noted that in B.

japonicum it acts only to initiate expression of fixK2, which positively regulates the genes

required for microaerobic growth. In B. japonicum expression of nifA in aerobic conditions

is significant but is increased in microaerobic conditions by action of the two-component

regulator RegS / RegR, which senses the redox state of the cell (Bauer et al., 1998). The

genetic structure and regulation of the fix genes of R. leguminosarum and R. etli is

remarkably similar and again the regulation differs from that previously discussed for B.

japonicum and S. meliloti. R. leguminosarum bv. viciae and R. elti have no FixJ homologue

and instead encode a FixL like protein that is a hybrid of both FixL and FixJ (Patschkowski

et al., 1996; Girard et al.,2000). FixL performs the function of both proteins to activate

expression of fixK and fnrN, encoding two FNR / CRP like transciptional regulators that are

20

important for expression of the fixNOQP and other (Patschkowski et al., 1996; Gutierrez et

al., 1997; Lopez et al., 2001). R. leguminosarum bv. viciae and R. etli have two copies of

fixNOQP and it is FnrN rather than FixK that is primarily responsible for expression of both

operons, however only a double mutation in fixK and fnrN results in a Fix- plant (Colonna-

Romano et al., 1990; Patschkowski et al., 1996; Gutierrez et al., 1997; Schluter et al., 1997;

Girard et al., 2000; Moris et al., 2004). Whilst strains that had a single mutation in fnrN

where Fix+ there was a significant reduction in the rate of nitrogen fixation, indicating its

role as the dominant transcriptional regulator for nifNOQP expression.

1.1.8 The nif genes and nitrogenase biosynthesis.

The reductive breakage of the strong triple bond between N2 molecules is an

energetically expensive reaction that is catalysed by the nitrogenase enzyme to yield NH3.

N2 +8 H+ +8 e- +16 ATP → 2 NH4

+ + H2 + 16 ADP + 16 Pi

Nitrogenase is composed of two structurally and mechanistically conserved

metalloenzymes, dinitrogenase and dinitrogenase reductase, which are encoded by the nif

genes in rhizobia (Hageman and Burris, 1978). Dinitrogenase is a molybdenum-iron, MoFe,

containing protein that is 220 – 240 kDa and forms an α2β2 tetramer of two pairs of two

metaloclusters (Kim and Ress, 1992; Chan et al., 1993). Each αβ pair contains one MoFe

cofactor, MoFe7S9 homocitrate, which contains the site of substrate reduction, and one P-

cluster, Fe - 7S (Einsle et al., 2002). The α-subunit is encoded by nifD and contains the

MoFe cofactor whilst the β-subunit is encoded by nifK and associates with the α-subunit,

with a P-cluster present at the αβ interface (Ruvkun et al., 1982; Schindelin et al., 1997).

Dinitrogenase reductase is a smaller dimeric iron containing protein of 60 kDa encoded by

nifH. Dinitrogenase reductase acts as the obligate electron donor to dinitrogenase and

contains a single 4Fe-4S cluster at the subunit interface as well as two Mg-ATP binding

sites, one on each subunit (Ruvkun et al., 1982; Georgiadis et al., 1992; Schindelin et al.,

1997). The oxygen labile nature of nitrogenase is due to this surface exposed 4Fe-4S cluster

on the dinitrogenase reductase as the enzyme mechanism requires electron transfer from

here to the P-cluster of the dinitrogenase and subsequently to the FeMo cofactor, the site of

substrate reduction. Nitrogenase is a relatively large and slow enzyme with a turnover time

of approximately 5 s-1 and can account for up to 30 % of the bacteroid’s protein content

(Haaker and Klugkist, 1987; Dixon and Kahn, 2004).

21

The role of nifA, nifD, nifK and nifH as the regulatory and structural genes for

dinitrogenase and dinitrogenase reductase has already been discussed above. However, a

number of other nif genes are required for the biosynthesis of the metalloclusters and the

correct polypeptide folding associated with nitrogenase maturation. The genetic

organisation of the nif genes in R. leguminosarum bv. viviae is such that nifAB and

nifHDKEN are found closely localised to the fix genes on the sym plasmid pRL10, nifU is

found on the chromosome and nifS on pRL8 (Downie et al., 1983; Aguilar et al., 1987;

Young et al., 2006). NifB, NifN, NifE, NifV and NifH have all been assigned roles in the

FeMo cofactor biosynthesis whilst NifU and NifS are proposed to have a role in Fe-S

cluster biosynthesis (Filler et al., 1986; Yuvaniyama et al., 2000; Rubio and Ludden, 2005).

The products of other non-nif genes under the regulation of NifA, such as GroEL, have also

been identified that have a role in maturation of nitrogenase. GroEL is a general chaperone

that forms transient interactions with NifH, NifD and NifK and has been shown to be vital

for correct interaction of the FeMo cofactor and form the active site (Govezensky et al.,

1991). However, there is still much to be determined as to how and by what the Fe-S and P-

clusters are formed and then associate with the polypeptides.

Transcriptional activation of the nif genes is mediated via the transcriptional

regulator NifA and the RNA polymerase sigma factor σ54 (Morett and Buck, 1989;

Roelvink et al., 1990). NifA was first identified as the regulator required for transcription of

nifH and other genes associated with rhizobia nitrogenase biosynthesis through addition of

purified NifA from K. pneumoniae, then later through cloning and mutation (Sundaresan et

al., 1983; Downie et al., 1983; Szeto et al., 1984; Morett and Buck, 1988; Morett et al.,

1988). The symbiotic regulation of nifA in R. leguminosarum bv. viviae UPM791 was

recently shown to be autoregulated as promoter mapping indicated a NifA binding site

upstream of the fixABCX nifAB operon (Martinez et al., 2004). A second weak

symbiotically expressed promoter also exists between the intergenic region of fixX and nifA

that is most likely required to initiate the transcription of nifA, as it has no discernable NifA

binding site upstream, so that transcription from the primary promoter can be initiated. NifA

is a member of the enhancer-binding protein family (EBP) and shares the conserved

architecture of an amino terminal regulatory domain, a carboxyl terminal DNA binding

domain and a central conserved AAA+ ATPase domain. The C-terminal DNA binding

domain contains a helix-turn-helix motif that is required for recognition of an upstream

activating element (UAS) -24 / -12 of the promoter, in S. meliloti the σ54 polymerase core

binds to the consensus sequence 5’-CTTTGTCGATATCCGACAAAG-3’ (Morett et al.,

1988; Tian et al., 2006). The N-terminus of typical NifA proteins from K. pneumoniae, A.

22

brasilense and A. vinelandii all contain cGMP-specific phosphodiesterase stimulated

Anabaena adenylate cyclases and an E. coli FhlA (GAF) sensory input domain, both

required for regulation of NifA activity in non-symbionts. Interaction at these sites appears

to be involved with sensing of the nitrogen status of the cell either by interaction of GlnB or

2-oxoglutarate (Arsene et al., 1996; Little and Dixon, 2003). Whilst NifA mediated

expression of nifH in rhizobia has not been demonstrated in response to the nitrogen status

of the cell the N-terminal region has been implicated in post-translational regulation. Partial

deletion of the N-terminal domain of NifA leads to an increase of transcription of the nif

genes indicating its regulatory role (Beynon et al., 1988). Finally the central AAA+ ATPase

domain is required for interaction with the σ54 RNA polymerase haloenzyme via DNA

looping to form a closed complex. ATP hydrolysis via the AAA+ domain then brings about

the change in the σ54 binding surface to form an open complex and initiate transcription of

the nif genes. This central region would also appear to confer NifA with its oxygen sensitive

nature, due to a region of conserved, indispensable and invariant cysteine residues that lie

between the AAA+ domain and the DNA binding domain that are believed to be involved in

the binding of metal ions (Fischer et al., 1988; Dixon and Kahn, 2004).

NifA is itself reactive to oxygen and so displays both transcription and post-

translational control that could allow for disparate oxygen sensing, bringing about the

differential timing of expression between the fix and nif genes. The hierarchical regulatory

cascade of B. japonicum displays transcription of nifA and fixK at an oxygen concentration

where NifA activity is prevented (Screen et al., 1994; Sciotti et al., 2003). This enables

expression of the fix genes required for microaerobic growth at the relatively higher oxygen

concentration found in certain areas of the nodule without expression of nif genes, at a

concentration where nitrogenase would be inactivated. When a lower relative oxygen

concentration is reached in the areas of nodule tissue that nitrogen fixation occurs NifA is

no longer inactivated and so transcription of the genes required for nitrogenase biosynthesis

occurs. The oxygen reactive nature of NifA was certainly attributed to be the reason as for

why microarray data comparing S. meliloti microaerobic growth with symbiotic conditions

showed only 31 genes induced in both conditions (Becker et al., 2004). Of these 31 genes

the transcriptional regulators nifA and fixK were both shown to be transcribed and whilst the

genes subject to FixK regulation were also detected those under the control of NifA were

not. They attribute this to the fact that their microaerobic environment was kept at a

concentration of just under 1 µM dissolved oxygen whereas the free oxygen reported in

soybean nodules is 18 nM (Layzell et al., 1990). Microarray analysis of S. meliloti nifH and

nifA mutants, relative to wild-type, have further demonstrated the regulatory function of

23

NifA on symbiotic genes compared to that of a structural gene involved in nitrogenease

biosynthesis. Mutantion in nifA caused a decrease in the transcription of 310 genes,

compared to a decrease of 150 genes in response to mutation in nifH, indicating possible

transcriptional control by NifA over 160 genes during symbiosis (Tian et al., 2006).

24

1.2 Carbon Metabolism by the Bacteroid.

1.2.1 Carbon provision to the bacteroid.

Bacteroid carbon supply, required to fuel nitrogenase activity, is derived from the

plant photosynthate and is transported to the nodules via the phloem as sucrose (Bach et al.,

1958; Streeter, 1981; Reibach and Streeter, 1983; Gordon et al., 1985; Kouchi and

Yoneyama, 1986). Proteomic and transcriptional analysis has revealed the presence of

several sugar transporters expressed at the PBM of L. japonicus and M. truncatula

(Wienkoop and Saalbach, 2003; Colebatch et al., 2004; Kouchi et al., 2004; El Yahyaoui et

al., 2004). However, transport of sugars has only been demonstrated across the PBM of

French beans and in other plant nodules it appears this only occur via diffusion, for which

the rate of uptake is not sufficient to support nitrogen fixation (Herrada et al., 1989;

Udvardi et al., 1990). Sugar metabolism of free-living rhizobia utilises the Entner-

Doudoroff and pentose phosphate pathways (Finan et al., 1988; Barnett et al., 2004).

However, pea bacteroids mutated in either glucokinase or fructoinase, and sugar catabolic

mutants of clover bacteroids, are unaltered in nitrogen fixation (Ronson and Primrose, 1979;

Arias et al., 1979; Glenn et al., 1984a; Glenn et al., 1984b; Arwas et al., 1986; El-Guezzar

et al., 1988). Sugars also appear to be poorly metabolised by isolated soybean and pea

bacteroids indicating they are not the principal carbon source for bacteroid metabolism

(Glenn and Dilworth, 1981; Salminen and Streeter, 1987; McKay et al., 1989).

Sucrose metabolism occurs in the uninfected cells of the nodule cortex, as the low oxygen

status of infected cells prevents mitochondrial respiration from providing a sufficiently

steady carbon supply to the bacteroid at rates capable for sustained nitrogen fixation

(Rawsthorne and LaRue, 1986; Day and Mannix, 1988). Infected cells are not able to take

up glucose or sucrose from the apoplast actively and so supply of carbon relies either on

symplastic transport from uninfected cells, or on passive movement of organic anions into

the cytosol due to the low apoplastic pH (Brown et al., 1995; Abd-Alla et al., 2000; Peiter

and Schubert, 2003). Sucrose can be cleaved either by sucrose synthase (SS), into UDP-

glucose and D-fructose, or alkaline invertase, into D-glucose and D-fructose. The activity of

both enzymes is higher in uninfected cells of the nodule than those of the surrounding roots

(Robertson and Taylor, 1973; Thummler and Verma, 1987; Singh et al., 1994; Chopra et

al., 1998; Craig et al., 1999). SS is also essential for nitrogen fixation indicating that

sucrose is fully metabolised to organic acids and released into the apoplast for uptake into

infected cells to serve as a carbon supply for bacteroid metabolism (Gordon et al., 1999;

Peiter and Schubert, 2003).

25

The hydrolysed products of sucrose metabolism are used either for cellulose and

starch biosynthesis, or further metabolised by glycolytic enzymes to enter the TCA cycle as

phosphenolpyruvate (PEP) to produce dicarboxylic acids that are then supplied to the

bacteroid (Rosendahl et al., 1990; Day and Copeland, 1991). Glycolysis is know to be

enhanced in nodules compared to roots and the relative abundance of fructose-6-phosphate

and glucose-6-phosphate is also 5-fold higher in the nodules of L. japonicus, whilst the

concentrations of fructose and glucose are much lower (Copeland et al., 1989b; Day and

Copeland, 1991; Desbrosses et al., 2005). The activity of PEP carboxylase (PEPC) in

nodules is higher than that in surrounding roots indicating that it plays a crucial role in

providing carbon skeletons to infected cells for both effective nitrogen assimilation and also

bacteroid metabolism to fuel nitrogenase activity (Christeller et al., 1977; Laing et al.,

1979; Coker and Schubert, 1981; Maxwell et al., 1984; King et al., 1986; Vance and Gantt,

1992; Chopra et al., 2002). Two isoforms of PEPC have also been identified in L. japonicus

and soybean where one is nodule enhanced further indicating its role in supplying a carbon

supply to bacteroids (Xu et al., 2003; Nakagawa et al., 2003). PEPC may act as a regulatory

control mechanism for carbon supply to the bacteroid as its activity is regulated according

to both the photosynthate and amide / uriede xylem sap concentrations (Deroche and

Carrayol, 1988; Nakagawa et al., 2003). PEP metabolism is most likely linked to malate

dehydrogenase (MDH) to produce malate for supply to the bacteroid. Proteomic and

transcriptional analysis of P. sativium, L. japonicum and M. truncatula nodules have all

detected the up-regulated MDH and PEPC (Saalbach et al., 2002; Wienkoop and Saalbach,

2003; Colebatch et al., 2004; Kouchi et al., 2004; El Yahyaoui et al., 2004). Furthermore

the expression of these genes is reduced in ineffective nodules with defective nitrogenase

activity (Haser et al., 1992; Vance et al., 1994; Suganuma et al., 2004). MDH activity in

nodules is rapidly enhanced as bacteroids develop and this is also linked to an increase in

malate concentration (Appels and Haaker, 1988; Ratajczak et al., 1989). A nodule enhanced

MDH has been detected in nodules where its transcripts and protein are more highly

expressed and its activity accounts for approximately 50 % of the total (Appels and Haaker,

1988; Ocheretina and Scheibe, 1997; Miller et al., 1998). The Km values for oxaloacetate

and NADH are also significantly lower than for malate and NAD+ indicating it favours

malate synthesis.

Dicarboxylates have been shown to stimulate bacteroid nitrogen fixation in vitro

indicating their role as the carbon source for bacteroid metabolism in planta (Bergersen and

Turner, 1967). The concentrations of dicarboxylates in nodules are high, expressed as nmol-

1 g-1 fresh weight of nodule, at 164 malate and 104 succinate in soybean bacteroids, 90

26

malate and 158 succinate in pea bacteroids and 206 malate and 114 succinate in alfalfa

bacteroids (Streeter, 1987; Rosendahl et al., 1990; Fougere et al., 1991). As well as the

concentration being high, labelling experiments with 14CO2 demonstrated a high turnover of

these pools as the label was rapidly incorporated into the bacteroids, primarily as malate

(Rosendahl et al., 1990; Salminen and Streeter, 1992). Whilst transport of sugars has only

been demonstrated across the PBM of French bean nodules, without exception the transport

of dicarboxylates at high rates has been demonstrated across the PBM of all nodules,

indicating their role as the principal carbon source for bacteroid metabolism (Herrada et al.,

1989; Ouyang et al., 1990; Ouyang and Day, 1992).

A significant body of evidence has also been established using bacteroids unable to

utilise succinate and malate, to show that plants produce the C4 dicarboxylic acids necessary

for bacteroids to drive nitrogen fixation. The C4 dicarboxylate transport system was shown

to be important for both free-living and symbiotic forms of R. leguminosarum bv. trifolli

and mutation of this Dct system was shown to produce ineffective bacteroids (Ronson et al.,

1981). Mutation of this transport system in other species of rhizobia further showed that dct

mutants unable to utilise succinate, malate and fumarate form ineffective nodules (Finan et

al., 1981; Finan et al., 1983; Bolton et al., 1986; Humbeck and Werner, 1989).

Complementation of these mutants with a cosmid containing the dct genes was able to

restore nitrogen fixation demonstrating that the bacteroids were still capable of producing

nitrogenase and other enzymes necessary for nitrogen fixation (Ronson et al., 1984). The

fact that bacteroids mutated in genes encoding the Dct appeared normally differentiated and

were accompanied by an increase in starch and a lack of leghaemoglobin suggested

alternative carbon sources were utilised during invasion but C4 dicarboxylates are required

for nitrogen fixation (Ronson et al., 1984).

1.2.2 The dicarboxylate transport system (Dct).

As previously discussed C4 dicarboxylates are required by the bacteroid for nitrogen

fixation and the Dct system is therefore important for their translocation into the bacteroid.

A full review of dicarboxylate transport has been conducted by Yurgel and Kahn, 2004 so

only the salient points regarding the Dct will be addressed here. The system is made up of

three genes; dctA encoding a transport protein, and dctB and dctD, which are divergently

transcribed and encode a two-component sensor regulator system that activates transcription

of dctA in response to C4 dicarboxylates (Ronson et al., 1984; Watson, 1990; Reid and

Poole, 1998). Mutational analysis and genome sequencing has revealed homologs of dctA,

dctB and dctD in most, if not all, the rhizobia identified to date (Engelke et al., 1989;

27

Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006;

Young et al., 2006). In S. meliloti the Dct genes can be found on the megaplasmid whereas

in R. leguminosarum they are located chromosomally near to the genes coding for

lipopolysaccharide production (Watson et al., 1988; Poole et al., 1994). All three genes are

essential to functionality, as mutation in any of the three genes results in loss of growth of

free-living cultures on succinate and malate as the sole carbon source. dctA encodes a

putative transport protein and expression is regulated mainly in response to C4

dicarboxylates (Engelke et al., 1989; Reid et al., 1996; Yurgel et al., 2000). DctA of

Rhizobium strains is typical of most bacterial DctA carriers in being cation (H+) C4

dicarboxylate symporters of approximately 450 amino acids that contain the classical 12

putative transmembrane spanning sequences, with the N-terminus and C-terminus located in

the cytoplasm (Jording and Puhler, 1993; Janausch et al., 2002). Transcription from the

dctA promoter is dependent on σ54 binding to a site 93 bp upstream of the start codon in

R.leguminosarum. DctD is able to bind 75 bp upstream of the dctA promoter, via its C-

terminus helix-turn-helix motif, to interact with both σ54 and the β-subunit of the RNA

polymerase. This in turn leads to ATP hydrolysis and the formation of an open complex to

initiate transcription (Jording et al., 1994; Lee et al., 1994; Wang et al., 1997; Reid and

Poole, 1998). The two component sensor pair DctB and DctD is transcribed from a

constitutive promoter upstream of dctB. DctB is proposed to be a membrane bound sensor

for C4 dicarboxylates that is itself autophosphorylated at position His416 and acts to

phosphorylate DctD for initiation of dctA transcription. Increased transcription of dctA in S.

meliloti, from a trp promoter, has been shown to have no effect on increased levels of

succinate transport suggesting that increased DctA is required to regulate DctB activity

(Rastogi et al., 1992). It has further been shown that strains mutated in dctA have broader

substrate specificity to initiate autophosphorylation of DctB, so become promiscuous in

activation of DctD. This led to the conclusion that DctB acts as the sensor but DctA is

required for correct signal detection and signalling specificity. This dual role of DctA

appears to be very important, as increased phosphorylating activity of DctB would lead to

increased activation of DctD. As all σ54 factors are relatively conserved in structure, ie.

DctD, NifA and NtrC, this could lead to “cross-talk” with other operons (Reid and Poole,

1998).

Mutation in dctA always confers a Fix- phenotype on plants, however S. meliloti

mutants in either dctB or dctD can fix nitrogen at nearly wild-type rates (Engelke et al.,

1989; Yarosh et al., 1989; Watson, 1990). In symbiosis expression of dctA is therefore

independent of dctBD, leading to the possibility of an alternative symbiotic activator (ASA)

28

expressed during fixation that can activate dctA (Arwas et al., 1985; Engelke et al., 1987;

Wang et al., 1989; Poole and Allaway, 2000). Activation of dctA by DctB / DctD occurs in

zones II and III, whereas expression by the ASA occurs much later when there is a

transition from early to late stage bacteroid development (Boesten et al., 1998). This

requirement for only later stage expression of dctA via ASA, indicates that other carbon

sources are made available to bacteroids during formation of the symbiosome but that there

is an absolute requirement for organic acid metabolism to fuel nitrogen fixation (Lodwig

and Poole, 2003).

1.2.3 Tricarboxylic acid (TCA) cycle.

The TCA cycle is the central metabolic pathway in rhizobia and C4 dicarboxylic

acid metabolism is required to drive nitrogen fixation (Dunn, 1998). Oxidation of

compounds via the TCA cycle provides reducing equivalents, ATP synthesis and

metabolites for amino acid production and other biosynthetic pathways. Microarray analysis

has determined that the genes encoding the enzymes of the TCA cycle and also those

encoding the Dct system are repressed in bacteroids (Ampe et al., 2003; Becker et al.,

2004). However, bacteroids are non-growing cells and by comparison free-living cultures

were grown on 10 mM succinate and so this is therefore of no surprise. Instead mutational,

enzymatic and proteomic approaches provide a clearer picture of bacteroid metabolism and

so shall be briefly reviewed here.

Condensation of acety-CoA with oxaloacetate is catalysed via citrate synthase (CS)

to form citrate, the first intermediate of the TCA cycle. In R. topici two genes, pcsA and

ccsA, encode CS enzymes and double mutation in both leads to formation of nodules devoid

of bacteroids (Pardo et al., 1994). Mutation in gltA, encoding the CS enzyme in both S.

meliloti and S. fredii, also produced nodules that were ineffective suggesting an essential

role for this enzyme in bacteroid TCA cycle metabolism (Mortimer et al., 1999; Krishnan et

al., 2003). However, the cell surface polysaccharides of the gltA S. meliloti mutant appeared

altered and it was suggested the phenotype was a result of disruption of the infection

process. To determine the effect of mutation of gltA in mature bacteroids of S. meliloti

temperature sensitive mutations were constructed that showed CS activity to be essential for

nodule maintenance (Grzemski et al., 2005).

As nitrogen fixation is driven in bacteroids by dicarboxylate metabolism then

anaplerotic synthesis of acetyl-CoA is required for the TCA cycle to function fully, as

succinate, fumarate and malate are intermediates of this pathway. Acetyl-CoA is derived in

bacteroids from either acetate or pyruvate. Synthesis from acetate occurs either by

29

concerted action of acetate kinase and phosphotransacetylase, or by acetyl-CoA synthase

(Dunn, 1998). Activities of all three enzymes have been detected in isolated bacteroids of B.

japonicum and all suggest the kinetics favour acetyl-CoA synthesis (Preston et al., 1989;

Preston et al., 1990). However, isolated bacteroids of S. meliloti were unable to metabolise

acetate and mutation of the genes coding for acetate kinase and phosphotransacetylase had

no effect on the symbiotic phenotype (Miller et al., 1988; Summers et al., 1999). Formation

of acetate from dicarboxylates also requires linkage between the TCA cycle and

gluconeogenesis, through phosphenolpyruvate carboxykinase (PEPCK) activity. However,

isolated bacteroids of R. leguminosarum and S. meliloti have either low PEPCK activity or

mutation in pckA has no effect on the symbiotic phenotype (Arwas et al., 1985; McKay et

al., 1985; McKay et al., 1989; Finan et al., 1991; Osteras et al., 1991). This indicates that

citrate synthesis in bacteroids requires metabolism of C4 dicarboxylates to produce

oxaloacetate via MDH, and acetyl-CoA via malic enzyme (ME) and pyruvate

dehydrogenase (PDH) (McKay et al., 1988; Finan et al., 1991; Driscoll and Finan, 1993;

Driscoll and Finan, 1996; Cabanes et al., 2000). Pyruvate dehydrogenase (PDH) is a multi

enzyme complex encoded by two genes, pdhAα and pdhAβ, in S. meliloti (Cabanes et al.,

2000). Mutation in a putative arylesterase (ada) that clusters with the genes for PDH

reduced the activity in S. meliloti 16-fold and resulted in a Fix- phenotype (Soto et al.,

2001).

In rhizobia there are two forms of malic enzyme; a NADP-dependent ME with high

affinity and stimulated by ammonium, and a NAD+-dependent ME with a lower affinity and

is stimulated by potassium and ammonium salts (McKay et al., 1988; Copeland et al.,

1989a; Driscoll and Finan, 1993; Driscoll and Finan, 1996). It is proposed that NAD+-ME

most likely predominates in bacteroids for nitrogen fixation, as it has low affinity for malate

and so functions only when the substrate concentration is high. Also, stimulation of NAD+-

ME by NH4+ would ensure that maximum activity occurred when ammonia concentrations

are high as in nitrogen fixation (Copeland et al., 1989a). This has been further confirmed by

mutational, proteomic and transcriptional analysis of the two malic enzymes that showed

NAD+-ME is essential for nitrogen fixation and is highly expressed in both free-living cells

and bacteroids, whilst NADH-ME is dispensable for nitrogen fixation and it is repressed in

bacteroids (Driscoll and Finan, 1997; Djordjevic, 2004; Sarma and Emerich, 2005). The

affinity of NAD+-ME for malate increases on carbon flow through the TCA cycle by

succinate or fumarate, whereas its affinity decreases by pyruvate, 2-oxoglutarate and acetyl-

CoA (Voegele et al., 1999). This allosteric control of malic enzyme allows the balanced

30

input and proper functioning of the TCA cycle as one molecule of oxaloacetate and one

molecule of acteyl-CoA are required for condensation to citrate.

It has been suggested that a full TCA cycle may not operate in bacteroids since

aconitase (ACN) mutants of B. japonicum can still establish effective nitrogen fixation with

soybean plants (Thorny-Meyer and Kunzler, 1996; Prell and Poole, 2006). ACN catalyses

the reversible isomerization of citrate and isocitrate, however, mutation in acnA only

abolished 70 % of the activity in free-living cells. Two genes encoding ACN have been

identified in E. coli, however analysis of the sequenced rhizobial genomes does not reveal

an obvious secondary gene encoding ACN (Gruer et al., 1997; Kaneko et al., 2000; Galibert

et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006; Young et al., 2006). Therefore the

implications of the acnA mutation in B. japonicum do not demonstrate whether a complete

TCA cycle is in operation in bacteroids. However, the fact that isocitrate dehydrogenase

mutants (ICDH) of S. meliloti are ineffective indicates that metabolism of citrate to 2-

oxoglutarate through the TCA cycle is an essential step in bacteroid metabolism. ICDH,

encoded by icd, catalyses the oxidation of isocitrate to 2-oxoglutarate. The activity of ACN

is high in isolated bacteroids of R. leguminosarum and ICDH activity is also high in

bacteroids of R. leguminosarum, S. meliloti and B. japonicum, further indicating its role in

bacteroid respiration (Mckay et al., 1989; Miller et al., 1991; Green et al., 1998).

31

Pyruvate Oxaloacetate Citrate

Acetyl-CoA

Isocitrate

2-oxoglutarate

Succinate semialdehyde

Succinyl-CoASuccinate

Fumarate

Malate

MDHME

CS

ACN

ICDH

OGDH

SCS

ODC

PDH

SSDH

FUM

SDH

PYCPyruvate Oxaloacetate Citrate

Acetyl-CoA

Isocitrate

2-oxoglutarate

Succinate semialdehyde

Succinyl-CoASuccinate

Fumarate

Malate

MDHME

CS

ACN

ICDH

OGDH

SCS

ODC

PDH

SSDH

FUM

SDH

PYC

Figure 1.2.1. The major enzymatic TCA cycle steps identified through proteomic and enzymatic analysis (Karr et al., 1984; Waters et al., 1985; McKay et al., 1989; Miller et al., 1991; Kim and Copeland, 1996; Djordjevic, 2004; Sarma and Emerich, 2005). ACN = Aconitase, CS = Citrate synthase, FUM = Fumarase, ICDH = Isocitrate dehydrogenase, MDH = Malate dehydrogenase, ME = Malic enzyme, ODC = 2- oxoglutarate decarboxylase, OGDH = 2-oxoglutarate dehydrogenase, PDH = Pyruvate dehydrognease, PYC = Pyruvate carboxylase, SCS = Succinyl-CoA synthase, SDH = Succinate dehydrogenase, SSDH = Succinate semialdehyde dehydrogenase.

Dicarboxylic acid metabolism by the TCA cycle revolves around the regeneration of

oxaloacetate from 2-oxoglutarate, initiated by 2-oxoglutarate dehydrogenase (OGDH)

(Dunn, 1998). The sucAB genes of R. leguminosarum and B. japonicum have been show to

encode the OGDH component (E1) and dihydrolipoamide succinyltransferase component

(E2) respectively, which catalyse the oxidative decarboxylation of 2-oxoglutarate to

succinyl-CoA (Walshaw et al., 1997b; Green and Emerich, 1997a; Green and Emerich,

1997b). The sucAB genes of R. leguminosarum are transcriptionaly coupled to mdh and

sucCD, which code for malate dehydrogenase (MDH) and succinyl-CoA synthetase (SCS)

respectively; and the same genetic organisation appears to occur in S. meliloti and M. loti

(Poole et al., 1999; Kanecko et al., 2000; Galibert et al., 2001; Dymov et al., 2005). The

32

whole operon is under the control of a single promoter upstream of mdh and as a

consequence it is not possible to split the TCA cycle, as occurs in E. coli. The same genetic

arrangement occurs in B. japonicum but whilst the latter four genes are co-transcribed it

appears mdh is not part of this operon (Green and Emerich, 1997a; Green and Emerich,

1997b; Green et al., 2003). Mutation in sucAB in R. leguminosarum resulted in a strain that

formed ineffective nodules, however the mutation also caused increased transcription of the

upstream genes and subsequently higher enzyme activities that may have negatively

impacted upon bacteroid metabolism (Duncan and Fraenkel, 1979; Walshaw et al., 1997b).

Mutation in sucD in R. leguminosarum also produced a strain that formed ineffective

nodules, as expected due to the polar effect on expression of downstream sucAB. The

sucCD genes encode the α and β subunits of SCS, which catalyses the hydrolysis of

succinyl-CoA to succinate. However, not all enzyme activity was abolished in free-living

cultures of R. leguminosarum mutated in sucD suggesting it contains another gene encoding

SCS (Walshaw et al., 1997b). Analysis of the sequenced rhizobial genomes reveals two

copies of both sucC and sucD in M. loti, but not in other rhizobia (Kaneko et al., 2000;

Galibert et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006; Young et al., 2006). In B.

japonicum sucAB is also clustered with mdh and sucCD but a strain mutated in sucA was

unaltered in mdh activity (Green and Emerich, 1997a). Nodulation of soybean plants by this

strain, whilst significantly delayed and reduced, did produce bacteroids capable of nitrogen

fixation at rates comparable to wild-type (Green and Emerich, 1997b). This again suggests

the possibility that a fully functional TCA cycle is not required for symbiotic nitrogen

fixation. However, an alternative pathway for 2-oxoglutarate metabolism has been

demonstrated in B. japonicum through action of 2-oxoglutarate decarboxylase (OGD) and

succinate semialdehyde dehydrogenase (SSDH) (Green et al., 2000). Both enzymes are

active in isolated bacteroids from soybean and demonstrate an alternate TCA cycle in B.

japonicum.

The sdhC, sdhD, sdhA and sdhB genes encode proteins that form the succinate

dehydrogenase (SDH) complex, which catalyses the dehydrogenation of succinate to

fumarate. S. meliloti and R. leguminosarum mutants are unable to grow on succinate but are

on fumarate and malate (Finan et al., 1981; Gardiol et al., 1982; Gardiol et al., 1987). Pea

and alfalfa plants nodulated by R. leguminosarum and S. meliloti SDH mutants form

ineffective bacteroids consistent with the hypothesis of dicarboxylates as the primary

carbon source for nitrogen fixation.

The fumC gene, encoding a type-II fumarase (FUM) that catalyses the hydration of

fumarate to malate, has been identified in R. leguminosarum, S. meliloti and R. etli, whilst

33

there is evidence for two genes encoding FUM in both M. loti and B. japonicum (Kaneko et

al., 2000; Galibert et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006; Young et al.,

2006). Mutation of fumC in B. japonicum abolished 60 % of the activity, consistent with

there being two genes encoding FUM, and was able to effectively fix nitrogen in symbiosis

with soybean (Acuna et al., 1991)

As discussed previously transcription of mdh and sucCDAB are coupled in R.

leguminosarum and S. meliloti (Poole et al., 1999; Dymov et al., 2005). Determining the

nature of a mutation in mdh is therefore difficult due to its effect on the downstream

sucCDAB genes. MDH catalyses the reversible oxidation of malate to oxaloacetate, which

as discussed earlier is required for condensation with acetyl-CoA, produced from malate by

ME and PDH, to form citrate. The protein and activity levels of MDH in bacteroids are

particularly high compared to those observed in free-living cells (Mckay et al., 1989; Natera

et al., 2000). Upstream of mdh in B. japonicum, R. leguminosarum, M. loti, R. etli and S.

meliloti are sequences that resemble members of the AAA gene family, which encode

putative transcriptional regulators (Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al.,

2002; Gonzalez et al., 2006; Young et al., 2006). Mutation in this gene in B. japonicum

gave a higher rate of MDH activity and also increased the rate of nitrogen fixation by up to

50 % (Birke et al., 1998). An mdh S. meliloti mutant, which retained expression of the

downstream sucCDAB by an outward orientated inducible promoter on the transposon,

formed ineffective nodules with alfalfa (Dymov et al., 2005). Growth of free-living mutant

cells was slowed but occurred indicating a bypass of MDH via ME and pyruvate

carboxylase (PYC). However, PYC activity is reported to be absent from bacteroids of R.

etli indicating that this bypass does not occur in bacteroids of rhizobia (Dunn et al., 1997).

1.2.4 Maintaining bacteroid metabolism.

Due to the microaerobic conditions within the nodule, required for nitrogenase

activity, it has been suggested that the full aerobic capacity of the TCA cycle is limited in

bacteroids. Bacteroids are also non-replicating cells and so require a delicate balance of

input and export of carbon skeletons from the TCA cycle so as not to cause inhibition by

build up of metabolites and reductants. Isolated bacteroids of R. leguminosarum have

demonstrated that incubation in conditions with a low concentration of malate or succinate

gives good rates of nitrogen fixation. However, in moderate concentrations there is an

inhibitory effect suggesting that the overall carbon demand by the bacteroid is not high and

that oxidation of dicarboxylates to an excess leads to an imbalance of metabolism (Prell and

Poole, 2006). The imbalance in the intracellular ratio of NAD+ to NADH has been

34

suggested to cause the TCA cycle to become inhibited at a number of key stages. The

microaerobic environment within the nodule is at a free O2 concentration of approximately

3 – 22 nM placing important considerations on the respiratory electron flow (Witty and

Minchin, 1990; Hunt and Layzell, 1993). The ratio of NAD+ to NADH in B. japonicum

bacteroids is estimated to be 0.83 (Salminen and Streeter, 1990). This has been suggested to

cause markedly reduced activities of ODGH, NAD+-ME and ICDH in B. japonicum, and

CS in M. ciceri (Karr and Emerich, 2000; Tabrett and Copeland, 2000; Lodwig and Poole,

2003). A number of pathways involved either in the redirection of carbon skeletons, ATP or

reductant from the TCA cycle have therefore been suggested to ensure the effective removal

or incorporation of metabolites to maintain nitrogenase activity.

The glutamine cycle is believed to function to consume NADH and ATP in an

energy displacing reaction that enables optimum energy flow essential for succinate and

glucose metabolism, as glycolysis is shown to be inhibited at high ATP concentrations

(Larsson et al., 1997; Encarnacion et al., 1998). The glutamine cycle involves a glutamine

transaminase, a ω-amidase and the GS / GOGAT pathway (Duran and Calderon, 1995;

Duran et al, 1995; Duran et al, 1996). Mutation in both glnA and glnII, or in GOGAT

abolishes this pathway in free-living cells of R. etli and S. meliloti and leads to the

preferential usage of glutamate over succinate. Although glutamine is degraded by

glutaminase, during symbiosis with bean, the glutamine cycle appears unlikely to be

important in bacteroids due to the predicted down regulation of GS / GOGAT enzymes

(Duran and Calderon, 1995; Duran et al, 1996).

It has been proposed that OGDH in particular may be inhibited by the low O2

tension of the nodule leading to glutamate synthesis. Consistent with this, mutation of

OGDH in free-living cultures of R. leguminosarum secreted large amounts of glutamate

(Walshaw et al., 1997b). Glutamate catabolism by the γ-aminobutyric acid (GABA) shunt

pathway has been proposed to occur as a possible bypass of the 2-oxoglutarate complex.

R.leguminosarum has a gabT gene, which encodes a GABA aminotransferase that is 2-

oxoglutarate dependent, and is also proposed to another have a similar GABA

aminotransferase that is pyruvate dependent (Prell et al., 2002). One possibility of this

pathway would be that glutamate is decarboxylated to GABA, whereby the amino group is

removed by transamination to yield succinate semialdehyde, which is then oxidised to

succinate (Fitzmaurice and O’Gara, 1993; Poole and Allaway, 2000). The GABA shunt

pathway does not however appear to occur in bacteroids, as the activity of glutamate

decarboxylase has not been detected (Salminen and Streeter, 1990). Another functional

bypass to OGDH that has been demonstrated to occur in bacteroids is via the metabolism of

35

2-oxoglutarate to succinate semialdehyde that is then further metabolised to succinate. ODC

activity has been determined in free-living cells and isolated bacteroids of B. japonicum, as

has SSDH in free-living and bacteroids of B. japonicum and R. leguminosarum (Green et

al., 2000; Prell et al., 2002; Prell, Bourdes and Poole, Unpublished).

Synthesis of polyhydroxybutyrate (PHB) has been demonstrated with isolated

bacteroids when the normal TCA pathway is blocked or over saturated by dicarboxylates

(Bergersen and Turner, 1990). Bacteroids, such as R. etli and B. japonicum, that form

determinate nodules in particular show high levels of PHB (Lodwig and Poole, 2003).

Removal of acetyl-CoA and NADPH from the TCA cycle is believed to occur in order to

maintain its activity under microaerobic conditions. Formation of citrate and a balanced

TCA cycle requires that for each molecule of oxaloacetate there must one molecule of

acetyl-CoA, as any imbalance will quickly accumulate, inhibiting enzyme efficiency and

lead to a greater imbalance of metabolites. The initial step in PHB formation is the α-

ketothiolase catalysed condensation of two acetyl-CoA molecules to form acetoacetyl-CoA.

Acetoacetyl-CoA is then reduced in an NADPH consuming acetoacetyl-CoA reductase

catalysed reaction to form D-β-hydroxybutyryl-CoA, which is incorporated into PHB by

PHB synthase. As PHB consumes acetyl-CoA it has therefore also been suggested to act as

an emergency store of carbon skeletons, ATP and reducing equivalents for nitrogenase

activity when carbon sources are scarce or if any pathway of the TCA cycle becomes

blocked (Lodwig and Poole, 2003).

36

1.3 Nitrogen Metabolism by the Bacteroid.

Regulation of nitrogen metabolism in rhizobia centres principally on the action of

five proteins; a PII like protein (GlnB), an uridylyltransferase (GlnD), a σ54 transcriptional

co-factor (NtrA), a hisitidine protein kinase (NtrB) and a response regulator (NtrC). The PII

protein is capable of integrating signals from carbon and nitrogen metabolism by modifying

its activity through uridiylylation (Ninfa et al., 2000; Arcondeguy et al., 2001). Intracellular

nitrogen status is determined through the ratio of glutamine to 2-oxoglutarate (Jiang et al.,

1998a; Jiang et al., 1998b). In conditions of either nitrogen excess or limitation the PII

protein is deuridylylated or uridylylated respectively by GlnD (Bueno et al., 1985; Holtel

and Merrick, 1988; Holtel and Merrick, 1989; Acrondeguy et al., 1997; Schluter et al.,

2000). In rhizobia it appears that genes involved in NH4+ metabolism require σ54 and

phosphorylated NtrC mediated transcription (Milcamps et al., 1998; Patriarca et al., 2002).

In conditions of nitrogen limitation NtrB acts as a kinase towards NtrC to transfer

phosphate from ATP and activate the response regulator. In conditions of nitrogen excess

PII of R. leguminosarum in its unmodified form changes in its interactions to bind with the

C-terminal GHKL domain of NtrB and activate its phosphatase activity on NtrC, thus

lowering expression of genes regulated by the ntr system (Amar et al., 1994; Ninfa and

Atkinson, 2000). In E. coli ntrBC are co-transcribed with glnA, encoding a glutamine

synthetase, but in R. etli and other rhizobia transcription is coupled to a gene encoding a

protein of unknown function (Patriarca et al., 1993; Kaneko et al., 2000; Galibert et al.,

2001; Kaneko et al., 2002; Young et al., 2006).

1.3.1 Glutamate and glutamine metabolism.

A wealth of data from genome sequencing, microarrays, and enzyme assays

indicates that ammonium assimilation in Rhizobium species proceeds via two mechanisms;

GS / GOGAT and AldA (Bravo and Mora, 1988; Allaway et al., 2000; Kaneko et al., 2000;

Galibert et al., 2001; Kaneko et al., 2002; Davalos et al, 2004; Gonzalez et al., 2006;

Young et al., 2006). The predominant pathway for ammonium assimilation is the concerted

action of glutamine synthetase (GS) and glutamate-2-oxoglutarate dehydrogenase

(GOGAT), demonstrated by the fact that GOGAT mutants are glutamate auxotrophs

(O’Gara et al., 1984; Carlson et al., 1987; Bravo and Mora, 1988; Castillo et al, 2000;

Ferraioli et al, 2002). For ammonium assimilation via the GS / GOGAT pathway glutamate

is initially aminated to glutamine in an ATP-dependent GS catalysed reaction. Glutamine is

37

then deaminated in an NADPH-dependent reaction, catalysed by GOGAT, which transfers

an amino group to 2-oxoglutarate yielding two molecules of glutamate.

There are three characterised genes encoding GS enzymes in S. meliloti,

R.leguminosarum, R.etli and M. loti; glnA, glnII and glnT encoding GSI, GSII and GSIII

respectively (de Buijin et al., 1989; Espin et al., 1990; Chiurazzi et al., 1992; Shatters et al.,

1993; Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2002; Gonzalez et al., 2006;

Young et al., 2006). The evolutionary reason for multiple isoforms of GS enzymes remains

unresolved, however the two primary GS enzymes are thought to be involved with either

assimilation of external NH4+ (GSI) or the assimilation of internal NH4

+ (GSII) (Patriarca et

al., 2002). GSI, but not GSII, phylogeny amongst rhizobia broadly resembles the 16S rDNA

phylogeny for the same bacteria. The rearrangements for GSII are proposed to be a result of

horizontal gene transfer; Mesorhizobium to Bradyrhizobium, Rhizobium to R. galegae and

Rhizobium to M. huakuii (Turner and Young, 2000). GSI is similar to the GS enzymes of

enteric bacteria and its activity is regulated by reversible adenylation, catalysed by GlnE

itself stimulated by unmodified PII (Arcondeguy et al., 1996). Expression of glnA is weakly

constitutive from a σ70 regulated promoter and is transcriptionaly coupled with glnB to

maintain a low intracellular concentration of GS (Chiurazzi and Iaccarino, 1990). When

growth is switched from a nitrogen-rich to a nitrogen-poor environment the intracellular

concentration of GSI increases through increased transcription from an independent glnA

promoter requiring σ54 and phosphorylated NtrC, while activity is regulated by reversible

adenylation (Reitzer and Magasanik, 1985; Reitzer and Magasanik, 1986; Rossi et al.,

1989; Arcondeguy et al., 1996; Davalos et al., 2004). GSI is also required for efficient

derepression of glnII and transcription of this gene dramatically increases in conditions of

nitrogen-limitation (Tate et al., 2001; Davalos et al., 2004). Divergently transcribed from

glnII is gstI, which encodes a post-transcriptional regulator of GSII (Tate et al., 2001;

Napolitani et al., 2004). In conditions of nitrogen excess gstI expression is high and glnII

low, but in conditions of nitrogen starvation phosphorylated NtrC binds in the intergenic

region to inhibit transcription of gstI and activate σ54 dependent transcription of glnII

(Patriarca et al., 1992; Reid et al., 1996; Tate et al., 2001). By contrast, expression of glnT

occurs only on mutation of both glnA and glnII (de Bruijin et al., 1989; Chiurazzi et al.,

1992; Shatters et al., 1993).

Expression and mutation of the genes involved in the GS / GOGAT pathway

indicate this system is switched off in bacteroids. Down regulation of the genes required for

uptake and assimilation of NH4+ is observed when bacteria are released from infection

threads (Tate et al., 1998). This is followed by a further down regulation of the regulatory

38

genes glnB and ntrC just before zone II-III in the nodule (Patriarca et al., 1996; Ercolano et

al., 2001). This is consistent with mutational and proteomic analysis of bacteroids from pea,

alfalfa and soybean nodules where only low levels of GSII protein were detected and

mutation of ntrC had no effect on symbiosis (Szeto et al., 1987; Udvardi et al., 1992;

Saalbach et al., 2002; Djordjevic, 2004; Sarma and Emerich, 2005). The concentration of

glutamine in bacteroids isolated from alfalfa and pea are also low at 7 ± 1 nmol-1 g-1 fresh

weight and 10 ± 3 nmol-1 g-1 fresh weight respectively (Rosendahl et al., 1990; Fougere et

al., 1991). Mutation of gltB, encoding the large subunit of GOGAT, in R. etli had no effect

on the symbiotic plant phenotype (Castillo et al., 2000). Similarly glt mutants of S. meliloti

were unable to assimilate ammonia but were able to nodulate alfalfa seedlings for effective

for nitrogen fixation (Lewis et al., 1990). However, mutation of gltD, encoding the small

subunit of GOGAT, in R. etli produced bacteroids with significantly reduced rates of

nitrogen fixation (Ferraioli et al., 2002). Abolishing GS activity through mutation of both

glnA and glnII in S. meliloti and B. japonicum gave contrasting phenotypes for the

requirement of bacteroid ammonium assimilation. A S. meliloti double mutant produced

effective nodules, however residual GS activity was detected in bacteroids due to the

presence of GSIII (de Bruijin et al., 1989). B. japonicum lacks a homolog for glnT and

mutation of both glnA and glnII in this strain abolished the ability to nodulate soybean

(Carlson et al., 1987). These results indicate either incomplete loss of enzyme activity or

else a general effect on bacterial growth and so do not reflect the impact of mutation of GS /

GOGAT on nitrogen metabolism by mature bacteroids. The difference between mutation of

either glnB or glnD on the symbiotic effectiveness of R. leguminosarum highlights the

requirement for a reduced nitrogen assimilation requirement in bacteroids. Mutation of glnB

leads to loss of PII protein and a state of constitutively phosphorylated NtrC, so expressing

genes involved in nitrogen metabolism (Amar et al., 1994). This strain induces early

symbiosis but nitrogenase is only weakly expressed in bacteroids relative to wild-type. By

contrast a glnD mutation leads to constitutively unmodified PII protein that interacts with

NtrB activating its phosphatase activity on NtrC and abolishing all expression of genes

involved in nitrogen metabolism. This strain is unaffected for nodulation and is able to form

effective nodules with wild-type rates of nitrogenase activity (Schluter et al., 2000). In R.

leguminosarum although GS activity was detectable GOGAT activity was absent, therefore

precluding the operation of the GS / GOGAT at a level comparable with NH3 formation

(Kurz et al., 1975).

The presence of high glutamate concentrations in isolated bacteroids has been

shown in several studies (Streeter, 1987; Fougere et al., 1991; Salminen and Streeter, 1992;

39

Rosendahl et al., 1992). However, such large levels have not been detected in bacteroids

isolated directly from whole plants exposed to 15N and it was suggested that the

accumulation of glutamate in previous studies may be a stress response induced by the

breakdown in the O2 diffusion barrier (Lodwig and Poole, 2003). As mentioned previously

high levels of intracellular glutamate may be due to inhibition of OGDH. However, the

identification of the ODC and SSDH pathway in B. japonicum represents a better bypass for

this complex to allow the TCA cycle to function (Green et al., 2000). Also ammonium

assimilation is thought to be down regulated in bacteroids so glutamate synthesis would

have to occur via transmination from an amino acid supplied to the bacteroid.

1.3.2 Aspartate and asparagine metabolism.

Free-living cultures of R. leguminosarum are not able to grow on aspartate as the

sole carbon source. S. meliloti contains three genes that encode proteins that display

aspartate aminotransferase activity, however only aatA is conserved amongst other rhizobia

(Alfano and Kahn, 1993; Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2002;

Gonzalez et al., 2006; Young et al., 2006). The Fix- symbiotic phenotype of aatA mutants

in both S. meliloti and R. leguminosarum highlights the critical role this enzyme plays in

balancing carbon and nitrogen pools in bacteroids (Rastogi and Watson, 1991; Lodwig et

al., 2003). Electron micrographs of pea nodule sections show that a R. leguminosarum aatA

mutant forms fully developed bacteroids similar to those mutated in dct (Lodwig et al.,

2003). Aspartate aminotransferase (AatA) catalyses the reversible transamination of

oxaloacetate by glutamate to yield aspartate and 2-oxoglutarate. It has also recently been

proposed that AatA is capable of transaminating pyruvate with either glutamate or aspartate

to yield alanine (Bourdes and Poole, Unpublished).

Aspartase activity has been detected in isolated B. japonicum bacteroids and so it

was suggested that the major pathway of glutamate utilization in bacteroids is

transamination to form aspartate, followed by direct deamination of aspartate by aspartase

(Kouchi et al., 1991). Aspartase catalyses the deamination of aspartate to yield fumarate and

ammonia. R. etli has also been shown to have aspartase activity and a putative aspartase

gene has been identified that forms part of an L-asparagine operon (Huerta-Zepeda et al.,

1997; Ortuno-Olea and Duran-Vargas, 2000). One species of R. leguminosarum also

demonstrated aspartase activity, however this was only expressed when a mutation occurred

that lead to constitutive enzyme synthesis (Poole et al., 1984).

Asparagine concentrations in bacteroids isolated from pea and alfalfa are the highest

and third highest of all amino acids respectively (Rosendahl et al., 1990; Fougere et al.,

40

1991). Asparagine biosynthesis occurs via the action of asparagine synthetase that catalyses

the ATP dependent transamidation of aspartate by glutamine to yield asparagine and

glutamate. Two genes in E. coli (asnA and asnB) and three in B. subtilis (asnB, asnO and

asnH) encode asparagine synthetases (Cedar and Schwartz, 1969; Humbert and Simoni,

1980; Felton et al., 1980; Reitzer and Magasanik, 1982; Yoshida et al., 1999). The AsnA

family of asparagine synthetases are ammonia dependent, whereas those typical of AsnB,

AsnO and AsnH use either ammonia or, preferentially, glutamine as a nitrogen donor.

Homologs of asnA and asnH are absent in all sequenced rhizobia genomes to date, however

S. meliloti, R. etli, M. loti and B. japonicum all encode a homolog of asnB (Kaneko et al.,

2000; Kaneko et al., 2002; Gonzalez et al., 2006). In addition S.meliloti and also

Mesorhizobium spp. BNC1 encode a homolog of asnO (Galibert et al., 2001; Joint Genome.

Institute, 2006 http://www.jgi.doe.gov/). AsnO in S. meliloti does not appear to be involved

in asparagine biosynthesis however. Mutation of asnO enables S. meliloti to escape

repression by FixT and so may instead serve a regulatory function in to couple nitrogen

fixation with the nitrogen needs of the cell (Berges et al., 2001).

In R. leguminosarum there is an absence of genes from the genome encoding

proteins that share homology to either AsnA or AsnB type asparagine synthetases (Young et

al., 2006). In addition there is no gene encoding an asparagine aminoacyl-transferase,

aparaginyl-tRNA synthetase. Instead it would appear that R. leguminosarum employs a

tRNA dependent transamidation mechanism for asparagine synthesis, similar to that

observed in T. thermophilus and D. radiodurans (Becker and Kern, 1998; Curnow et al.,

1998). These species possess a non-discriminating aspartyl-tRNA synthetase that generates

misacylated Asp-tRNAAsn. This misacylated Asp-tRNAAsn is then amidated, using

glutamine, to form the correctly charged Asn-tRNAAsn by the heterotrimeric Asp-tRNAAsn

amidotransferase, encoded by gatCAB (Curnow et al., 1998). This Asp-tRNAAsn

amidotransferase can also transamidate Glu-tRNAgln to Gln-tRNAgln (Becker et al., 2000;

Salazar et al., 2001; Raczniak et al., 2001). As R. leguminosarum also lacks a canonical

glutaminyl-tRNA synthetase then it would appear this strain also contains a misacylating

glutamyl-tRNA synthetase. It would appear therefore that tRNA dependent asparagine

synthesis is the sole biosynthetic route for this amino acid and so the free levels of aspargine

observed in bacteroids of R. leguminosarum are not a product of bacteroid synthesis.

Asparaginase catalyses the hydrolysis of asparagine to yield aspartate and NH4+.

Two asparaginase activities have been identified in R. etli; asparaginase I is theremostable

and constitutive, asparaginase II thermolabile and induced by asparagine but repressed by

other carbon sources (Huerta-Zepeda et al., 1997). The L-asparagine operon of R. etli

41

contains a putative thermolabile asparaginase (ansA) and an aspartase (ansB) both inducible

and essential for asparagine catabolism, similar to the ans operon of B. subtilis (Sun and

Setlow, 1991; Ortuno-Olea and Duran-Vargas, 2000). The L-asparagine operon is absent

from other rhizobia and only R.leguminosarum has a gene that shows any homology,

although very low, to ansA (Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2002;

Gonzalez et al., 2006; Young et al., 2006).

1.3.3 Alanine metabolism.

The dad operon is present in a wide range of bacteria and represents the principal

route of alanine catabolism in rhizobia and mutation results in a loss of growth on alanine

(Wild and Klopotowski, 1981; Allaway et al., 2000). DadX, an alanine racemase, first

converts L-alanine to D-alanine before being oxidised to pyruvate by DadA, a membrane

linked D-alanine dehydrogenase. In addition alanine catabolism can also occur via the over-

expression of the soluble NAD+ linked L-alanine dehydrogenase (AldA) that can

compensate for the loss of growth by a dad mutation (Allaway et al., 2000). However, the

regulation and kinetics of alanine dehydrogenase overwhelmingly favour alanine formation

by ammonia-dependent reductive amination of pyruvate (Smith and Emerich, 1993;

Allaway et al., 2000; Lodwig et al., 2004). Bacteroids isolated from indeterminate nodules

have lower AldA activity than those isolated from determinate nodules (Smith and Emerich,

1993; Lodwig et al., 2004; Kumar et al., 2005). Consistent with this S. meliloti and R

leguminosarum encode only one copy of aldA, whereas B. japonicum and M. loti, encode

two copies (Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2002; Young et al.,

2006). Mutation in genes coding for proteins with AldA activity in R. leguminosarum, M.

loti and R. etli has have no effect on nodulation and all strains are capable of effective

nitrogen fixation (Allaway et al., 2000; Tate et al., 2004; Kumar et al., 2005). It would

appear that de novo alanine synthesis in bacteroids has a secondary role in balancing the

intracellular concentrations of alanine and pyruvate.

Alanine synthesis has also been reported in R. etli to occur through the action of

glutamine transferase however this has not been investigated in depth (Duran and Calderon,

1995).

1.3.4 Nitrogen provision to the plant and amino acid cycling.

It is generally accepted that the principal secretion product of nitrogen fixation is

ammonium (Bergersen., 1965). Ammonium transport by free-living rhizobia in nitrogen

limitation occurs through active uptake via the ntr regulated Amt transporters (Glenn and

42

Dilworth, 1984; O’Hara et al., 1985; Pargent and Kleiner, 1985). In conditions of nitrogen

excess ammonia is able to enter cells by diffusion (Howitt et al., 1986). During symbiosis

the Amt is not expressed, in fact ectopic expression of this system in R. etli disrupts

nodulation and bacteroid differentiation (Tate et al., 1998; Tate et al., 1999). Therefore it is

expected that diffusion of ammonia occurs from nitrogen fixing bacteroids into an acidified

PBS to enhance NH4+ formation for transport across the PBM (Glenn and Dilworth, 1984;

Tyerman et al., 1995; Day et al., 2001). It was also proposed that nitrogen efflux from the

symbiosome to the plant cytosol occurs via diffusion because a large concentration gradient

of ammonia exists (Streeter, 1989; Udvardi and Day, 1990). However, a novel voltage-

gated channel capable of NH4+ transport was identified on the PBM from soybean and pea

that will allow transport when a positive membrane potential is generated across the PBM

(Tyerman et al., 1995; Mouritzen and Rosendahl, 1997; Kaiser et al., 1998; Roberts and

Tyerman, 2002). Acidification of the PBS would generate such a potential and energise the

membrane to allow the movement of NH4+ into the plant cytosol. The acidification of the

PBS is facilitated by a proton pumping H+-ATPase (Blumwald et al., 1985; Udvardi and

Day, 1989; Szafan and Haaker, 1995). Biochemical and immunological studies revealed

that the major H+-ATPase of symbiosis is a P-ATPase (Blumwald et al., 1985; Fedorova et

al., 1999). Proteomic studies of the PBM fraction of L. japonicus and pea have also

revealed the presence of V-type H+-ATPases (Saalbach et al., 2002; Weinkoop and

Saalbach, 2003).

Plant ammonium assimilation of symbiotically fixed nitrogen in the plant cytosol

occurs through the GS / GOGAT pathway and asparagine synthesis (Kennedy, 1966a;

Kennedy, 1996b; Waterhouse et al., 1996; Shi et al., 1997). Temperate legumes that tend to

form determinate nodules, such as pea clover and alfalfa, mainly export asparagine whereas

tropical legumes that tend to form indeterminate legumes, such as soybean and Phaseolus

bean, export uriedes (Vance et al., 1987; Waterhouse et al., 1996; Vance et al., 2000;

Lodwig and Poole, 2003). In the amide transporters, such as alfalfa and clover, the activity

of GS and Aat activity is induced in the plant cytosol of infected cells over that in

uninfected cells (Cullimore and Bennett, 1988; Robinson et al., 1994; Trepp et al., 1999).

Transcription of the gene encoding NADH-dependent GOGAT and GOGAT activity are

also induced in infected cells compared to those of uninfected cells and other plant organs

(Vance and Gantt, 1992; Chen and Cullimore, 1988; Vance et al., 1995). Transciptome,

proteomic and metabolite profiling by GC-MS of L. japonicus supported the biosynthesis of

glutamine and asparagine and identified induction of two genes encoding GS enzymes and

43

two genes encoding asparagine synthetases (Weinkoop and Saalbach, 2003; Colebatch et

al., 2004; Desbrosses et al., 2005).

Whilst ammonia is undoubtedly the primary secretion product of nitrogen fixation, it

is not the only one essential for effective symbiosis. Mutation of the two bi-directional

broad range amino acid transporters in R. leguminosarum lead to a symbiotic phenotype

where plants appeared stunted for growth and nitrogen starved (Lodwig et al., 2003).

However, bacteroid nitrogenase activity was detectable at a level significant enough for

sustaining effective symbiosis but the plant could not apparently acquire the resulting

ammonium. This confirmed the earlier proposal that amino acid cycling between plant and

bacteroid is necessary for nitrogen fixation, similar to the malate / aspartate shuttle in

mitochondria (Meijer and van Dam, 1974; Kahn et al., 1985; Indiveri et al., 1987).

Observations that isolated nitrogen fixing bacteroids excrete alanine and / or aspartate are

compatible with the proposal that the oxidation of malate is coupled with the transamination

of keto-acids for amino acid for secretion (Kretovich et al., 1986; Appels and Haaker, 1991;

Kouchi et al., 1991; Rosendahl et al., 1992; Waters et al., 1998; Allaway et al., 2000). This

would allow the transfer of reducing equivalents necessary for nitrogenase activity but

would not provide net carbon transfer, important as bacteroids are not actively growing cells

so accumulation of carbon would occur rapidly.

44

Figure 1.3.1. Amino acid cycling in bacteroids of R. leguminosarum (Lodwig et al., 2003).

Lodwig et al., 2003 proposed that the bacteroid is required to not only produce

ammonium but also an amino acid such as aspartate for asparagine synthesis within the

plant cytosol. Bacteroids of R. leguminosarum mutated in aap bra retained nitrogenase

activity and the biochemical capacity for amide synthesis. Bacteroid protein corrected

concentrations of glutamine were as wild-type in plant xylem, but the concentration of

asparagine was significantly reduced. Glutamate was proposed as the donor amino acid as it

acts as a precursor for most amino acid metabolism to be channelled through it. Incubation

of pea peribacteroid units with glutamate also led to aspartate and alanine synthesis (Appels

and Haaker, 1991; Rosendahl et al., 1992). Aspartate was proposed as the amino acid

secretion product as any blockage in its secretion would significantly reduce plant

asparagine synthesis, as observed. Also mutation in aatA, encoding the main enzyme

required for aspartate biosynthesis, was also shown by the authors to be essential for

symbiotic nitrogen fixation.

For amino acid cycling to occur, one of the determinants of its functionality is the

ability for amino acids to cross the PBM. Transport studies with symbiosomes isolated from

a number of legumes have in the majority failed to identify amino acid transport across the

PBM (Udvardi et al., 1988b; Herrada et al., 1989; Ouyang and Day, 1992; Trinchant et al.,

1994). Radioactive loading experiments with isolated symbiosomes energised with ATP

failed to detect rapid uptake or exchange of aspartate or alanine (Whitehead et al., 1998).

45

Many amino acid transporters are proton coupled and operate as symporters. Whilst the pH

gradient across the PBM is in the wrong direction for import into the symbiosome it is in

the right direction for export. An H+ / aspartate export system, which moves solutes from

the PBS to the cytosol, has been identified on pea PBMs (Rubeck et al., 1999; Rosendahl et

al., 2001). Although no transport system has yet been identified for amino acid transport

into symbiosomes isolation techniques may damage the PBM, or the membrane may be

incorrectly energised, abolishing transport in vitro (Day et al., 2001).

46

1.4 ATP Binding Cassette (ABC) Transporters.

1.4.1 Structure and function.

ABC transporters are by far the most widespread active transport system and

mutations in ABC transporter genes have been shown to be associated with cystic fibrosis,

Tangier disease, persistent hyperinsulinemic hypoglycemia and Wegener’s granulomatosis

in humans (Higgins and Linton, 2004). Overexpression of ABC transporter genes has also

been associated with the multidrug resistance associated protein and breast cancer resistance

protein, both of which are causes of resistance to anticancer drugs (Gottesman et al., 2002).

Members of this large family of transporters all share the same basic structure of two

nucleotide-binding domains (NBD) and two integral membrane proteins (IMP) (Welsh et al,

1998). ABC transporters are common to almost all species mediating both uptake and efflux

of solutes. In prokaryotes uptake is coupled to ATP hydrolysis and requires a high affinity

solute binding protein (SBP). In humans there are 48 ABC transport systems and 80 in E.

coli (Saier, 2000). However, members of the rhizobia encode a disproportionately high

number of transport systems relative to their genome size, 183 and 164 complete transport

systems in R. leguminosarum and S. meliloti respectively (Konstantinidis and Tiedje, 2004;

Young et al., 2006). The bi-directional nature of bacterial ABC transporters has also been

determined, demonstrating that whilst ATP hydrolysis is essential for solute uptake ATP

formation occurs on efflux (Hosie et al, 2001; Balakrishnan et al., 2004).

The SBPs of bacterial ABC transporters are located either in the periplasm of gram-

negative bacteria, or are tethered via a thiol-lipoyl group to the transport complex of gram-

positive bacteria (van der Heide and Poolman, 2002). Three distinct folding patterns have

been identified for SBPs and so they are classed accordingly as class I, II or III. The general

structure of SBPs revealed by x-ray crystalography is that they consist of two large lobes

linked by a hinge region to form a binding cleft between the two domains (Gilliland and

Quiocho, 1981; Vyas et al., 1983; Sack et al., 1989). The Km for transport of solutes is

greatly increased by the mutation of the SBP indicating they are responsible for the high

affinity of these transport systems. The Kd of the transport complex for the SBP can

therefore dictate the Km for solute transport by this system (Davidson and Chen, 2004).

Maltose binding protein was shown to normally display a weak affinity for its membrane

complex. The affinity, however, increased when the transport complex was inhibited by

vanadate to mimic a conformation normally associated with ATP hydrolysis. This suggests

that the binding of the SBP to the membrane complex stimulates the ATPase activity of the

NBD by stabilizing the transition state for ATP hydrolysis (Chen et al., 2001). The SBP

47

also no longer binds maltose with any great affinity suggesting that it may also cause a

relaxation of the hinge region to allow transport through the IMPs. The SBP ABC

transporters are required for the active uptake of a variety of small molecules, such as amino

acids sugars and metal ions, and can accumulate solutes against large concentration

gradients (Higgins, 1992).

The NBDs of ABC transporters are the most conserved across entire families, but

only one catalytically active subunit is required to support ATP hydrolysis and translocation

(Higgins et al, 1986; Nikaido and Ames, 1999). The NBD is where the ATP hydrolysis

essential for transport occurs (Hobson et al., 1984; Higgins et al., 1985). X-ray

crystallography of the NBDs from different transport systems revealed that each monomer

of the NBD can be divided into two subdomains; a larger RecA like domain and a smaller

helical subdomain (Hung et al., 1998; Diederichs et al., 2000; Verdon et al., 2003; Chen et

al., 2003). Several conserved areas were determined essential for hydrogen bonding with

ATP; the Walker A motif, Walker B motif (also suggested to contain a catalytic base for

ATP hydrolysis) and the LSGGQ motif. However, the exact molecular mechanism in

coordinated binding and hydrolysis was unclear. It was suggested a “nucleotide sandwich”

(a dimer of ATP) binds to form the closed NBD dimer required for ATP hydrolysis (Jones

and George, 1999; Lamers et al., 2000; Obmolova et al., 2000; Locher et al., 2002). In these

dimeric structures the LSGGQ motif of one NBD and the Walker A motif of the other

subunit are both required to contact the nucleotide before they can associate into a

catalytically active conformation (Davidson and Chen, 2004). It was suggested that only

one of the two ATP molecules bound was hydrolysed per transport event but that it allowed

alternation between the sites of catalysis (Senior et al., 1995; Hrycyna et al., 1998).

IMPs of ABC transport systems are comparatively variable compared to the

conserved identity shown between NBDs. Each IMP is predicted to contain 5

transmembrane domains that consist of α-helices. The structure of BtuCD indicates that an

aqueous chamber is formed through the membrane, at the interface between the two IMPs,

with the extracellular side (periplasm) open but the intracellular side (cytoplasm) closed

(Locher et al., 2002). They propose a model whereby the binding and hydrolysis of ATP

acts to energise the re-orientation of the IMPs to switch conformation so that the chamber is

exposed to the cytoplasm but closed to the periplasm. However, the dimeric structures of

MalK from E. coli suggest the IMPs are closer together on the periplasmic face in an ATP

free form and that they are then brought closer together on ATP binding at the cytoplasmic

face (Chen et al., 2003) (Figure 1.4.1.).

48

Figure 1.4.1. Model for domain reorganisation during transport of maltose via MalFGK of E. coli (Davidson, 2002).

The SBP binds to its cognate solute and undergoes a conformational change from an

open to a closed conformation. In its closed conformation the affinity for the membrane

complex is increased (Figure 1.4.1., A). The binding of MBP allows a closed conformation

for dimeric binding of ATP to the NBDs and domain reorganisation of the IMPs to open the

gate at the periplasmic side. In a transition state with the IMP the SBP is tightly bound and

internal binding sites are exposed to each other reducing the affinity of the SBP for the

solute and so transferring it into channel formed by the IMP complex (Figure 1.4.1., B). The

IMP activates the hydrolysis of ATP at the catalytic site of the NBD complex. Hydrolysis of

ATP causes a conformational change in the NBD helical domains and the crucial

TMD:NBD interface brings about energy transfer to the IMP closing the gate at the

periplasmic face releasing the SBP (Figure 1.4.1., C). The substrate is then transported

through the open gate on the cytoplasmic side.

1.4.2 The general amino acid permease (Aap).

The aap operon of rhizobia encodes five proteins that form an ABC transport

complex with a broad range of amino acid specificity. Mutation of this transport system

abolished growth on glutamate (as the sole carbon and nitrogen source) on solid medium

but not in liquid medium. Amino acid uptake by strains mutated in aap was severely

affected but not abolished, indicating there is another broad range amino acid transporter in

49

rhizobia (Walshaw and Poole, 1996; Hosie et al., 2002a). Mutation of this transport system

in R. leguminosarum bv. viciae 3841, R. leguminosarum bv. phaseoli 8002 and R. etli had

no effect on nodulation efficiency or on symbiotic phenotype (Walshaw et al., 1996; Tate et

al., 2004; Kumar and Poole, Unpublished). Amino acid efflux was also demonstrated to

occur via the Aap and so this permease can be considered to function in a bi-directional

manner in vivo (Walshaw and Poole, 1996; Hosie et al., 2001). Although the Vmax for

uptake and efflux are not significantly different the affinity for uptake is 10-3 – 10-4 higher.

This enables a substantial concentration gradient to be established to provide net uptake into

cells.

The aapJ gene encodes a SBP, aapQ and aapM encode IMPs and aapP encodes a

NBD. The aap operon is under the control of a constitutive promoter upstream of aapJ. In

the intergenic region between aapJ and aapQ there is an attenuator sequence that brings

about an approximate 3-fold decrease in expression of aapQM. However, in the intergenic

region between aapM and aapP there is weak promoter activity that increases the

expression of aapP relative to aapQM. This higher expression of aapP is required as this

gene alone encodes the NBD for the Aap transport complex. A dimer of AapP is required in

order to associate correctly with the two IMPs AapQ and AapM that are individually

encoded (Walshaw et al., 1996).

Aap belongs to the polar amino acid transporter (PAAT) family of ABC

transporters. The solute specificity of Aap is unusual in comparison with other members of

this family as it transports a wide range of acidic, basic and aliphatic L-amino acids (Poole

et al., 1985). Most members only transport one or two amino acids, such as the HisJQMP

permease of S. enterica, the GlnHPQ permease of E. coli (Ames and Lever, 1972; Nohno et

al., 1986). The uncharacteristically broad solute specificity of Aap may be due the size of its

integral membrane proteins. On average PAAT members with broader solute specificity

contain binding and inner membrane proteins that are approximately 30% larger than those

found in the PAAT members with narrow solute specificity (Walshaw et al., 1997a). Each

IMP is predicted to contain 8 or 9 transmembrane spanning segments, compared to the

characteristic 5 or 6 reported for IMPs of transporters with narrower solute specificity

(Walshaw et al., 1997a; Hosie and Poole, 2001; Locher et al., 2002; Davidson and Chen,

2004). Sequence comparison between members of the PAAT family has revealed an N-

terminus region of 63 residues that is hypothesised to be important for the increased

specificity. Sequence analysis of these inner membrane proteins revealed a conserved

arginine or lysine residue at position 30 that is changed to a glutamate in arginine

transporters. The charge of residue 53 is also predicted to impact upon specificity, basic

50

amino acid transporters contain a negatively charged amino acid at this point whereas those

with a broader specificity an aliphatic amino acid (Walshaw et al., 1997a). Site-directed

mutagenesis of these residues in the aap demonstrated that a change in charge at residue 30

had no effect on the solute specificity (Hosie and Poole, Unpublished). However, a change

at residue 53 from proline to either glutamate or aspartate did affect the rate of transport, but

this was a general transport effect and the reduced the specificity of all amino acids.

The only other characterised PAAT transporter with such a broad solute range is the

BztABCD of Rhodobacter capsulatus (Zheng and Haselkorn, 1996). Sequence analysis of

the two SBPs identified possible differences in their SBP that other PAAT SBPs lack. A

larger C-terminus of the SBP means that additional residues present in the broad solute

range transporters may be required for increased solute specificity (Walshaw et al., 1997a).

The 33 kDa AapJ shows no homology to previously identified SBPs, highlighting possible

reasons why such broad solute specificity is not seen in other transport systems. However,

AapJ was determined to be required for solute efflux as glutamate secretion in an Aap

mutant could only be restored on addition of plasmid based aapJQMP but not aapQMP

(Walshaw and Poole, 1996).

Regulation of the aap occurs at both a transcriptional and post-transcriptional level.

Amino acid uptake via the Aap is significantly reduced in R. leguminosarum when grown in

medium supplemented with either NH4+ (representing a nitrogen-rich environment) or

glutamate (representing a nitrogen-limited environment) as sole nitrogen source (Walshaw

et al., 1997c). The reduction in uptake via the Aap was attributed to an observed decrease in

the transcription of aap in strains grown in nitrogen rich medium. Mutation in ntrC however

abolished repression of aap transcription and restored uptake to levels observed for growth

in nitrogen-limited medium. This demonstrated NtrC has a negative regulatory effect on

transcription of aap, which is contrary to its usual role as a transcriptional activator.

Post-transcriptional regulation of amino acid uptake by the Aap was also observed

when the intracellular balance between amino acid and keto-acid concentrations was not

properly maintained. Unregulated transport of aspartate via the Dct led to a high

intracellular concentration that was offset by glutamate secretion, as observed when cultures

were grown on glucose aspartate (Reid et al., 1996). Similarly unregulated accumulation of

2-oxoglutarate, caused by mutation in OGDH, lead to cells secreting glutamate (Walshaw et

al., 1997b). In both instances this imbalance in either the intracellular amino acid or keto-

acid concentrations caused a decrease in the amino acid uptake rates, but the transcription of

aap was slightly upregulated. Growth on succinate, which is an intermediatory metabolite

of the TCA cycle, also caused a slight decrease in the rate of uptake. This indicates that the

51

balance between the amino acids and keto-acids is controlled by bi-directional amino acid

transport. An imbalance in the concentrations of either leads to an inhibition of amino acid

uptake, but not transcription, and the secretion of glutamate by cells. This highlights the

crucial role glutamate plays in regard to balancing both the intracellular amino acid and

TCA cycle metabolite levels, which is thought essential in maintaining bacteroid carbon

metabolism and amino acid cycling.

1.4.3 Branched chain amino acid permease (Bra).

A second broad range amino acid transporter of R. leguminosarum has been

identified that shows homology to the hydrophobic amino acid transporter (HAAT) family

of ABC transporters (Hosie et al., 2002a). Member of the HAAT sub-family of ABC

transporters have until now been identified in only three bacterial species; E. coli, S.

typhimurium and P. aeruginosa (Hoshino, 1979; Hoshino and Kose, 1990; Adams et al.,

1990; Matsubara et al., 1992; Hosie et al., 2001). The Bra transports a range of acidic, basic

and polar amino acids (preferentially aliphatic) and inhibition studies indicate possible D-

amino acids could also be transported. In addition not only are α-amino acids transported

but this has also been shown to be the only bacterial ABC transporter that shows uptake for

GABA (Hosie et al, 2002a). Another Bra homologue (BraCDEFG2) has also been

identified but mutational studies indicate it is not expressed or has a different affinity to Bra

(Hosie et al., 2002a).

The bra operon is made up of five genes, braCDEFG, that encode two IMPs

(BraDE), two NBDs (BraFG) and a SBP (BraC). Expression of the bra operon occurs by

co-transcription, as braDEFG has a promoter upstream of braD but braC has its own

promoter in the intragenic region between braG – braC. A second SBP capable of

interaction with the BraDEFG membrane complex has been proposed as transport of alanine

can occur independently of BraC (Hosie et al., 2002a). This is not uncommon for

transporters of the HAAT family, whereas the operon encoded SBP is essential for transport

via the LIV-1 transport system of P. aeruginosa the LIV-1 transport system of E. coli

encodes two SBPs (Adams et al., 1990; Hoshino et al., 1992). LivK is a leucine specific

SBP whereas LivJ binds leucine, isoleucine and valine; along with alanine, theonine and

serine at lower affinity.

This transport permease like Aap has been shown to be bi-directional (Hosie et al.,

2001). Mutation in the structural genes of the bra operon has no effect on the symbiotic

phenotype of R. leguminosarum or R. etli, however double mutation in concert with aap

leads to a complete loss of amino acid transport and symbiotic nitrogen fixation (Lodwig et

52

al., 2003; Tate et al., 2004). As both Aap and Bra have a broad solute specificity then

determining the role of each transport system, as either an uptake or export system, and also

the amino acids involved is unclear.

53

1.5. Research Aims.

Mutualism between the plant and bacteroid was proposed to be more complex with

the observation that amino acid cycling, via the two broad range amino acid transporters

Aap and Bra, are essential for symbiotic nitrogen fixation in pea nodules (Lodwig et al.,

2003). The exact nature of the amino acids involved will have a significant impact upon

nodule carbon and nitrogen metabolism. As glutamate stimulated amino acid secretion from

isolated pea bacteroids, is highly abundant in nodules and most bacteroid amino acid

metabolism is channelled through it, glutamate was proposed to be the donor amino acid in

this cycle (Appels and Haaker, 1991; Rosendahl et al., 1992; Lodwig et al., 2003). As

aspartate and alanine have been demonstrated as being secretion products of nitrogen

fixation, and aspartate aminotransferase activity was also shown to be essential for effective

nitrogen fixation, aspartate was proposed as the amino acid secretion product of bacteroids

that would allow plant asparagine synthesis (Appels and Haaker, 1991; Rosendahl et al.,

1992; Waters et al., 1998; Allaway et al., 2000; Lodwig et al., 2003).

This research aims to further determine the amino acids essential for symbiotic

nitrogen fixation in the R. leguminosarum – pea symbiosis, to identify which is the donor

and which the accessory secretion product essential for nitrogen fixation. Narrowing the

solute specificity of Aap Bra, and also by complementing the Fix reduced phenotype of aap

bra double mutants with transporters from other proteobacteria that have a narrower solute

specificity, will help to identify the amino acids involved in this cycle. This research also

aims to investigate the importance of bacteroid ammonium assimilation through

mutagenesis of the routes for de novo amino acid synthesis. This will determine if a fully

functioning amino acid cycle is required, or does bacteroid ammonium assimilation provide

the essential amino acid secretary product. Finally this work aims to identify any other

amino acid transporters in R. leguminosarum that may be nodule specific and could

facilitate either uptake or export of one of the amino acids essential for driving symbiotic

nitrogen fixation.

54

Chapter 2:- Materials and Methods.

55

2.1 Bacterial Strains, Plasmids and Media.

2.1.1 Culture conditions.

R. leguminosarum strains were grown on either agar or in broth at 26oC. The growth

media was either Tryptone Yeast (TY) or Acid Minimal Salts / Agar (AMS/A), which is

adapted from Rhizobium mineral salts medium (Beringer, 1974; Brown and Dilworth, 1975;

Poole et al., 1994). As a defined medium 1 litre AMS consists of 97 ml 0.5 mM K2HPO4, 2

mM MgSO4.7H2O, 3.4 mM NaCl, 20 mM MOPS buffer; 1 ml Rhizobium solution A (40

mM EDTA-Na2, 0.56 mM ZnSO4.7H2O, 0.83 mM NaMoO4.2H2O, 4 mM H3BO3, 2.3 mM

MnSO4.4H2O, 80 µM CuSO4.5H2O, 4.2 µM CoCl2.6H2O) and 1 ml Rhizobium solution B

(115.3 mM CaCl2, 21.7 mM FeSO4), buffered to pH 7 with 1 M NaOH. 1 ml Rhizobium

solution C (3 mM Thiamine HCl, 4.2 mM D-Pantothenic acid Ca salt, 4.1 mM Biotin) is

added after autoclaving along with antibiotics and carbon and nitrogen sources. Carbon and

nitrogen sources and concentrations are detailed in the text.

E. coli strains were grown on either Luria-Bertani (LB) agar or broth at either 26oC,

30oC or 37oC (Miller, 1972). For E. coli strains containing plasmids expressing potentially

cytotoxic products, under control of the lac promoter, the media were supplemented with

0.6 % (v/v) glucose.

Media were supplemented for antibiotics and stains at the following concentrations

(Table 2.1.1.), unless otherwise stated in the text.

Concentration (µg-1 ml-1) Antibiotic / Fungicide / Stain E. coli R. leguminosarum

Ampicillin 50 - Gentamicin 25 20 Kanamycin 20 40 Spectinomycin 50 100 Streptomycin - 500 Tetracycline 10 2 (AMS / A) 5 (TY) Nyastatin - 50 X-Gal 40 -

Table 2.1.1. List of antibiotics, fungicides and stains used. The concentrations used for each in the growth of both R. leguminosarum and E. coli strains are also listed.

56

2.1.2 Bacterial strains and phage.

The strains and phage used with their descriptions are listed below.

Strain Genotype / Description Source / Reference

Rhizobium leguminosarum.

3841 Rhizobium leguminosarum bv viciae, strr derivative of strain 300.

Johnston and Bellinger, 1975

A34 Rhizobium leguminosarum bv. viciae, formerly 8401 / pRLJI1, strr

Downie et al., 1983

RU443 Strain 3841 containing pRU3028, strr, tetr, kanr Walshaw and Poole, 1996

RU714 Strain 3841 dctABD::Ω, strr, spcr Reid et al., 1996

RU798 Strain RU714 containing pRU3028, strr, spcr, tetr

Reid et al., 1996

RU929 Strain 3841 ntrC::Ω, strr, spcr Walshaw et al., 1997b

RU1099 Strain 3841 aapJQM::Ω, strr, spcr Hosie et al., 2001

RU1180 Strain 3841 mctP::Tn5lacZ, strr, kanr Hosie et al., 2002b

RU1357 Strain RU1356 braE::Tn5phoA, strr, spcr, kanr Hosie et al., 2001

RU1370 Strain 3841 aldA::Tn5lacZ, strr, kanr Allaway et al., 2000

RU1416 Strain 3841 containing pJP2 Lodwig et al., 2004

RU1469 Strain RU1099 mctP::Tn5lacZ, strr, spcr, kanr Hosie and Poole, Unpublished

RU1492 Strain 3841 containing pRU3158, strr, tetr, kanr Hosie and Poole, Unpublished

RU1493 Strain RU1180 containing pRU3028, strr, kanr, tetr

Hosie and Poole, Unpublished

RU1494 Strain RU1180 containing pRU3158, strr, kanr, tetr

Hosie and Poole, Unpublished

RU1621 Strain RU1357 containing pJP2, strr, spcr, kanr, tetr

Hosie and Poole, Unpublished

RU1721 Strain 3841 braEF::Ω, strr, tetr Lodwig et al., 2003

RU1722 Strain RU1721 aapJQM::Ω, strr, spcr, tetr Lodwig et al., 2003

RU1736 Strain RU1722 selected for fast growth on AMA 10mM GABA, strr, spcr, tetr

This work

RU1816 Strain 3841 selected for fast growth on AMA 10mM GABA, strr

This work

57

RU1833 Strain RU1357 containing pRU728, strr, spcr, kanr, tetr

This work

RU1876 Strain 3841 containing pBIO206, strr, tetr, kanr This work

RU1877 Strain RU1180 containing pBIO206, strr, kanr, tetr

This work

RU1891 Strain RU1978 containing pRU1166, strr, tetr This work

RU1978 Strain 3841 ∆aapJ, strr Kinghorn and Poole, Unpublished

RU1979 Strain RU1978 braC::Ω, strr, spcr Kinghorn and Poole, Unpublished

RU2227 Strain RU1736 RL3429::Tn5, strr, spcr, tetr, kanr

This work

RU2228 Strain RU1736 pRL100244::Tn5, strr, spcr, tetr, kanr

This work

RU2229 Strain RU1736 gstC::Tn5, strr, spcr, tetr, kanr This work

RU2230 Strain RU1736 pRL100243::Tn5, strr, spcr, tetr, kanr

This work

RU2231 Strain RU1736 pckA::Tn5, strr, spcr, tetr, kanr This work

RU2232 Strain RU1736 gstD::Tn5, strr, spcr, tetr, kanr This work

RU2267 Strain RU1978 braEF::Ω, strr, tetr This work

RU2281 Strain RU1979 bra3C::Tn GeneJumperTM, strr, spcr, kanr

This work

RU2286 Strain RU714 containing pRU3158, strr, spcr, tetr, kanr

This work

RU2287 Strain RU714 containing pBIO206, strr, spcr, tetr, kanr

This work

RU2290 Strain RU1978 containing pBIO206, strr tetr, kanr

This work

RU2291 Strain RU1979 containing pBIO206, strr, spcr, tetr, kanr

This work

RU2306 Strain RU1357 containing pRU1622, strr, spcr, kanr, tetr

This work

RU2307 Strain 3841 gltB::Ω, strr, spcr This work

RU2308 Strain RU1370 gltB::Ω, strr, kanr, spcr This work

RU2381 Strain RU1979 containing pRU1702, strr, spcr, tetr

This work

RU2382 Strain RU1979 containing pRU1703, strr, spcr, tetr

This work

RU2383 Strain RU1979 containing pRU1689, strr, spcr, tetr

This work

58

RU2384 Strain RU1979 containing pRU1704, strr, spcr, tetr

This work

RU2388 Strain RU2307 containing pRU976, strr, spcr, tetr

This work

RU2389 Strain RU2307 containing pRU986, strr, spcr, tetr

This work

RU2393 Strain RU2307 undetermined::Tn5 selected for growth on AMS 10mM succ 10mM NH4 10mM glu, strr, spcr, kanr

This work

RU2394 Strain RU2307 RL0851::Tn5 selected for growth on AMS 10mM succ 10mM NH4 10mM glu, strr, spcr, kanr

This work

RU2395 Strain RU1978 bra3C::Tn GeneJumperTM, strr, kanr

This work

RU2396 Strain 3841 gstB::Tn GeneJumperTM, strr, kanr This work

RU2397 Strain RU1816 gstB::Tn GeneJumperTM, strr, kanr

This work

RU2398 Strain RU1979 gstB::Tn GeneJumperTM, strr, spcr, kanr

This work

RU2399 Strain RU1736 gstB::Tn GeneJumperTM, strr, spcr, tetr, kanr

This work

RU2400 Strain 3841 RU2229 transductant, strr, kanr This work

RU2401 Strain RU1979 RU2229 transductant, strr, spcr, kanr

This work

RU2402 Strain RU1736 RU2227 transductant, strr, spcr, tetr, kanr

This work

RU2403 Strain RU1736 RU2228 transductant, strr, spcr, tetr, kanr

This work

RU2404 Strain RU1736 RU2229 transductant, strr, spcr, tetr,kanr

This work

RU2405 Strain RU1736 RU2230 transductant, strr, spcr, tetr, kanr

This work

RU2406 Strain RU1736 RU2231 transductant, strr, spcr, tetr, kanr

This work

RU2407 Strain RU1736 RU2232 transductant, strr, spcr, tetr, kanr

This work

RU2408 Strain 3841 RU2227 transductant, strr, kanr This work

RU2409 Strain 3841 RU2231 transductant, strr, kanr This work

RU2417 Strain RU2307 RU2393 transductant, strr, spcr, kanr

This work

59

RU2418 Strain RU2307 RU2394 transductant, strr, spcr, kanr

This work

RU2444 Strain RU1736 containing pRU1768, strr, spcr, tetr, genr

This work

RU2445 Strain RU1736 containing pRU1769, strr, spcr, tetr, genr

This work

RU2446 Strain RU1736 containing pRU1770, strr, spcr, tetr, genr

This work

RU2447 Strain RU1736 containing pRU1771, strr, spcr, tetr, genr

This work

RU2448 Strain RU1736 containing pRU1709, strr, spcr, tetr, genr

This work

RU2449 Strain RU1736 containing pRU1710, strr, spcr, tetr, genr

This work

RU2450 Strain RU1736 containing pRU1711, strr, spcr, tetr, genr

This work

RU2451 Strain RU1736 containing pRU1712, strr, spcr, tetr, genr

This work

RU2480 Strain 3841 aldA::Ω, strr, tetr This work

RU2481 Strain RU1979 aldA::Ω, strr, tetr This work

RU2482 Strain RU2398 aldA::Ω, strr, tetr This work

RU2484 Strain RU2307 containing pJP2, strr, spcr, tetr This work

RU2485 Strain RU2307 containing pRU1134, strr, spcr, tetr

This work

RU2487 Strain RU1979 RU1275 transductant, strr, spcr, kanr

This work

RU2488 Strain RU2481 RU1275 transductant, strr, spcr, tetr, kanr

This work

RU2491 Strain 3841 containing pRU1810, strr, tetr This work

RU2492 Strain RU2307 containing pRU1811, strr, spcr, tetr

This work

RU2493 Strain RU2307 containing pRU1812, strr, spcr, tetr

This work

RU2494 Strain RU2307 containing pRU1813, strr, spcr, tetr

This work

RU2498 Strain RU1736 containing pRU1815, strr, spcr, tetr, genr

This work

RU2499 Strain RU1736 containing pRU1816, strr, spcr, tetr, genr

This work

60

RU2500 Strain RU1736 containing pRU1817, strr, spcr, tetr, genr

This work

RU2501 Strain RU1816 containing pRU1815, strr, spcr, tetr, genr

This work

RU2502 Strain RU1816 containing pRU1816, strr, spcr, tetr, genr

This work

RU2503 Strain RU1816 containing pRU1817, strr, spcr, tetr, genr

This work

RU2504 Strain RU2398 gstB::, strr, spcr This work

RU2505 Strain 3841 containing pRU1829, strr, tetr, kanr This work

RU2506 Strain RU714 containing pRU1829, strr, spcr, tetr, kanr

This work

RU2507 Strain RU1180 containing pRU1829, strr, tetr, kanr

This work

RU2508 Strain RU2307 containing pRU3028, strr, spcr, tetr, kanr

This work

RU2509 Strain RU2307 containing pRU1829, strr, spcr, tetr, kanr

This work

RU2510 Strain RU2307 containing pRU3158, strr, spcr, tetr, kanr

This work

RU2511 Strain RU2307 containing pBIO206, strr, spcr, tetr, kanr

This work

Escherichia coli

C600 supE44 Sambrook et al., 2001 DH5α supE44, recA1, endA1, nalr Sambrook et al., 2001 DH5α Τ1 supE44, recA1, endA1, nalr Invirtogen MC1061 E.coli non-suppressor strain for phage

mutagenesis, strr Sambrook et al., 2001

SCS110 supE44, endA1, dam, dcm, strr Stratagene

TOP10 recA1, endA1, strr Ivitrogen Phage

λTnphoA λ carrying transposable TnphoA translational fusion (Tn5 derivative), kanr

Manoli and Beckwith, 1985

RL38 Generalised transducing phage of R.leguminosarum

Buchanan-Wollaston, 1979

Strains were routinely stored at -20°C and -80°C in 15 % (v/v) glycerol after snap

freezing in liquid nitrogen. Phage stored at 4oC in either nH2O or SM buffer with a few

drops of chloroform.

61

2.1.3 Plasmids.

The plasmids used with their descriptions are listed below.

Plasmid Description Source / Reference

pBIO206 pIJ1427 braE::TnphoA, tetr, kanr Hosie et al., 2002a

pBluescriptII SK-

pUC19 derivative, f1 origin of replication, ColE1 replicon, ampr

Stratagene

pCRBluntII- TOPO

Blunt-ended PCR product cloning vector, f1 origin of replication, ColE1 replicon, kanr, ampr, lacZ

Invitrogen

pCR2.1-TOPO TA PCR product cloning vector, f1 origin of replication, ColE1 replicon, ampr, kanr, lacZ

Invitrogen

pCR4-TOPO TA PCR product cloning vector, f1 origin of replication, ColE1 replicon, ampr, kanr, lacZ

Invitrogen

pHP45Ω pBR322 derivative carrying Ω antibiotic interposons, pHP45 replicon, ampr, spcr

Prentki and Krisch, 1984; Fellay et al., 1987

pIJ1891 pLAFR3 containing pUC118 polylinker, tetr Finnie et al., 1997

pJP2 Stable broad host range cloning vector, pTR102 GUS with artificial MCS, ampr, tetr

Prell et al., 2002

pJQ200SK- pACYC derivative, P15A origin of replication, genr, lacZ sacB traJ

Quandt and Hynes, 1993

pLAFR1 Broad host range mobilizable P-group cloning vector, tetr

Freidman et al., 1982

pRK415-1 Broad host range P-group cloning vector, tetr Keen et al, 1988

pRK2013 ColE1 replicon RK2 tra genes, helper plasmid used for mobilizing P- and Q- group plasmids, kanr

Figurski and Helenski, 1979

pRU728 pIJ1891 containing braCDEFG from P.aeruginosa,tetr

Hosie and Poole, Unpublished

pRU976 pJP2 containing gltP from E.coli, ampr, tetr Hosie et al., 2002b

pRU986 pJP2 containing gltS from E.coli, ampr, tetr Hosie et al., 2002b

pRU1097/D- TOPO

Promoter probe vector, pBJA27 promoterless gfpmut3.1 cloned into pOT2, genr

Karunakaran et al., 2005

pRU1134 pJP2 containing aapJQMP from strain 3841, ampr, tetr

Hosie and Poole, Unpublished

pRU1166 pJP2 containing aapJ from strain 3841, ampr, tetr

Hosie and Poole, Unpublished

62

pRU1536 pJQ200SK- containing braC3::Tn GeneJumperTm, genr, kanr

Kinghorn and Poole, Unpublished

pRU1580 p416 and p417 PCR product of gltBD from strain 3841 cloned into pCR4-TOPO, ampr, kanr

This work

pRU1604 p631 and p633 PCR product of gstABCD from strain 3841 cloned into pCRBluntII-TOPO, ampr, kanr

This work

pRU1606 p631 and p633 PCR product of gstABCD from strain RU1736 cloned into pCRBluntII- TOPO, ampr, kanr

This work

pRU1607 pRU1580 with a 2.8kb fragment excised via BamHI and replaced with a 2.2kb BamHI fragment from pHP45Ω containing the omega spc interposon, ampr, kanr, spcr

This work

pRU1608 SpeI NotI fragment excised from pRU1607 and ligated into pJQ200SK-, genr, spcr

This work

pRU1610 p500 and p634 overlap PCR product of the aapJ promoter region from strain 3841 and braC from P.aeruginosa cloned into pCRBluntII-TOPO, ampr, kanr

This work

pRU1612 SacI XbaI fragment excised from pRU1610 and ligated into pJP2, ampr, tetr

This work

pRU1622 pRU1612 with a 350bp fragment excised via AgeI XbaI and replaced with an AgeI XbaI fragment from pRU728 containing braDEFG from P.aeruginosa, ampr, tetr

This work

pRU1689 HindIII XbaI fragment excised from pRU1606 and ligated into pRK415-1, tetr

This work

pRU1702 HindIII XbaI fragment excised from pRU1604 and ligated into pRK415-1, tetr

This work

pRU1703 KpnI XbaI fragment excised from pRU1604 and ligated into pRK415-1, tetr

This work

pRU1704 KpnI XbaI fragment excised from pRU1606 and ligated into pRK415-1, tetr

This work

pRU1706 pRU1689 gstB::Tn GeneJumperTM, tetr, kanr This work

pRU1708 SphI SpeI fragment excised from pRU1706 and cloned into pJQ200SK-, genr, kanr

This work

pRU1709 Gst9 and Gst10 PCR product of pRL100244 – pRL100245 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

63

pRU1710 Gst11 and Gst12 PCR product of pRL100245 – pRL100246 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1711 Gst13 and Gst14 PCR product of pRL100246 – pRL100247 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1712 Gst15 and Gst16 PCR product of pRL100247 – gstA intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1728 p733 and p734 PCR product of aldA from strain 3841 cloned into pCR4-TOPO, ampr, kanr

This work

pRU1735 pRU1728 with a 450bp fragment excised via EcoRV and replaced with a 2.2kb SmaI fragment from pHP45Ω containing the omega tet interposon, ampr, kanr, tetr

This work

pRU1768 Gst1 and Gst2 PCR product of pRL100240 – gstR intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1769 Gst3 and Gst4 PCR product of gstR – pRL100242 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1770 Gst5 and Gst6 PCR product of pRL100242 – pRL100243 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1771 Gst7 and Gst8 PCR product of pRL100243 – pRL100244 intergenic region from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1777 XbaI fragment excised from pRU1735 and ligated into pJQ200SK-, genr, tetr

This work

pRU1803 p831 and p832 PCR product of gltBD from strain 3841 cloned into pCR2.1-TOPO, ampr, kanr

This work

pRU1804 p833 and p834 PCR product of gltBD from strain 3841 cloned into pCR2.1-TOPO, ampr, kanr

This work

pRU1805 p835 and p836 PCR product of gstR from strain 3841 cloned into pCR2.1-TOPO, ampr, kanr

This work

pRU1807 pRU1805 with a 200bp fragment excised via HincII to create ∆gstR, ampr, kanr

This work

pRU1810 KpnI XbaI fragment excised from pRU1803 and ligated into pJP2, ampr, tetr

This work

64

pRU1811 NsiI XbaI fragment excised from pRU1804 and ligated into pRU1810, ampr, tetr

This work

pRU1812 KpnI fragment excised from pRU1811 and ligated into pJP2, ampr, tetr

This work

pRU1813 pRU1811 with a 2.8kb fragment excised via BamHI to create ∆gltB, ampr, tetr

This work

pRU1814 pRU1708 with a 3.8kb fragment excised via MfeI, genr

This work

pRU1815 p857 and p858 PCR product of gstR from strain 3841 cloned into pRU1097/D-TOPO, genr

This work

pRU1816 p857 and p858 PCR product of gstR from strain RU1736 cloned into pRU1097/D-TOPO, genr

This work

pRU1817 p857 and p858 PCR product of ∆gstR from pRU1807 cloned into pRU1097/D-TOPO, genr

This work

pRU1829 pRU1134 aapJ::TnphoA, ampr, tetr This work

pRU3024 pLAFR1 cosmid containing aapJQMP from strain 3841, tetr

Walshaw and Poole, 1996

pRU3028 pRU3024 aapJ::TnlacZ, tetr Walshaw and Poole, 1996

pRU3158 pIJ1427 braC::TnlacZ, tetr, kanr Hosie et al., 2002a

pSUP202- 1::Tn5

Contains mob site, used for transposon mutagenesis, ampr kanr

Simon et al., 1983

pSUP202- 1::TnB50 / 61

Contains mob site, used for transposon mutagenesis, ampr, genr/tetr

Simon et al., 1989

65

2.2 Molecular Techniques.

2.2.1 DNA isolation.

Chromosomal DNA was isolated using either the Bioline DNAce spin culture kit for

isolation of DNA from sera, or the Qiagen Dneasy tissue kit for isolation of total DNA from

animal tissue. Isolation and purification of plasmid DNA was carried out using Promega’s

Wizard Plus SV Minipreps Purification System.

DNA was purified and concentrated by phenol extraction and ethanol precipitation

as described by Sambrook et al., 2001. 100 µl phenol:choloform:isoamyl alcohol was added

to the DNA sample and vortexed before centrifugation at 13,000 rpm for 5 min. The

aqueous layer was recovered and 10 % (v/v) of 3 M sodium acetate, then 250 % (v/v) ice

cold ethanol was added. The sample was incubated at -20oC for at least one hour and

centrifuged at 13,000 rpm for 20 min to pellet the DNA. The supernatant was removed, the

pellet washed in 500 µl 70 % (v/v) ethanol and left to air dry. The pellet was resuspended in

the required volume of nH2O.

DNA sequencing was performed by MWG Biotech, as per their website

(http://www.mwg-biotech.com). DNA was supplied as a 1 µg pellet and sequencing primers

at 0.5 pmol-1 µl-1. DNA sequences were analysed using Vector NTI 7.1 and BLAST

programs at either the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST), or the

RhizoBD website (http://rhizo.bham.ac.uk/blast/index.cgi?help=blast&frame=) (Altschul et

al., 1997).

2.2.2 Agarose gel electrophoresis.

DNA was separated according to size requirements on 0.8 – 1.6 % (w/v) agarose

gel, in Tris Acetate (400 mM) EDTA (1 mM) buffer. Samples were loaded in 1:5 ratio with

6 x loading buffer (30 % (v/v) glycerol, 0.25 % (w/v) bromophenol blue). Fragment size

was determined relative to 1 kb or 1 kb plus DNA ladder (Invitrogen). Gels were stained in

ethidium bromide solution (0.75 µg-1 ml-1) and visualised under a UV transluminator. DNA

was excised and purified using Quiagen’s gel extraction kit.

2.2.3 Cloning and transformation.

DNA was digested following the manufacturers protocols for restriction

endonucleases, supplied by Invitrogen or New England Biolabs. Enzymes were heat

inactivated and then removed by ethanol precipitation. DNA was ligated using Invitrogen’s

T4 DNA ligase, following the guidelines supplied. Reactions were incubated either at 16oC

66

overnight or at 26oC for one hour. To prevent self-ligation digested plasmid DNA was

dephosporylated with Bacterial Alkaline Phosphatase (BAP) (Invitrogen) using the

manufacturers simplified protocol.

Transformation of chemically competent E. coli was performed as per

manufacturers instructions and as described by Sambrook et al., 2001.

2.2.4 Polymerase chain reaction (PCR).

Amplification from plasmid and chromosomal DNA was carried out using the DNA

polymerases BIO-X-ACT (Bioline), Pfu Turbo (Stratagene) and NEB Taq (New England

Biolabs). Buffers and additives were those specifically supplied for each polymerase and

used at the recommended concentrations. Each 50 µl reaction contained 0.5 U DNA

polymerase, 1 ng-1 µl-1 DNA template, 0.2 mM dNTPs and 1 pmol-1 µl-1 of both the sense

and antisense primer. Primers were obtained from MWG-Biotech and designed using

Vector NTI 7.1 and the guidelines described by Sambrook et al.,2001 (Table 2.1.2.).

Name Primer Binding Site Sequence (5' - 3')

GeneJumperTM A Sequencing primer A for GeneJumperTM transposon. ATCAGCGGCCGCGATCC

GeneJumperTM B Sequencing primer B for GeneJumperTM transposon. TTATTCGGTCGAAAAGGATCC

Gst1

Sense primer for amplification of pRL100240 – gstR intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCACTGGCTCGTCAACTGCA CGGGAAT

Gst2 Antisense primer for amplification of pRL100240 – gstR intergenic region (HindIII site shown in bold).

AAGCTTGGAAGAGGTGTTCGTC AGCACAGCC

Gst3

Sense primer for amplification of gstR – pRL100242 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCTCCGCCAAGAAGCCTGCC GAC

Gst4 Antisense primer for amplification of gstR – pRL100242 intergenic region (HindIII site shown in bold).

AAGCTTATCCCTCGACAGCATC GCCG

Gst5

Sense primer for amplification of pRL100242 – pRL100243 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCGAGATCGTCGTGGCTCTT GGTGC

67

Gst6 Antisense primer for amplification of pRL100242 – pRL100243 intergenic region (HindIII site shown in bold).

AAGCTTGGGTCACGCCTGTAGA CGCCG

Gst7

Sense primer for amplification of pRL100243 – pRL100244 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCGTCCGATGATCCGAACTC GAC

Gst8 Antisense primer for amplification of pRL100243 – pRL100244 intergenic region (HindIII site shown in bold).

AAGCTTCAGCCTCGATGACCTC TTCCATG

Gst9

Sense primer for amplification of pRL100244 – pRL100245 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCATGATGGCAGCCCGACCG AGG

Gst10 Antisense primer for amplification of pRL100244 – pRL100245 intergenic region (HindIII site shown in bold).

AAGCTTCGATGCCGATGTCGAG TCGTCC

Gst11

Sense primer for amplification of pRL100245 – pRL100246 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCGTCGCCAACGGCTGCAAC GT

Gst12 Antisense primer for amplification of pRL100245 – pRL100246 intergenic region (HindIII site shown in bold).

AAGCTTGTCCGATCTTCACCGC AGACAGG

Gst13

Sense primer for amplification of pRL100246 – pRL100247 intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCGACGATTCTCGATTGCGA CGATGT

Gst14 Antisense primer for amplification of pRL100246 – pRL100247 intergenic region (HindIII site shown in bold).

AAGCTTGCCCAGATGTGGACGA TCTCGTTGA

Gst15

Sense primer for amplification of pRL100247 – gstA intergenic region (Region required for TOPO-directional cloning shown in bold).

CACCGCCTTTGCGAGCCTGGAC GAC

Gst16 Antisense primer for amplification of pRL100247 – gstA intergenic region (HindIII site shown in bold).

AAGCTTGCGGATCGAGCTTGGA TTTATCGA

IS50R Sequencing primer for Tn5 AGGTCACATGGAAGTCAGATC

68

Mu End Screening primer for Tn GeneJumperTM direct gene replacement.

GTTTTTCGTGCGCCGCTTCA

p416 Sense primer for amplification of gltBD (SpeI site shown in bold).

TTACTAGTCTTGCCAGCGACAG CGAGTT

p417 Antisense primer for amplification of gltBD (SpeI site shown in bold).

TTACTAGTCGGTCGATTTCCAG AAACCC

p500 Sense primer for amplification of the aapJ promoter region for overlap PCR

CACCCGCGCGTCCCGTAAGTGT AT

p543

Antisense primer for amplification of the aapJ promoter region for overlap PCR (Region homologous to P. aeruginosa braC shown in bold)

CGCTGAGTACCCTTCTTCATTTT CCCAACCTTTTCCGTTG

p544

Sense primer for amplification of the P. aeruginosa braC for overlap PCR (Region homologous the aapJ promoter region from strain 3841 shown in bold)

CAACGGAAAAGGTTGGGAAA ATGAAGAAGGGTACTCAGCG

p631 Sense primer for amplification of gstABCD.

ACAGCGAGGGATCATTGAGCTT C

p633 Antisense primer for amplification of gstABCD.

GCTCGACTATACCCGTACCAAG ACG

p634 Sense primer for amplification of the P. aeruginosa braC for overlap PCR.

TGTAGCGTTCGGCGATGAACTT GCC

p635 Screening primer for braC3::Tn GeneJumperTM direct gene replacement.

GCACTCGCCACGCTCGACACCT ACA

p636 Screening primer for braC3::Tn GeneJumperTM direct gene replacement.

CCAGGCTGTCGAGAACCACCAG ATCG

p653 Screening primer for direct gene replacement of gltB::Ωspc. CCTGTTCGACCGTCTTGATGG

p654 Screening primer for direct gene replacement of gltB::Ωspc. CTCCGTCGCCTGGGTGATGGT

p733 Sense primer for amplification of aldA (XbaI site shown in bold).

TCTAGACGTCACGAAGATTGGC GGATAGGC

p734 Antisense primer for amplification of aldA (XbaI site shown in bold).

TCTAGACAATCCCTCAACGAAG AGCCGACT

p831 Sense primer for amplification of gltB fragment (KpnI site shown in bold).

GGTACCCGATTCCGTCAGCAGA CGTTCG

p832 Antisense primer for amplification of gltB fragment (XbaI site shown in bold).

TCTAGAGGATTCTTCGCCGCCC TCGCC

p833 Sense primer for amplification of gltD fragment. CATCATCGTGCTCTCCGACCG

69

p834 Antisense primer for amplification of gltD fragment (XbaI site shown in bold).

TCTAGAGCGAAATGACGCCAG CACCTCC

p835 Sense primer for amplification of gstR (HindIII site shown in bold).

AAGCTTCGGGATCAGTCATTCA CCGCTT

p836 Antisense primer for amplification of gstR. CCCAGGGATTCTTCACGACCGC

p837 Screening primer for direct gene replacement of aldA::Ωtet. GCGAGGACCACCTGAACGGC

p838 Screening primer for direct gene replacement of aldA::Ωtet.

GGCGGCTGAAGTGAAACGCACT C

p857 Sense primer for amplification and of gstR (Region required for TOPO-directional cloning shown in bold)

CACCGGGATCAGTCATTCACCG CTT

p858 Antisense primer for amplification and of gstR (HindIII site shown in bold).

AAAAAGCTTCCCAGGGATTCTT CACGACCGC

pOT Forward Screening primer for direct gene replacement with Ω interposons. CGGTTTACAAGCATAAAGC

Table 2.1.2. Primers used for PCR.

Reactions were cycled in a Px2 thermal cycler (Thermo Hybaid) at 95oC for 5 min,

followed by 30 cycles of 95oC for 90 seconds, 55 – 62oC for 90 seconds, 72oC for sixty

seconds plus an additional 60 seconds per kb of DNA product. The program was concluded

with a 10 minute extension period at 72oC. For colony PCR no DNA template was added to

the PCR mix. The 50 µl reaction was aliquoted into 10 µl reactions; to each a sterile

toothpick was used to transfer a pinprick sized amount of colony. The initial 95oC step of

the reaction was extended to 10 min to allow the cells to lyse and the DNA to denature.

Overlap PCR was an adapted form of that described by Horton et al., 1989 and

Hosie et al., 2002b. PCR products from the two independent initial amplifications were

purified and used as the DNA template for the final reaction at 1 ng µl-1.

PCR products were purified directly using Qiagen’s nucleotide removal kit, or

following agarose gel electrophoresis using Qiagen’s gel extraction kit. PCR products were

cloned directly into pCR2.1®-TOPO, pCR BluntII®-TOPO and pCR4®-TOPO (Invitrogen)

according to the manufacturers protocol.

2.2.5 RNA isolation and quantification.

Rhizobium strains were grown in 60 ml 10 mM glucose 10 mM NH4+ AMS to mid-

log stage. Cells were mixed with 200 % (v/v) RNA later (Ambion) and harvested by

centrifugation at 10,000 rpm and 4oC for 10 min. Cells were resuspended in 500 µl 10 mM

70

Tris HCl pH 8.0 and mechanically lysed in a Ribolyser (Hybaid) at speed setting 6.5 for 30

seconds. Lysed cells were incubated on ice for 3 min and supernatant recovered by

centrifugation at 13,000 rpm and 4oC for 3 min. RNA was then isolated using Qiagen’s

RNeasy mini kit columns and an adapted form of the protocol.

RNA was quantified using BioRad’s Experion automated electrophoresis system,

following the protocol for RNA.

2.2.6 qRT-PCR.

Quantitative real-time RT-PCR was performed with QuantiTect SYBR Green RT-

PCR Kit (Qiagen). SYBR Green 1 binds only to dsDNA with excitation at OD494 nm and

emission at OD521 nm. Fluorescence increases with PCR product formation and this was

detected by GeneAmp 5700 sequence detection system. The relative quantification

technique, or Comparative CT method (∆∆CT), was used with the endogenous reference

gene as mdh (Bustin, 2002). Experiments were carried out according to the protocol with

each 25 µl reaction containing ≥ 20 ng-1 µl-1 RNA and 0.5 pmol-1 µl-1 of both the sense and

antisense primer. The primers used for amplification are listed (Table 2.1.3.). Reactions for

the target and reference genes were performed in triplicate. No template controls and no

RT-polymerase controls were performed in duplicate for both the target and reference genes

to check for genomic DNA contamination and primer dimer formation.

Name Primer Binding Site Sequence 5' - 3'

p789 Sense primer for amplification of mdh.

GTTCTCTTCGACATCGCGGACG GC

p790 Antiense primer for amplification of mdh.

GACCTTGAGGTTGATGCCGAGA AG

p821 Sense primer for amplification of gstA. CCGACAACATGGTCTTTTCG

p822 Antiense primer for amplification of gstA. ACGTCCCAGGTGACCTGACC

p823 Sense primer for amplification of gstB. GCAAGGCAACAGGGTTTGGG

p824 Antiense primer for amplification of gstB. TTGAGATAGGTCGCGGATCC

p825 Sense primer for amplification of gabD4.

AGGCGAGCCGCTGGGGGTGGTG C

p826 Antiense primer for amplification of gabD4. TTCGATCATCAGCCGGTGCC

p829 Sense primer for amplification of pRL100242. GAAATTCACGCAGGCGCTCC

71

p830 Antiense primer for amplification of pRL100242. CGTGTGGATAAGCGCGGACC

p851 Sense primer for amplification of gstR. ATGAGCGGTGCTCTGAAG

p852 Antiense primer for amplification of gstR. CAAATGCCTCAGAACCTC

Table 2.1.3. Primers used for qRT-PCR.

Reactions were cycled in a PCR system 9700 thermal cycler (GeneAmp) at 50oC for

30 min, 95oC for 15 min, followed by 30 cycles of 95oC for 45 seconds, 57oC for 45

seconds and 72oC for 60 seconds. RT-PCR products were visualised on a 1.6 % (w/v)

agarose gel to confirm the negative controls and also clean product formation.

2.2.7 Conjugation.

Conjugation of plasmid and cosmid DNA from E. coli to Rhizobium was performed

either by bi-parental or tri-parental conjugation as described by Simon et al., 1983 and

Figurski and Helinski, 1979 respectively. For tri-parental mating pRK2013 provides trans-

acting factors required to facilitate the mobilization and conjugal transfer of unrelated

plasmids. This allows the use of otherwise non-transmissible broad host range vectors as

powerful cloning vehicles. Conjugation was carried out as described by Poole et al., 1994.

Cultures of the donor and helper plasmids were grown overnight in LB broth with

antibiotics, at 225 rpm and 37oC. 200 µl of bacterial cells were sub-cultured into 10 ml of

fresh LB broth and incubated at 100 rpm and 37oC for 4 hours to promote formation of sex

pili. 1 ml of cells were harvested by centrifugation at 6000 rpm for 5 min and washed three

times in TY broth, to remove traces of antibiotics. The Rhizobium accepting strain was

washed from a fresh TY agar slope in 3 ml of TY broth. 400 µl of the donor plasmid, 400 µl

of the Rhizobium accepting strain and 200 µl of the helper plasmid were mixed, spun down

and resuspended in TY broth to a final volume of 30 µl. This mating suspension was then

spotted onto a sterile nitrocellulose membrane and placed on TY agar medium overnight at

26oC. Bacteria were recovered either using a sterile wire loop or resuspension in TY broth.

2.2.8 Sac mutagenesis and direct gene replacement.

pJQ200SK- contains the p15A origin of replication that is incompatible in

Rhizobium. Conjugation and selection for the plasmid resistance marker forces the

recombination of the vector into the genome at the homologous sites of the plasmid based

gene deletion. Following conjugation Rhizobium colonies were recovered on selective

72

media for the resistance marker of the mutated gene and also genr. A dozen recovered

colonies were harvested, pooled and grown on a TY agar slope with appropriate antibiotics

for 2 days at 26oC before being washed off in 3 ml TY broth and stocked. pJQ200SK- also

carries the sacB gene from B. subtilis enabling a double recombination event to be forced

through sucrose selection against the vector. The stock of single recombinants was diluted

to 10-1, 10-2, 10-3, 10-4, 10-5 and plated onto TY or 20 % (v/v) sucrose 10 mM NH4+ AMA

containing antibiotics for the resistance marker interposon. Recovered colonies were then

replica patched back onto 20% (v/v) sucrose selective media to screen for retention of

resistance marker interposon and gens. Colony PCR was used to screen putative mutants,

using a primer specific to the resistance marker and primers set back on the genome from

the original amplification sites.

2.2.9 Transposon mutagenesis of Rhizobium.

Tn5 mutagenesis of Rhizobium strains was carried out as an adapted form of that

described by Simon et al, 1983. Bi-parental conjugation of the transposon into Rhizobium

strains was carried out using the suicide vector pSUP202-1. Mutant strains were recovered

from the nitrocellulose membrane following conjugation and resuspended in 1 ml TY broth.

The conjugation mix was plated out onto Genetix Q-trays, containing 10 mM glucose 10

mM NH4+ AMA with appropriate antibiotics, at a serial dilution to give between 1000 –

1500 cfu. Colonies were picked by a Genetix Robot into Genetix 96 well plates containing

200 µl TY broth and grown for 48 hours at 225 rpm and 26oC. The Tn5 mutant library was

then replica patched onto 10 mM glucose 10 mM NH4+ AMA and AMA with the

appropriate carbon and nitrogen sources (as detailed in the text) to select for auxotrophy.

For isolation of transposon mutations that promote growth the conjugation mix was

plated directly onto AMA, with the appropriate antibiotics and carbon and nitrogen sources

(as described in the text), to give 1000 cfu.

The sequence at both ends of the Tn5 transposon is duplicated and so the transposon

and its flanking genomic DNA must be subcloned into pBluescript®IISK- for sequencing.

Chromosomal DNA was isolated, as described previously, and the DNA randomly digested

using the restriction enzyme SalI, as this cuts in the transposon so only one half of the

transposon and its flanking DNA will be subcloned. The digestion mix was ethanol

precipitated and ligated into the similarly digested vector. 5 µl of the ligation mix was used

to transform DH5α cells and incubated overnight at 30oC on LB agar plates, containing 0.6

% (v/v) glucose and the appropriate antibiotics. Recovered colonies were purified on LB

agar plates, single colonies pooled and plasmid DNA recovered. Plasmid DNA was

73

screened via restriction enzyme digestion with SalI to confirm a fragment of greater than

2.5 kb, indicating successful cloning of the transposon and a portion of flanking genomic

DNA. Plasmid DNA was ethanol precipitated to 1 µg for sequencing using the primer

IS50R.

2.2.10 Transposon mutagenesis of plasmid DNA.

Phage containing the TnphoA display a lytic lifecycle in E. coli C600 and were

propagated overnight in this strain to obtain a titre of between 1010 – 1012 pfu. E. coli was

grown overnight at 225 rpm and 37oC in 10 ml 10 mM MgSO4 LB broth with appropriate

antibiotics. 100 µl of this was sub-cultured in 10 ml 10 mM MgSO4 LB broth and grown for

4 hours to obtain cells at their mid-log stage. Phage was diluted to 10-4, 10-5, 10-6, 10-7 in

SM buffer (0.1 M NaCl, 8 mM MgSO4.7H2O, 0.001 % (w/v) gelatin, 50 mM Tris HCl

pH7.5). 900 µl of bacterial cells was mixed with 100 µl of each phage dilution and added to

4 ml of 0.75 % (w/v) 10 mM MgSO4 LB agar. This was overlayed onto a (1.5 % w/v) 10

mM MgSO4 LB agar plate and incubated overnight at 37oC. Minus phage and minus

bacteria controls were also similarly prepared and incubated. Near confluent plates were

flooded with 10 ml of SM buffer and rocked for 1 hour before the supernatant was collected

and filter sterilised by passing through a sterile Millipore 0.22 µm membrane.

Plasmid pRU1134 was used to transform E. coli MC1061, which the phage cannot

propagate in due to the mutation in supF. Plasmid DNA was mutagenised as an adapted

from of that described by Simon et al., 1989. Cultures of MC1061 containing pRU1134

were grown overnight at 225 rpm and 37oC in 10 mM MgSO4 LB broth with appropriate

antibiotics. 100 µl of this was sub-cultured in 10 ml 10 mM MgSO4 LB broth and grown for

4 hours to obtain cells at mid-log stage. Phage was diluted to 10-2, 10-4, 10-6 in 10 mM

MgSO4 LB broth. 900 µl of bacterial cells was mixed with 100 µl of each phage dilution

and incubated at 125 rpm and 37oC for 2 hours. Cells were harvested at 13.000 rpm for 2

min and washed three times in 10 mM MgSO4 LB broth before being resuspended to a final

volume of 1 ml. This suspension was then added to 9 ml of 50 µg-1 ml-1 kanamycin 10 µg-1

ml-1 tetracycline LB broth and grown overnight at 125 rpm and 37oC. Cells were harvested

and plasmid DNA isolated. Recovered plasmid DNA was used to transform E. coli DH5α

and recovered colonies screened by colony PCR for insertion of the transposon into the

desired gene. Plasmid DNA indicating successful mutation was ethanol precipitated to 1 µg

and sent for sequencing using primer IS50R to ensure the TnphoA was inframe.

GeneJumperTM mutagenesis of plasmid DNA was carried out according to the

manufacturers protocol.

74

2.2.11 General transduction.

The bacteriophage RL38 was used in an adapted form of that described by Beringer

et al., 1978 and Buchanan-Wollaston, 1979. Phage were propagated in the donor Rhizobium

strain to a titre of between 1010 – 1012 pfu. The donor strain was grown for 3 days on a TY

agar slope at 26oC before being washed off in 3 ml TY broth. Phage was diluted to 10-3, 10-

4, 10-5, 10-6 in TY broth. 100 µl of bacterial cells was mixed with 100 µl of each phage

dilution and added to 3 ml of a mixture of 50 % (v/v) TY agar and 50 % (v/v) TY broth.

This was then overlayed onto a TY agar plate and incubated for 2 days at 26oC. Minus

phage and minus bacteria controls were also similarly prepared and incubated. Near

confluent plates were flooded with 10 ml nH2O and rocked for 1 hour before the

supernatant was collected and filter sterilised by passing through a sterile Millipore 0.22 µm

membrane.

The Rhizobium recipient strain was washed off a fresh TY agar slope in 3 ml TY

broth. Phage was diluted to 100, 10-1, 10-2, in TY broth. 200 µl of bacterial cells was mixed

with 1 µl of each phage dilution and incubated for 1 hour at 125 rpm and 26oC. 100 µl of the

bacteria-phage suspension was plated onto 80 µg-1 ml-1 kanamycin TY agar and incubated

at 26oC until colonies were observed. Isolated colonies were purified and colony PCR

screened for the presence of the transposon.

75

2.3 Plant Experiments.

2.3.1 Nodulation phenotype and plant dry weights.

Nodulation phenotypes were determined in 2 litre pots of sterile vermiculite

containing 800 ml nitrogen-free rooting solution (100 µM KH2PO4, 100 µM Na2HPO4, 1

mM CaCl2.2H2O, 100 µM KCL, 800 µM MgSO4.7H2O, 10 µM Fe EDTA, 35 µM H3BO3, 9

µM MnCl2.4H2O, 0.8 µM ZnCl2, 0.5 µM Na2MoO4.2H2O, 0.3 µM CuSO4.5H2O). To

prevent nodulation by other Rhizobium strains pea seeds (Pisum sativum cv. Avola) were

surface sterilised in 95 % (v/v) ethanol for 30 seconds followed by 10 min in 2 % (v/v)

sodium hypochlorite. Sterilised peas were washed ten times in sterile distilled water and

planted three seeds per pot at a depth of 2 cm. Rhizobium strains were washed off a fresh

TY agar slope in 10 ml AMS and 400 µl of the cell suspension was used to inoculate seeds

at the time of sowing. Pots were covered and incubated at 22oC with a 16 hour light cycle,

provided by Sonti Agro grow lights. Following germination plants were thinned to one per

pot. Plants were watered after 21 and 35 days with sterile distilled water.

Plants were taken to 42 days and harvested for determining plant shoot dry weight.

Aerial parts of the plant were dried in an oven at 70oC for 48 hours and weighed. A

minimum of 15 plants was used for determining the mean dry weight.

To determine the nodulating strain, nodules were picked from the roots of each plant

and surface sterilised for 5 min in 2 % (v/v) sodium hypochlorite and then washed five

times in sterile distilled water. Individual nodules were crushed in 20µl sterile distilled

water and replica patched onto TY agar containing appropriate antibiotics.

2.3.2 Nitrogenase activity.

Nitrogenase activity was determined by assaying the reduction of acetylene to

ethylene, as described by Trinick et al., 1976. Plants were harvested intact at 26 days and

placed in sealed 250 ml Schott bottle, adapted for needle entry and close via a double rubber

seal. The bottom of the bottle was lined with moist tissue to prevent any drying of the plant

root system during the experiment. 5 % (v/v) of the bottles volume of air was removed with

a syringe and replaced with the same volume of acetylene. Plants were incubated at 26oC

for 1 hour and samples taken in triplicate for each plant using a 1 ml syringe and stabbed

into rubber bungs for later analysis. Samples were injected into a GC column (2 m long

internal diameter 1/8 inch phenyl isocyanate porocil C80 / 100 mesh column). Acetylene

and ethylene concentrations were determined assuming that 1 mole acetylene occupies

76

22.41 litres at standard temperature and pressure. The rate of nitrogenase activity was

determined by the ratio between acetylene and ethylene.

2.3.3 Nodule microscopy.

Plants were grown to 21 days and harvested. Nodule sectioning was conducted by

Kim Findlay, John Innes Centre, Norwich.

77

2.4 General Techniques and Enzyme Assays.

2.4.1 Cell disruption.

Rhizobium strains were grown overnight in 60 ml AMS, with the appropriate carbon

and nitrogen source (as detailed in the text), at 26oC and 225 rpm to an OD600 nm 0.3 – 0.8.

Cells were harvested at 3,800 rpm and 4oC for 20 min and washed in ice cold 10 mM

HEPES pH 7.4, before being finally resuspended in ice cold 40 mM HEPES pH 7.4, 2 mM

DTT, 20 % (v/v) glycerol to a volume of 2 ml. Cells were mechanically lysed in a Ribolyser

(Hybaid) at speed setting 6.5 for 30 seconds. Lysed cells were incubated on ice for 3 min

and supernatant recovered by centrifugation at 13,000 rpm and 4oC for 3 min. Recovered

supernatant was then centrifuged for a further 30 min at 13,000rpm and 4oC to pellet cell

membranes and debris. For enzyme assays cell extract was used within 12 hours and stored

at 4oC.

2.4.2 Protein determination.

Protein concentration was determined as described by Bradford, 1976. For

Bradford’s Coomassie blue reagent 10 mg of Coomassie brilliant blue G-250 was dissolved

in 5 ml of 90 % (v/v) ethanol, before addition of 10 ml of 85 % (v/v) phosphoric acid in a

total volume of 100 ml with H2O. This was mixed, filtered and kept for 2 – 3 days at 4oC. A

one in four dilution of sample, in 20 µl of extract buffer, was added to 180 µl of Coomassie

blue reagent and incubated for 5 min. Assays were carried out in 96-well plates and read

using GENios plate reader at OD595 nm. Protein standards of 0, 0.28, 0.56, 1.4, 2.1, 2.8, 3.5

and 7 µg were used to determine standard curve. Samples were calculated by plotting

against standard curve.

For SDS-PAGE protein concentration was determined using BioRad’s Experion

automated electrophoresis system, following the protocol for protein quantification.

2.4.3 Glutamine 2-oxoglutarate aminotransferase (GOGAT).

GOGAT activity was assayed as an adapted form of that described by Castillo et al.,

2000. Cell extract was prepared as described in Section 2.4.1. The reaction mixture

contained 200 µl 250 mM HEPES pH 8.5, 5 % (v/v) mecaptoethanol and 100 µl 30 mM 2-

oxoglutarate. Immediately prior to the start of the reaction 100 µl 2 mM NADPH and 500 µl

of cell extract and H2O were added. The reaction was started on addition of 100 µl 36.5 mM

glutamine and assayed at 28oC by measuring the change in absorbance at OD340 nm due to

78

the oxidation of NADPH. Specific activities are reported as nmol-1 NADPH oxidised min-1

mg-1 protein.

2.4.4 Alanine dehydrogenase (ADH).

ADH activity was assayed as an adapted form of that described by Allaway et al.,

2000. Cell extract was prepared as described in Section 2.4.1. The reaction mixture

contained 200 µl 250 mM HEPES pH 8.5, 5 % (v/v) mecaptoethanol and 100 µl 50 mM

pyruvate. Immediately prior to the start of the reaction 100 µl 2 mM NADH and 500 µl of

cell extract and H2O were added. The reaction was started on addition of 100 µl 1 M NH4Cl

and assayed at 28oC by measuring the change in absorbance at OD340 nm due to the oxidation

of NADH. Specific activities are reported as nmol-1 NADH oxidised min-1 mg-1 protein.

2.4.5 Amino acid uptake.

Solute uptake by Rhizobium strains was determined for radiolabelled compounds by

an adapted form of the rapid filtration method described by Poole et al., 1985. 60 ml

cultures were grown overnight in AMS, with appropriate carbon and nitrogen sources (as

detailed in the text), at 26oC and 225 rpm to mid-log stage. If bacterial cells were

complemented in trans for uptake systems then antibiotics were added to the medium to

ensure retention of plasmid DNA. Cells were harvested at 3,800 rpm and 24oC for 20 min

and washed in RMS before being resuspended to an OD600 nm of 1. Cultures were left to

starve for 1 hour in RMS at 60 rpm and 26oC. 200 µl of bacterial cells were used in a final

assay volume of 500 µl, in which uptake solutes were added to give a concentration of 25

µM and 0.125 µCi of either 14C or 3H radiolabelled compound. For transport of 14C alanine

via the Mct this concentration was increased to 500 µM and 0.5 µCi.

Competing compounds were added at 0.5 mM concentration for inhibition of

radiolabelled solute uptake. Solute uptake was then assayed as previously described.

Kinetic constants for solute uptake were determined using various µM and µCi

concentrations of radiolabelled compounds in standard uptake assays. The assay volume

was increased to a 5 ml volume and 2 ml samples were taken at 0,1 and 2 minute time

points.

For uptake by isolated shaeroplasts 400 ml cultures were grown overnight in 10 mM

glucose 10 mM NH4+ AMS to mid-log stage. Cells were harvested at 3,800 rpm and 24oC

for 20 min and washed in RMS before being resuspended in 10 ml 10 mM Tris-HCl pH 8,

20 % (v/v) sucrose, 1 mg-1 ml-1 lysozyme. Cells were incubated at 26oC for 15 min and 10

µl of 0.5 M EDTA pH 8 added before further incubation for 20 min. Cells were spun down

79

at 3,800 rpm and 24oC for 20 min and resuspended in RMS (20% (w/v) sucrose) to an

OD600 of 10. Standard uptake assays were performed, but using RMS (20% (w/v) sucrose)

to wash cells, so as not to induce an osmotic effect. The viability of sphaeroplasts was

checked microscopically.

2.4.6 β-galactosidase.

Cells were grown overnight in 10 ml AMS, containing the appropriate carbon and

nitrogen sources (as detailed in the text) and the appropriate antibiotics, at 26oC and 225

rpm to a mid-log stage. 1.5 ml of cells were harvested and spun down at 6,500 rpm for 5

min. Cells were resuspended in 1.5 ml Z buffer (0.06 M Na2HPO4, 0.04 M NaH2PO4, 0.01

M KCl, 0.001 M MgSO4.7H2O) pH 7.0. The OD600 nm was determined using 800 µl

resuspended cells. 350 µl resuspended cells were combined with 280 µl Z buffer and 70 µl

lysozyme solution (0.5 mg-1 ml-1 lysozyme, 3.5 % (v/v) mercaptoethanol, 10 mM phosphate

buffer pH 7.8). Samples were incubated at room temperature for 5 min. 15 µl of 0.5 M

EDTA pH 8.0 was added and incubated for a further 15 min. 7 µl of 1 % (w/v) SDS was

added and samples were equilibrated at 30°C for 5 min. 140 µl of o-nitrophenyl-β-galacto

pyranoside solution (4 mg-1 ml-1 ONPG, 0.35 % (v/v) mecaptoethanol) was added and

samples incubated for 10 min, or until colour developed. The reaction was stopped by

addition of 350 µl 1M Na2CO3. The reaction mix was centrifuged at 13,000 rpm for 30 min

to pellet cell debris and the colour intensity of the supernatant read at OD420 nm. The activity

was calculated (nmol-1 mg-1 protein min-1) based on the fact that 1 ml of culture with OD600

nm of 1 has 0.22 mg protein.

2.4.7 Alkaline phosphatase.

Cells were grown overnight in 10 ml AMS, containing the appropriate carbon and

nitrogen sources (as detailed in the text) and the appropriate antibiotics, at 26oC and 225

rpm to a mid-log stage. The OD600 nm was determined using 800 µl of culture. 1.5 ml cells

were harvested and spun down at 6,500 rpm for 5 min. Cells were resuspended in 1 ml 0.1

M Tris-HCl pH 8.0. 20 µl of chloroform and 10 µl of 10 % (w/v) SDS was added and

vortexed. 700 µl of 0.1 M Tris-HCl pH 8.0 was added to 100 µl of cells and incubated at

30oC for 5 min. To start the reaction 100 µl of p-nitrophenyl phosphate solution (4 mg-1 ml-1

PNPP, 0.1 M Tris-HCl pH 8.0) was added and incubated for 20 min, or until colour

developed. The reaction was stopped by addition of 100 µl of K2HPO4. The reaction mix

was centrifuged at 13,000 rpm for 30 min to pellet cell debris and the colour intensity of the

80

supernatant read at OD420 nm. The activity was calculated (nmol-1 mg-1 protein min-1) based

on the fact that 1 ml of culture with OD600 nm of 1 has 0.22 mg protein.

2.4.8 β-glucuronidase.

Cells were grown overnight in 10 ml AMS, containing the appropriate carbon and

nitrogen sources (as detailed in the text) and the appropriate antibiotics, at 26oC and 225

rpm to a mid-log stage. 1.5 ml of cells were harvested and spun down at 6,500 rpm for 5

min. Cells were resuspended in 1.5 ml Z buffer (0.06 M Na2HPO4, 0.04 M NaH2PO4,

0.01M KCl, 0.001 M MgSO4.7H2O) pH 7.0. The OD600 nm was determined using 800 µl

resuspended cells. 350 µl resuspended cells were combined with 280 µl Z buffer and 70 µl

lysozyme solution (0.5 mg-1 ml-1 lysozyme, 3.5 % (v/v) mercaptoethanol, 10 mM phosphate

buffer pH 7.8). Samples were incubated at room temperature for 5 min. 15 µl of 0.05 M

EDTA pH 8.0 was added and incubated for a further 15 min. 7 µl of 1 % (w/v) SDS was

added and samples were equilibrated at 30°C for 5 min. 140 µl of p-nitrophenyl β-D-galacto

pyranoside solution (4 mg-1 ml-1 PNPG, 0.35% (v/v) mecaptoethanol) was added and

samples incubated for 10 min, or until colour developed. The reaction was stopped by

addition of 350 µl 1 M Na2CO3. The reaction mix was centrifuged at 13,000 rpm for 30 min

to pellet cell debris and the colour intensity of the supernatant read at OD420 nm. The activity

was calculated (nmoles-1 mg-1 protein min-1) based on the fact that 1 ml of culture with

OD600 nm of 1 has 0.22 mg protein.

For determining bacteroid GUS activity nodules were harvested at 21 days and

macerated in 50 mM phosphate buffer pH 7. Bacteroids were separated from plant debris by

centrifugation at 1,250 rpm for 5 min. Supernatant was removed and centrifuged again at

6,000 rpm for 5 min in a fresh 1.5 ml microcentrifuge tube. Assays were carried out as

previously using dilution of bacteroid extract. The activity was calculated (nmoles-1 mg-1

protein min-1) based on the fact that 1 ml of bacteroids with OD600 nm of 1 has 0.45 mg

protein.

2.4.9 GFP-UV fluorescence.

As a method for quantifying promoter activity and gene expression GFP-UV shows

comparable results to lacZ reporter fusions (Chalfie et al, 1994; Scholz et al, 2000). The

advantages of GFP-UV over lacZ are that it requires no cofactors, substrates or other gene

products and can be conducted in real time. GFP-UV has an excitation maximum of OD395

nm, a minor peak at OD470 nm and an emission maximum of OD509 nm (Clontech).

81

Cells were grown overnight in 10 ml AMS, containing the appropriate carbon and

nitrogen sources (as detailed in the text) and the appropriate antibiotics, at 26oC and 225

rpm to a mid-log stage. 200 µl cells were aliquoted into 96 well microtitre plates and GFP-

UV levels quantified using a GENios plate reader (Tecan), at OD495 nm excitation

wavelength filter and OD510 nm emission wavelength filter. Optical density was quantified at

OD595 nm. For blank reading fluorescence was measured against wild-type cells containing

no GFP-UV reporter fusion. For optical density, readings were made against the

uninoculated medium. Specific fluorescence was calculated by florescence emission OD510

nm wavelength / OD595 nm.

2.4.10 Glutamate determination.

Rhizobium strains were grown overnight in 60 ml AMS, with the appropriate carbon

and nitrogen source, at 26oC and 225 rpm to an OD600 nm 0.6 – 0.8. Cells were harvested at

3,800 rpm and 26oC for 20 min and washed in AMS before being resuspended to an OD600

nm of 1 in AMS, containing the original growth substrates. Resuspended cells were

incubated at 26oC for 4 hours. Samples were centrifuged at 3,800 rpm and 26oC for 20 min

and the supernatants assayed for metabolites.

Amino acid excretion by free-living R. leguminosarum was determined by

enzymaticly linked NAD+ ⇔ NADH colorimetric reactions at OD340 nm. These were

coupled to a standard curve of known concentrations to enable quantification.

L-glutamate UV assay with glutamate dehydrogenase and NAD+ was adapted from

that described by Bernt and Bergmeyer, 1974. The reaction mixture contained 250 µl buffer

(1.4 M hydrazine, 1.68 M glycine), 200 µl 12 mM NAD+ and 950 µl sample and H2O. 100

µl enzyme mix (250 mM hydrazine, 300 mM glycine, 3 U glutamate dehydrogenase) was

added to a final and reaction volume of 1.5 ml and incubated at 37oC for 90 min. The

change in absorbance at OD340 nm, due to the reduction of NAD+, was determined and

plotted against a standard curve of 0 – 120 nM glutamate for quantification.

2.4.11 Alanine determination.

This was performed as for glutamate determination but instead using 100 µl enzyme

mix (250 mM hydrazine, 300 mM glycine, 0.5 U alanine dehydrogenase). Samples

quantified by the change in absorbance at OD340 nm and against a standard curve of 0 - 120

nM of alanine.

82

2.4.12 Aspartate determination.

Determination of aspartate concentration was and adapted from that described by

Bergmeyer et al., 1974. The reaction mixture contained 250 µl of 336 mM potassium

phosphate buffer pH 7.2, 100 µl of 45 mM 2-oxoglutarate, 100 µl of 3 mM NADH and 950

µl sample and H2O. 100 µl of enzyme mix (60 mM potassium phosphate buffer pH 7.2, 8 U

malate dehydrogenase, 1.2 U aspartate aminotransferase was added to a final and reaction

volume of 1.5 ml and incubated at 37oC for 90 min. The change in absorbance at OD340 nm,

due to the oxidation of NADH, was determined and plotted against a standard curve of 0 –

120 nM of aspartate for quantification.

83

Chapter 3:- Aliphatic Amino Acid Transport by the Bacteroid Drives Symbiotic Nitrogen Fixation.

84

3.1 Introduction.

As discussed earlier there has been a recent reassessment of the major secretion

products of symbiotic nitrogen fixation following observations of the release of amino acids

from pea isolated peri-bacteroid units and bacteroids (Appels and Hacker, 1991; Rosendahl

et al., 1992). It was not determined if these amino acids were an artefact of either plant

enzyme contamination in bacteroid fractions, a stress response to nodule detachment or if

mixed secretion products were a fundamental part of the symbiotic relationship. Waters et

al., 1998 went so far as to propose that in soybean nodules alanine and not ammonia is the

major secretion product by bacteroids. However, other attempts to replicate this alanine

secretion from soybean bacteroids were unsuccessful and showed ammonium as the sole

nitrogen secretion product (Li et al., 2002). To finally resolve this, Allaway et al., 2000

measured alanine secretion by isolated pure bacteroid fractions from R. leguminosarum bv.

viciae 3841. Alanine secretion was demonstrated to occur at ammonium concentrations that

are physiologically relevant to those expected in mature bacteroids of pea nodules. No other

amino acid secretion was detected and mutation of aldA abolished detectable alanine

secretion. The rate of ammonium synthesis and the symbiotic phenotype of plants were

unaffected by mutation of aldA demonstrating that whilst this is the primary route for de

novo alanine synthesis in bacteroids alanine is not the sole nitrogen secretion product.

Lodwig et al., 2003 readdressed the debate as to the role of amino acid secretion in

planta with the proposal that an amino acid cycle operates between the host plant and

bacteroid. It was suggested that the bacteroid acts like a plant organelle to cycle amino acids

back to the plant for asparagine synthesis, creating mutual dependence and selective

pressure for mutualistic evolution. The bi-directional nature of the two broad range amino

acid ABC transporters, Aap and Bra, means they can act both as uptake transport systems of

amino acids but also as high-rate low-affinity amino acid exporters (Walshaw and Poole,

1996; Hosie et al., 2001). In studies on alanine and amino acid secretion isolated bacteroids

were likely fragile, damaged and removed from the normal metabolite exchange with the

plant. Isolated bacteroids were not supplied with amino acids and osmotic upshift during

bacteroid isolation transiently inhibits uptake via ABC transporters, such as the two

principal amino acid transporters Aap and Bra (Fox et al., 2006). Isolation of bacteroids for

proteomic analysis of pea nodules has also demonstrated that isolation leads to the loss of

the SBPs both Aap and Bra (Saalbach et al., 2002). The factors, which all negatively effect

amino acid movement, likely affect the rate of flux or stoichiometries that are the same as

inside the nodule. Therefore, although mutation of aldA abolished de novo alanine secretion

85

by isolated bacteroids in vitro it will not necessarily abolish alanine synthesis by

transamination and subsequent secretion in planta. Alanine synthesis by transamination

likely predominates as mutation of aldA has little effect on the symbiotic plant phenotype

compared to the Fix reduced phenotype for mutation of aap bra, which leads to a

breakdown in the amino acid cycle. Transamination of pyruvate to alanine occurs directly

from either glutamate or aspartate in R. leguminosarum by action of the AatA enzyme

(Bourdès and Poole, Unpublished). However, aatA mutants in R. leguminosarum develop

fully into bacteroids but show a Fix- phenotype similar to that of dct mutants (Finan et al.,

1983; Lodwig et al., 2003). The regulation of amino acid pools by AatA in bacteroids must

therefore play an important role in nitrogen fixation and indicate the requirement for this

enzyme in mature bacteroids for amino acid synthesis and secretion.

The broad specificity of the Aap and Bra has meant that the role of these

transporters for import, export or both and also the exact amino acids involved remained

unsolved. Hosie et al., 2002a describe a second SBP capable of interaction with the Bra

transport complex that restricts the transport specificity to aliphatic amino acids. This is a

powerful tool for determining the role of alanine transport in symbiotic nitrogen fixation.

Using this strain that is specific for aliphatic amino acids allowed investigation of mixed

secretion and the role that alanine plays. Here we report the identification of this secondary

SBP (BraC3) and report how a triple mutation in aapJ, braC and braC3 alters the symbiotic

plant phenotype. This shows that the minimum requirement for nitrogen fixation is alanine

movement between the host plant and the bacteroid. We also demonstrate that it is most

likely amino acid export by these transport systems and not import that is required for

effective symbiotic nitrogen fixation.

86

3.2 Results.

3.2.1 Mutation in aapJ and braC.

The bra operon consists of braDEFGC, where braDEFG code for proteins that form

the membrane complex and the final gene braC codes for a SBP. Work conducted on strains

derived from R. leguminosarum bv. viciae A34 (Wild-type) mutated in aap and braC

indicated that transport of alanine and leucine via Bra was not solely dependent on BraC

(Hosie et al., 2002a). This was determined by the fact that transport of amino acids was

significantly reduced when the mutation was in braDEFG, but when the mutation was in

braC significant uptake of alanine and leucine remained. Alanine transport in

R.leguminosarum also occurs via the Mct secondary transporter. However, the Mct was has

a greater affinity for both pyruvate and lactate than it does for alanine indicating its

principal role is not alanine transport (Hosie et al., 2002b). Uptake of alanine (25 µM 0.125

µCi 14C) in the presence of 0.5 mM competing solutes was carried out to confirm that

alanine transport via the Mct was not upregulated in response to mutation of aapJ and braC.

Transport was inhibited only by alanine and leucine and not by other common amino acids

or keto-acids demonstrating that this alanine transport is not via the Mct (Hosie and Poole,

Unpublished). Current understanding of solute transport by bacterial ABC transporters

indicates that it is unlikely that the membrane complex can bring about uptake in the

absence of SBP (Higgins, 2001). It was therefore proposed that two solute SBPs are capable

of interaction with the membrane complex BraDEFG for amino acid transport. BraC is

capable of transport for a broad range of amino acids whereas the putative secondary SBP is

restricted to the aliphatic amino acids.

The transport phenotype indicating the presence of two Bra SBPs was highlighted in

strains mutated in aapJQM, as Aap is also a broad range amino acid transporter, so uptake

via this system partially masks the effect of mutation in braC. For consistency it was

decided mutation in the aap should also be confined only to the gene coding for the systems

SBP. The aap operon consists of aapJQMP, where the first gene of the operon codes for the

SBP and aapQMP code for the structural transport membrane complex. However,

transposon mutations in aapJ are polar on the distal genes (Walshaw and Poole, 1996).

Strains derived from bv. viciae 3841 were constructed prior to this work with single and

double mutations in aapJ and braC (Kinghorn and Poole, Unpublished). Strain RU1978

(aapJ-) contains an inframe aapJ deletion that allows expression of the downstream genes

aapQMP. RU1978 (aapJ-) was further used as the parent strain for deletion of an internal

fragment of braC and insertion of an spcr cassette forming RU1979 (aapJ- braC-). As braC

87

is the final gene of the operon an inframe deletion was not required to allow expression of

braDEFG.

Whilst the aapJ and braC mutations had been created in these strains, and the

mutations physically confirmed by PCR, they remained untested. To confirm the mutation

in aapJ of RU1978 (aapJ-) is inframe and allows expression of aapQMP, aapJ was

complemented in trans. Plasmid pRU1166 (pJP2 x aapJ) was conjugated into RU1978

(aapJ-) to create strain RU1891 (aapJ- x pRU1166). Strains mutated in aap are unable to

grow on 10 mM glutamate AMA as the sole carbon source and so RU1978 (aapJ-) and

RU1891 (aapJ- x pRU1166) were screened for growth relative to that of 3841 (Wild-type)

(Walshaw and Poole, 1996). Whilst RU1891 (aapJ- x pRU1166) showed a similar growth

rate to that of 3841 (Wild-type) after 5 days, RU1978 (aapJ-) was unable to grow. To

determine if this observed growth phenotype was due to reconstituted amino acid transport,

via the Aap, the rate of uptake for amino-isobutyric acid (AIB) (25 µM 0.125 µCi 14C) was

assayed in all strains (Table 3.2.1.).

Strain Rate (nmol-1 mg-1 protein min-1) SEM

3841 (Wild-type) 5.84 0.77 RU1978 (aapJ-) 0.38 0.00 RU1891 (aapJ- x pRU1166) 7.25 0.19

Table 3.2.1. Transport rate of AIB in wild-type versus strains mutated and complemented for an inframe deletion of aapJ. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS and assays conducted in the presence of a 20-fold excess of GABA (0.5 mM) to inhibit AIB transport via the Bra (Hosie et al., 2002a). Number of replicates is n = ≥ 3 with standard error values (SEM).

The rate of AIB transport and growth on 10 mM glutamate AMA show RU1978

(aapJ-) can be successfully complemented in trans for mutation in aapJ. This also

demonstrates that the aapJ deletion is indeed inframe and expression of aapQMP occurs in

RU1978 (aapJ-) strain under the normal promoter upstream of aapJ. The slight increase of

transport in RU1891 (aapJ- x pRU1166) relative to 3841 (Wild-type) is probably due to the

multicopy effect of aapJ being based on the low copy number plasmid pJP2. It is unlikely

to be an artefact of the inframe aapJ mutation as the deletion was an internal aapJ fragment.

Therefore the intragenic region between aapJ and aapQ, containing any regulatory

elements, remains unaffected maintaining normal expression of the distal genes aapQMP.

Mutation in braC has been complemented in strains of an A34 (Wild-type)

background so no attempt was made to complement RU1979 (aapJ- braC-) as it has been

88

established that braC mutation has no effect on expression of the genes encoding for the

membrane complex (Hosie et al., 2002a). Since braC is the last gene of the operon

expression of the membrane complex is not likely to be abolished but expression may be

altered. The PotABCD ABC transport system of E.coli shows negative regulation by a

precursory form of the SBP (PotD) on genes that code for the transport complex (Antognoni

et al., 1999). The Aap appears to utilise only one SBP so any upregulation of aapQMP in

response to an inframe mutation in aapJ would be negated by the fact transport cannot

occur without a SBP. However, as Bra appears to utilise two SBPs any upregulation of

braDEFG by mutation of braC could have an effect on transport facilitated by this putative

secondary SBP. The regulation of the membrane complex genes was determined in all

strains through the cosmid based reporter fusion pBIO206 (pIJ1427 braE::TnphoA) (Hosie

et al., 2002a). Cosmid pBIO206 (pIJ1427 braE::TnphoA) was conjugated into strains 3841,

RU1978 and RU1979 (RU1876, RU2290, RU2291 respectively).

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU1876 (Wild-type x pBIO206) 8.31 0.38 RU2290 (aapJ- x pBIO206) 9.76 0.29 RU2291 (aapJ- braC- x pBIO206) 9.76 0.62

Table 3.2.2. Alkaline phosphatase activity of braE::TnphoA reporter fusion to determine the effect of braC mutation on braDEFG expression. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 2 µg ml-1 tet AMS. Number of replicates is n = ≥ 3 with standard error values.

The PhoA activities don’t differ between strains indicating no up regulation of

braDEFG in response to braC mutation. Any upregulation of the membrane complex in

response to mutation in braC may have indicated that expression of the putative secondary

SBP was low in free-living cultures and impact upon attempts to identify the gene through a

proteomic approach. However, it would appear both Bra SBPs are expressed in free-living

cultures and the implications on transport will be discussed later.

As a reference for loss of all amino acid transport via the Bra, versus RU1978 (aapJ-

) and RU1979 (aapJ- braC-), a strain mutated in the genes coding for membrane complex

was required. Using the same parent strain RU1978 (aapJ-) as that of RU1979 (aapJ- braC-

), braEF were mutated by gene deletion and insertion of an omega interposon. Plasmid

pRU1137 contains the braDEFG operon with a 153bp EcoRV deletion in braEF into which

an omega tetr cassette has been cloned (Hosie et al., 2002a). Plasmid pRU1137 is derived

89

from pJQ200SK- and contains the p15A origin of replication that is incompatible in R.

leguminosarum. Plasmid pRU1137 was conjugated into RU1978 (aapJ-) for direct gene

replacement by Sac mutagenesis on 10 % sucrose 10 mM NH4+ AMA. Two sucrose

resistant colonies were recovered that were gens and tetr indicating loss of the vector and

direct gene replacement for the bra with the braEF gene deletion and interposon. Genomic

DNA was isolated from both and PCR screened using primers p438 and p439 to physically

confirm the mutation. Screening was relative to 3841 (Wild-type) and RU1722 (aapJQM-

braEF-). The presence of a product of 1 kb was visualised for 3841 (Wild-type) compared

to a 2.5 kb product for RU1722 (aapJQM- braEF-) and both colonies, indicating successful

gene replacement. The first of these two colonies was again purified and its genetic markers

re-checked before stocking as RU2267 (aapJ- braEF-).

Uptake assays for glutamate, aspartate, alanine, AIB, leucine, histidine (25 µM

0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) were carried out to determine the

transport phenotype of all mutations (Figure 3.2.1.).

90

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB Leu His GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

5

10

15

20

25

303841 (Wild-type) RU1978 (aapJ-) RU1979 (aapJ- braC-) RU1722 (aapJQM- braEF-) RU2267 (aapJ- braEF-)

Figure 3.2.1. Effect on amino acid uptake for the loss of the SBP BraC compared to loss of proteins that form the Bra membrane complex. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

The rate of transport for amino acids by RU1978 (aapJ-) is the same as that reported

previously for strains mutated for the integral membrane proteins of the Aap (Walshaw and

Poole, 1996; Hosie et al., 2002a; Lodwig et al., 2003). The transport phenotype of RU2267

(aapJ- braEF-) is the same as RU1722 (aapJQM- braEF-), virtually abolishing all amino

acid transport via both systems and confirming that that the aap has no auxiliary SBP and

that RU2267 (aapJ- braEF-) carries the correct braEF deletion. The transport rates for

glutamate, aspartate, histidine and GABA for both RU1979 (aapJ- braC-) and RU2267

(aapJ- braEF-) indicate that deletion of braC, which codes for the SBP, is as effective at

abolishing transport of these solutes as a mutation in genes coding for the Bra membrane

complex, which has been shown to abolish all transport by the Bra (Hosie et al., 2002a;

Lodwig et al., 2003). However, the uptake rates of alanine, leucine and AIB by RU1979

(aapJ- braC-) differ between both RU2267 (aapJ- braEF-) and RU1978 (aapJ-). Mutuation

in braC leads to an increase in alanine transport and only an approximate halving of AIB

and leucine transport relative to RU1978 (aapJ-). However, uptake is virtually abolished for

these solutes in RU2267 (aapJ- braEF-) compared to RU1978 (aapJ-). As seen in A34

(Wild-type), 3841 (Wild-type) derived strains, which already lack amino acid transport via

91

the Aap, do not abolish all amino acid transport when mutated in braC, coding for the SBP,

but do when the mutation is in braDEFGH, coding for the membrane complex. This

indicates again the presence of a secondary more specific SBP that can compensate for

mutation of braC for transport of aliphatic amino acids, but cannot when the mutation is in

braDEFG, as it also requires the Bra membrane complex to facilitate transport. Transport

via this putative secondary SBP in strain RU1979 (aapJ- braC-) is specific for aliphatic

amino acids in much the same way as transport via the Bra of P. aeruginosa (Hoshino and

Kose, 1990). Alanine transport is lower in RU1978 (aapJ-), where both Bra SBPs are

present, than in RU1979 (aapJ- braC-) indicating this secondary SBP has a greater affinity

for alanine than BraC. Mutation of aap and bra does leave very low residual transport for

alanine and histidine and this can be attributed to the R. leguminosarum Mct and His

transporters respectively (Hosie and Poole, 2001; Hosie et al., 2002b; Hosie and Poole,

Unpublished).

3.2.2 Identification and mutation of braC3.

The complete genome of R. leguminosarum bv. viciae 3841 reveals twelve genes,

other than braC (RL3745), encoding putative SBPs of the HAAT family; pRL80026,

pRL90258, pRL110400, pRL120099, pRL120404, pRL120445, pRL120493, RL2597,

RL2844, RL3540, RL3741, and RL3906 (Young et al., 2006). pRL120404 forms part of a

transport operon that has been previously identified and characterised as braC2, part of the

bra2 operon (Hosie et al., 2002a). However, over-expression of this operon demonstrated

no increase in transport of neutral or aliphatic amino acids in a strain mutated for aap braC

indicating BraC2 is unable to interact with BraDEFG. The interaction of two SBPs with the

membrane complex of ABC transport systems is well established for the His and Liv

systems, in S. enterica and E. coli respectively. For both systems the secondary SBP

appears to stem from a tandom gene duplication of a single ancesteral gene and is

associated upstream of the transporter operon (Higgins and Ames, 1981; Adams et al.,

1990). RL3741 is located on the chromosome of R. leguminosarum bv. viciae 3841

upstream of braD. However, RL3741 appears to be divergently transcribed to form part of a

putative operon with genes encoding other transport components, so probably forms part of

a separate transport complex. The preliminary uptake assays for RU1979 (aapJ- braC-)

demonstrates that transport by this putative secondary SBP is more restricted and confined

to the neutral and aliphatic amino acids, whereas BraC transports a variety of polar,

hydrophobic, neutral and even D amino acids (Hosie et al., 2002a). Similar LIV-I

transporters of E. coli and P. aeruginosa transport only neutral amino acids such as alanine,

92

leucine, isoleucine, valine, threonine and possibly serine (Robins and Oxender, 1973;

Landick and Oxender, 1985; Hoshino et al., 1992). Homology based alignment of the

HAAT SBPs from Rhizobium sp. with the LIV-I SBPs form other proteobacteria will

hopefully reveal the gene identity of the putative secondary Bra SBP (Figure 3.2.2.).

Sequences obtained from;

R. leguminosarum bv. viciae 3841 – http://www.sanger.ac.uk/Projects/R_leguminosarum

S. meliloti 1021 – http://sequence.toulouse.inra.fr/meliloti.html

B. japonicum USDA110 – http://www.kazusa.or.jp/rhizobase/Bradyrhizobium/index.html

M. loti MAF303099 – http://www.kazusa.or.jp/rhizobase/Mesorhizobium/index.html

R. etli CFN42 – http://www.cifn.unam.mx/retlidb/

E. coli K-12 – http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=48994941

P. aeruginosa PAO1 –

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=9946990

93

Figure 3.2.2. Phylogenic tree of HAAT SBPs from various organisms based upon predicted protein sequence. . Based on Phylip values obtained from ClustalW 1.83 multiple alignment values, http://align.genome.jp/. pRL / RL = R.leguminosarum bv. viciae 3841, SM = S.meliloti 1021, bll / blr = B.japonicum USDA110, mll / mlr = M.loti MAF303099, RHE = R.etli CFN42, ec = E.coli K-12, pa = P.aeruginosa PAO1.

blr3432 mll4889

RL3906 SMb20568 pRL90258 pRL110400

SMc03121 blr2262 blr1050 RL3741 SMb20605 mll0762

pRL120445 mll1986

bll3614 RL2844

bll6899

RL2597 mlr7182

SMc00513 RL3540 (BraC3) RHE_CH03093

SMc00078 mlr7721

RL3745 (BraC) RHE_CH03321 mll3970

SMc01946 blr5675 SMa0576 pa_BraC ec_LivJ

mlr9716 pRL120493

mll7204 pRL120099

SMc02356 pRL80026

mlr9034

pRL120404 bll2844

94

The predicted protein products of RL2597 and RL3540 cluster closely with BraC

and also pa_BraC and ec_LivJ, representing targets for mutagenesis to eliminate the

observed residual alanine transport. Incidentally both of these genes do not appear to form

an operon, or are associated, with other genes encoding parts of an ABC transport complex

and so are termed orphan SBPs. It was considered that RL3540 was most likely to represent

the SBP of interest as it is less evolutionally distinct than RL2597 and appears conserved in

both S. meliloti and R. etli, as well as possibly in M. loti. The genetic architecture around

RL3540 also appears to be conserved in R. etli, but not S. meliloti, and the flanking genes

both appear to be involved in maintaining the nitrogen status of the cell (Galibert et al.,

2001; Gonzalez et al., 2006). Divergently transcribed from RL3540 is RL3539 that codes

for a putative metal-dependent phosphohydrolases containing an HD domain. HD domains

are highly conserved amongst metal-dependent phosphohydrolases that are linked to ppGpp

hydrolysis as part of the stringent response in amino acid / carbon starvation (Cashel et al.,

1996; Aravind and Koonin, 1998). It is believed these HD domains act to coordinate

divalent cations, which is essential for the activity of these proteins (Aravind and Koonin,

1998). RL3541 appears to form an operon with RL3540 and encodes a putative adenine

deaminase, which has also been implicated in the stringent response to amino acid

starvation (Kocharian et al., 1982; Nygaard et al., 1996; Eymann et al., 2002). The

conservation of the genes around this orphan HAAT SBP in both R. leguminosarum and R.

etli indicates a shared genetic heritage. The evolutionary origin of RL3540 remains

uncertain. RL3540 does not appear to have arisen as a result of tandem gene duplication as

it shares only 59 % identity to braC, compared to 71 % identity of hisJ to argT and 78 %

identity of livJ to livK, in S. enterica and E. coli respectively, where this evolutionary origin

has been suggested (Higgins and Ames, 1981; Adams et al., 1990). The genes coding for

both Bra SBPs are also not clustered on the chromosome as is again the case for both the

His and Liv systems. RL3540 has a G + C content of 65 % compared to 61 % for the 3841

genome, 61.2 % for braC, 63.9 % for P. aeruginosa braC and 54 % for E. coli livJ. Whilst

the G + C content is most similar to the P. aeruginosa braC it remains evolutionally closer

to braC so appears unlikely to have arisen through horizontal gene transfer. RL3540 was

considered for further investigation and termed braC3.

A 3.5 kb region containing braC3 was amplified using primers P493 and P494, to

which an XbaI and SpeI site were added respectively, and cloned directly into pCR2.1-

TOPO (pRU1526) (Kinghorn and Poole, Unpublished). The region containing braC3 was

then cloned as a 3.5kb XbaI / SpeI fragment into pJQ200SK- (pRU1529) (Kinghorn and

95

Poole, Unpublished). Invitrogen GeneJumperTM kanr in vitro mutagenesis was then carried

out and recovered kanr colonies PCR screened, using either P493 or p494 and the Mu End

primer. Colonies carrying insertions in braC3 were indicated by PCR products of between

1.7 to 2.8 kb and 0.8 to 1.9 kb. One clone was identified and stocked (pRU1536) (Kinghorn

and Poole, Unpublished). Plasmid DNA was isolated and mapped by restriction digest to

confirm the position of the GeneJumperTM kanr insertion in braC3. Fragments of 5.35, 2.75

and 2.1 kb were produced on digestion with XbaI / SpeI, whilst fragments of 7.5, 1.6 and

1.1kb were produced on digestion by BamHI to confirm the insertion in BraC3. To

determine the exact juncture of the mutation pRU1536 (pRU1529 braC3::TnGenejumper)

was sequenced using the GeneJumperTM sequencing primers A and B and it was found that

the insertion mapped between bases 3716435 and 3716436 on the chromosome in braC3

(Figure 3.2.3.).

96

7343 bp

braC3 RL3541RL3539 RL3542

GeneJumperTM kanr

p635 (100.0%) p636 (100.0%)

AACGGCGTGC TGATGGTCACCCCGA CCGCG A CGGCCCCCG

3716420 3716440

7343 bp

braC3 RL3541RL3539 RL3542

GeneJumperTM kanr

p635 (100.0%) p636 (100.0%)

AACGGCGTGC TGATGGTCACCCCGA CCGCG A CGGCCCCCG

3716420 3716440

Figure 3.2.3. Genetic arrangement braC3 and surrounding DNA. The juncture of the GeneJumperTM insertion used for mutagenesis is shown above. Also shown are the primer binding sites used to screen for direct gene replacement.

Conjugation of pRU1536 (pRU1529 braC3::TnGenejumper) into RU1978 (aapJ-)

and RU1979 (aapJ- braC-) again lead to direct gene replacement through sucrose selection,

on 10 % sucrose 10 mM NH4+ AMA. Five kanr gens colonies derived from the parent strain

RU1978 (aapJ-) and three kanr gens colonies derived from the parent strain RU1979 (aapJ-

braC-) were recovered. Colonies were PCR screened for correct integration using the Mu

End primer and either p635 or p636, which are set back from the p493 and p494 sites used

for amplification. Fragments of 2.3 kb for p635 and Mu End as well as 1.8 kb for p636 and

Mu End indicate correct gene replacement. All of the colonies recovered gave the correct

fragment pattern and one of each was purified and stocked as RU2395 (aapJ- braC3-) and

RU2281 (aapJ- braC- braC3-) respectively for strains with RU1978 (aapJ-) and RU1979

(aapJ- braC-) as their parent. To identify if braC3 was indeed encoding a secondary SBP

capable of interaction with BraDEFG the rate of amino acid transport was determined to see

if mutation of aapJ braC braC3 abolished alanine and leucine uptake to the levels of a Bra

IMP mutant (Figure 3.2.4.). Amino acid transport via the Bra, with respect to two

independently functioning SBPs, can now be assessed in free-living Rhizobium cells. The

rate of uptake that remains in a strain mutated for aap has been a combination of the

transport rates of two SBP competing for one membrane complex. Therefore, the rate and

kinetics of amino acid transport reported by Hosie et al., 2002a will be influenced by the

affinity of each SBP for the membrane complex as well as for solutes. Mutation in braC and

braC3, both separately and in concert, allowed determination of BraC3 as a secondary SBP

of Bra and the specificity and kinetics of amino acid transport via each SBP.

97

Uptake assays for glutamate, aspartate, alanine, AIB, leucine, histidine (25 µM

0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) were carried out to determine the

transport phenotype of all mutations (Figure 3.2.4.).

98

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB Leu His GABA

Rat

e (n

mol

-1 m

g-1 P

rote

in m

in-1

)

0

5

10

15

20

25

303841 (Wild-type) RU1978 (aapJ-)RU1979 (aapJ- braC-) RU2395 (aapJ- braC3-)RU2281 (aapJ- braC- braC3-) RU2267 (aapJ- braEF--)

Figure 3.2.4. Rates of amino acid uptake for aap bra mutants to determine the transport phenotype of the two Bra SBPs. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

As seen previously (Figure 3.2.3.) amino acid uptake by RU1978 (aapJ-) was half

that of wild-type. Again as expected strain RU2267 (aapJ- braEF-) demonstrated a loss of

all amino acid transport, as seen for RU1722 (aapJQM- braEF-). Comparison of amino acid

uptake rates for RU1979 (aapJ- braC-), RU2281 (aapJ- braC- braC3-) and RU2267 (aapJ-

braEF-) confirms BraC3 as a second SBP for the Bra membrane complex. The triple SBP

mutant, RU2281 (aapJ- braC- braC3-), demonstrates a reduction of uptake for all amino

acids similar to RU2267 (aapJ- braEF-), where mutation of the bra operon is in genes

coding for the membrane complex. Crucially the uptake of alanine, leucine and AIB by

RU1979 (aapJ- braC-) is lost on further mutation in braC3, RU2281 (aapJ- braC- braC3-),

to the same rates as observed for RU2267 (aapJ- braEF-).

Amino acid uptake by RU2395 (aapJ- braC3-) demonstrates the profile of amino

acid uptake by interaction of BraC alone with the Bra membrane complex. Mutation in

braC3 does not abolish transport of any amino acids and does not impact greatly on the

transport phenotype of that observed for RU1978 (aapJ-), indicating that BraC retains its

characteristics as being a SBP capable of binding a broad range of amino acids. However,

99

the kinetics of transport for solutes by BraC will have to be re-determined, as those reported

were assayed on a strain where the Bra system utilised two competing functional SBPs

(Hosie et al., 2002a). As mentioned previously the rate of alanine transport increases on

mutation in braC indicating that BraC3 may have a greater Vmax for alanine than BraC.

Uptake of alanine by RU1978 (aapJ-) occurs via the binding of alanine to both Bra SBPs

that then compete for the same membrane complex. The rate of alanine uptake by RU1978

(aapJ-) is more similar to RU2395 (aapJ- braC3-) than to RU1979 (aapJ- braC-). Further

analysis of the Kd for binding of the SBPs to the membrane complex may indicate that

whilst BraC3 has the greater rate of uptake for alanine the Bra membrane complex has a

greater affinity for binding BraC.

Amino acid uptake by RU1979 (aapJ- braC-) suggests that BraC3 is second SBP of

restricted specificity capable of interaction with the Bra membrane complex to bring about

transport of aliphatic amino acids. To confirm the specificity of BraC3 for aliphatic amino

acids the rate of uptake for AIB, alanine, valine, isoleucine and leucine (25 µM 0.125 µCi 14C) was determined for all strains (Figure 3.2.5.).

100

Solute 25 µM 0.125 µCi

AIB Ala Val Iso Leu

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

5

10

15

20

25

303841 (Wild-type)RU1978 (aapJ-)RU1979 (aapJ- braC-)RU2395 (aapJ- braC3-)RU2281 (aapJ- braC- braC3-)RU2267 (aapJ- braEF-)

Figure 3.2.5. Rates of aliphatic amino acid uptake for aap bra mutants to determine the transport phenotype of BraC3. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

The aliphatic amino acid uptake rates of RU1979 (aapJ- braC-) indicate that the

specificity of BraC3 can be extended to include uptake of valine and isoleucine, further

demonstrating it is a SBP specific for the aliphatic amino acids. Again mutation in braC3 to

make a triple SBP mutant, RU2281 (aapJ- braC- braC3-), reduced the uptake rate of all

solutes to that demonstrated for RU2267 (aapJ- braEF-), where the mutation in the bra

operon is in the genes coding for the membrane complex. The confines on specificity of

uptake by RU1979 (aapJ- braC-) appear to be due to the ability of BraC3 to bind differing

amino acids, as the Bra membrane complex allows transport of a wide range of amino acids

on interaction with BraC. The rates of alanine, valine, isoleucine and leucine uptake by

RU2395 (aapJ- braC3-) indicate that all share comparable rates that do not differ

significantly. However, the rate of aliphatic amino acid uptake by RU1979 (aapJ- braC-)

appears to decrease as the size and branching of the amino acid increases. This again

indicates that specificity is dictated by the ability of the SBP to bind solutes and not by the

membrane complex that can transfer a wide range of amino acids, as indicated by transport

101

via BraC. The kinetics and molecular structures of the two Bra SBPs will reveal more about

the constraints and determinants of solute specificity for each SBP.

3.2.3 Structural comparison of both Bra SBPs.

For interaction with the Bra membrane complex both SBPs must share significant

sites of homology that allow the SBP to associate with the integral membrane proteins. To a

lesser extent conservation among residues that form the backbone of the SBP would also be

expected, so as to allow the favourable energetics of structural change that enable domain

reorientation during ligand binding. However, changes to residues in the binding cleft,

formed by the two SBP domains, would be expected to differ between both Bra SBPs to

account for the broader transport profile of BraC.

For BraC and BraC3 cleavage of the signal peptide was predicted to occur between

residues AWA↓DV and AHA↓DI respectively. The putative signal peptide of BraC is 23

residues and typical of signal peptides in that it contains two basic amino acids at the N-

terminus, an alanine at the cleavage site and is predominantly, 65 %, hydrophobic (Emr et

al., 1980). The signal peptide of BraC3 is 22 residues and also predominantly (68 %)

hydrophobic, also has an alanine residue at the cleavage site, but does lack the two basic

amino acids commonly found at the N-terminus. Once the signal peptide has been cleaved

the mature BraC consists of 350 amino acids and has a predicted molecular weight of

36,510 Da, compared to the 345 amino acids and predicted molecular weight of 35,349 Da

for BraC3. The sequences aligned for the mature BraC and BraC3 show identity over the

total mature protein is 44.9 % (Figure 3.2.6.). Identity between mature SBPs can be divided

into thirds, the N-terminus third from Asp1 to Gln123 share 56.1 % identity, the middle

third from Ala124 to Gly226 share 47.8 % and the C-terminus third from Leu227 onwards

share 31.1 %. However, although homology can be divided into thirds over the polypeptide

this has no bearing on the assigning roles to each with regard to understanding the mature

folded protein. The two globular domains (I and II) of the SBP are linked by three segments

so that each domain is folded from two separate segments from both the N- and C- terminal

halves of the polypeptide chain (Sack et al., 1989).

102

Figure 3.2.6. ClustalW 1.83 alignment of R.leguminosarum BraC and BraC3, http://www.ebi.ac.uk/clustalw/. Removal of signal peptide had no effect on alignment of mature proteins. * = residues conserved by all, : = residues conserved according to type, i.e. polar, non- polar, aromatic, aliphatic etc, . = residues that are semi-conserved.

Of the 189 amino acids that differ between BraC and BraC3 96 constitute the

replacement of one amino acid for another of the same characteristics and do not lead to a

charge change. The charge does change at 52 of these 189 residues and the total number of

glutamate and aspartate residues relative to lysine and arginine is also dissimilar between

proteins. BraC has 43 acidic and 31 basic residues whereas BraC3 has 45 acidic and 34

basic residues. This slight difference is reflected in the theoretical pI of the mature proteins,

4.89 for BraC and 4.87 for BraC3 (http://www.expasy.ch/tools/pi_tool.html).

Two areas of significant homology exist between the polypeptide sequences of BraC

and BraC3. Residues Arg137 – Gln152 of BraC3 (Arg138 – Gln153 for BraC) on

comparison to the crystal structure of E. coli LivJ are predicted to form hinge region 1 of

the SBP (Figure 3.2.6.; Figure 3.2.8.). The hinge region allows the reorientation of the two

domains of the SBP on solute binding in order to bring together the residues necessary to

trap the ligand. To prevent closure in the absence of solute the hinge region is “spring

loaded” holding the protein open until binding of the ligand “pays” the energetic cost

(Wemmer, 2003). The hinge region 1 of a LIV-I binding protein has been demonstrated to

undergo the greatest conformational change on moving from an “open” to “closed” state of

solute binding (Trakhanov et al., 2005). Conservation of this hinge region 1 between BraC

103

and BraC3 may therefore be important for the energetics of solute binding or release.

However, the predicted hinge regions 2 and 3 of BraC (Gly271 – Asp273 and Iso350 –

Iso354 respectively) and BraC3 (Ala270 – Asp272 and Ser350 – Ser354 respectively) share

very little homology to each other. SBP affinity can also be affected by changes to the hinge

region, as changes in certain residues can affect the closure angle (Marvin and Hellinga,

2001). Of the residues that form the E. coli LivJ hinge regions those that undergo the most

conformational change are Asp123 and Phe329 (Trakhanov et al., 2005). Change in the

residue at the same position as Phe329 in E. coli MBP was also shown to affect the binding

affinity and angle of the “open” conformation of the SBP (Marvin and Hellinga, 2001).

Interestingly all three aliphatic specific binding proteins, BraC3, E. coli LivJ and P.

aeruginosa BraC, all share a conserved Phe residue at the equivalent position. However, in

BraC this Phe residue is substituted for Tyr. The consequences of this on affinity or solute

specificity of BraC however are unknown.

The second area of homology between BraC and BraC3 is between residues

Gly199 – Leu206 of BraC3 (Gly200 – Leu207 of BraC) (Figure 3.2.6.). Structural mapping

of this region to the elucidated crystal structure of the similar LIV-I SBP LivJ of E.coli

predicts these residues form an α-helix that is part of the outward face of Domain II of the

SBP. This region may be an area required for interaction of the SBP with the Bra membrane

complex as mutations in residues that align to the same area of ArgT from S. enterica

demonstrated an inability of the SBP to interact with the membrane complex (Higgins and

Ames, 1981). Similarly mutations in residues Asp166, Asp171 and Arg176 in HisJ of

S.typhimurium demonstrated no adverse effect on ligand binding but showed loss of amino

acid transport (Liu et al., 1999). A degree of identity or conservation of residues between

SBPs utilising the same transmembrane domain would be expected for interaction, as

substrate binding is a requirement for IMPs to initiate the transport cycle (Liu et al., 1999;

Higgins and Linton, 2004). Whilst as yet no SBP has been crystallised interacting with its

transmembrane domain the interaction of the E. coli BtuF SBP binding with its cognate

membrane permease BtuC has been modelled. It is proposed to occur through interactions

of two surface glutamate residues, Glu72 and Glu202, on the SBP with arginine residues on

the periplasmic side of the BtuCD transporter (Borths et al., 2002; Locher et al., 2002;

Locher, 2004). These residues are conserved amongst transporters that mediate iron and

vitamin B12 and are believed to bring about binding through formation of interprotein salt

bridges. Sequence alignment of ArgT, HisJ and BtuF with the E. coli LivJ, BraC and BraC3

does not highlight conservation of any of the residues shown to influence SBP interaction

from other transport systems. As aliphatic amino acids are highly hydrophobic it is likely

104

the SBP interacts closely with the inner leaflet of the membrane and so it would be expected

to differ from the binding of BtuF to its transmembrane domain. The future identification of

the residues required for the interaction of both Bra SBP with the membrane complex may

also explain any differences in the affinity of each SBP for the membrane complex, as there

is an observed increase of alanine uptake when braC is mutated.

As a SBP specific for aliphatic amino acids BraC3 would be expected to share

significant sites of homology to SBPs of similar specificity, such as the P. aeruginosa BraC

or E. coli LivJ. The crystal structure of E. coli LivJ in ligand-free and bound states revealed

how aliphatic amino acids are bound in by polar and non-polar interactions from specific

residues to become completely engulfed in the binding cleft between the two domains of the

“closed” state SBP (Trakhanov et al., 2005). Specifically hydrogen bonding and van der

Waal interactions hold the amino acid in the binding cleft of LivJ. There are eight hydrogen

bonds in total, 6 from domain I of the SBP and 2 from domain II, that are formed from five

residues Ser102, Ala123, Thr125, Tyr225 and Glu249. Hydrogen bonds form between the

α-ammonium group of liganded aliphatic amino acids and Ala123, Thr125 and Glu249.

Also hydrogen bonds form between the α-carboxylate group of liganded aliphatic amino

acids and Ser102, Ala123, Thr125 and Tyr225 (Magnusson et al., 2004; Trakhanov et al.,

2005). Non-polar interactions with the bound amino acid are greater in number and are

again predominantly made by residues in domain I of the SBP. Tyr41, Leu100, Cys101,

Ser102, Ala123, Ala124, Thr125, Tyr173, Tyr225, Glu249 and Phe299 all form van der

Waal interactions with the ligand. Of particular importance are the van der Waal

interactions from Tyr41, Leu100, Ala123, and Phe299 from domain I and Tyr225 from

domain II as they bind to the side chains of aliphatic amino acids to accommodate them in a

hydrophobic side pocket in the “closed” state of ligand binding (Trakhanov et al., 2005).

Mapping of these specific residues to the structure of the SBP highlights domain I as being

dominant in amino acid binding (Figure 3.2.7.). Despite the fact that Domain I is formed

from folded segments of both the N- and C- terminal ends of the polypeptide eight of the

eleven residues highlighted in determining specificity can be found in the first 150 residues

of the mature SBP. This is consistent with the fact that in chimeric SBPs residues that

function to dictate specificity are particularly found in the first 150 amino acids of the

mature N-terminus of the polypeptide (Higgins and Ames, 1981).

105

Figure 3.2.7. Swiss-Model of E. coli LivJ binding cleft between domains I and II of the SBP as determined by its crystal structure (Trackhanov et al., 2006). Red = Residues forming van der Waal interactions with ligand, Green = Residues forming both hydrogen bonds and van der Waal interactions with ligand.

All these residues map to areas in the binding cleft of the SBP formed by domains I

and II. Conservation of these residues in BraC3 and P. aeruginosa BraC may highlight

specific determinants for aliphatic amino acid specificity. Further changes, revealed by

sequence alignment, in these residues at comparable sites in BraC may also help to

determine some aspects of its broader solute specificity (Figure 3.2.8.).

106

Figure 3.2.8. ClustalW alignment of R.leguminosarum BraC3 and the neutral and aliphatic amino acid specific SBPs from other proteobacteria, http://www.ebi.ac.uk/clustalw/. Removal of signal peptide had no effect on alignment of mature proteins. * = residues conserved by all, : = residues conserved according to type, i.e. polar, non- polar, aromatic, aliphatic etc, . = residues that are semi-conserved.

Of the eight residues associated with forming hydrogen bonds between E. coli LivJ

and its ligand only two (Ser102, Thr125) are conserved between all four SBPs, whilst three

(Ser102, Thr125, Tyr225) are conserved amongst the aliphatic specific SBPs. Ser102 and

Thr125 form five of the eight hydrogen bonds, whilst Ser102, Thr125 and Tyr225 form six

of the eight hydrogen bonds. This does not appear to represent much of a significant change

that could explain the narrower solute range of the aliphatic amino acid SBPs compared to

BraC. However, all the E. coli LivJ associated hydrogen bonding residues that show

identity in BraC are found in domain I of the SBP.

107

Of the eleven residues that form van der Waal interactions with the ligand seven

(Tyr41, Ser102, Ala124, Thr125, Tyr173, Tyr225, Phe299) are conserved amongst the

aliphatic specific SBPs while four (Ser102, Ala124, Thr125, Tyr173) are conserved

amongst all SBPs. The difference is most notable in conservation of those residues

associated with accommodating the aliphatic side chains in a hydrophobic pocket on E. coli

LivJ ligand binding. Of these five residues three (Tyr41, Tyr225, Phe299) are conserved

between aliphatic specific SBPs whereas none are conserved in BraC. However, the

changes at these positions in BraC (Tyr41 → Phe40, Tyr225 → Leu224, Phe299 →

Tyr297) are semi-conserved so the formation of a hydrophobic pocket on ligand binding to

accommodate the side chains of aliphatic amino acids would still be expected. This is

reflected by the uptake rates for valine, isoleucine and leucine being the same for BraC as

BraC3 (Figure 3.2.6.).

Correlation of the sequence alignment with the binding affinities of each SBP, once

determined, may identify specific residues for site directed mutagenesis that may restrict the

binding profile of BraC to exclude aliphatic amino acids with larger side chains. By further

limiting the binding activities of BraC3 to strictly alanine it would be possible to

conclusively demonstrate that movement of alanine alone is the minimum requirement for

symbiotic nitrogen fixation.

3.2.4 Symbiotic phenotype of aap bra SBP mutants.

Glutamate, aspartate, glutamine, asparagine, alanine and GABA are the most rapidly

labelled amino acids in pea nodules and R. leguminosarum bacteroids following 15N

labelling (Scharff et al., 2003; Lodwig and Poole, Unpublished). Of these amino acids

RU1979 (aapJ- braC-) can only transport alanine and so this strain becomes crucial for

assessing amino acid cycling in the nodule. An aap bra mutant causes a breakdown in

amino acid cycling and the symbiotic phenotype on pea plants (Pisum sativum cv. Avola) is

distinct in that nodules contain fully developed bacteroids that cause a Fix reduced

phenotype. This Fix reduced phenotype is characterised by an increased number of root

nodules that are pink in colour unlike the observed red of Fix+ nodules and the white of Fix-.

Plants inoculated with aap bra mutants progressively yellow and show a significant

decrease in dry weight. However, whilst total nitrogenase activity per plant was 32-55 %

that of wild-type when it was expressed on a bacteroid protein basis the levels are the same

or even higher than wild-type (Lodwig et al., 2003).

To determine the symbiotic phenotype of the aap bra SBP mutations all strains were

inoculated onto surface sterilised pea seeds sown into 2 litre pots.

108

Figure 3.2.9. Symbiotic phenotype of aap bra mutants reveals transport by BraC3 is sufficient for effective nitrogen fixation. A = Water control, B = 3841 (Wild-type), C = RU1978 (aapJ-), D = RU2267 (aapJ- braEF-), E = RU1979 (aapJ- braC-), F = RU1722 (aapJQM- braEF-).

Uninoculated plants (Figure 3.2.9., Plant A) did not become nodulated, were yellow

and severely reduced in plant growth due to nitrogen deficiency. Plants nodulated by strain

RU1978 (aapJ-) (Figure 3.2.9., Plant C) appeared healthy and showed no sign of nitrogen

deficiency. Uptake rates for a broad range of amino acids by this strain remain between 40-

70 % that of 3841 (Wild-type), suggesting this is sufficient for establishing the amino acid

cycling that is essential for effective nitrogen fixation. Mutation of the Bra membrane

complex in this strain, RU2267 (aapJ- braEF-), reduced amino acid uptake to that shown by

RU1722 (aapJQM- braEF-), which was proposed to abolish amino acid cycling and display

a Fix reduced plant phenotype (Lodwig et al., 2003). Plants inoculated with these strains

(Figure 3.2.9., Plant D; Figure 3.2.9., Plant F) appeared nitrogen deficient and nodules

characteristically Fix reduced, being increased in number and pink in colour. However,

whilst mutation of the Bra membrane complex gave plants displaying a Fix reduced

phenotype, plants nodulated by strain RU1979 (aapJ- braC-) appeared healthy and showed

no sign of nitrogen deficiency (Figure 3.2.9., Plant E). The amino acid uptake profile of

strains RU1979 (aapJ- braC-) and RU2267 (aapJ- braEF-) suggests that aliphatic amino

acid transport, via interaction of BraC3 and the Bra membrane complex, is the minimum

determinant for amino acid cycling and establishing effective nitrogen fixation.

A B C D E F

109

Figure 3.2.10. Triple mutation of SBPs required for amino acid transport by free-living cells leads to a loss of effective nitrogen fixation. A = Water control, B = 3841 (Wild-type), C = RU1979 (aapJ- braC-), D = RU2281 (aapJ- braC- braC3-).

Plants nodulated by strain RU2281 (aapJ- braC- braC3-) (Figure 3.2.10., Plant D)

appeared nitrogen deficient and nodules were small and pink in colour. The difference in

amino acid uptake between RU1979 (aapJ- braC-) and RU2281 (aapJ- braC- braC3-) is the

transport of aliphatic amino acids, particularly alanine, by the former. Mutation in braC3

abolishes this aliphatic amino acid uptake to a level the same as that for RU2267 (aapJ-

braEF-), a mutant in the Bra membrane complex, and conveys the same Fix reduced

phenotype on plants. This indicates amino acid transport via BraC3 as the cause of the Fix+

phenotype of plants inoculated with RU1979 (aapJ- braC-). The amino acid uptake rates by

strain RU2395 (aapJ- braC3-) were not significantly altered from RU1978 (aapJ-) so a

functional amino acid cycle would be expected to operate between plant and bacteroids.

Plants nodulated by strain RU2395 (aapJ- braC3-) were healthy with red nodules and Fix+

(data not shown). This demonstrates that it is the abolition of aliphatic amino acid transport

in RU2281 (aapJ- braC- braC3-), compared to RU1979 (aapJ- braC-), that gives rise to the

Fix reduced phenotype of plants, and not an effect of mutation in braC3.

The Fix phenotype of plants inoculated by each strain was confirmed by the plant

dry weights (Table 3.2.3.).

A B C D

110

Strain Dry Weight (g) SEM p Value (vs 3841)

Water control 0.46 0.02 1.32 x 10-10

3841 (Wild-type) 1.28 0.07 N/A RU1978 (aapJ-) 1.11 0.05 0.07 RU2267 (aapJ- braEF-) 0.66 0.03 1.64 x 10-8 RU1979 (aapJ- braC-) 1.21 0.05 0.39 RU1722 (aapJQM- braEF-) 0.57 0.03 1.19 x 10-9

RU2395 (aapJ- braC3-) 1.14 0.05 0.12 RU2281 (aapJ- braC- braC3-) 0.67 0.04 2.23 x 10-8

Table 3.2.3. Plant dry weights for all aap bra mutant strains, wild-type and water controls. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance.

The reduction in mean dry weight of plants nodulated by RU2281 (aapJ- braC-

braC3-) represents a 48 % loss relative to plants inoculated by 3841 (Wild-type). The mean

dry weight is comparable to that observed for plants nodulated by RU2267 (aapJ- braEF-)

and RU1722 (aapJQM- braEF-), where amino acid transport has also been abolished by the

two general amino acid transporters Aap and Bra. However, the difference in the mean dry

weight of plants nodulted by RU2281 (aapJ- braC- braC3-), RU2267 (aapJ- braEF-) and

RU1722 (aapJQM- braEF-) is statistically significant from the mean dry weight of

uninoculated plants, p values of 1.14 x 10-4, 3.69 x 105 and 0.01 respectively. This

represents a Fix reduced phenotype of plants inoculated by these strains, as opposed to a

Fix- phenotype. The mean dry weight of plants nodulated by strain RU1979 (aapJ- braC-)

do not represent a significant statistical difference from the mean dry weight of plants

nodulated by 3841 (Wild-type). This is again comparable to strains RU1978 (aapJ-) and

RU2395 (aapJ- braC3-), which also display aliphatic amino acid uptake.

11

1

A

B

Figu

re 3

.2.1

1. L

ight

mic

rogr

aphs

of i

nfec

ted

nodu

les s

tain

ed fo

r sta

rch.

A =

384

1 (W

ild-ty

pe),

B =

RU22

81 (a

apJ- b

raC

- bra

C3- )

11

2

A

B

Figu

re 3

.2.1

2. L

ight

mic

rogr

aphs

of i

nfec

ted

nodu

les s

tain

ed fo

r sta

rch.

A =

384

1 (W

ild-ty

pe),

B =

RU22

81 (a

apJ- b

raC

- bra

C3- )

113

A B

Figure 3.2.13. Electron micrographs of infected plant cells. A = 3841 (Wild-type), B = RU2281 (aapJ- braC- braC3-).

The comparison of light micrographs from plants inoculated either by 3841 (Wild-

type) or RU2281 (aapJ- braC- braC3-) show a large accumulation of plant starch (dark

granular areas) in the nodular cortex of RU2281 (aapJ- braC- braC3-) infected nodules

(Figure 3.2.12.). This is consistent with the fact that the lowered nitrogen fixation rates

correspond to a lowered carbon demand on the plant. Therefore the hydrolysed products of

sucrose metabolism are instead used for starch biosynthesis, rather than being further

metabolised by glycolytic enzymes to enter the TCA cycle as PEP to produce dicarboxylic

acids that are supplied to bacteroids to fuel nitrogen fixation. The electron micrographs of

the nodule sections of plants inoculated by RU2281 (aapJ- braC- braC3-) show fully

developed bacteroids containing an abundance of electron transparent PHB granules, which

are absent in 3841 (Wild-type) and characteristic of the Fix reduced phenotype. (Figure

3.2.13.) It was proposed that these granules result from inefficient use of dicarboxylates by

bacteroids, as oxaloacetate cannot be converted to aspartate because of a breakdown in

amino acid cycling (Lodwig et al., 2003). On comparison with the electron micrograph of

nodules infected by 3841 (Wild-type) the only PHB granules visible in bacteroids are in the

cells being released from the nodule infection threads (IT).

Comparison of the amino acid uptake rates and symbiotic phenotype of strains

RU1979 (aapJ- braC-) and RU2281 (aapJ- braC- braC3-) demonstrates the minimum

requirement for effective amino acid cycling, between the plant and bacteroid, is transport

of aliphatic amino acids. Of these aliphatic amino acids alanine predominates in bacteroids

PHB

PHB IT

2 microns 2 microns

114

and nodules so can be proposed to act either as the donor amino acid for cycling or as an

essential secondary secretion product of symbiotic nitrogen fixation.

3.2.5 Complementation of aap bra mutation with P.aeruginosa Bra.

As demonstrated earlier the movement of aliphatic amino acids, such as alanine, via

either the Aap or Bra forms part of an amino acid cycle between plant and bacteroid.

Mutation in both aap and bra leads to a breakdown in this aliphatic amino acid movement

and effective nitrogen fixation. The loss of amino acid transport in these strains does

however provide the possibility of exploring the amino acids involved in cycling through

complementation with amino acid transporters that are specific in nature. The transport

specificity of the P. aeruginosa Bra is for neutral and aliphatic amino acids, including

leucine, valine, isoleucine, alanine, threonine and possibly serine. (Hoshino and Kose,

1990). Successful complementation using this transporter to restore a Fix+ plant phenotype

would reinforce the role of alanine transport being the minimum requirement for amino acid

cycling.

Two plasmids pUBR8 and pKTH24 were previously obtained and the braCDEFG

cloned as a 5.3kb SstI / KpnI fragment into pIJ1891 (pRU728) (Hoshino and Kose, 1990;

Hosie and Poole, Unpublished). As pRU728 (pIJ1891 x pa_braCDEFG) is tetr the plasmid

was conjugated into strain RU1357 (aapJQM- braE-), a R. leguminosarum bv. viciae A34

derivative (RU1833). This switch in strain was due to the tetr interposon in the R.

leguminosarum bv. viciae 3841 derivative RU1722 (aapJQM- braEF-). Transport assays for

glutamate, aspartate, alanine, AIB, leucine, histidine (25 µM 0.125 µCi 14C) and GABA (25

µM 0.125 µCi 3H) were carried out to determine the expression and transport specificity of

this transport complex in RU1833 (aapJQM- braEF- x pRU728) (Figure 3.2.15.). The

transport specificity will be discussed later. On plasmid pRU728 (pIJ11891 x

pa_braCDEFG) expression of the P.aeruginosa braCDEFG is under control of the lac

promoter. To guarantee expression in bacteroids an overlap PCR approach was adopted to

clone the aap promoter and ribosome-binding site to the first ATG of the P. aeruginosa

braC. “Gene splicing” by overlap extension allows the recombination of DNA molecules at

precise junctions without the use of restriction sites (Horton et al., 1988). Primers are

designed so that the ends of the two PCR products contain complementary sequences. When

PCR products are mixed, denatured and reannealed the strands act as primers for each other,

having matching sequences at their 3’ ends. Extension by DNA polymerase over this

overlap produces a molecule where the original sequences are spliced together (Figure

3.2.14.).

115

Figure 3.2.14. Mechanism of overlap PCR. Grey = R.leguminosarum aap promoter and ribosome binding site, Black = P.aeruginosa braC.

Due to the size of the P. aeruginosa bra operon it was decided to use overlap PCR

to clone the aap promoter to a fragment of braC. Primers p500 and p543 were used to

amplify the aap promoter region until the first ATG of aapJ from pRU1134 (pJP2 x

aapJQMP). Primers p544 and p634 were used to amplify the P.aeruginosa braC from the

first ATG from pRU728 (pIJ1891 x pa_braCDEFG). PCR was carried out using Pfu Turbo,

a blunt ended DNA polymerase, to ensure high fidelity and prevent capping of the PCR

products. The PCR products were mixed and gradient PCR performed with Pfu Turbo, with

annealing temperatures ranging from 56 – 60oC. Products were visualised on a 1.5 %

agarose gel as bands of 900 bp and recovered using Qiagen’s gel extraction kit before being

cloned into pCR-BluntII-TOPO (pRU1610). The entire P. aeruginosa bra operon from

pRU728 (pIJ1891 x pa_braCEDFG) was cloned into pJP2 as a 6kb SacI / XbaI fragment.

p500

p543

p544

p634

Initial PCR Reactions

Overlap PCR

p634

p500

ATGNn

TACNn

116

This plasmid was then HindIII / AgeI digested to remove the original promoter and start site

of P. aeruginosa braC and was replaced by ligation of the similarly digested product from

pRU1610 (pCR-BluntII-TOPO x pa_braC under the aap promoter). This plasmid was

sequenced using p634 to confirm the correct cloning and reconstitution of pa_braCDEFG

operon under control of the aap promoter.

CCGTGATAATCGAAGGGGTCGTTGCCGATATGGGTCAGGCGGGTGTTGATGCCGGCATTT

TGCAGCAAGCTGTCTTTGTCTTTCATGTCGGGAATAGCCTTTGGCGAAGGGTCGCGAAACC

AGACTTTTGGACGCCCCGCCGTTTCCGGTCAACCCCTTGAAGATCGGTTGAGGCGACGATC

CGAAATCATGGAAATTTCGATTTTCGCGTTATTTTTCCGCAACCGGACGCCTATTTCCTAGT

CAACCGCCCATGAATGCAGCGCTATCTGCCAAAATGTTGCATTTCGCCGCAATTATTGGGC

GTGACACTTGACCATAGTGACATTTGCGACTGTGATAGGGTCACTCGCGCCGGGAGGGTG

TCGAGACAATGGGGAGGCGGCACGGATTGTCGGCACGCACTCCCCACAAGAAAAGATAAG

ACAACGGAAAAGGTTGGGAAAATGAAGAAGGGTACTCAGCGTCTATCCCGCCTGTTCGCCGCG

ATGGCCATTGCCGGGTTCGCCAGCTACTCCATGGCCGCCGACACCATCAAGATCGCCCTGGCTGG

CCCGGTCACCGGTCCGGTAGCCCAGTACGGCGACATGCAGCGCGCCGGTGCGCTGATGGCAATC

GAACAGATCAACAAGGCAGGCGGCGTGAACGGCGCGCAACTCGAAGGCGTGATCTACGACGAC

GCCTGCGATCCCAAGCAGGCCGTGGCGGTCGCCAACAAGGTGGTCAACGACGGCGTCAAGTTCG

TGGTCGGTCATGTCTGCTCCAGCTCCACCCAACCCGCCACCGACATCTACGAAGACGAAGGCGT

GCTGATGATCACCCCGTCGGCCACCGCCCCGGAAATCACCTCGCGCGGCTACAAGCTGATCTTCC

GCACCATCGGCCT

Table 3.2.4. Sequencing of pRU1622. Bold = aap promoter and ribosome binding site sequence, Normal text = pa_braC sequence, Italic / underline = AgeI used in cloning to reconstitute pabra.

This correct clone was stocked (pRU1622). Following conjugation into strain

RU1357 (aapJQM- braE-) (RU2306) transport assays for glutamate, aspartate, alanine, AIB,

leucine, histidine (25 µM 0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) were carried

out to determine the expression and transport specificity of this transport complex in R.

leguminosarum (Figure 3.2.15.).

117

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB Leu His GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

5

10

15

20

25

30RU1357 (aapJQM- braE-)RU1833 (aapJQM- braE- x pRU728)RU2306 (aapJQM- braE- x pRU1622)

Figure 3.2.15. Transport phenotype of P. aerugionsa Bra to complement amino acid uptake in an A34 aap bra mutant. Cells grown overnight in AMS (10mM glc 10mM NH4). Number of replicates is n = ≥ 3 with standard error values.

The amino acid uptake rates by strains RU1833 (aapJQM- braE- x pRU728) and

RU2306 (aapJQM- braE- x pRU1622) indicate expression of the P.aeruginosa bra in

R.leguminosarum and complementation of amino acid uptake in strain RU1357 (aapJQM-

braE-). The specificity of the transport system in R. leguminosarum is restricted to uptake of

the aliphatic amino acids alanine and leucine, as reported in P. aeruginosa (Hoshino and

Kose, 1990). Uptake of valine and isoleucine would also be expected by strains RU1833

(aapJQM- braE- x pRU728) and RU2306 (aapJQM- braE- x pRU1622) but was not

measured.

Expression of the P. aeruginosa braCDEFG appears stronger when under the

control of the aap rather than lac promoter as the rate of uptake is slightly elevated in strain

RU2306 (aapJQM- braE- x pRU1622). As the aap promoter is native to R. leguminosarum,

and known to express in bacteroids, strain RU2306 (aapJQM- braE- x pRU1622) was

inoculated onto surface sterilised peas seeds sown into 2 litre pots.

118

Figure 3.2.16. Complementation of aap bra mutation in A34 aap bra mutants using the P. aeruginosa Bra. A = Water control, B = A34 (Wild-type), C = RU1357 (aapJQM- braE-), D = RU2306 (aapJQM- braE- x pRU1622).

Plants inoculated by strain RU2306 (aapJQM- braE- x pRU1622) (Figure 3.2.16.,

Plant D) appeared healthy with red nodules after six weeks growth. By comparison plants

nodulated by strain RU1357 (aapJQM- braE-) were nitrogen deficient with pink nodules,

again showing that mutation in aap bra gives a Fix reduced phenotype. This demonstrates

successful complementation of the aap bra double mutation by an aliphatic specific

transport system. It again confirms that most likely alanine movement in the bacteroid is the

minimum requirement for amino acid cycling, via Aap Bra, and symbiotic nitrogen fixation.

However, plants inoculated with RU2306 (aapJQM- braE- x pRU1622), while Fix+, did

show a noticeable reduction in plant size over the whole experiment compared to those

inoculated with A34 (Wild-type). Dry weights of plants were determined to see if this

change was statistically significant (Table 3.2.5.).

A B C D

119

Strain Dry Weight (g) SEM p Value (vs A34)

Water control 0.50 0.02 1.37 x10-13

A34 (Wild-type) 1.85 0.08 N/A RU1357 (aapJQM- braE-) 0.62 0.03 3.16 x10-13

RU2306 (aapJQM- braE- x pRU1622) 1.37 0.09 1.77 x10-4

Table 3.2.5. Plant dry weights to determine the extent of the plant Fix+ phenotype of an aap bra mutant complemented by P. aeruginosa Bra. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance.

Plants inoculated with RU2306 (aapJQM- braE- x pRU1622) showed a significant

25 % decrease in total shoot dry weight compared to A34 (Wild-type). These plants,

however, still had a 220 % greater total shoot dry weight than those inoculated with strain

RU1357 (aapJQM- braE-). The reason for this reduction in dry weight may in part be due to

inefficient transport via the P. aeruginosa Bra in bacteroids. Amino acid transport by the P.

aeruginosa Bra appears to be sufficient to confer a Fix+ phenotype but is at a reduced

capacity to that by A34 (Wild-type) explaining the difference in dry weight. As this

transport system is from another proteobacterium the codon usage or integration of the IMP

whilst efficient in free-living cells may differ for bacteroids. The reduction in total shoot dry

weight is therefore likely a consequence of limited alanine being supplied to the plant to

enable asparagine biosynthesis.

3.2.6 Mutation in genes encoding alanine catabolic enzymes.

The establishment of aliphatic amino acid movement, most likely alanine, between

plant and bacteroid as being essential for symbiotic nitrogen fixation does not indicate if

transport via Aap Bra is required for uptake or secretion. ABC transport systems,

particularly the Aap, are reported to be bi-directional supporting high affinity uptake and

low affinity efflux (Hosie et al., 2001; Balakrishnan et al., 2004). The Km for AIB uptake by

the Aap is 807 nM while for efflux it is 10.8 nM. However, the Vmax for AIB uptake and

efflux are almost identical (Hosie and Poole, 2001). The intracellular amino acid

concentrations at which the Aap supports efflux are physiologically relevant, for example

the steady state level of glutamate in R. leguminosaurm is 4 mM (Walshaw et al., 1997b).

Therefore intracellular amino acid concentrations can quickly be reached where efflux will

equal the rate of uptake. Alanine secretion by isolated bacteroids is well documented and

any alanine uptake would be expected linked to catabolism (Appels and Haacker, 1991;

Waters et al., 1998; Allaway et al., 2000). The dad operon is present in a wide range of

120

bacteria and represents the principal route of alanine catabolism in R. leguminosarum, as

mutation results in a loss of growth on alanine (Wild and Klopotowski, 1981; Allaway et

al., 2000). DadX, an alanine racemase, first converts L-alanine to D-alanine before being

oxidised to pyruvate by DadA, a membrane linked D-alanine dehydrogenase. Alanine

catabolism can also occur via the over-expression of the soluble NAD+ linked L-alanine

dehydrogenase, AldA, that can compensate for the loss of growth by a dad mutation

(Allaway et al., 2000) (Figure 3.2.17.). However, the regulation and kinetics of alanine

dehydrogenase overwhelmingly favour alanine formation (Smith and Emerich, 1993;

Allaway et al., 2000; Lodwig et al., 2004).

121

DadA

NAD +

NADH + H +

H2 O NH4 +

DadX

Pyruvate L-Alanine

COOH COOH

C O H C NH

CH3 CH3

AldA

NADH + H+ NA D+

NH4+ H2O

D-Alanine

CH3

NH2 C H

COOH

DadA

NAD +

NADH + H +

H2 O NH4 +

DadX

Pyruvate L-Alanine

COOH COOH

C O H C NH

CH3 CH3

AldA

NADH + H+ NA D+

NH4+ H2O

D-Alanine

CH3

NH2 C H

COOH

D-Alanine

CH3

NH2 C H

COOH

Figure 3.2.17. Alanine metabolism in R. leguminosarum.

Transamination of other keto-acids using alanine as the donating amino acid does

not appear to occur in R.leguminosarum, as double mutation in ald dad abolishes all growth

on 20 mM alanine AMA. Transamination of oxaloacetate using alanine as the donor amino

acid is possible in vitro with purified AatA, although at concentrations not physiologically

relevant for free-living cells or bacteroids (Bourdés and Poole, Unpublished). When grown

on alanine as sole carbon and nitrogen source amino acid biosynthesis occurs through action

of GS / GOGAT. Mutation of GOGAT abolishes growth on alanine demonstrating that cells

reassimilate the NH3 liberated on oxidisation of alanine to pyruvate (Section 4.). As alanine

catabolism can occur by either Dad or AldA it was decided that single and double mutants

would be created in RU1979 (aapJ- braC-) to determine if the Fix+ phenotype was a result

of alanine uptake coupled to catabolism.

A 2.3 kb region including aldA was amplified by PCR using primers p733 and p734

and cloned into pCR®-4-TOPO (pRU1728). A 450bp region of aldA was then deleted by

digestion with the blunt-end restriction enzyme EcoRV and the omega tetr cassette cloned

into its place as a blunt-ended SmaI restriction enzyme fragment (pRU1735). The whole

region containing the deleted aldA omega tetr cassette was then cloned into the suicide

vector pJQ200SK- as a 4.6 kb XbaI fragment (pRU1777). This plasmid was then conjugated

into RU1979 (aapJ- braC-) for sucrose selection on 10 % sucrose 10 mM NH4+ AMA

against the vector and retention of tetr to force direct gene replacement. Four colonies were

obtained and PCR screened for correct mutation using primers pOT For and either p837 or

122

p838, which are set back on the chromosome from the primers used in the initial

amplification. As all strains PCR screened to give fragments indicating correct gene

replacement one colony was purified and stocked as RU2481 (aapJ- braC- aldA-).

123

4571 bp

aldARL1967

RL1965RL1964EcoRV (2185)

EcoRV (2623)p837 (100.0%)

p838 (100.0%)

p733 (83.3%)p734 (83.3%)

4571 bp

aldARL1967

RL1965RL1964EcoRV (2185)

EcoRV (2623)p837 (100.0%)

p838 (100.0%)

p733 (83.3%)p734 (83.3%)

Figure 3.2.18. The ald operon of R. leguminosarum. Marked are the sites used for PCR screening and amplification and also chromosomal screening for correct integration. The EcoRV sites used in the deletion of aldA and the blunt end cloning of the omega tetr cassette are also shown.

To further confirm the correct mutation in aldA, strain RU2481 (aapJ- braC- aldA-)

was assayed for alanine dehydrogenase activity relative to 3841 (Wild-type). The rate of

AldA activity for RU2481 (aldA-) grown in 20mM alanine AMS was 0.004 µmol-1 mg-1

protein min-1 compared to 1.365 µmol-1 mg-1 protein min-1 for 3841 (Wild-type). The rate of

activity by RU1327 (aldA-), a previously identified Tn5 mutant, was 0.009 µmol-1 mg-1

protein min-1, confirming mutation in aldA in strain RU2481 (aapJ- braC- aldA-).

Double ald dad mutants were produced by transducing the dadR::Tn5 from strain

RU1275 (dadR-) into RU1979 (aapJ- braC-) and RU2481 (aapJ- braC- aldA-) by general

transduction using the bacteriopahge RL38 (Beringer et al., 1978; Buchanan-Wollaston,

1979). The recipient strains were plated onto TY kan (80 µg-1 ml-1) plates to select for the

presence of the Tn5 transposon. In all 9 transductants for each of the parent strains, RU1979

(aapJ- braC-) and RU2481 (aapJ- braC- aldA-), were isolated and the growth phenotype on

20mM alanine AMA was determined to identify correct insertion. One transductant

produced from each parent strain was stocked for RU1979 (aapJ- braC-) and RU2481

(aapJ- braC- aldA-) (RU2487, RU2488 respectively).

An interesting growth phenotype observed during isolation of dadR::Tn5

transductants was that strain RU2487 (aapJ- braC- dadR-) was still capable of growth on

20mM alanine AMA compared to RU1275 (dadR-). Growth of RU2487 (aapJ- braC- dadR-)

was still significantly slower than that observed for its parent strain RU1979 (aapJ- braC-),

but colonies still formed on average after 5 – 7 days. This residual growth was abolished in

strain RU2488 (aapJ- braC- aldA- dadR-) indicating that growth was due to alanine

catabolism via AldA. The transport rate of alanine for RU1275 (dadR-) is higher than

RU2487 (aapJ- braC- dadR-), as transport occurs via both Aap and Bra, so it is likely an

effect of the narrower transport range of RU2487 (aapJ- braC- dadR-) rather than a rate

determined effect.

124

To determine the symbiotic phenotype of the single and double ald dad mutations

all strains were inoculated onto surface sterilised peas seeds sown into 2 litre pots.

125

Figure 3.2.19. Mutation of the alanine catabolic enzymes in a strain capable of only aliphatic amino acid transport has no effect of symbiotic plant phenotype. A = Water control, B = RU1979 (aapJ- braC-), C = RU2487 (aapJ- braC- aldA-), D = RU2481 (aapJ- braC- dadR-), E = RU2488 (aapJ- braC- aldA- dadR-).

Mutation in ald dad, either separately or in concert, has no effect on the symbiotic

plant phenotype (Figure 3.2.19.). Plants nodulated by all strains were healthy with red

nodules indicating a Fix+ phenotype and an adequate supply of fixed nitrogen for the plant.

The plant dry weights confirm the visible phenotype that all strains are effective for

nitrogen fixation (Table 3.2.6.).

Strain Dry Weight (g) SEM p Value (vs RU1979)

Water control 0.54 0.03 4.82 x10-9

RU1979 (aapJ- braC-) 1.44 0.09 N/A RU2487 (aapJ- braC- aldA-) 1.3 0.06 0.22 RU2481 (aapJ- braC- dadR-) 1.41 0.1 0.84 RU2488 (aapJ- braC- aldA- dadR-) 1.33 0.07 0.34

Table 3.2.6. Plant dry weights to confirm the Fix+ phenotype of strains mutated for the alanine catabolic enzymes. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance.

If alanine were being transported into the bacteroid for catabolism as part of an

amino acid cycle then double mutation in ald dad would be expected to lead to a Fix

reduced phenotype. Alanine has not been demonstrated to act as a donor amino acid for

transamination indicating any alanine being transported into bacteroids would be effectively

inert in an ald dad double mutant, as it couldn’t be metabolised. This points to the role of

alanine as being an essential secretion product via Aap Bra for symbiotic nitrogen fixation.

A B C D E

126

3.2.7. Regulation of Aap and Bra in response to intracellular amino acid concentrations.

The plant phenotype of a strain with a triple mutation in aapJ braC and braC3 and

also that of a strain with a double mutation in aldA and dadR indicate that alanine export via

Aap and Bra is essential for effective symbiotic nitrogen fixation. As Aap and Bra are bi-

directional it raises the question why not use a dedicated export system to prevent

reaccumulation of the secreted alanine? It may be that uptake by bacteroids of another

amino acid, which has higher affinity for uptake via Aap and Bra, occurs to prevent the

reaccumulation of the secreted alanine. However, restriction of the uptake solute specificity

to aliphatic amino acids, by double mutation in aapJ and braC, would abolish the inhibitory

effect of another amino acid causing alanine secretion and reaccumulation to become a

futile cycle, contradictory to the demonstration that bacteroid alanine secretion is essential.

Alternatively there may be an unidentified molecular mechanism that regulates the import /

efflux equilibrium of the transporter shifting it towards a state preferable for amino acid

secretion. Growth of R. leguminosarum in 10 mM glucose 10 mM aspartate AMS lead to an

inhibition of aspartate uptake and also glutamate secretion, which was reduced by 76 % on

mutation in aap (Reid et al., 1996; Walshaw et al., 1996). This effect was not accompanied

by a reduction in the rate of aapJ transcription indicating there is a post-transcriptional

effect on Aap that leads to an inhibition of uptake and also allows amino acid secretion via

this permease. Aspartate, as well as being a solute for Aap and Bra, is also transported by

the Dct (Reid et al., 1996). It was therefore proposed that unregulated aspartate

accumulation lead to a high intracellular amino acid concentration, as indicated by a low

level of glnII expression when grown in 10 mM glucose 10 mM aspartate AMS.

Transcription of glnII is nitrogen regulated in R. leguminosarum and NtrC acts as a

positively regulator for expression in response to nitrogen-limitation (Morett et al., 1985;

Patriarca et al., 1992). The kinetics of transport via the Aap and Bra indicate that these

permeases can facilitate amino acid efflux under such conditions of high intracellular amino

acid concentration. The Km for AIB import and efflux via Aap is 807 ± 383 nM and 10.75 ±

4.79 mM respectively and for Bra 95 ± 56 nM and 12.12 ± 8.39 mM respectively (Hosie et

al., 2001). The intracellular concentration of glutamate was 4 mM in R. leguminosarum

grown in 10 mM glucose 10 mM NH4+ AMS, indicating physiologically relevant

concentrations of amino acids can be reached for export to occur (Walshaw et al., 1997b).

By understanding any such regulation in free-living cultures we can better understand the

regulation of Aap and Bra required in bacteroids for amino acid secretion.

127

Reid et al., 1996 characterised the post-transcriptional effect of uptake inhibition

prior to the identification of the Bra permease, a second broad range amino acid transporter

(Hosie et al., 2002a). To determine if this effect was specific to the Aap, or was general in

respect to both amino acid transporters, uptake assays were performed on strains mutated in

either aap or bra using the non-metabolizable amino acid analogue AIB, which is specific

for uptake via these permeases (25 µM 0.125 µCi 14C) (Figure.3.2.20.).

128

Strain

3841 RU1099 RU1721 RU1722

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

2

4

6

8

10

12

14

16

1810 mM Glucose 10 mM NH4

+

10 mM Glucose 10 mM Aspartate

Figure 3.2.20. 14C AIB uptake by Aap and Bra mutant strains grown either in 10 mM glucose 10 mM NH4

+ or 10 mM glucose 10 mM aspartate. Cells grown overnight in 60 ml AMS. Number of replicates is n = ≥ 3 with standard error values. 3841 = Wild-type, RU1099 = aapJQM-, RU1721 = braEF-, RU1722 = aapJQM- braEF-.

Strain 3841 (Wild-type) showed an approximate 50 % reduction in the rate of uptake

when grown in 10 mM glucose 10 mM aspartate AMS, similar to that previously reported

for A34 by Reid et al., 1996. Strains RU1099 (aapJQM-) and RU1721 (braEF-) also

showed a reduction in the rate of uptake when grown in 10 mM glucose 10 mM aspartate

AMS, indicating it is an inhibitory effect on uptake by both Aap and Bra. All uptake was

lost for strain RU1722 (aapJQM- braEF-), indicating that Aap and Bra are the only

transporters of AIB.

In addition to uptake via Aap and Bra, alanine (like aspartate) is also taken into cells

via another secondary transport system (Mct) (Hosie et al., 2002b). To determine if this

effect is specific to aspartate accumulation, cells were grown either in 10 mM glucose 10

mM NH4+ AMS or 20 mM alanine AMS and AIB uptake assays performed (25 µM 0.125

µCi 14C) (Figure 3.2.21.).

129

Strain

3841 RU1099 RU1721 RU1722

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

5

10

15

2010 mM Glucose 10 mM NH4

+

20 mM Alanine

Figure 3.2.21. 14C AIB uptake by Aap and Bra mutant strains grown either in 10 mM glucose 10 mM NH4

+ or 20 mM alanine. Cells grown overnight in 60 ml AMS. Number of replicates is n = ≥ 3 with standard error values. 3841 = Wild-type, RU1099 = aapJQM-, RU1721 = braEF-, RU1722 = aapJQM- braEF-.

Strain 3841 (Wild-type) again showed an approximate halving in the rate of AIB

uptake when grown in 20 mM alanine AMS. Similarly this was shown in both RU1099

(aapJQM-) and RU1721 (braEF-), whilst transport was also abolished in the double mutant

RU1722 (aapJQM- braEF-). This demonstrates that the intracellular accumulation of amino

acids, not just aspartate, via another transport system inhibits uptake via both Aap and Bra.

Mutation in dctA abolished this unregulated transport of aspartate into cells and also

derepressed uptake via Aap Bra. To determine if the inhibition of uptake via Aap and Bra

by alanine could be alleviated in a similar manner Hosie and Poole, unpublished assayed

AIB uptake for strains mutated in mctP, after growth in 20 mM alanine AMS versus 10 mM

glucose 10 mM NH4+ AMS (25 µM 0.125 µCi 14C) (Figure 3.2.22.).

130

Strain

3841 RU1180 RU1469 RU1793 RU1723

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

10

20

30

40

5010 mM Glucose 10 mM NH4

+

20 mM Alanine

Figure 3.2.22. 14C AIB uptake by Aap and Bra mutant strains grown either in 10 mM glucose 10 mM NH4

+ or 20 mM alanine (Hosie and Poole, Unpublished). Cells grown overnight in 60 ml AMS. Number of replicates is n = ≥ 3 with standard error values. 3841 = Wild-type, RU1180 = mctP-, RU1469 = aapJQM- mctP-, RU1793 = braEF- mctP-

, RU1723 = aapJQM- braEF- mctP-.

Uptake by 3841 (Wild-type) was again inhibited when grown in 20 mM alanine,

however uptake by strain RU1180 (mctP-) was derepressed by mutation in mctP. Uptake in

RU1180 (mctP-) was instead increased over the rate of uptake when grown in 10 mM

glucose 10 mM NH4+ AMS, similar to how uptake via Aap and Bra is increased when

grown in nitrogen-limiting conditions such as10 mM glucose 10 mM glutamate AMS

(Walshaw et al., 1997c). This indicates that the high intracellular alanine concentration is

abolished by mutation in its secondary transporter (Mct) and is similar to how the effects of

high intracellular aspartate concentration are alleviated by mutation in its secondary

transporter (Dct). Strains RU1469 (aapJQM- mctP-) and RU1793 (braEF- mctP-) both

showed an increase in the rate of uptake for growth in 20 mM alanine, demonstrating that

the inhibition of uptake was alleviated for both Aap and Bra by mutation in mctP.

The inhibition of uptake by growth in 10 mM glucose 10 mM aspartate AMS was

not accompanied by a decrease in the transcription of aapJ (Reid et al., 1996). To determine

if the intracellular levels of alanine have any regulatory effect on the transcription of aap

131

the reporter fusion pRU3028 (pRU3024 aapJ::TnlacZ) was conjugated into RU1180 (mctP-

) (RU1493). For the first time the effect of the intracellular concentrations of aspartate and

alanine on the transcription of bra was also determined. The reporter fusion pRU3158

(pIJ1427 braC::TnlacZ) was conjugated into 3841 (Wild-type), RU714 (dctA-) and RU1180

(mctP-) (RU1492, RU2286, RU1494 respectively). Cells were grown overnight in 10 ml

AMS, containing appropriate carbon and nitrogen sources, and the β-galactosidase activity

determined accordingly for each strain (Table 3.2.7.; Table 3.2.8.).

Strain 10 mM Glucose 10 mM NH4

+ 10 mM Glucose

10 mM Aspartate 20 mM Alanine

RU443 (Wild-type x pRU3028) 6664.14 ± 213.46 9626.59 ± 743.33 8579.30 ± 1431.95

RU798 (dctABD- x pRU3028) 7818.09 ± 737.34 15971.84 ± 511.79 ND

RU1493 (mctP- x pRU3028) 5539.88 ± 323.38 ND 14199.54 ± 168.86

Table 3.2.7. β-galactosidase activity of aapJ::TnlacZ reporter fusion in wild-type and Dct or Mct secondary transporter mutants. Cells grown overnight in 10 ml AMS. Number of replicates is n = ≥ 6 with standard error values.

Strain 10 mM Glucose 10 mM NH4

+ 10 mM Glucose

10 mM Aspartate 20 mM Alanine

RU1492 (Wild-type x pRU3158) 19449.18 ± 982.48 21841.68 ± 512.55 30004.76 ± 1298.35

RU2286 (dctABD- x pRU3158) 21666.60 ± 1310.35 23764.49 ± 2352.92 ND

RU1494 (mctP- x pRU3158) 20523.92 ± 736.19 ND 35402.75 ± 1910.96

Table 3.2.8. β-galactosidase activity of braC::TnlacZ reporter fusion in wild-type and Dct or Mct secondary transporter mutants. Cells grown overnight in 10 ml AMS. Number of replicates is n = ≥ 6 with standard error values.

The transcription of aap and bra was slightly elevated in 3841 (Wild-type) when

cells were gown either in 10 mM glucose 10 mM aspartate AMS or 20 mM alanine AMS,

compared to growth in 10 mM glucose 10 mM NH4+ AMS. This is consistent with the

previous report of slightly elevated level of aap transcription in cultures grown in 10 mM

glucose 10 mM aspartate AMS (Reid et al., 1996). The effect of mutation either in dct or

mct, when grown in either 10 mM glucose 10 mM aspartate AMS or 20 mM alanine AMS,

compared to growth in 10 mM glucose 10 mM NH4+ AMS, was an increase in aapJ

transcription. This is consistent with the observed increase in AIB uptake by Aap in strains

mutated in either dct or mct. When the intracellular nitrogen concentration is high

132

expression of aap is negatively regulated by NtrC (Walshaw et al., 1997c). The increase in

transcription of aapJ in strains mutated in either dct or mct, when grown with amino acids

as the sole nitrogen source for growth, can therefore be attributed to derepression by NtrC

caused by the lowered intracellular nitrogen concentration. The transcription of braC is not

affected by mutation in dct when cells were gown in 10 mM glucose 10 mM aspartate AMS

compared to growth in 10 mM glucose 10 mM NH4+ AMS. However, there was a slight

elevation in transcription of braC in strains mutated in mct when cells were gown in 20 mM

alanine AMS compared to growth in 10 mM glucose 10 mM NH4+ AMS.

To determine if the intracellular levels of aspartate and alanine regulate the

translation of aap and bra the activity of phoA translational reporter fusions were

determined. The reporter fusion pRU1829 (pRU1134 aapJ::TnphoA) was conjugated into

3841 (Wild-type), RU714 (dctA-) and RU1180 (mctP-) (RU2505, RU2506, RU2507

respectively). The reporter fusion pBIO206 (pIJ1427 braE::TnphoA) was conjugated into

3841 (Wild-type), RU714 (dctA-) and RU1180 (mctP-) (RU1876, RU2287, RU1877

respectively). Cells were grown overnight in 10 ml AMS, containing appropriate carbon and

nitrogen sources, and the alkaline phosphatase activity determined accordingly for each

strain (Table 3.2.9.; Table 3.2.10.).

Strain 10 mM Glucose 10 mM NH4

+ 10 mM Glucose

10 mM Aspartate 20 mM Alanine

RU2505 (Wild-type x pRU1829 251.15 ± 11.59 264.52 ± 26.38 297.54 ± 19.79

RU2506 (dctABD- x pRU1829) 194.98 ± 8.36 305.14 ± 39.16 ND

RU2507 (mctP- x pRU1829) 259.73 ± 30.33 ND 590.19 ± 32.30

Table 3.2.9. Alkaline phosphatase activity of aapJ::TnphoA reporter fusion in wild-type and Dct or Mct secondary transporter mutants. Cells grown overnight in 10 ml AMS. Number of replicates is n = ≥ 6 with standard error values.

133

Strain 10 mM Glucose 10 mM NH4

+ 10 mM Glucose

10 mM Aspartate 20 mM Alanine

RU1876 (Wild-type x pBIO206) 16.54 ± 0.49 21.07 ± 1.62 26.34 ± 0.73

RU2287 (dctABD- x pBIO206) 20.77 ± 0.16 28.69 ± 3.02 ND

RU1877 (mctP- x pBIO206) 18.00 ± 0.46 ND 31.12 ± 0.89

Table 3.2.10. Alkaline phosphatase activity of braE::TnphoA reporter fusion in wild-type and Dct or Mct secondary transporter mutants. Cells grown overnight in 10 ml AMS. Number of replicates is n = ≥ 6 with standard error values.

As seen for transcription of aap and bra the translation of both operons in 3841

(Wild-type) was slightly elevated when cells were grown on either in 10 mM glucose 10

mM aspartate AMS or 20 mM alanine AMS compared to 10 mM glucose 10 mM NH4+

AMS. There was also slight increases in translation of aap when cells were mutated in

either in dct or mct between growth in 10 mM glucose 10 mM NH4+ AMS, 10 mM glucose

10 mM aspartate AMS and 20 mM alanine AMS. The translation of bra varied slightly on

mutation in dct and mct when grown on different substrates.

The conclusion is clear that high intracellular amino acid concentrations bring about

an inhibition of uptake that is facilitated by an unidentified post-translational mechanism.

The expression of the permeases is unaffected as they are likely required for export of

amino acids. To fully determine if there is a mechanistic switch towards secretion then a

key experiment would be in determining if the rate of export is increased in strains grown to

induce a high intracellular amino acid concentration. Solute efflux is independent from

uptake so the rate of amino acid secretion can be determined for cultures grown either in 10

mM glucose 10 mM NH4+ AMS or 10 mM glucose 10 mM aspartate AMS (Hosie et al.,

2001). The rate of secretion would then be measured from washed and resuspended cells,

pre-loaded with 14C AIB, to determine is secretion was increased by growth in 10 mM

glucose 10 mM aspartate AMS.

134

3.3 Discussion.

This chapter reports the identification of a second aliphatic amino acid specific SBP,

BraC3, capable of interaction with the BraDEFG membrane complex. Of the six most

abundant and rapidly labelled amino acids in pea bacteroids only alanine transport was

demonstrated in free-living cells by strain RU1979 (aapJ- braC-). Aliphatic amino acids,

with the exception of alanine, in bacteroids do not appear to be of a high enough

concentration to support amino acid cycling (Rosendahl et al., 1989; Salminen and Streeter,

1992; Schaarf et al., 2003; Lodwig and Poole, Unpublished). This therefore presented a

powerful tool in investigating the role of alanine in mixed secretion, as well as determining

its role in amino acid cycling. This strain was capable of conferring a Fix+ plant pheonotype

whereas a mutation in the transport complex or in both Bra SBPs lead to a Fix reduced plant

phenotype, indicating disruption of the plant bacteroid amino acid cycle, as described

previously (Lodwig et al., 2003). Successful complementation of the aap- bra- Fix reduced

phenotype by the aliphatic specific ABC transporter Bra from P.aerugionsa further

confirmed the essential role that alanine movement likely plays. This demonstrates that

aliphatic amino acid movement, principally alanine, between the bacteroid and plant is the

minimum requirement for establishing effective symbiotic nitrogen fixation.

The interaction of two SBPs with one membrane complex is well documented

amongst proteobacteria, usually with one more restricted in solute specificity than the other.

However, in all instances the genes coding for the SBPs appear genetically adjacent to each

other and show a large degree of homology both at the protein and nucleotide level,

indicating a tandem gene duplication and divergence (Higgins and Ames, 1981; Adams et

al., 1990). This high degree of identity is not shared to the same extent between BraC and

BraC3 and the genes encoding both are distinctly separated on the chromosome of

R.leguminosarum, approximately 20 kb (Young et al., 2006). Identity between BraC and

BraC3 is restricted to areas predicted to be involved in interaction with the membrane

complex and also those that possibly form hinge region 1 of the SBP. The transport

specificity of BraC3 is similar to that of the E. coli LivJ and P. aeruginosa BraC LIV-I

SBPs for uptake of aliphatic amino acids, such as alanine, valine, isoleucine and leucine.

The restricted solute specificity of BraC3, relative to BraC, may in part be due the

conservation of seven amino acids found in the binding cleft of BraC3, demonstrated to be

important for formation of hydrogen bonds and van der Waal interactions in E. coli LivJ

ligand binding (Trakhanov et al., 2005). Since BraC3 is specific for aliphatic amino acids it

still leaves the remote possibility that movement of aliphatic amino acids other than alanine

135

may be play a role in symbiotic nitrogen fixation. Mutation of the residues that form the

hydrophobic pocket, which accommodates the side chains of larger aliphatic amino acids,

may further restrict solute binding to alanine. Particularly important for formation of the

hydrophobic pocket in E.coli LivJ are residues Tyr41 and Phe299 that form van der Waal

interactions with only the side chains of valine, isoleucine and leucine. Their homologous

residues in BraC3 (Tyr39, Phe296) therefore represent possible targets for site directed

mutagenesis to limit the specificity of the SBP further.

To identify the metabolic fate of alanine and determine the directionality of

movement the genes coding for enzymes in the catabolic pathways ADH and Dad were

mutated in bacteroids. Alanine cannot be used as a transaminating donor in the biosynthesis

of other amino acids to sustain free-living growth (Section 4). Therefore any alanine being

transported into ald dad mutant bacteroids would be effectively inert and lead to a

breakdown in the predicted amino acid cycle. The demonstration that there were no

detectable changes in the Fix phenotype of either single or double alanine catabolic mutants

strongly indicates that alanine secretion and not uptake occurs in bacteroids. This is

consistent with the described observations that alanine is a secretion product of pea and

soybean bacteroids (Waters et al., 1998; Allaway et al., 2000). However, the alanine

secretion observed in these studies was a product of de novo synthesis, as inhibition of

AldA or mutation in aldA lead to loss of secretion. In planta mutation of aldA would not

abolish alanine secretion, as it will still occur as part of amino acid cycling (i.e. a

transamination cycle), whereas mutation of Aap Bra would prevent secretion of both de

novo alanine and also that resulting from amino acid cycling. Attempts to reconstitute

amino acid cycling in bacteroids outside of the nodule may prove flawed due to the

predicted damage done to the outer membrane and loss of the Aap and Bra SBPs. To

conclusively demonstrate that it is alanine secretion via Aap Bra in bacteroids then

modulation of the transport systems to one of exclusively export may provide the clearest

phenotype. Binding of vanadate to the NBD of ABC transport systems induces an inhibitory

state complex, where ADP and vanadate are tightly bound to one of the two nucleotide

binding sites to prevent ATP hydrolysis (Sharma and Davidson, 2000; Chen et al., 2001).

Whilst this was shown to abolish amino acid uptake via Aap it would appear that export can

still occur (Hosie and Poole, Unpublished). The NBD domains of ABC transport systems

contain the LSGGQ motif that is thought associate on dimerisation of the NBDs for contact

and cleavage with the bound nucleotide (Fetsch and Davidson, 2002). Modification of the

known catalytic lysine of AapP would act to inhibit ATP hydrolysis in a manner similar to

vanadate binding and leave the Aap with a capacity for export but not import (van Veen and

136

Poole, Personal communication). This would provide definitive proof that alanine export

via the Aap Bra drives symbiotic nitrogen fixation.

As a consequence of restricting the transport phenotype of RU1979 (aapJ- braC-) to

aliphatic amino acid transport, via BraC3, amino acid cycling between plant and bacteroid

needs to be questioned. If a cycle is in operation then uptake of the donor amino acid by the

bacteroid must proceed through another unidentified transport system. A possibility is that

the source of alanine secretion is de novo synthesis and ammonium assimilation is not shut

down in bacteroids. Alanine de novo synthesis can occur either directly, through the action

of AldA, or indirectly via GS / GOGAT and subsequent transamination by AatA (Lodwig

and Poole, 2003). The demonstration that mutation in aldA leads to no change in plant

phenotype suggests that synthesis through transamination predominates and the role of

AldA activity in bacteroids is to modulate the organic acid, amino acid and ammonium

concentrations (Allaway et al., 2000; Lodwig et al., 2004). The requirement for the

formation of alanine by transamination also provides an explanation for the Fix phenotypic

effect of aatA mutation (Lodwig et al., 2003). The question therefore remains as to the

identity and source of the transamination donor and whether it forms part of an amino acid

cycle or is de novo synthesis. This is addressed in the next chapter.

137

Chapter 4:- Symbiotic Nitrogen Fixation is Independent of Bacteroid Ammonium Assimilation.

138

4.1 Introduction.

Results from the previous chapter indicate alanine is a putative secondary secretion

product essential for symbiotic nitrogen fixation. Restricting the specificity of transport to

determine the role of alanine in amino acid cycling presents a paradox, as uptake of amino

acids relevant to nodule physiology, including the common transamination donors

glutamate and aspartate, is also abolished. Lodwig and Poole, Unpublished observed that 15N labelling of isolated bacteroids from plants inoculated by wild-type and an aap bra

mutant strain of R.leguminosarum bv. viciae A34 show similar atom percent excess (APE)

values for intracellular glutamate, aspartate and alanine. This indicates that the amino group

is derived from nitrogen fixed by the bacteroid and yet this would require assimilation by

the plant for amino acids to be cycled back for uptake into the cell by the two broad range

amino acid permeases. As no other amino acid transport, or transporters, have been reported

in either free-living cells or bacteroids, this chapter therefore questions the establishment of

a complete amino acid cycle and considers the possibility that bacteroid ammonium

assimilation provides the transamination donors used for alanine synthesis.

The principal routes for ammonium assimilation are via alanine dehydrogenase and

the concerted action of GS / GOGAT (Figure 4.1.1.) (Brown and Dilworth, 1975;

Kondorosi et al., 1977; Osburne and Signer, 1980; Ali et al., 1981; Smith and Emerich,

1993; Allaway et al., 2000). There is no detectable glutamate dehydrogenase or aspartase

enzyme activity in isolated bacteroids of either R. leguminosarum or B. japonicum (Dunn

and Klucas, 1973; Kurz et al., 1975; Poole et al., 1984). Mutational and enzyme analysis

have revealed the GS / GOGAT pathway to be the main one for ammonium assimilation

(Kurz, 1975; O’Gara et al., 1984; Carlson et al., 1987; Lewis et al., 1990; Castillo et al.,

2000; Ferraioli et al., 2002). GOGAT mutants are glutamate auxotrophs showing that no

other ammonium assimilation pathway is able to support significant growth of rhizobia in

free-living cultures. This suggests that de novo alanine, synthesised via AldA, cannot be

utilised for further amino acid biosynthesis. For alanine to act as the sole nitrogen source for

growth it is first catabolised to liberate NH4+ for reassimilation via GS / GOGAT.

139

NH4+ Glutamine Glutamate

Aspartate

Alanine

GS GOGATGlutamate 2-oxoglutarate

APT

Pyruvate

GOT

Oxaloacetate

GPT

Pyruvate

ALD

Pyruvate

NH4+ Glutamine Glutamate

Aspartate

Alanine

GS GOGATGlutamate 2-oxoglutarate

APT

Pyruvate

GOT

Oxaloacetate

GPT

Pyruvate

ALD

Pyruvate

Figure 4.1.1. Pathways to de novo alanine synthesis.

Mutation in aldA in bacteroids has already been demonstrated to have no detrimental

effect on the Fix+ plant phenotype (Allaway et al., 2000). In strains mutated in aldA

ammonium assimilation can still proceed via GS / GOGAT for the synthesis of glutamate,

which serves as the transaminating donor for alanine synthesis via the concerted GOT and

APT activity of AatA. AatA purified from R. leguminosarum has also been demonstrated to

catalyse the transamination of pyruvate directly using glutamate as the donor amino acid

(Bourdés and Poole, Unpublished). There is no reported GOGAT enzyme activity from

mature isolated bacteroids of R. leguminosarum, but there is in bacteroids of R. etli (Castillo

et al., 2000; Bourdes and Poole, Unpublished). Mutation for the loss of GOGAT activity on

the symbiotic effectiveness of S. meliloti, B. japonicum and R. etli has proved contradictory,

due to the nature of some mutants. In S. meliloti chemical, U.V and transposon mutants that

are all uncharacterised glutamate auxotrophs have shown no effect on nitrogen fixation

(Osburne and Signer, 1980; Ali et al., 1981; Lewis et al., 1990). However, contradictory to

these mutations having no effect on plant phenotype an undefined B. japonicum mutant

lacking GOGAT activity did not fix nitrogen (O’Gara et al., 1984). The only characterised

mutants were in R. etli, however both studies conflict. Castillo et al., 2000 reported a

transposon mutation in gltB that showed increased nitrogen supply to the plant, ascribed to a

decrease of the bacteroid amino-nitrogen pool so that more ammonium was secreted to the

plant. Ferraioli et al., 2002 later demonstrated the contradiction within the species with

isolation of a gltD transposon mutation that showed a reduced nodule number, reduced dry

weight and 25 % of wild-type nitrogenase activity. The ambiguous nature of these mutants,

especially that seen between mutation in gltB and gltD in R. etli, demonstrates the

140

requirement for a defined deletion mutant. Mutation in the genes encoding both

GS/GOGAT and alanine dehydrogenase would prove useful in determining to what extent

ammonium assimilation was required for symbiotic nitrogen fixation.

This chapter reports the effect of mutation in gltB and the loss of GOGAT activity

by R. leguminosarum on the symbiotic phenotype with pea plants. Mutation in gltB for loss

of GOGAT activity has implications for bacteroid development due to amino acid

availability, however this can be overcome to by increasing the transport rate,

demonstrating that in mature bacteroids de novo amino acid synthesis is dispensable for

effective symbiotic nitrogen fixation.

141

4.2 Results.

4.2.1 Mutation of gltB, the large subunit of glutamine 2-oxoglutarate aminotransferase.

In the GS / GOGAT pathway glutamate is initially aminated to glutamine in an

ATP-dependent, glutamine synthetase (GS) catalysed reaction that consumes NH4+.

Glutamine is then de-aminated in an NADPH-dependent glutamine 2-oxoglutarate

transaminase (GOGAT) catalysed reaction to yield two molecules of glutamate (Reitzer,

1996). R. leguminosarum contains three primary glutamine synthetases GSI, GSII and

GSIII encoded by glnA, glnII and glnT respectively (Filser et al., 1986; Espin et al., 1990).

In addition the R. leguminosarum genome revealed three other genes coding for

homologues genes of undefined function that show identity to glnA (RL0755, RL1466,

RL3346) (Young et al., 2006). R. etli and S. meliloti strains mutated in both glnA and glnII

also showed reduced succinate utilisation (Encarnacion et al., 1998). Therefore for a

mutational strategy these genes do not present a favourable target due to the multiplicity of

genes encoding GS enzymes and the possible impact of reduced succinate utilisation on the

bacteroids capacity for nitrogenase activity.

GOGAT is a large heterodimeric enzyme comprised of a large and small subunit,

encoded by gltB and gltD respectively (Miller and Stadtman, 1972; Mantsala and Zalkin,

1976; Castano et al., 1988). In R. leguminosarum bv. viciae 3841 gltB (RL4085) and gltD

(RL4084) comprise an operon of approximately 6.3 kb with two major open reading frames

that encode proteins of 1573 and 484 amino acids in length. The open reading frames are

separated by 230 nucleotides and each is preceded by a potential ribosome-binding site

(Young et al., 2006). RL4084 shares 97 %, 87 %, 80 % and 69 % identity to the GltB

proteins of R. etli, S. meliloti, M. loti and B. japonicum respectively, whilst RL4085 shares

98 %, 88 %, 82 % and 59 % identity to the GltD proteins (Lewis et al., 1990; Castillo et al.,

2000; Galibert et al., 2001; Kaneko et al., 2000; Kaneko et al., 2004; Gonzalez et al., 2006).

The genome sequence of R. leguminosarum also revealed a second putative gltD (RL3707)

with 28 % identity to gltD (RL4084) and 29 %, 28 %, 27 % and 29 % identity to the GltD

proteins of R. etli, S. meliloti, M. loti and B. japonicum respectively. Due to the possibility

that RL3707 may complement for mutation in gltD it was decided to abolish GS / GOGAT

ammonium assimilation through a gltB gene deletion.

A 5.7 kb region containing gltB was amplified by PCR using primers p416 and p417

that were adapted to contain SpeI restriction sites. The PCR product was resolved on a 0.8

% agarose gel and the DNA excised and recovered using Qiagen’s gel extraction kit. This

142

purified PCR fragment was then cloned directly into pCR 4-TOPO (pRU1580). An internal

2.8 kb region of gltB was deleted by digestion with BamHI and the similarly digested

omega spcr cassette from pHP45Ω was ligated in its place (pRU1607). The whole region

containing the deleted gltB omega spcr cassette was then subcloned into the suicide vector

pJQ200SK- as a 4.9 kb SpeI / NotI (pRU1608).

143

10160 bp

gltB

gltD RL4086RL4083

KpnI (3116)

NsiI (5808)

BamHI (4440)BamHI (7254)

p416 (75.0%)p417 (82.1%) p831 (85.7%)

p832 (81.5%)

p833 (100.0%)

p834 (85.7%)p653 (100.0%)

p654 (100.0%)

10160 bp

gltB

gltD RL4086RL4083

KpnI (3116)

NsiI (5808)

BamHI (4440)BamHI (7254)

p416 (75.0%)p417 (82.1%) p831 (85.7%)

p832 (81.5%)

p833 (100.0%)

p834 (85.7%)p653 (100.0%)

p654 (100.0%)

Figure 4.2.1. Genetic arrangement of the genes encoding the large and small subunits of GOGAT in R. leguminosarum bv. viciae 3841. Also shown are the primer binding sites and the restriction sites used for cloning and mutagenesis.

Plasmid pRU1608 (pJQ200SK- x gltB::Ωspcr) was conjugated into 3841 (Wild-type)

and RU1370 (aldA-) for sucrose selection against the vector and retention of spcr to force

direct gene replacement. As GOGAT mutants are glutamate auxotrophs the growth medium

used to subculture strains for selection, 10 % sucrose 10 mM NH4+ AMA, was

supplemented with 10 mM glutamate. From a preliminary screen of approximately 1000

colonies none were recovered that were sucrose resistant and gens spcr. Fox et al., 2006

demonstrated that osmotic upshift transiently inhibits uptake via ABC transporters so

colonies were subcultured on 10 % sucrose TY agar plates in an attempt to supply the cells

with enough amino acids to overcome any effect that may have resulted in the lack of

growth of successful recombinants on 10 % sucrose 10 mM NH4 10 mM glutamate AMA.

Five spcr gens colonies derived from each parent strain, 3841 (Wild-type) and RU1370

(aldA-), were recovered. Colonies were PCR screened for direct gene replacement using

primers pOT For and either p653 or p654, which are set back on the chromosome from the

primers used in the initial amplification. All colonies from the 3841 (Wild-type) parent

strain and one colony from the RU1370 (aldA-) parent strain gave correct PCR fragments of

1.8 kb and 1.6 kb, for primers pOT For and p653 and primers pOT For and p654

respectively. One colony of each was purified and stocked as RU2307 (gltB-) and RU2308

(gltB- aldA-).

144

To confirm that mutation in gltB abolished all GOGAT activity in R.

leguminosarum, strains RU2307 (gltB-) and RU2308 (gltB- aldA-) were assayed relative to

3841 (wild-type). Cultures were grown overnight to mid-log stage at 26oC and 225 rpm in

60 mls 10 mM glucose 10 mM NH4+ 10 mM aspartate AMS, which will be discussed in

section 4.2.2. The same cell extract was used to determine both the GOGAT and alanine

dehydrogenase activities of all strains.

Strain Rate (nmol-1 mg-1 protein min-1) SEM

3841 (Wild-type) 32.40 1.32 RU2307 (gltB-) 1.88 0.48 RU2308 (gltB- aldA-) 1.00 0.00

Table 4.2.1. GOGAT activity of Wild-type and strains mutated in gltB. Number of replicates is n = ≥ 3 with standard error values.

Whilst 3841 (Wild-type) had active GOGAT this was lost in both RU2307 (gltB-)

and RU2308 (gltB- aldA-). The loss of enzyme activity and lack of growth on 10 mM

glucose 10 mM NH4+ AMA for both mutant strains demonstrates that ammonium

assimilation via the GS / GOGAT pathway was abolished through deletion of gltB.

To confirm that mutation in aldA abolished all alanine dehydrogenase activity in

strain RU2308 (gltB- aldA-), this strain was assayed relative to 3841 (wild-type) and

RU2307 (gltB-).

Strain Rate (nmol-1 mg-1 protein min-1) SEM

3841 (Wild-type) 354.00 46.00 RU2307 (gltB-) 647.00 59.00 RU2308 (gltB- aldA-) 4.00 0.00

Table 4.2.2. Alanine dehydrogenase activity of strains mutate in gltB and aldA. Number of replicates is n = ≥ 3 with standard error values.

Alanine dehydrogenase specific activity was abolished in strain RU2308 (gltB- aldA-

) through a Tn5 insertion in aldA. The lack of GOGAT activity also seen in this strain

(Table 4.2.1.) demonstrates that it is incapable of de novo amino acid synthesis, through all

known routes of ammonium assimilation in R. leguminosarum. Strain RU2307 (gltB-)

retained activity demonstrating that mutation of gltB has no deleterious effect on alanine

dehydrogenase activity and confirms the mutation in aldA as the cause of this loss of

enzyme activity. The increase in activity in RU2307 (gltB-) relative to 3841 (Wild-type) is

145

likely due to experimental error. Cells were cultured in the absence of alanine so induction

of aldA transcription will be low and so this two-fold difference is not a significantly high

enough activity to be physiologically relevant. Importantly we have succeeded in

determining that AldA activity is present in RU2307 (gltB-) but not RU2308 (gltB- aldA-).

4.2.2 Complementation and regulation of gltBD.

To complement the gltB deletion in trans the gltBD operon was amplified and

cloned into pJP2. Due to the large size of the operon two sections were amplified by PCR

and the whole reconstituted on cloning into pJP2. This also provided the potential to

generate a GUS reporter fusion to investigate gltBD regulation through directional cloning

of the first fragment, which included the intregenic region between RL4086 and gltB, into

pJP2. The first part of gltB sequence was amplified as a 3.4 kb region with primers p831

and p832. The large intergenic region was included to ensure the expression and regulation

of gltBD by its promoter and ribosome-binding site. The second part of gltB and the whole

of gltD were amplified as a 3.8 kb region with primers p833 and p834. PCR products were

resolved on a 0.8 % agarose gel and the DNA excised and recovered using Qiagen’s gel

extraction kit. The purified PCR product of the intergenic region and partial gltB fragment

was cloned directly into pCR 2.1-TOPO (pRU1803). The second purified PCR product of

the partial gltB fragment and gltD was also cloned into pCR 2.1-TOPO (pRU1804).

Primers p831 and p832 carried an additional KpnI and XbaI restriction sites respectively

that allowed directional cloning of the 3.4 kb fragment into pJP2 (pRU1810) to generate a

GUS reporter fusion. To reconstitute the gltBD operon on pJP2 primer p834 contained an

XbaI restriction site and the gltB sequence contains an NsiI restriction site. This NsiI

restriction site was included and amplified in both the gltB fragments present in pRU1804

(pCR 2.1-TOPO x gltBD fragment I) and pRU1810 (pCR 2.1-TOPO x gltBD fragment II).

This enabled directional cloning of the second gltBD fragment as a 3.6 kb fragment from

pRU1804 (pCR 2.1-TOPO x gltBD fragment I) subcloned as a NsiI and XbaI fragment into

the similarly digested pRU1810 (pCR 2.1-TOPO x gltBD fragment II) (pRU1811). To

construct a gltB complementing plasmid a 5.3 kb KpnI fragment containing gltB and its

preceding intergenic region was subcloned from pRU1811 (pJP2 x gltBD) into pJP2

(pRU1812). To construct a gltD complementing plasmid pRU1811 (pJP2 x gltBD) was

digested with BamHI, a 2.8 kb region excised and then the plasmid re-ligated to create an

inframe deletion in gltB (pRU1813).

Plasmids pJP2, pRU1811 (pJP2 x gltBD), pRU1812 (pJP2 x gltB) and pRU1813

(pJP2 x gltD) were all conjugated into RU2307 (gltB-); strains RU2484 (gltB- x pJP2),

146

RU2492 (gltB- x pRU1811), RU2493 (gltB- x pRU1812) and RU2494 (gltB- x pRU1813)

respectively. To determine the gene requirements for complementation of GOGAT activity

strains were assayed for growth on 10 mM glucose 10 mM NH4+ AMA. Following 3 – 4

days inoculation only RU2492 (gltB- x pRU1811) displayed growth compared to other

complemented strains and the negative control. After 10 days post inoculum strain RU2493

(gltB- x pRU1812) began to show a very slow rate of growth. The growth of this strain

could be ascribed to the fact that R. leguminosarum encodes another putative gltD-like gene

on its chromosome (RL3707) that is capable of interaction to give low levels of GOGAT

activity. However, it may be that the omega spcr interposon has some weak promoter

activity to confer basal gltD expression that is sufficient for slow growth. As RU2494 (gltB-

x pRU1813) did not grow relative to RU2484 (gltB- x pJP2) it demonstrates the requirement

for the large subunit of GOGAT for activity and that R. leguminosarum does not encode

additional copies of gltB.

To briefly determine the regulation of gltB the GUS reporter fusion pRU1810 was

conjugated into 3841 (Wild-type) to generate RU2491 (Wild-type x pRU1810). Nitrogen

metabolism in rhizobia is modelled on that of enteric bacteria where the ratio of glutamine

to 2-oxoglutarate is sensed through a cascade of regulatory proteins to regulate transcription

through the ntr system. This is a two-component system comprising the protein kinase NtrB

and the transcriptional regulator NtrC (Patriarca et al., 2002). In enteric bacteria under

nitrogen deficiency the transcription of ntrC and the DNA-binding activity of the protein

are increased whereas in R. etli only the activity is (Patriarca et al., 1994; Martino et al.,

1996). It has been suggested that the majority of nitrogen limitation induced genes are

independent of the ntr system and that in rhizobia the main function of NtrC is in NH4+

metabolism (Milcamps et al., 1998; Partiarca et al., 2002). To determine the role that NtrC

might play in the regulation of nitrogen metabolism through gltBD expression pRU1810

was also conjugated into RU929 (ntrC-) (this strain was not assigned a strain number).

Mutation of ntrC- had no effect on the transcription of gltB as there was no effect on the

rates of activity for RU929 (ntrC-) x pRU1810 grown in all media compared to RU2491

(Wild-type x pRU1810) (Figure 4.2.2.). This indicated that expression of gltBD is

independent of ntrC, despite the hypothesis that NtrC acts to regulate the activity of genes

involved in NH4+ metabolism.

147

Growth Media (AMA 10 mM)

Glc NH Glc Glu Glc Asp

GU

S A

ctiv

ity (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

200

400

600

800

1000

1200RU1416 (Wild-type x pJP2)RU2491 (Wild-type x pRU1810) RU929 (ntrC-) x pRU1810

Figure 4.2.2. GUS activity of gltBD reporter fusion.

Transcription of gltBD increased two-fold in conditions of nitrogen excess, 10 mM

glucose 10 mM NH4+, relative to conditions of limited availability, 10 mM glucose 10 mM

glutamate (Figure 4.2.2.). It indicates that glutamate, the product of GOGAT activity, may

act to repress transcription of gltBD. The regulation of gltBD is contradictory to the

transcriptional evidence for glnA and glnII, which encode the GS enzymes, where

transcription is higher in conditions of low nitrogen availability (Rossi et al., 1989;

Patriarca et al., 1992; Davalos et al., 2004). Enzymes assays, on cells grown in similar

conditions, should be carried out to determine if a post-translational mechanism also

controls GOGAT activity.

4.2.3 Growth phenotype of R. leguminosarum gltB- strains.

It was noted earlier that strain RU2307 (gltB-) could not grow on 10 mM glucose

AMA with 10 mM NH4+ as the sole nitrogen source, compared to 3841 (Wild-type). To

confirm the glutamate auxotrophy of gltB mutation mean generation times were calculated

for strain RU2307 (gltB-) grown at 26oC and 225 rpm in 60 mls 10 mM glucose 10 mM

NH4+ AMS, supplemented with 10 mM of various amino acids (Figure 4.2.3.).

148

The exponential growth phase of cells was determined and the mean generation time

(MGT) was calculated for a 24 hour period from 8 hours post inoculum using the equation;

Generations (G) = (Log10 OD600nm at 32 hours – Log10 OD600nm at 8 hours) / Log10 2

MGT (Hours) = 24 / g

149

Time (Hours)

0 10 20 30 40

OD

600n

m

0.01

0.1

1

Figure 4.2.3. Growth rate of RU2307 (gltB-) in 10 mM glucose 10 mM NH4+ AMS

supplemented with 10 mM of various amino acids. Cell OD600nm sampled every 4 hours. Number of replicates is n = ≥ 3 with standard error values. • = 10 mM glc 10 mM NH4

+, • = 10 mM glc 10 mM NH4+ 10 mM glu, • = 10 mM glc 10

mM NH4+ 10 mM Asp, • = 10 mM glc 10 mM NH4

+ 10 mM ala, • = 10 mM glc 10 mM NH4

+ 10 mM glu asp, • = 10 mM glc 10 mM NH4+ 10 mM glu 10 mM ala, • = 10 mM glc

10 mM NH4+ 10 mM asp 10 mM ala.

Growth Medium (AMS) MGT (Hours)

10 mM glc 10 mM NH4+ 71.51

10 mM glc 10 mM NH4+ 10 mM glu 49.68

10 mM glc 10 mM NH4+ 10 mM asp 14.01

10 mM glc 10 mM NH4+ 10 mM ala 83.46

10 mM glc 10 mM NH4+ 10 mM glu 10 mM asp 13.43

10 mM glc 10 mM NH4+ 10 mM glu 10 mM ala 71.58

10 mM glc 10 mM NH4+ 10 mM asp 10 mM ala 5.07

Table 4.2.3. Mean generation times for RU2307 (gltB-) grown in 60 mls 10 mM glucose 10 mM NH4

+ AMS supplemented with 10 mM of various amino acids. Number of replicates is n = ≥ 3.

150

The mean generation time of RU2307 (gltB-) in 10 mM glucose 10 mM NH4+AMS

indicates a virtual loss of growth and amino acid auxotrophy. However, the mean

generation time for RU2307 (gltB-) grown in 10 mM glucose 10 mM NH4+ 10 mM

glutamate AMS indicates that added glutamate does not restore effective growth, as was

observed for R. etli mutants that lack GOGAT activity (Castillo et al., 2000; Ferraioli et al.,

2002). Whilst addition of 10 mM glutamate or alanine was unable to restore growth of

RU2307 (gltB-), growth was restored by10 mM aspartate. Growth medium supplemented

with 10 mM aspartate, either on its own or in combination with other common amino acids,

restores growth of RU2307 (gltB-) as indicated by a significant increase in growth rate and a

lower mean generation time.

Growth of RU2307 (gltB-) on medium with added aspartate demonstrates that

mutation of gltB does not have an effect on glutamate utilisation, which would explain the

lack of growth when glutamate was added to the medium. Aspartase activity is not normally

expressed in cells and has only been detected in one strain of R. leguminosarum (Poole et

al., 1984). It acts to breaks down aspartate to fumarate and liberate NH4+, which a GOGAT

mutant would then be unable to assimilate back into the cell as glutamate. Therefore

aspartate metabolism in R. leguminosarum involves the transamination of 2-oxoglutarate by

AatA to give glutamate, as evident by growth of 3841 (Wild-type) in 10 mM glucose 10

mM aspartate AMS resulting in glutamate excretion (Walshaw et al., 1997).

It was hypothesised that the supply or transport rate for glutamate into the cell is not

sufficient to enable growth of RU2307 (gltB-) when provided as the sole amino acid.

Aspartate may complement growth because as well as being transported via the Aap and

Bra it can also be taken into cells via the Dct secondary transporter (Reid et al., 1996). It is

possible that this additional amino acid uptake via a secondary transport system is capable

of bridging the gap for the amino acid requirements needed for growth of this strain. A

further indication that additional amino acid uptake is important for restoring growth of

RU2307 (gltB-) is that the mean generation time for RU2307 (gltB-) in 10 mM glucose 10

mM NH4+ 10 mM aspartate AMS is over two fold lower than when grown in 10 mM

glucose 10 mM NH4+ 10 mM aspartate 10 mM alanine AMS. Alanine can also be

transported into cells by the Mct secondary uptake system and may act to further ease any

restraints on growth limited by the supply of aspartate (Hosie et al., 2002b). However

alanine alone cannot complement growth of a GOGAT mutant, as it has been shown not to

act as a transamination donor for glutamate and its metabolism liberates NH4+ for

reassimilation into the cell by GS / GOGAT.

151

The Dct system has a very low affinity for aspartate transport (Ki for inhibition of

succinate transport by aspartate is 5 mM) and a high affinity for succinate (Km is 5 µM)

(Reid et al., 1996). This indicates that at equimolar concentrations succinate would largely

prevent binding of aspartate to the Dct. To demonstrate that aspartate transport via the Dct

was responsible for rescuing growth of RU2307 (gltB-) mean generation times were

calculated for growth at 26oC and 225 rpm in 60 mls 10 mM NH4+ AMS with either10 mM

glucose or 10 mM succinate as the sole carbon source and supplemented with either 10 mM

glutamate or 10 mM aspartate (Figure 4.2.4.). Ammonium was kept in all growth media as

it was shown that in wild type S. meliloti glutamine cycling and succinate utilisation were at

an optimum (Encarnacion et al., 1998).

152

Time (Hours)

0 10 20 30 40

OD

600n

m

0.01

0.1

1

Figure 4.2.4. Growth rate of RU2307 (gltB-) in 10 mM NH4+ AMS supplemented with 10

mM various carbon sources and 10 mM various amino acids. Cell OD600nm sampled every 4 hours. Number of replicates is n = ≥ 3 with standard error values. • = 10 mM glc 10 mM NH4

+ 10 mM glc 10 mM NH4+ 10 mM glu, • = 10 mM glc 10 mM

NH4+ 10 mM asp, • = 10 mM succ 10 mM NH4

+ 10 mM glu, • = 10 mM succ 10 mM NH4

+ 10 mM asp.

Growth Medium (AMS) MGT (Hours)

10 mM glc 10 mM NH4+ 10 mM glu 78.08

10 mM glc 10 mM NH4+ 10 mM asp 11.22

10 mM succ 10 mM NH4+ 10 mM glu 110.29

10 mM succ 10 mM NH4+ 10 mM asp 82.25

Table 4.2.4. Mean generation times for RU2307 (gltB-) in 10 mM NH4+ AMS

supplemented with 10 mM various carbon sources and 10 mM various amino acids. Cell OD600nm sampled every 4 hours. Number of replicates is n = ≥ 3.

The growth rate and mean generation times for strain RU2307 (gltB-) again showed

complementation for amino acid auxotrophy by growth in 10 mM glucose 10 mM NH4+ 10

mM aspartate AMS. However, growth in 10 mM succinate 10 mM NH4+ 10 mM aspartate

AMS, where aspartate transport via the Dct will be excluded, reduces the growth rate and

153

the mean generation time to that observed for growth with glutamate as the added amino

acid.

Mutants of S. meliloti that lack a functional GS/GOGAT pathway for glutamate

synthesis show a decrease in growth rate and succinate utilisation relative to wild-type

(Encarnacion et al., 1998). This could suggest that the lack of growth by RU2307 (gltB-) on

succinate is as a result of insufficient carbon metabolism and not an effect of limited amino

acid supply. However, in these mutant strains, despite poor utilisation, succinate still served

as a better carbon source for growth than glucose, as the concentration of glucose required

to achieve the equivalent growth rate was ten-fold higher. R. leguminosarum is incapable of

growth with aspartate as the sole carbon source so glucose must have been the carbon

source for growth of RU2307 (gltB-) in 10 mM glucose 10 mM NH4+ 10 mM aspartate

(Reid et al., 1996). Therefore we cannot attribute the loss of growth for RU2307 (gltB-) on

succinate to be poor metabolism as it is capable of growth with glucose, which has been

demonstrated as a worse carbon source than succinate for strains mutated in the genes

coding for GS / GOGAT (Encarnacion et al., 1998). Therefore it has been demonstrated that

amino acid transport via the Aap and Bra is insufficient and limits the growth of gltB

mutants, which can be rescued through additional aspartate uptake via the Dct.

The exclusion of aspartate, by succinate, for transport via the Dct is responsible for

the loss of growth by RU2307 (gltB-). When 3841 (Wild-type) is grown in 10 mM succinate

10 mM NH4+ 10 mM aspartate AMS transport of aspartate into cells occurs solely via the

Aap and Bra. Grown on either carbon source, glutamate is transported only via the Aap and

Bra. In both cases when amino acid transport is restricted to the Aap and Bra then it was not

possible to restore growth of RU2307 (gltB-) through the addition of an amino acid to the

medium. This suggests that amino acid transport via Aap Bra is either lowered or abolished

in RU2307 (gltB-). To determine the rate of amino acid transport in RU2307 (gltB-) uptake

assays for AIB (25 µM 0.125 µCi 14C) were carried out relative to 3841 (Wild-type) on cells

grown in 10 mM glucose 10 mM glutamate AMS (Table 4.2.5.).

Strain Rate (nmol-1 mg-1 protein min-1) SEM

3841 (Wild-type) 13.22 1.12 RU2307 (gltB-) 0.51 0.17

Table 4.2.5. Effect of gltB mutation on amino acid transport. Cells grown overnight in 10 mM glucose 10 mM glutamate AMS. Number of replicates is n = ≥3 with standard error values.

154

The uptake rates for RU2307 (gltB-) indicate that virtually all amino acid transport is

lost by mutation of gltB (Table 4.2.5.). However, RU2307 (gltB-) grew very slowly to an

OD600nm of 0.4 and cells rapidly flocculated making assaying an evenly distributed sample

of a consistent OD600nm of 1 difficult. Therefore the fitness of RU2307 (gltB-) cells used in

the assay must be questioned and the results are not conclusive.

Uptake assays for glutamate, aspartate, alanine, AIB (25 µM 0.125 µCi 14C) and

GABA (25 µM 0.125 µCi 3H) were carried out on cultures grown in 10 mM glucose 10 mM

NH4+ 10 mM aspartate AMS to determine the gltB mutation caused any effect on amino

acid transport via the Aap and Bra in RU2307 (gltB-) (Figure 4.2.5.).

155

Solute 25 µΜ 0.125 µCi

Glu Asp Ala AIB GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

2

4

6

8

10

12

143841 (Wild-type)

RU2307 (gltB-)

Figure 4.2.5. Effect of gltB mutation on amino acid transport. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

The rate of amino acid uptake by RU2307 (gltB-) when grown in 10 mM glucose 10

mM NH4+ 10 mM aspartate AMS demonstrates that transport via Aap and Bra is not

abolished in a gltB mutant. When grown on 10 mM glucose 10mM NH4+ 10 mM glutamate

the loss of transport is therefore probably due to an imbalance in the intracellular amino

acid content rather than on aap and bra directly. The rate of amino acid uptake by RU2307

(gltB-) grown on 10 mM glucose 10 mM NH4+ 10 mM aspartate was still approximately 75

– 80 % of that determined for 3841 (Wild-type). To identify if this slight reduction of amino

acid uptake was a result of a change in the transcription or translation of aap and bra the

reporter fusions pRU3028 (aapJ::TnlacZ), pRU3158 (braC::TnlacZ), pRU1829

(aapJ::TnphoA) and pBIO206 (braE::TnlacZ) were conjugated into both 3841 (Wild-type)

and RU2307 (gltB-) (RU443, RU1494, RU2505, RU1876, RU2508, RU2509, RU2510,

RU2511 respectively).

156

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU443 (Wild-type x pRU3028) 6336.37 388.54 RU2508 (gltB- x pRU3028) 6381.58 3616.31

Table 4.2.6. β-galactosidase activities of aapJ::TnlacZ reporter fusion. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU2505 (Wild-type x pRU1829) 313.25 24.95 RU2509 (gltB- x pRU1829) 332.26 14.61

Table 4.2.7. Alkaline phosphatase activities of aapJ::TnphoA reporter fusion. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU1494 (Wild-type x pRU3158) 17959.5 512.55 RU2510 (gltB- x pRU3158) 17902.76 112.62

Table 4.2.8. β-galactosidase activities of braC::TnlacZ reporter fusion. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU1876 (Wild-type x pBIO206) 19.79 1.3 RU2511 (gltB- x pBIO206) 15.52 0.86

Table 4.2.9. Alkaline phosphatase activities of braE::TnphoA reporter fusion. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

The transcription and translation of aap and bra was not altered between strains so

the slight inhibition of transport caused by gltB mutation when cells are grown in 10 mM

glucose 10 mM NH4+ 10 mM aspartate AMS might be a related post-translational

modification already determined in 3841 (Wild-type) (Reid et al., 1996). Growth of

RU2307 (gltB-) strains, that carry the transcriptional and translational reporter fusions, in 10

mM glucose 10 mM NH4+ 10 mM glutamate AMS may be sufficient to allow the

157

determination of whether the loss of uptake when grown in this medium is further post-

translational modification, or is accompanied by transcriptional and translational repression.

Amino acid uptake by Aap and Bra appears to be abolished in RU2307 (gltB-) and

added glutamate cannot complement for growth, as it cannot enter the cell (Table 4.2.5.).

When another amino acid, such as aspartate that can act as a precursor for glutamate

biosynthesis, is taken up into cells via another transport system it acts to relieve the

unidentified mechanism of inhibition for Aap Bra (Figure 4.2.5.). Inhibition of amino acid

uptake by Aap Bra has been demonstrated before in 3841 (Wild-type) and is believed to

occur due to an imbalance of intracellular amino acid concentrations (Reid et al., 1996;

Walshaw et al., 1997b). When cells are grown in nitrogen rich media inhibition of transport

occurs by transcriptional repression of aap, by NtrC acting as a negative regulator for the

operon (Walshaw et al., 1997b). NtrC activity is regulated by the PII protein, which is itself

activated by GlnD in response to intracellular glutamine levels (Arcondeguy et al., 2001).

Growth on 10 mM glucose 10 mM aspartate also inhibited transport via the Aap and Bra

due to unregulated uptake of aspartate via the Dct, however the mechanism of inhibition

was not transcriptional (Reid et al., 1996). Nitrogen levels in rhizobia are sensed through

the concentration of glutamine by a cascade of regulatory proteins that regulate the activity

of promoters encoding components for NH4+ metabolism (Patriarca et al., 2002). If the cells

of RU2307 (gltB-) have an imbalance of amino acid levels, particularly glutamine then this

may cause a similar inhibition of uptake via Aap and Bra. As the genes coding for the GS

enzymes are not mutated in RU2307 (gltB-) then aspartate transport via the Dct may act to

provide the cell with a source of glutamate that then restores the amino acid balance and

relieve the inhibition of uptake on Aap and Bra.

Amino acid transport via the Aap and Bra alone is not sufficient for the amino acid

requirements of RU2307 (gltB-) for growth. Additional amino acid transport via other

transport permeases, such as aspartate via the Dct, is able to satisfy the growth requirement

of the strain. To demonstrate that additional glutamate uptake via other transport systems is

also capable of restoring growth in a similar manner as observed for aspartate, gltP and gltS

from E. coli, encoding secondary amino acid transport systems, were supplied in trans. GltP

is a proton coupled glutamate and aspartate specific secondary transport permease and GltS

is a sodium-coupled permease specific for glutamate (Deguchi et al., 1989; Wallace et al.,

1990). Plasmids pRU976 (gltP) and pRU986 (gltS) were conjugated in to RU2307 (gltB-)

(RU2388, RU2389 respectively). The gltP and gltS from E. coli had been cloned with the

promoter and ribosome-binding site of aapJ through overlap PCR to ensure expression in R.

leguminosarum (Hosie et al., 2002b). To confirm expression uptake of glutamate, aspartate,

158

alanine, AIB (25 µM 0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) was assayed for

RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) relative to RU2307 (gltB-).

159

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

20

40

60

80

1003841 (Wild-type) RU2307 (gltB-) RU2388 (gltB- x pRU976) RU2389 (gltB- x pRU986)

Figure 4.2.6. Amino acid uptake rates for RU2307 (gltB-) complemented with E. coli gltP and gltS. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥3 with standard error values.

Expression of gltP and gltS, in RU2388 (gltB- x pRU976) and RU2389 (gltB- x

pRU986) respectively, increased the transport rate of glutamate over 10-fold. In addition

expression of gltP also increased the uptake rate of aspartate, indicating that both

transporters had the same transport profile as reported for expression in E. coli (Deguchi et

al., 1989; Wallace et al., 1990).

To determine the effect of increased glutamate uptake on the growth phenotype of

RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) strains were inoculated onto 10

mM glucose 10 mM NH4+ 10 mM glutamate AMA plates and growth compared to RU2307

(gltB-) (Figure 4.2.7.).

160

Figure 4.2.7. Growth of RU2307 (gltB-), RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) on 10 mM glucose 10 mM NH4

+ 10 mM glutamate 5-days post inoculum. A = RU2307 (gltB-), B = RU2388 (gltB- x pRU976), C = RU2389 (gltB- x pRU986).

Growth of RU2307 (gltB-) was again demonstrated to be abolished on 10 mM

glucose 10 mM NH4+ 10 mM glutmate AMA (Figure 4.2.7., A). However, growth on 10

mM glucose 10 mM NH4+ 10 mM glutamate AMA was restored in both RU2388 (gltB- x

pRU976) (Figure 4.2.7., B) and RU2389 (gltB- x pRU986) (Figure 4.2.7., C). To confirm

that both RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) were glutamate

auxotrophs strains were also plated onto 10 mM glucose 10 mM NH4+ 10 AMA (Figure

4.2.8.).

A

B C

161

Figure 4.2.8. Growth of RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) on 10 mM glucose 10 mM NH4

+ versus 10 mM glucose 10 mM NH4+ 10 mM glutamate 5-days

post inoculum. A = RU2388 (gltB- x pRU976) 10 mM glucose 10 mM NH4

+, B = RU2388 (gltB- x pRU976) 10 mM glucose 10 mM NH4

+ 10 mM glutamate, C = RU2389 (gltB- x pRU986) 10 mM glucose 10 mM NH4

+, D = RU2389 (gltB- x pRU986) 10 mM glucose 10 mM NH4

+ 10 mM glutamate.

Both RU2388 (gltB- x pRU976) and RU2389 (gltB- x pRU986) were able to grow in

the presence of glutamate indicating that mutation in gltB restricts amino acid uptake via the

Aap and Bra (Figure 4.2.7.). As expected both strains were unable to use ammonium as the

sole nitrogen source for growth (Figure 4.2.8.). Overall this confirms the earlier observation

that additional amino acid transport is required for growth of strains mutated in gltB, as

transport via the Aap and Bra alone is insufficient. It also confirms the observation that

rhizobia that lack a functional GS / GOGAT pathway are glutamate auxotrophs.

A B

C D

162

Although RU2307 (gltB-) is not complemented for growth by addition of glutamate

to the growth medium when strain RU2307 was grown on 10 mM glucose 10 mM NH4+ 10

mM glutamate AMA large mutant colonies became visible amongst small pin colonies after

approximately 8 days post inoculation (Figure 4.2.9.).

163

Figure 4.2.9. Isolation of RU2307 (gltB-) mutant colonies capable of rapid growth on 10 mM glucose 10 mM NH4

+ 10 mM glutamate AMA.

The frequency for growth of mutant colonies was low but sub-culturing of isolated

colonies back onto 10 mM glucose 10 mM NH4+ 10 mM glutamate AMA indicated once

selected they remained constitutive for rapid growth. Two colonies were purified and

stocked as RU2393 (gltB- Glu+) and RU2394 (gltB- Glu+)

Growth of RU2307 (gltB-) was shown to be complemented for growth in 10 mM

glucose 10 mM NH4+ 10 mM glutamate AMS by the provision of additional amino acid

transport. To determine if the increased growth rate of RU2393 (gltB- Glu+) and RU2393

(gltB- Glu+) with glutamate was a result of increased transport, uptake assays for glutamate,

aspartate, alanine, AIB (25 mM 0.125 mCi 14C) and GABA (25 mM 0.125 mCi 3H) were

performed (Figure 4.2.10.)

164

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

20

40

60

80

1003841 (Wild -Type) RU2307 (gltB-) RU2393 (gltB- Glu+) RU2394 (gltB- Glu+)

Figure 4.2.10. Amino acid uptake by gltB mutant strains showing complementation for growth with glutamate. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

The rate of amino acid uptake in strains RU2393 (gltB- Glu+) and RU2394 (gltB-

Glu+) was 10-fold increased for almost all amino acids over 3841 (Wild-type) and the

parent strain RU2307 (gltB-). Amino acid uptake rates this high have previously only been

reported in strains that overexpress aap or bra from multicopy plasmids (Walshaw et al.,

1996; Hosie et al., 2002a). As the rate of GABA uptake was also increased it indicates this

effect is likely an effect of transport by both Aap and Bra.

Hughes and Poole, Unpublished performed microarray analysis on a strain similarly

selected and isolated for growth on 10 mM glucose 10 mM NH4+ 10 mM glutamate. The

data indicated that this second site mutation might have a global effect on the regulation of a

number of ABC transport systems. Of the fifty genes that showed the greatest upregulation

over the parent strain RU2307 (gltB-), thirty-three are predicted to encode proteins that form

part of an ABC transporter. The diversity in the ABC transport systems upregulated

indicates this is a general effect and is not specific solely to amino acid transporters. Of the

thirty-three genes encoding proteins associated with ABC transporters it includes aapQMP,

braDEFG, RL3543 – RL3546 (encoding an oligopeptide transport system), RL3350 –

165

RL3352 (encoding part of a Fe3+ transport system) and pRL110486 – pRL110488 (encoding

part of a sugar transport system).

A pLAFR1 cosmid library was conjugated into RU2394 (gltB- Glu+) in an attempt to

complement the mutation and abolish the up-regulation in glutamate uptake (Downie et al.,

1983). Complemented colonies can be isolated for the loss of growth on 10 mM glucose 10

mM NH4+ 10 mM glutamate AMA while able to grow on 10 mM glucose 10 mM NH4

+ 10

mM aspartate AMA. Tn5 mutagenesis of any complementing cosmid may then identify any

genes responsible for the elevated levels of amino acid uptake. However, prior to the

conclusion of this work a screen of approximately 250 recovered colonies revealed none

that showed a loss of growth.

3.2.4 Symbiotic properties of gltB mutants.

Ammonium assimilation during differentiation and symbiosis is down regulated, as

there is a shift towards ammonium export. Mature isolated bacteroids of S. meliloti show a

down-regulation of PII and all three GS proteins (Natera et al., 2000). Proteomic analysis of

protein fractions from free-living and bacteroid cells of S. meliloti and B. japonicum

revealed the absence of NtrC, GlnB and GlnK from mature bacteroids (Djordjevic, 2004;

Sarma and Emerich, 2005). In B. japonicum and S. meliloti respectively a small amount of

GlnA and GlnII were however detectable. Nitrogen fixing bacteroids show very low levels

of ammonium assimilation activity and mutations in genes such as glnA, glnII and gltB

resulted in normal nitrogen fixing nodules (De Bruijin et al., 1989; Lewis et al., 1990;

Castillo et al., 2000). In fact expression of gdhA, encoding glutamate dehydrogenase, from

E. coli reduces nodulation efficiency and also has a negative effect on the nitrogen

provision to the plant in mature bacteroids (Mendoza et al., 1998). It would therefore be

expected that mutation of gltB in R. leguminosarum would have no effect on symbiotic

nitrogen fixation. Strains RU2307 (gltB-) and RU2308 (gltB- aldA-) were used to inoculate

onto surface sterilised peas seeds sown into 2l pots (Figure 4.2.11.).

166

Figure 4.2.11. Mutation in gltB leads to loss of bacteroid GOGAT activity and a Fix- plant phenotype. A = Water control, B = 3841 (Wild-type), C = RU1370 (aldA-), D = RU2307 (gltB-), E = RU2308 (gltB- aldA-)

Figure 4.2.12. Nodule morphology for plants nodulated by strains mutated in ammonium assimilation pathways. A = 3841 (Wild-type), B = RU1370 (aldA-), C = RU2307 (gltB-), D = RU2308 (gltB- aldA-), E = RU2308 (gltB- aldA-).

A B C D E

A B

C D

E

167

Plants inoculated with strains mutated in gltB showed a classic Fix- phenotype in

that plants were nodulated, yellow and severely stunted in plant growth due to nitrogen

deficiency (Figure 4.2.11., Plant D; Figure 4.2.11., Plant E). In comparison plants

inoculated by 3841 (Wild-type) and RU1370 (aldA-) were nodulated, green and healthy

(Figure 4.2.11., Plant B; Figure 4.2.11., Plant C). The morphology of RU2307 (gltB-)

induced nodules were also white, reduced in size and more numerate (Figure 4.2.12., C).

The nodules induced by RU2308 (gltB- aldA-) were also white in colour but tended to be

slightly larger and less frequent than those observed for RU2307 (gltB-) (Figure 4.2.12., D).

The Fix- phenotype of RU2307 (gltB-) was complemented when gltBD were supplied in

trans (RU2492 (gltB- x pRU1811)) indicating that the Fix- phenotype is a result of the lack

of GOGAT activity in nodulating strains (Data not shown).

An interesting characteristic of RU2308 (gltB- aldA-) induced nodules was first

noticed on two of the plants from the first experiment. Plant experiments with this strain

were repeated and again on one plant nodules with a previously unreported character were

observed (Figure 4.2.12., E). On roots of the same plant some carried nodules typical of the

Fix- phenotype whilst other roots carried nodules that were white at the base and red at the

tip. Nodules of both type were recovered and strains recovered to screen for contamination.

Nodules were also cut along the divide between the white and red half of the nodule and

strains recovered and screened for contamination. All retained the correct antibiotic

resistance markers for specific for the mutation in gltB and aldA. Plants that carried the red-

white nodules tended to look more pale green in colour and appeared to have slightly

greater plant growth.

Plant dry weights and acetylene reduction were carried out to confirm the Fix-

phenotype of plants inoculated with RU2307 (gltB-) and RU2308 (gltB- aldA-) (Table

4.2.10.; Table 4.2.11.).

Strain Dry weight (g) SEM p value (vs 3841)

Water control 0.50 0.02 2.36 x 10-8

3841 (Wild-type) 1.67 0.10 N/A RU1370 (aldA-) 1.55 0.06 0.65 RU2307 (gltB-) 0.56 0.03 4.22 x 10-8

RU2308 (gltB- aldA-) 0.58 0.04 4.30 x 10-8

Table 4.2.10. Plant dry weight for plants nodulated by strains mutated in ammonium assimilation pathways. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance.

168

Strain Acetylene reduction activity (%)

Water control 0.00 3841 (Wild-type) 100.00 RU1370 (aldA-) 98.65 RU2307 (gltB-) 0.00 RU2308 (gltB- aldA-) 0.00

Table 4.2.11. Acetylene reduction activity for plants nodulated by strains mutated in ammonium assimilation pathways. Number of replicates for calculating percentage activity is n = ≥ 4. 100 % activity = 4.09 ± 0.81 µmol-1 ethylene plant-1 hour-1.

The plant dry weights are conclusive with the observed phenotype of plants

inoculated by all strains. Both RU2307 (gltB-) and RU2308 (gltB- aldA-) appeared nitrogen

deficient and reduced in growth had significantly lower dry weights. The acetylene

reduction activities of plants inoculated with all strains demonstrate the link between plant

phenotype and nitrogenase activity. Mutation in gltB in strains RU2307 (gltB-) and RU2308

(gltB- aldA-) abolished all acetylene reduction activity indicating a lack of functional

nitrogenase and so an absence of nitrogen fixation in nodules. RU1370 (aldA-) retains

nitrogenase activity and plant dry weights are not significantly different from plants

inoculated with 3841 (Wild-type), indicating that the aldA mutation in RU2308 (gltB- aldA-)

is not the cause of the lack of nitrogenase activity.

Mutation of the principal aspartate aminotransferase in R. leguminosarum (aatA)

blocks nitrogen fixation by pea (Lodwig et al., 2003). There is no detectable acetylene

reduction but electron micrographs of nodule sections show bacteroids are fully developed

and appear as wild-type. Light and electron micrographs of sectioned nodules infected with

3841 (Wild-type) and RU2307 (gltB-) were taken and stained by Kim Findlay to determine

the bacteroid number and observe changes to infected cells and nodule tissue (Figure

4.2.13.).

16

9

A

B

Figu

re 4

.2.1

3. L

ight

mic

rogr

aphs

of i

nfec

ted

nodu

les s

tain

ed fo

r sta

rch.

A =

384

1 (W

ild-ty

pe),

B =

RU

2307

( gltB

- )

17

0

A

B

Figu

re 4

.2.1

4. L

ight

mic

rogr

aphs

of i

nfec

ted

nodu

les s

tain

ed fo

r sta

rch.

A =

384

1 (W

ild-ty

pe),

B =

RU

2307

( gltB

- )

171

The light micrograph of RU2307 (gltB-) shows a smaller ratio of infected cells to

uninfected cells compared to 3841 (Wild-type) (Figure 4.2.13., B; Figure 4.2.14., B). Cells

that have been invaded are also abnormally shaped and show an abundance of dark granular

areas in the nodule cortex. This is an accumulation of plant starch granules at the cell

periphery that are absent from 3841 (Wild-type) (Figure 4.2.13., A; Figure 4.2.14., A). As

nitrogenase activity is lacking in bacteroids of RU2307 (gltB-), revealed through acetylene

reduction (Table 4.2.11.), there is no demand for carbon to drive nitrogen fixation, the

hydrolysed products of sucrose are therefore diverted into starch biosynthesis.

172

A B

Figure 4.2.15. Electron micrographs of infected plant cells. A = 3841 (Wild-type), B = RU2307 (gltB-).

The electron micrograph of RU2307 (gltB-) indicates that release of cells from the

infection thread is impeded by mutation in gltB (Figure 4.2.15., B). Symbiosomes of

nodules infected with 3841 (Wild-type) contain fully differentiated bacteroids (Figure

4.2.15., A). On comparison symbiosomes of strain RU2307 (gltB-) containing differentiated

bacteroids occur rarely and when found they are enlarged in size. In some plant cells there

is a visible black region that may represent cell death and failure to progress into mature

nitrogen fixing bacteroids. This explains the lack of nitrogenase by plants nodulated with

this strain and also the Fix- phenotype, which appears more similar to aatA mutants of S.

meliloti than dctA mutants.

The ability of amino acid auxotrophs to invade developing nodules was believed to

indicate that the plant can provide at least some of the amino acids required for bacterial

growth within the nodule (Tate et al., 1997; Tate et al., 1999; Ferraioli et al., 2002). It was

suggested that undifferentiated cells use amino acids as a source of carbon and energy, as a

S. meliloti mutant altered in proline catabolism shows reduced nodule efficiency and

competitiveness (Patriarca et al., 2002). Mutation of gltB reduces the uptake of amino acids

and this appears to impede bacteroid development. Strain RU2307 (gltB-) is unable to carry

out de novo glutamate synthesis, or receive amino acids in sufficient amounts from the plant

to enable bacteroids differentiations.

173

Amino acid uptake is not required for differentiation as a strain mutated in both the

broad range amino acid transporters, Aap and Bra, is able to differentiate fully (Lodwig et

al., 2003). This strain is capable of de novo amino acid synthesis through a functional GS /

GOGAT pathway implying that ammonium assimilation occurs later into bacteroid

development than previously thought. Microarrays and reporter fusions have identified

repression of the genes encoding the principal regulatory and assimilatory proteins, glnA,

glnB, glnK and ntrC, involved in nitrogen metabolism in both mature bacteroids but also

early on in S. meliloti and R. etli bacteroid development (Patriarca et al., 1996; Tate et al.,

1998; Ampe et al., 2003; Becker et al., 2004). Proteomic analysis of S. meliloti and B.

japonicum also reveals the loss of these proteins from mature bacteroids, however they did

detect a weak signal for GlnII protein (Djordjevic, 2003; Sarma and Emerich, 2005). To

determine the expression of the gltBD reporter fusion (pRU1810) in bacteroids plants were

inoculated with RU1416 (Wild-type x pJP2) and RU2481 (Wild-type x pRU1810).

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU1416 (Wild-type x pJP2) 71.50 1.07 RU2481 (Wild-type x pRU1810) 1613.34 121.58

Table 4.2.12. GUS activity of gltBD reporter fusion in RU2391 (Wild-type x pRU1810) 21 day recovered bacteroids. Number of replicates n = ≥ 6

The expression of the gltBD reporter fusion in recovered RU2481 (Wild-type x

pRU1810) bacteroids indicates a high level of expression in R. leguminosarum bacteroids.

However, there was no detectable GOGAT enzyme activity in recovered 21 day 3841

(Wild-type) bacteroids, whilst malate dehydrogenase activity was detected indicating pure

bacteroid extract (Bourdès and Poole, Unpublished). It may be that the regulation of

GOGAT activity therefore largely occurs at a post-transcriptional level, or that the control

of GS / GOGAT is through regulation of the genes coding for the GS enzymes.

Alternatively gltBD expression may occur later in differentiating cells than previously

thought and it is only repressed immediately prior to nitrogenase biosynthesis. Therefore the

GUS enzyme may persist in the nodule up until 21 days post inoculation giving an elevated

indication of gltBD activity.

4.2.5 Complementation of Fix- phenotype of gltB mutants.

Increased amino acid transport can complement for growth of RU2307 (gltB-) on

medium supplemented with 10 mM glutamate. It has been proposed that in the early stages

174

of invasion growing cells are supplied with amino acids whilst the ammonium assimilation

pathways are shut down. Complementation for growth of RU2307 (gltB-) on glutamate was

achieved through additional transport via the GltP and GltS secondary transporters from E.

coli. However expression of gltP and gltS has been shown to be weak in isolated mature

bacteroids (Hosie and Poole, Unpublished). Growth on medium with added glutamate was

also complemented by colonies with second site mutations that elevated the level of amino

acid uptake via Aap and Bra. However, the implications on the regulation of these

transporters have not been fully addressed.

Significant inhibition of uptake via the Aap Bra is indicated in RU2307 (gltB-) when

grown on 10 mM glucose 10 mM NH4+ 10 mM glutamate. However, this might be

compensated for by overexpression of aapJQMP, as indicated by the second site mutations.

Plasmid pRU1134 (aapJQMP x pJP2) was conjugated into RU2307 (gltB-) and RU2308

(gltB- aldA-) (RU2485, RU3943 respectively). To determine the rate of uptake glutamate,

aspartate, alanine, AIB (25 µM 0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) were

assayed for RU2485 (gltB- x pRU1134) relative to its parent strain RU2307 (gltB-) (Figure

4.2.16.).

175

Solute 25 µM 0.125 µCi

Glu Asp Ala AIB GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

20

40

60

80

100

1203841 (Wild-type)

RU2307 (gltB-)

RU2485 (gltB- x pRU1134)

Figure 4.2.16. Amino acid uptake rates for RU2307 (gltB-) complemented with aap. Cells grown overnight in 10 mM glucose 10 mM NH4

+ 10 mM aspartate AMS. Number of replicates is n = ≥ 3 with standard error values.

Strain RU2485 (gltB- x pRU1134) showed increased amino acid transport of all

solutes. With the exception of GABA all amino acids are characterised solutes of the Aap

(Chapter 3). The slight increase in the rate of GABA uptake is possibly due to alleviating

the inhibition of transport via Bra, as the balance of intracellular amino acid levels is likely

restored by the overexpression of Aap.

Strains RU2485 (gltB- x pRU1134) and RU3943 (gltB- aldA- x pRU1134) could

both grow in 10 mM glucose 10 mM NH4+ 10 mM glutamate AMS but not in 10 mM

glucose 10 mM NH4+ AMS and so are glutamate auxotrophs, due to the lack of GOGAT

activity caused by mutation in gltB. This is consistent with the earlier observation that the

lack of growth for RU2307 (gltB-) is due to insufficient amino acid uptake via Aap and Bra,

which can be complemented by amino acid uptake through other transport systems to allow

growth.

Strains RU2485 (gltB- x pRU1134) and RU3943 (gltB- aldA- x pRU1134) were used

to inoculate onto surface sterilised peas seeds sown into 2l pots to determine if increased

176

amino acid transport could compensate for the lowered uptake rates caused mutation in gltB

of RU2307 (gltB-) and RU2308 (gltB- aldA-) (Figure 4.2.17.).

177

Figure 4.2.17. Increased amino acid transport complements the Fix- plant phenotype of gltB mutants. A = Water control, B = 3841 (Wild-type), C = RU2307 (gltB-), D = RU2485 (gltB- x pRU1134), E = RU2308 (gltB- aldA-), F = RU3943 (gltB- aldA- x pRU1134).

Strains RU2307 (gltB-) (Figure 4.2.17., Plant C) and RU2308 (gltB- aldA-) (Figure

4.2.17., Plant E) showed their previously reported Fix- plant phenotype. However, plants

inoculated with either RU2485 (gltB- x pRU1134) and RU3943 (gltB- aldA- x pRU1134)

appeared green and healthy as for 3841 (Wild-type), indicating a supply of fixed nitrogen.

Red nodules were also found on roots of plants inoculated by either strain. To confirm the

plant phenotype strains were isolated from root nodules to confirm correct inoculation and

the shoots taken to determine the dry weight (Table 4.2.13.).

A B C D

A B E F

178

Strain Dry Weight (g) SEM p Value (vs 3841)

Water control 0.46 0.04 1.25 x 10-8 3841 (Wild-type) 1.06 0.06 N / A RU2307 (gltB-) 0.45 0.03 1.46 x 10-8 RU2485 (gltB- x pRU1134) 1.17 0.10 0.31 RU2308 (gltB- aldA-) 0.60 0.04 1.19 x 10-6 RU3943 (gltB- aldA- x pRU1134) 1.18 0.10 0.28

Table 4.2.13. Plant dry weights for water controls, wild-type and gltB mutant strains complemented for Fix- phenotype by increased amino acid transport.. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance. The plant dry weights confirm the Fix+ phenotype of strains RU2485 (gltB- x

pRU1134) and RU3943 (gltB- aldA- x pRU1134). This suggests that the developmental

defect for release of gltB mutants from the infection threads and differentiation into mature

bacteroids has been overcome by increasing amino acid transport into cells.

The plant dry weights for both RU2485 (gltB- x pRU1134) and RU3943 (gltB- aldA-

x pRU1134) are in fact slightly higher than that observed for plants nodulated by 3841

(Wild-type). Castillo et al., 2000 reported that bean plants nodulated with R. etli gltB

mutants whilst not altered in plant dry weight showed an increase in the plant nitrogen

content, which they argued enhanced the symbiotic performance. They suggested this

enhancement was a result of lowered bacteroid amino nitrogen content as no ammonium

assimilation occurred so allowing more nitrogen to be supplied to the plant.

Mature bacteroids of RU3943 (gltB- aldA- x pRU1134) lack the two main pathways

of ammonium assimilation and so de novo alanine synthesis is blocked in this strain, either

directly by AldA or indirectly by GS / GOGAT and transmaination of pyruvate. The loss of

activity in mature bacteroids has no detrimental effect on the symbiotic effectiveness of the

strains indicating that ammonium assimilation is dispensable for symbiotic nitrogen

fixation. This also indicates that the precursor for alanine synthesis must be supplied to the

bacteroid by the plant as part of an amino acid cycle.

179

4.3 Discussion.

This chapter reports the isolation and characterisation of a R. leguminosarum strain

that carries a gltB gene deletion. This mutant lacks any detectable GOGAT enzyme activity

and is interestingly an aspartate auxotroph. The complementation for growth by aspartate

can be abolished by growth with succinate as the sole carbon source. This led to the

demonstration that amino acid transport by Aap Bra alone was insufficient to support

growth of free-living cultures. Additional aspartate transport via the Dct system, which is

excluded by growth on succinate, enabled cells to overcome the growth restrictions imposed

by limited uptake via the Aap and Bra. This was further demonstrated by the addition of

other transporters and the overexpression of aap, which increased the rate of glutamate

uptake and was now able to complement for growth. Strains mutated in gltB were

subsequently therefore found to be glutamate auxotrophs.

The amino acid uptake rates for a gltB mutant indicated that the broad range ABC

transporters Aap and Bra were inhibited for uptake when grown on 10 mM glucose 10 mM

NH4+ 10 mM glutamate. This inhibition of uptake by the Aap and Bra could be relieved

either by aspartate transport via the Dct or glutamate transport by other permeases

expressed in trans. As the inhibition of uptake can be alleviated by Dct, GltP or GltS it

demonstrates that mutation in gltB is not directly regulating Aap and Bra. Instead it

probably acts indirectly by perturbing cellular metabolism. Microarray analysis by Poole

and Hughes, Unpublished indicated rhiABC as being upregulated in RU2307 (gltB-)

compared to 3841 (Wild-type). The rhi genes are located on pRL10 (pRL100169-

pRL100171) between the fix and nod genes and are highly expressed in the rhizosphere

(Dibb et al., 1984; Cubo et al., 1992; Young et al., 2006). However, they are also highly

expressed in the transition to a stationary growth phase indicating growth is severely

impaired by mutation in gltB (Gray et al., 1996). As GOGAT is important for cellular

nitrogen metabolism it is likely that mutation of gltB leads to an imbalance of the

intracellular amino acid concentrations that this inhibits transport via Aap and Bra.

Inhibition of amino acid uptake via the Aap is well documented. Growth in 10 mM glucose

10 mM NH4+ leads to a repression of amino acid uptake by negative regulation of

aapJQMP transcription by NtrC (Walshaw et al., 1997b). When provided as the sole

nitrogen source for growth aspartate further increased this inhibition of amino acid uptake

by an as yet unidentified mechanism, as no change in transcription was observed (Reid et

al., 1996). This inhibition of amino acid uptake in 3841 (Wild-type) when grown with

aspartate is caused by unregulated transport by the Dct system that leads to intracellular

180

amino acid pools and a high nitrogen status. As RU2307 (gltB-) is unaffected for mutation

in the genes coding for GS enzymes the intracellular amino acids could therefore be

corrected when cells are supplied with another amino acid for glutamate biosynthesis via

another transport system.

In this work it has demonstrated that whilst mutation of GOGAT activity does not

have an effect on the ability of mature bacteroids to fix nitrogen, it does however, have a

developmental effect on cell differentiation and release from the infection thread. On

release from the infection thread several nitrogen regulatory genes, such as gstI, ntrC, glnB

and glnK are switched off and there is a down-regulation of genes required for NH4+ uptake

and assimilation (Patriarca et al., 1996; Tate et al., 1998; Ampe et al., 2003; Djordjevic,

2003; Becker et al., 2004; Sarma and Emerich, 2005). As cells grow inside the nodule,

before nitrogenase expression, nitrogen must be provided to the bacteria by the plant. It is

generally accepted that the nitrogen source provided for growth in the early stage of

infection is amino acids and not NH4+, as genes involved in ammonium assimilation are

switched off whilst strains that are amino acid auxotrophs are able to nodulate effectively.

However, this hypothesis appeared to be dispelled by the fact that aap bra mutant strains, in

which amino acid transport is virtually abolished, are sill able to differentiate and express

nitrogenase. This suggests either that another nitrogen donor is made available by the plant

or that ammonium assimilation is not down regulated till much later, if at all. As gltB

mutants can neither transport amino acids effectively nor assimilate nitrogen for amino acid

synthesis then it abolishes bacteroid differentiation. Nodule sections of plants inoculated

with RU2307 (gltB-) confirmed that this strain was capable of growth in infection threads

but not in formation of symbiosomes. The over-expression of aap in RU2307 (gltB-) is able

to overcome the limitation on growth by amino acid transport and also enables cells to

differentiate in infected cells following release from the infection thread. The symbiotic

development of gltB mutants and also aap bra mutants indicate that the plant supplies

amino acids to the infecting bacteria, but if uptake is prohibited then there is sufficient NH4+

for ammonium assimilation to compensate. This would indicate that although the

transcription of genes involved in nitrogen metabolism might be down regulated enzyme

activity persists longer.

The implication for bacteroid amino acid cycling is that de novo ammonium

assimilation by AldA and GOGAT does not account for alanine secretion by bacteroids.

Mutation of both ammonium assimilation pathways demonstrates that the transamination

donor for alanine synthesis is not a product of de novo synthesis. While alanine

dehydrogenase may act to balance the carbon and reductant levels by feeding into alanine

181

secretion it does not account for the synthesis that underpins nitrogen fixation. This

suggests that an amino acid cycle is in operation between plant and bacteroid. However, the

Aap and Bra are only essential for amino acid secretion and uptake must also proceed via

another as yet unidentified transport system.

182

Chapter 5:- Characterisation of a GABA Specific ABC Transport System in R. leguminosarum.

183

5.1 Introduction.

Previous chapters have demonstrated that alanine, or another aliphatic amino acid, is

secreted from bacteroids as part of an amino acid cycle between plant and bacteroid. As the

solute specificity of Aap and Bra was narrowed to identify alanine as the secreted amino

acid, it also indicates that another amino acid transporter either solely, or additionally,

facilitates uptake of the donor amino acid. The identity of this amino acid remains

undetermined as the transport of all common amino acids by free-living cells is abolished

on mutation of aap and bra, indicating this other transporter needs to be nodule specific.

Amino acid uptake assays on isolated bacteroids have also failed to identify the donor

amino acid. This is in part due to it being shown that isolated pea bacteroids are severely

damaged, with cytoplasmic and periplasmic proteins, such as the SBPs AapJ and BraC,

being isolated in the PBS fraction (Saalbach et al., 2002).

High concentrations of GABA have been reported in isolated bacteroids of B.

japonicum. S. meliloti and R. leguminosarum (Streeter, 1987; Miller et al., 1991; Lodwig

and Poole, Unpublished) and more recently using 15N NMR GABA was determined as the

second most abundant amino acid of pea nodules (Scharff et al., 2003). The role of GABA

in bacteroids has been proposed to be in a “GABA shunt pathway” (Fitzmaurice and

O’Gara, 1993). This enables glutamate metabolism to act as a bypass for the OGDH

complex, which may be limited by the low O2 concentration in the nodule. However, the

authors base the GABA shunt pathway on the fact that mutation of SSDH activity confers a

Fix- phenotype. The 2-oxoglutarate decarboxylase pathway also requires SSDH and ODC

activity has been detected in B. japonicum bacteroids (Green et al., 2000). Further evidence

of the GABA shunt pathway not occurring in bacteroids is that the crucial enzyme of this

pathway, glutamate decarboxylase, shows low activity and oxygen dependency in nodules

of both snake bean and soybean (Jin et al., 1990; Salminen and Streeter, 1990; Miller et al.,

1991: Green et al., 2000). An annotated homologue for glutamate decarboxylase is also

absent from the published genome sequences of M. loti, S. meliloti, B. japonicum, R. etli

and R. leguminosarum demonstrating it as not a functional pathway found amongst rhizobia

(Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2004; Gonzalez et al., 2006;

Young et al., 2006).

Whilst the GABA shunt pathway of glutamate metabolism may not occur in

bacteroids due to the absence of GDC activity, the enzymes required for GABA metabolism

are highly expressed. GabT is a 2-oxoglutarate-dependent GABA transaminase induced in

pea bacteroids (Prell et al., 2002). Whilst gabT mutants are Fix+ this may be due to another

184

pyruvate-dependent GABA transaminase, which has also been shown to be very active in R.

leguminosarum bacteroids. This indicates that two routes of amino acid biosynthesis, using

GABA as the transamination donor, readily occur in bacteroids to yield glutamate and

alanine. As a donor amino acid for cycling between plant and bacteroids GABA therefore

represents an attractive candidate. It is proposed that as a consequence of bacteroid

metabolism the TCA cycle is inhibited by the low oxygen tension at the OGDH complex

(Lodwig and Poole, 2003). In the predicted model for amino acid cycling, however,

glutamate acts as the donating amino acid (Lodwig et al., 2003). Glutamate as a

transamination donor yields 2-oxoglutarate, exasperating the problem of the OGDH

complex. Transamination using GABA as the donating amino acid leaves succinate

semialdehyde and enzyme activities of bacteroids indicate high SSDH activity compared to

other enzymes of the TCA cycle (Miller et al., 1991; Prell et al., 2002). This raises an

important issue of whether GABA uptake and subsequent metabolism is essential for

symbiotic nitrogen fixation. GABA uptake by free-living R. leguminosarum occurs via the

broad range amino acid transporter, Bra (Hosie et al., 2002a). However, here we report

GABA uptake independent of the Bra permease that occurs by a novel GABA specific

transporter, but its expression in mature bacteroids remains to be conclusively

demonstrated.

185

5.2 Results.

5.2.1 Selection of rapid growth on GABA by a R. leguminosarum aap bra mutant strain.

As previously reported, mutation in bra leads to a loss of growth for strains on 10

mM GABA, as sole carbon and nitrogen source (Hosie et al., 2002a). However, when strain

RU1722 (aapJQM- braEF-) was grown on 10 mM GABA AMA, as sole carbon and

nitrogen source, large mutant colonies became visible amongst small pin colonies after

approximately 8 days post inoculation (Figure 5.2.1.). Isolated mutant colonies retained this

rapid growth phenotype when sub-cultured into 10 mM GABA AMS. A purified colony

was isolated and stocked as RU1736 (aapJQM- braEF- gst+). RU1736 (aapJQM- braEF-

gst+) retained the same observed growth phenotype for utilisation of other amino acids as

reported for aap bra double mutants (Table 5.2.1.).

Strain 10 mM Glc10 mM NH4

+10mM GABA 10mM Glu 10mM Gln

3841 (Wild-type) +++++ +++ +++ ++++ RU1722 (aapJQM- braEF-) +++++ - - - RU1736 (aapJQM- braEF- gst+) +++++ +++++ - - RU1816 (gst+) +++++ +++++ +++ ++++

Table 5.2.1. Growth of R. leguminosarum strains following 6 days incubation in 10 ml AMS. +++++ = ≥ 7 x 108 CFU ml-1 48 h post inoculation, ++++ = ≥ 7 x 108 CFU ml-1 72 h post inoculation, +++ = ≥ 3.5 x 108 CFU ml-1 72 h post inoculation, ++ = ≥ 3.5x108 CFU ml-1 140 h post inoculation, + = ≥ 2 x 108 CFU ml-1 140 h post inoculation, - = < 2 x 108 CFU ml-1 140 h post inoculation.

186

Figure 5.2.1. Isolation of mutant colonies capable of rapid growth on 10 mM GABA. A = RU1722 (aapJQM- braEF-), B = RU1736 (aapJQM- braEF- gst+).

The growth phenotype of RU1722 (aapJQM- braEF-) and RU1736 (aapJQM-

braEF- gst+) indicates that the ability of RU1736 (aapJQM- braEF- gst+) to grow on GABA

is not conferred by reversion of the braEF deletion. This strain was still unable to grow

either on glutamate or glutamine, which is characteristic for growth of a strain expressing

bra in liquid culture. The random colonies present along the streak line of RU1722

(aapJQM- braEF-) (Figure 5.2.1., A) instead indicate a suppressor mutation with a low

frequency of selection that enables the expression of another GABA transporter. This

transporter would appear to be specific for GABA and not usually expressed in free-living

cells. Once initially selected, the system may be constitutive, as growth of RU1736

(aapJQM- braEF- gst+) resulted in large uniform colonies, which when purified and

reinoculated back on 10 mM GABA AMA do not show random selection of colonies but

complete growth along the streak lines (Figure 5.2.1., B).

To show that the growth of RU1736 (aapJQM- braEF- gst+) on GABA is not just a

consequence of mutation in aap and bra attempts to isolate fast growing colonies of 3841

(Wild-type) were made. After 4-day post inoculation some colonies with a larger

morphology were isolated and subcultured. One in particular was purified and stocked as

RU1816 (gst+). Its growth phenotype matched that of 3841 (Wild-type) except for its

increased growth on GABA, which would seem to indicate no effect on Aap and Bra

expression (Table 5.2.1.).

To determine if the increased growth rate of RU1736 (aapJQM- braEF- gst+) and

RU1816 (gst+) on GABA was a result of increased transport, uptake assays for glutamate,

A B

187

AIB, leucine (25 µM 0.125 µCi 14C) and GABA (25 µM 0.125 µCi 3H) were performed

(Figure 5.2.2).

188

Solute 25 µM 0.125 µCi

Glutamate AIB Leucine GABA

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

10

20

30

40

503841 (Wild-type) RU1816 (gst+) RU1722 (aapJQM- braEF-) RU1736 (aapJQM- braEF- gst+)

Figure 5.2.2. Amino acid uptake for strains showing an increased growth rate on GABA. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

Uptake of GABA by both RU1816 (gst+) and RU1736 (aapJQM- braEF- gst+) was

increased over its respective parent strain. Uptake by RU1816 (gst+) was 3.5-fold higher

than its parent strain 3841 (Wild-type). Whilst GABA uptake by RU1722 (aapJQM- braEF-

) was abolished by mutation in bra, RU1736 (aapJQM- braEF- gst+) showed a rapid rate of

uptake. The difference in the rate of GABA uptake between strains RU1816 (gst+) and

RU1736 (aapJQM- braEF- gst+) is approximately that observed for GABA uptake by 3841

(Wild-type). This indicates that the higher rate of transport in RU1816 (gst+) is due to the

sum of transport via the Bra and another transport system, which is that characterised in

RU1736 (aapJQM- braEF- gst+).

The amino acid uptake rates highlight that the increase in growth rate by these

strains on GABA is a result of an increased supply to the cells. It also demonstrates that for

growth of 3841 (Wild-type) on GABA, as the sole carbon and nitrogen source, uptake is the

rate-limiting factor. The ability of RU1736 (aapJQM- braEF- gst+) but not RU1722

(aapJQM- braEF-) to transport GABA, and the inability of both to transport glutamate, is

189

consistent with the growth phenotype of both strains on these solutes as the sole carbon and

nitrogen source.

RU1736 (aapJQM- braEF- gst+) solely transports GABA indicating no reversion or

suppressor mutation of the bra deletion has occurred in this strain to reconstitute transport

via this permease. RU1816 (gst+) also only demonstrates increased GABA uptake and does

not display an increased uptake rate for the Bra solutes glutamate, AIB and leucine. To

further confirm this in strain RU1816 (gst+) uptake of GABA (25 µM 0.125 µCi 3H) was

assayed in a 20-fold excess of other amino acid solutes of Bra (Figure 5.2.3.).

190

Inhibitory Solute (0.5 mM)

Con

trol

GA

BA

Leuc

ine

Asp

arta

te

Glu

tam

ate

Rat

e (n

mol

-1 3 H

GA

BA

mg-1

pro

tein

min

-1)

0

10

20

30

40

5-am

inop

ento

ic a

cid

Figure 5.2.3. Inhibition of GABA uptake by RU1816 (gst+). Cells grown overnight in 10 mM glucose AMS 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

Uptake of GABA via the Bra is not inhibited by either glutamate or aspartate in R.

leguminosarum bv. viciae A34, as these solutes have a lower affinity than for GABA

(Hosie et al.,2002a). Uptake by RU1816 (gst+) was not affected suggesting that if another

transport system is functioning for GABA uptake then either its specificity is not as broad

as Bra or else, as for the Bra, the affinity of these solutes is lower than GABA. The Bra has

an affinity for leucine more similar to that of GABA and this solute can abolish GABA

uptake in 3841 (Wild-type). However, the rate of GABA uptake by RU1816 (gst+) when

inhibited with leucine was only reduced by approximately a quarter. This indicates that a

secondary permease expressed in RU1816 (gst+) facilitates GABA transport and this system

has a similar rate of uptake and specificity as that seen in RU1736 (aapJQM- braEF- gst+).

Only GABA itself was capable of fully inhibiting transport by both permeases. The GABA

191

analog 5-aminopentoic acid was also capable of significantly inhibiting transport. The

inhibitory effect of 5-aminopentoic acid on GABA uptake via the Bra in 3841 (Wild-type)

is unknown so it is not possible to determine if the inhibition of GABA uptake in RU1816

(gst+) was just on one transport system or a cumulative effect. Due to its apparent narrow

specificity these permease was termed the GABA specific transporter (Gst.)

The identification of the Gst indicates that R. leguminosarum encodes another amino

acid transporter(s) that is not expressed, or inducible, in free-living cells. As strains were

cultured for uptake assays in 10 mM glucose 10 mM NH4+ AMS it shows that although

expression of gst requires selectable pressure by growth on GABA once it is induced then

its expression is constitutive. To identify if there is a basal level of expression or if it can be

further increased in response to GABA RU1736 (aapJQM- braEF- gst+) cultures were

grown overnight in either 10 mM glucose 10 mM NH4+ AMS or 10 mM GABA AMS and

the uptake of GABA (25 µM 0.125 µCi 3H) was assayed (Table 5.2.2.).

Growth Medium (AMS) Rate (nmol-1 mg-1 protein min-1) SEM

10 mM Glucose 10 mM NH4+ 29.22 1.88

10 mM GABA 24.20 1.46

Table 5.2.2. GABA uptake by RU1736 (aapJQM- braEF- gst+) grown on 10 mM glucose NH4

+ vs 10 mM GABA. Number of replicates is n = ≥ 3 with standard error values.

The growth medium did not affect the rate of GABA uptake by RU1736 (aapJQM-

braEF- gst+). This suggests that once selectively induced then expression of the Gst is

constitutive and is not further regulated. This is expected, as this transport system is not

usually expressed in free-living cells.

Whereas GABA transport in R. leguminosarum occurs via Bra, an ABC transport

system, other bacterial GABA transporters are predominately members of the amine,

polyamine, choline (APC) secondary transporter superfamily, which function as solute /

cation symporters or solute / solute antiporters (Metzer and Halpern, 1990; Ferson et al.,

1996; Sanders et al., 1998; Seth and Connell, 2000; Hosie et al., 2002a). The best studied of

these are the GabP permease of E. coli and the GadC of L. lactis, to which the GABA

transporters of B. subtilis and M. bovis share strong homology. BLASTP analysis of the R.

leguminosarum genome reveals no homolog of GabP indicating GABA transport is not via

a secondary transport system (http://www.sanger.ac.uk/cgi-

bin/blast/submitblast/r_leguminosarum). Miura and Mizushima, 1968 and Yamato et al.,

192

1975 described the separation of the outer membrane from the cytoplasmic membrane and

release of periplasmic proteins, such as the SBPs of ABC transport systems. This abolishes

transport via ABC transport systems, such as Bra, but not secondary transport systems, such

as GabP. To determine if GABA transport occurs via a secondary transport system or via an

ABC transport system uptake of GABA (25 µM 0.125 µCi 3H), alanine (500 µM 0.5 µCi 14C) and glucose (25 µM 0.125 µCi 14C) was assayed for whole cells and also for

sphaeroplasts (Figure 5.2.4.).

193

Solute

GABA Ala Glc

Rat

e (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

10

20

30

40

50Whole Cells Sphaeroplasts

GABA (25 µM) Alanine (500 µM) Glucose (25 µM)

Figure 5.2.4. The requirement of RU1736 (aapJQM- braEF- gst+) for a periplasmic SBP to facilitate GABA and glucose uptake. Cells grown overnight in AMS (10 mM glc 10 mM NH4

+). Number of replicates is n = ≥ 3 with standard error values.

Glucose uptake is hypothesised to occur by action of an as yet unidentified ABC

transport system in S. meliloti and R. leguminosarum (Fry, 2000; Barnett et al., 2004).

Optimal growth by R. leguminosarum on alanine requires uptake of alanine via the

secondary Mct permease (Hosie et al., 2002b). Uptake of glucose and alanine occured in

intact cells, but glucose uptake was lost by removal of the outer and periplasmic proteins

indicating it has a requirement for a SBP for transport. As a secondary transport system

alanine uptake via the Mct was retained. RU1736 (aapJQM- braEF- gst+) GABA uptake

was as that observed for glucose indicating that it too has a requirement for a SBP to

mediate transport. This suggests the Gst to be an ABC transport system. GABA uptake via

the Gst is unlike that observed for other bacterial GABA transport, which is predominantly

via secondary APC transporters. Nor is it like the characteristic rhziobial GABA transport,

where it occurs in free-living cells and is only one of a number of solutes transported by a

broad range amino acid ABC transport system, Bra. The Gst appears to be an ABC

transport system that is not usually expressed and is more restricted in its solute range.

194

5.2.2 Tn5 mutagenesis to identify the Gst transport operon.

Identification of ABC transport systems through a technique involving ligand

binding to the SBP separated on a non-denaturing polyacrylamide gel electrophoresis has

proved successful (Nobile and Deshusses, 1988; Le Rudulier et al., 1991; Talibart et al.,

1994). However, the growth phenotype of RU1736 (aapJQM- braEF- gst+) compared to its

parent strain RU1722 (aapJQM- braEF-) on 10 mM GABA AMA favoured a transposon

mutagenesis approach. Mutants in genes encoding Gst should be easily isolated, as they

should lack growth 10 mM GABA AMA.

A RU1736 (aapJQM- braEF- gst+) Tn5 mutant library was created to screen for loss

of growth on 10 mM GABA AMA. Any kanr Tn5 mutant colonies that were capable of

growth on 10 mM glucose 10 mM NH4+ AMA but were significantly reduced or abolished

for growth 10 mM GABA AMA were purified. This initial screen was then rechecked for

its growth phenotype on 10 mM GABA to identify six kanr Tn5 mutant colonies that

showed a total loss of growth and two kanr Tn5 mutant colonies with a reduced growth rate.

Strains that showed a complete loss of growth on 10 mM GABA AMA were stocked

(RU2227 – RU2232), as were those that showed a reduced growth rate (RU2233 and

RU2236). To identify if any of the Tn5 mutant strains, which showed a loss of growth on

GABA, had a reduced capacity for transport GABA (25 µM 0.125 µCi 3H) uptake was

assayed (Table 5.2.3.).

Strain Rate (nmol-1 mg-1 protein min-1)

RU1722 (aapJQM- braEF-) 0.48 RU1736 (aapJQM- braEF- gst+) 25.82 RU2227 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 0.06

RU2228 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 0.00

RU2229 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 0.43

RU2230 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 0.38

RU2231 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 21.67

RU2232 (aapJQM- braEF- gst+ Tn5 - growth on 10 mM GABA) 1.06

Table 5.2.3. Uptake of GABA by RU1736 Tn5 mutant strains showing loss of growth on 10 mM GABA AMA. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 1.

195

Five of the RU1736 (aapJQM- braEF- gst+) Tn5 mutants showed a loss of GABA

uptake. Transport in these strains was reduced to the level shown for RU1722 (aapJQM-

braEF-), where the Gst is not expressed. Only strain RU2232 (aapJQM- braEF- gst+ Tn5 for

loss of growth on 10 mM GABA) retained GABA uptake at the same rate as its parent

RU1736 (aapJQM- braEF- gst+). This suggests it may be a catabolic mutant whereas the

other five are likely transposon mutants in the transport operon.

All strains that showed a complete loss of growth on GABA underwent generalised

transduction, using bacteriophage RL38, back into the parent strain RU1736 (aapJQM-

braEF- gst+) to confirm that the Tn5 transposon was responsible for the growth phenotype.

All RU1736 (aapJQM- braEF- gst+) transduced strains (RU2402 – RU2407) showed a loss

of growth on 10 mM GABA AMA and uptake was also abolished in all strains except

RU2406 (aapJQM- braEF- gst+ Tn5), into which the transposon was transduced from phage

propagated in RU2231 (aapJQM- braEF- gst+ Tn5). This indicates that the Tn5 is tightly

linked to the mutant phenotype in all strains.

Fragments containing the transposon and a portion of flanking DNA were cloned

from all eight of the Tn5 mutants isolated, by SalI digestion of genomic DNA into

pBluescript®SK-. SalI cuts the middle portion of the Tn5 allowing sequencing from one end

of the transposon with the IS50R primer. BLASTN analysis of the R. leguminosarum

genome (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/r_leguminosarum) revealed the

juncture with the 9bp repeat of the Tn5 (Table 5.2.4.).

19

6

Stra

in

Gen

e::T

n5

Inse

rtio

n L

oci

Com

men

t

RU

2227

(aap

JQM

- bra

EF-

gst

+ Tn5

) R

L342

9

3604

972

bp T

CA

CG

GTG

CA

CA

TGC

AC

GT

CT

A

T

GC

↓ G

GC

CC

CG

TCC

TAC

ATC

AA

CC

GC

CA

C 3

6050

21 b

p

Enc

odes

a p

utat

ive

LysR

fam

ily tr

ansc

riptio

nal

regu

lato

r. - g

row

th o

n 10

mM

GA

BA

.

RU

2228

(aap

JQM

- bra

EF-

gst

+ Tn5

) pR

L100

244

24

8916

bp TG

CC

AA

GA

CG

TCG

CG

CA

ATT

TT

GC

C ↓

AT

CA

TG

AC

CG

GA

GC

GC

AG

CA

TT

TT

G 2

4896

5 bp

Enc

odes

a p

utat

ive

flavo

prot

ein

oxyg

enas

e.

- gr

owth

on

10 m

M G

AB

A.

RU

2229

(aap

JQM

- bra

EF-

gst

+ Tn5

) pR

L100

250

25

5167

bp C

TGA

CA

TCC

TGG

GA

CG

AG

GTG

G

TG

G ↓

TG

GC

GA

TC

TTC

ATG

TCC

AG

CC

C

G

AC

255

216

bp

gst

C, e

ncod

es a

put

ativ

e A

BC

tran

spor

ter I

MP

(w

ith h

omol

ogy

to E

. col

i Pot

C).

- gro

wth

on

1

0 m

M G

AB

A.

RU

2230

(aap

JQM

- bra

EF-

gst

+ Tn5

) pR

L100

243

24

8544

bp G

GA

AA

GA

CG

TGG

CTG

GTC

CG

GC

GC

T ↓

GT

TT

CT

GA

CG

GG

GTC

CG

ATG

AT

C

CG

248

593

bp

Enc

odes

a p

utat

ive

hydr

olas

e (w

ith a

n α

/ β fo

ld

at e

nzym

e co

re).

- gro

wth

on

10 m

M G

AB

A.

RU

2231

(aap

JQM

- bra

EF-

gst

+ Tn5

) R

L003

7

4101

9 bp

TC

CG

GC

CC

GG

AC

GC

TGA

TC

GG

C

G

AT

↓ G

AC

GA

AC

AC

GG

CTG

GA

GC

GA

GA

AC

G 4

1068

bp

pck

A, e

ncod

es P

EPC

K. -

gro

wth

on

10 m

M

GA

BA

.

RU

2232

(aap

JQM

- bra

EF-

gst

+ Tn5

) p

RL1

0025

1

2555

38 b

p G

AC

ATC

AC

GC

TGG

AG

GG

CA

AG

A

C

CC

↓ T

GC

TC

GC

CA

CG

CC

GTC

GC

AC

AA

GC

G 2

5558

7 bp

gst

D e

ncod

es a

put

ativ

e A

BC

tran

spor

ter N

BD

(w

ith h

omol

ogy

to E

. col

i Pot

A).

- gro

wth

on

1

0 m

M G

AB

A.

RU

2233

(aap

JQM

- bra

EF-

gst

+ Tn5

) R

L195

6

2063

093

bp G

GA

TCG

ATG

ATG

TCG

GG

CA

TC

G

G

CG

↓ C

CG

GA

CC

GA

TCA

TTG

GC

CG

CG

T

TGC

206

3142

bp

Enc

odes

a p

utat

ive

trans

mem

bran

e pr

otei

n (n

o

hom

olog

y to

kno

wn

cons

erve

d do

mai

ns).

±

gro

wth

on

10 m

M G

AB

A.

RU

2236

(aap

JQM

- bra

EF-

gst

+ Tn5

) R

L432

6

4598

140

bp C

GG

CC

CG

GG

CTT

CG

GC

CA

GG

CG

CA

G ↓

CG

CG

AG

ATG

GA

AG

GC

GC

CG

GC

C

G

TG 4

5981

89 b

p

Enc

odes

a p

utat

ive

trans

mem

bran

e pr

otei

n (n

o

hom

olog

y to

kno

wn

cons

erve

d do

mai

ns).

±

gro

wth

on

10 m

M G

AB

A.

Tab

le 5

.2.4

. Tra

nspo

son

mut

ants

of R

U17

36 (a

apJQ

M- b

raEF

- gst

+ ). Th

e in

sert

ion

site

is gi

ven

as th

e la

st b

ase

of th

e 9

bp re

peat

(bol

d).

197

12344 bp

gstAgstB

gstC

gstD

Tn5 (RU2229)

Tn5 (RU2228)

Tn5 (RU2230)

Tn5 (RU2232)

gstR

pRL100242

pRL100243

pRL100244pRL100245 pRL100246 pRL100247

gabD4

12344 bp

gstAgstB

gstC

gstD

Tn5 (RU2229)

Tn5 (RU2228)

Tn5 (RU2230)

Tn5 (RU2232)

gstR

pRL100242

pRL100243

pRL100244pRL100245 pRL100246 pRL100247

gabD4

Figure 5.2.5. Gst Operon.

Four of the five Tn5 mutations that caused a complete loss of transport and growth

on GABA are located in a 13 kb region of pRL10 that contains genes encoding the putative

components of a member of the polyamine / opine / phosphonate (POPT) ABC transporter

family (Figure 5.2.5.). Two of the four transposon mutants that abolish uptake, RU2229

(aapJQM- braEF- gst+ gstC-) and RU2232 (aapJQM- braEF- gst+ gstD-), located in genes

that encode transport components. To confirm the phenotype that mutation in the genes

coding for this transport system abolished growth on 10 mM GABA mean generation times

were calculated for RU1816 (gst+), RU1736 (aapJQM- braEF- gst+) and RU2229 (aapJQM-

braEF- gst+ gstC-) (Figure 5.2.6., Table 5.2.5.).

The growth rate was measured over 30 hours and the MGT calculated for an 18 hour

period from 4 hours post inoculum using the equation;

Generations (G) = (Log10 OD600nm at 22 hours – Log10 OD600nm at 4 hours) / Log10 2

MGT (Hours) = 18 / g

19

8

A

B

Figu

re 5

.2.6

. Gro

wth

rate

of s

train

s in

A =

10

mM

glu

cose

10

mM

NH

4+ AM

S, B

= 1

0 m

M G

AB

A A

MS.

• =

3841

(Wild

-type

), •

= R

U18

16 (g

st+ ),

• =

RU17

22 (a

apJQ

M- b

raEF

- ), •

= R

U17

36 (a

apJQ

M- b

raEF

- gst

+ ), •

= R

U22

29 (a

apJQ

M-

br

aEF- g

st+ g

stC

- ).

Tim

e (H

ours

)

010

2030

OD600 nm

0.010.1110

Tim

e (H

ours

)

010

2030

OD600 nm

0.010.11

199

Strain 10 mM Glc 10 mM NH4

+ 10 mM GABA

3841 (Wild-type) 3.98 17.33 RU1816 (gst+) 3.92 7.37 RU1722 (aapJQM- braEF-) 4.05 57.48 RU1736 (aapJQM- braEF- gst+) 3.97 6.84 RU2229 (aapJQM- braEF- gst+ gstC-) 3.98 68.43

Table 5.2.5. Mean generation times of strains grown in 10 mM glucose 10 mM NH4+ AMS

relative to 10 mM GABA AMS.

The mean generation times of all strains in 10 mM glucose 10 mM NH4+ AMS were

the same. This demonstrates that induction of and mutation in gst is not detrimental to

glucose metabolism or ammonia assimilation. The growth rate of RU1816 (gst+) in 10 mM

GABA AMS was significantly increased over its parent 3841 (Wild-type). The same was

observed for RU1736 (aapJQM- braEF- gst+) where its growth was greatly increased over

its parent strain RU1722 (aapJQM- braEF-). There is no detectable growth rate for RU1722

(aapJQM- braEF-), however, as this strain lacks all GABA uptake due to a mutation in bra.

Selectable induction of the gst therefore increases the growth rate due to an increased

supply of GABA to the cell. Following gstD is a gene that encodes a putative succinate

semialdehyde dehydrogenase (GabD4). gabD4 appears to be cotranscribed with gstABCD

so it would appear that induction of this operon in strains also confers a higher activity for

enzymes of GABA metabolism, which may account for the faster grow rate. RU2229

(aapJQM- braEF- gst+ gstC-) has a similar growth rate and mean generation time as

RU1722 (aapJQM- braEF-) for growth on GABA. This indicates that mutation in the gst

abolishes both the growth on and uptake of GABA to a level observed in a strain where the

gst had not been selected for constitutive expression.

The complementation of mutant phenotypes is usually achieved using a pLAFR1

cosmid library (Downie et al., 1983). However, complementation using this technique is not

possible as all gst strains contain the tetr cassette, located in the deleted braEF region. The

gst does also not appear to be expressed in free-living cells so complementation with a

cosmid library created from strain not selected on GABA would not restore GABA

transport, except via complementation of the bra deletion. Therefore to confirm these genes

encode the Gst they were supplied in trans on pRK415-1, which contains a lac promoter

upstream of the multiple cloning site to mediate expression (Keen et al., 1998). As

gstABCD encode products that show homology to the spermidine / putrescine PotABCD

ABC transport system of E. coli and not a known GABA transporter, genes were amplified

200

from both 3841 (Wild-type) and RU1736 (aapJQM- braEF- gst+) to determine if the

mutation was due to a change in solute specificity (Furuchi et al., 1991; Kashiwagi et al.,

1993). A 4.2 kb fragment, containing gstABCD and the intergenic region between

pRL100247 and gstA, was amplified form both 3841 (Wild-type) and RU1736 (aapJQM-

braEF- gst+) genomic DNA by PCR using primers p631 and p633. The PCR products were

resolved on a 0.8 % agarose gel and the DNA excised and recovered using Qiagen’s gel

extraction kit. The purified PCR fragments were then cloned directly into pCR 2.1-TOPO

(pRU1604 and pRU1606 respectively). HindIII / XbaI and KpnI / XbaI fragments from

pRU1604 (3841gstABCD x pCR 2.1-TOPO) and pRU1606 (RU1736gstABCD x pCR 2.1-

TOPO) were cloned into pRK415-1 so that each set of transport genes are supplied in trans

both independent of and subject to expression from the lac promoter (pRU1702

(3841gstABCD x pRK415-1), pRU1703 (3841gstABCD x pRK415-1 lac promoter), pRU1689

(RU1736gstABCD x pRK415-1), RU1704 (RU1736gstABCD x pRK415-1 lac promoter)).

Plasmids were then conjugated into RU1979 (aapJ- braC-), in which GABA uptake is

abolished, to generate strains RU2381 (aapJ- braC- x pRU1702), RU2382 (aapJ- braC- x

pRU1703), RU2383 (aapJ- braC- x pRU1689) and RU2384 (aapJ- braC- x pRU1704).

GABA (25 µM 0.125 µCi 3H) uptake was assayed to determine if it was increased in strains

carrying gstABCD in trans (Table 5.2.6.).

Strain Comment Rate (nmol-1 mg-1 protein min-1)

RU1736 (aapJQM- braEF- gst+) N / A 19.86 RU1979 (aapJ- braC-) N / A 0.36 RU2381 (aapJ- braC- x pRU1702) 3841gstABCD 0.74 RU2382 (aapJ- braC- x pRU1703) 3841gstABCD lac promoter 44.07 RU2383 (aapJ- braC- x pRU1689) RU1736gstABCD 0.86 RU2384 (aapJ- braC- x pRU1704) RU1736gstABCD lac promoter 42.04

Table 5.2.6. Complementation of GABA uptake by gst. Cells grown overnight in AMS (10 mM glc 10 mM NH4

+). Number of replicates is n = ≥ 1.

GABA uptake was dramatically increased in both RU2382 (aapJ- braC- x

pRU1703) and RU2384 (aapJ- braC- x pRU1704) relative to their parent strain RU1979

(aapJ- braC-). This demonstrates that the Gst from 3841 (Wild-type) is also a GABA

transporter but that it is not expressed in free-living cells. Neither RU2381 (aapJ- braC- x

pRU1702) nor RU2383 (aapJ- braC- x pRU1689) showed an increase in GABA uptake.

201

This indicates that the gst promoter does not lie within the intergenic region that precedes

gstA.

The two other transposon mutants that abolish GABA uptake, RU2228 (aapJQM-

braEF- gst+ pRL100244-) and RU2230 (aapJQM- braEF- gst+ pRL100243-), are located in

genes approximately 4.5kb upstream of the first gene predicted to encode a component of

this ABC transport system (Figure 5.2.5.). As these two upstream mutations abolish

transport it is hypothesised that they have a polar effect on the expression of the ABC

transport system and so it would appear the entire region is cotranscribed as one operon.

This would be consistent with the earlier observation that the intergenic region of

pRL100247 and gstA does not contain a promoter for gstABCD. The putative gene products

of this large operon were determined by BLASTP analysis (Table 5.2.7.) (Altschul et al.,

1990; http://www.ncbi.nlm.nih.gov/BLAST/).

Gene Comment

gstR (pRL100241) Encodes a putative GntR family transcriptional regulator.

pRL100242 Encodes a putative conserved hypothetical protein.

pRL100243 Encodes a putative hydrolase (with an α / β fold at enzyme core).

pRL100244 Encodes a putative flavoprotein oxygenase.

pRL100245 Encodes a putative flavin-dependent oxidoreductase.

pRL100246 Encodes a putative NADP-dependent aldehyde dehydrogenase.

pRL100247 Encodes a putative conserved hypothetical protein.

gstA (pRL100248) Encodes a putative ABC transporter SBP (with homology to E. coli PotD).

gstB (pRL100249) Encodes a putative ABC transporter SBP (with homology to E. coli PotB).

gstC (pRL100250) Encodes a putative ABC transporter SBP (with homology to E. coli PotC).

gstD (pRL100251) Encodes a putative ABC transporter SBP (with homology to E. coli PotA).

gabD4 (pRL100252) Encodes a putative NADP-dependent SSDH.

Table 5.2.7. Genes and putative gene products of the gst operon.

202

The first gene of the operon would appear to be a transcriptional regulator of the

GntR family. Regulation by this family of regulators is best studied in B. subtilis where the

first gene of the gluconate operon encodes GntR that acts as a negative regulator by binding

to the DNA at the site of the operons promoter to compete with the RNA polymerase (Fujita

and Fujita, 1987). The regulation of the operon with regard to gstR will be addressed later

(Section 5.2.4.).

The function of the six predicted protein products of pRL100242 – pRL100247

appear ambiguous with regard to GABA and amino acid metabolism. Two of these genes,

pRL100242 and pRL100247, encode predicted proteins that are conserved hypothetical in

function. pRL100243 encodes a putative hydrolase with a generalised predicted function

that contains and α / β core. pRL100243 encodes a flavoprotein oxygenases of unknown

function. pRL100245 encodes a putative protein of the flavin-dependent oxidoreductases

family, which comprise an abundant class of cellular enzymes with a wide range of

important cellular functions. In particular this protein shows strong homology to a F420-

dependent N5,N10-methylene tetrahydromethanopterin reductase that catalyzes the reduction

of methylenetetrahydrofolate to methyltetrahydrofolate, using NADH as the reductant

(Sheppard et al., 1999). pRL100246 encodes an NADP-dependent aldehyde dehydrogenase

with homology to members of the PutA family. PutA catalyses the oxidation of proline to

glutamate and its activity in E. coli is regulated by the flavin redox state (Zhu and Becker,

2003). A homolog of E. coli PutA has been identified in B. japonicum and this protein is

similarly regulated (Krishnan and Becker, 2005). However, there is only 31 % identity

between B. japonicum PutA and the predicted protein of pRL100246. The putative aldehyde

dehydrogenase also shows homology to the glutamate-5-semialdehyde dehydrogenase

family, which act in the catabolism of ornithine to glutamate.

As previously stated, GstABCD shows strong homology to the spermidine /

putrescine PotABCD ABC transport system of E. coli (Furuchi et al., 1991; Kashiwagi et

al., 1993). A search of the completed genome sequences for other rhizobia revealed a

number of POPT ABC transport systems in each, most notably M. loti which contained 22

POPT like SBPs (Kaneko et al., 2000; Galibert et al., 2001; Kaneko et al., 2004; Gonzalez

et al., 2006; Young et al., 2006). Homology based alignment of the POPT SBPs from other

rhizobia and proteobacteria reveal other putative Gst and PotD homologs (Figure 5.2.6.).

Sequences obtained from;

R.leguminosarum bv. viciae 3841 – http://www.sanger.ac.uk/Projects/R_leguminosarum

S. meliloti 1021 – http://sequence.toulouse.inra.fr/meliloti.html

203

B. japonicum USDA110 – http://www.kazusa.or.jp/rhizobase/Bradyrhizobium/index.html

M. loti MAF303099 – http://www.kazusa.or.jp/rhizobase/Mesorhizobium/index.html

R. etli CFN42 – http://www.cifn.unam.mx/retlidb/

E. coli K-12 – http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=48994941

P. aeruginosa PAO1 –

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=9946990

L. lactis IL1403 –

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=12724130

204

Figure 5.2.6. Phylogenic tree of POPT SBPs from various organisms based upon predicted protein sequence. Phylip values obtained from ClustalW 1.83 multiple alignment values (http://align.genome.jp/). pRL/RL = R. leguminosarum bv. viciae 3841, SM = S. meliloti 1021, bll / blr = B. japonicum USDA110, mll / mlr = M. loti MAF303099, RHE = R. etli CFN42, ec = E. coli K-12, pa = P. aeruginosa PAO1, ll = L. lactis IL1403.

SMa0392RL4190

SMc01652

RL0763RHE_CH00714

SMc00770

ll_PotD

ec_PotF ec_PotD

SMc01632pa_PotD

SMc00991

pRU120142SMb20284

RL_GstA (pRL100248)RHE_PC00028 SMa0799

SMa1755 blr6645

SMa0950

SMb20383

RL3878 RHE_CH03415SMb21273 RL2013 SMa2209 pRL120172

RL2012

mlr5381mll3669

mll3670mlr7383

mlr6533 mll1024 mlr6992blr3806

mll7188

mll1741

mlr4190

mlr6964mll2885

mlr2023mll8444

blr5574

mll0236

mlr7542 bll6825

mlr7676mlr9377

blr3547

mlr6078mll6256

mll2591

mlr1384

bll3286 bll3242

bll7197 mlr9013

blr3630

205

GstA clusters in a distinctly separate grouping from the characterised PotD and PotF

SBPs of E. coli (Furuchi et al., 1991; Pistocchi et al., 1993). GstA homologs are present in

R. etli and S. meliloti (RHE_PC00028 and SMc0799 respectively) and are found in operons

with the same genetic organisation as that for the gst in R. leguminosarum (Galibert et al.,

2001; Gonzalez et al., 2006; Young et al., 2006). GstA also clusters with a number of POPT

SBPs from both B. japonicum and M. loti. Of these the other Gst transport complex

components share greatest identity to blr6644 – blr6647 from B. japonicum and mll6253 –

mll6255 from M. loti (Kaneko et al., 2000; Kaneko et al., 2004). However, the genetic

organisation of both differs from the gst. This suggests there is some conservation of this

transport system amongst rhizobia.

The final gene of the operon is gabD4 that encodes a protein with homology to

SSDH. A gene coding for SSDH (gabD2) has already been characterised in R.

leguminosarum and forms inducible operon for GABA metabolism with gabT, encoding a

2-oxoglutarate transaminase (Prell et al., 2002). Mutation of gabD2 did not affect growth on

GABA and sequence analysis of the R. leguminosarum genome reveals a total of five genes

encoding putative SSDH enzymes, of which gabD and gadD4 are two. Prell and Poole,

Unpublished determined that gabD4 was transcriptionaly coupled to gstABCD through

assaying the SSDH activity in free-living cultures. RU1736 (aapJQM- braEF- gst+) grown

in the absence of GABA displayed high SSDH activities that were absent from both its

parent RU1722 (aapJQM- braEF-) and 3841 (Wild-type). RU2232 (aapJQM- braEF- gst+

gstD-) has a Tn5 located to gstD, which precedes gabD4 in the operon. This strain also

showed no succinate SSDH activity. Prell and Poole, Unpublished also determined that

GabD4 activity was NAD+-dependent.

Of the Tn5 mutants that did not sequence to the gst operon, but abolished growth on

GABA, only RU2227 (aapJQM- braEF- gst+ RL3429-) demonstrated a loss of GABA

uptake (Table 5.2.3.). The transposon was transduced back into its parent strain, RU1736

(aapJQM- braEF- gst+), and confirmed this as the cause of the mutant phenotype (RU2402).

Cloning and sequencing of the transposon revealed it to lie in RL3429, which encodes a

putative LysR family regulator. Members of the LysR family are approximately 35 kDa in

size, have an N-terminal helix-turn-helix DNA binding domain, frequently show

autorepression, and usually require inducers for activity (Schell et al., 1993). Inducers act to

change either the LysR DNA binding affinity or the promoter architecture (Wang et al.,

1992; Toledano et al., 1994). In rhizobia NodD is the most characterised member of the

LysR family of transcriptional activators (Rostas et al., 1986). The function of the putative

206

LysR protein product of RL3429 in GABA uptake via the Gst was not determined further in

this study. As LysR proteins often act as global regulators the transposon from RU2227

(aapJQM- braEF- gst+ RL3429-) was also transduced into 3841 (Wild type) (RU2408) to

determine any effect on the symbiotic phenotype. Plants inoculated by RU2408 (RL3429-)

were green and healthy with no visible reduction in plant mass (Data not shown). Nodules

were also red in colour as for plants inoculated by 3841 (Wild-type) indicating RU2408

(RL3429-) is unaffected in its ability to establish effective nitrogen fixation.

The Tn5 mutants RU2233 (aapJQM- braEF- gst+ RL1956-) and RU2236 (aapJQM-

braEF- gst+ RL4326-) showed a reduced growth rate on GABA. These transposon mutants

were also not investigated further in this study. In both of these strains the Tn5 sequenced to

genes that encoded putative transmembrane domains, although how these mutations

affected growth on GABA remains unclear. Uptake assays for GABA were not carried out

for these strains neither were the transposons transduced to confirm if the transposon is

tightly linked to the mutant phenotype.

The only RU1736 (aapJQM- braEF- gst+) transposon mutant that abolished growth

on GABA but retained its rate of uptake was RU2231 (aapJQM- braEF- gst+ pckA-) (Table

5.2.3.). The Tn5 insertion sequenced to pckA (RL0037) that encodes PEPCK. In rhizobia

PEPCK is important for gluconeogenesis by mediating the conversion of TCA cycle

intermediates into hexose sugars, via the decarboxylation and phosphorylation of

oxaloacetate into phosphenolpyruvate (McKay et al., 1985; Finan et al., 1988; Osteras et

al., 1991). PEPCK activity is therefore required for growth of rhizobia on organic acids

(Arwas et al., 1985; Finan et al., 1988; Osteras et al., 1991). The growth phenotype of the

isolated pckA Tn5 mutant, RU2231 (aapJQM- braEF- gst+ pckA-), was therefore determined

along with strain RU2409 (pckA), isolated by generalised transduction of the transposon

into 3841 (wild-type) (Table 5.2.8.). The pckA mutants RU2231 (aapJQM- braEF- gst+

pckA-) and RU2409 (pckA-) are similar in their ability to utilise certain carbon sources for

growth. Neither can utilise organic acids consistent with the earlier observed phenotype for

R. leguminosarum pckA mutants (McKay et al., 1985). In rhizobia GABA forms succinate

by action of GabT and SSDH, glutamate forms 2-oxoglutarate by action of AatA, pyruvate

forms actetyl-CoA and oxaloacetate by action of PDH and PYC respectively and arabinose

forms either 2-oxoglutarate or pyruvate (Duncan and Fraenkel, 1979; McKay et al., 1988;

McKay et al., 1989; Rastogi and Watson, 1991; Prell et al., 2002). Carbon sources that are

TCA cycle intermediates, or are metabolised to TCA cycle intermediates, cannot be utilised

by either RU2231 (aapJQM- braEF- gst+ pckA-) or RU2409 (pckA-) for growth. However,

the growth of both strains on carbon sources, such as glucose, inositol and manitol, which

207

feed metabolites into pathways above phosphenolpyruvate, are unaffected compared to their

respective parents RU1736 (aapJQM- braEF- gst+) and 3841 (Wild-type).

In S. meliloti pckA mutants have a reduced in capacity for nitrogen fixation,

however, PEPCK activity is not detectable from isolated bacteroids (Finan et al., 1991). In

R. leguminosarum PEPCK activity is detectable in isolated bacteroids but mutation in pckA

does not affect the symbiotic phenotype (McKay et al., 1985). To confirm the plant

phenotype of mutation in pckA for R. leguminosarum strain RU2409 (pckA-) was inoculated

onto surface sterilised peas in 2 litre vermiculite pots. At 28 days post inoculation plants

were harvested (Figure 5.2.7.).

20

8

Gro

wth

med

ium

(AM

S)

3841

(Wild

-typ

e)

RU

1736

(aap

JQM

-

br

aEF- g

st+ ) R

U22

31 (a

apJQ

M-

braE

F- gst+ p

ckA- )

RU

2409

(pck

A- )

10m

M G

luco

se 1

0 m

M N

H

++++

+ ++

+++

++++

+ ++

+++

10m

M G

AB

A

+++

++++

+ -

- 1

0 m

M G

luta

mat

e ++

+ -

- -

10

mM

Glu

cose

10

mM

Asp

arta

te

+++

++++

++

++

+++

20

mM

Ala

nine

++

++

++++

-

- 2

0mM

Pyr

uvat

e 10

mM

NH

++

+++

++++

-

- 1

0mM

Suc

cina

te 1

0 m

M N

H

++++

+ ++

++

- -

10m

M A

rabi

nose

10

mM

NH

++

++

++++

-

- 1

0mM

Inos

itol 1

0 m

M N

H

++++

++

++

++++

++

++

10m

M M

anito

l 10

mM

NH

++

++

++++

++

++

++++

T

able

5.2

.8. E

ffect

of p

ckA

mut

atio

n on

gro

wth

of R

. leg

umin

osar

um st

rain

s fo

llow

ing

6 da

ys in

cuba

tion

in 1

0 m

l AM

S.

++

+++

= ≥

7 x

108 C

FU m

l-1 4

8 h

post

inoc

ulat

ion,

+++

+ = ≥

7 x

108 C

FU m

l-1 7

2 h

post

inoc

ulat

ion,

+++

= ≥

3.5

x 1

08 CFU

ml-1

72

h po

st

in

ocul

atio

n, +

+ = ≥

3.5x

108 C

FU m

l-1 1

40 h

pos

t ino

cula

tion,

+ =

≥ 2

x 1

08 CFU

ml-1

140

h p

ost i

nocu

latio

n, -

= <

2 x

108 C

FU m

l-1 1

40 h

pos

t

inoc

ulat

ion.

209

Figure 5.2.7. Plant Phenotype of RU2409 (pckA-). A = 3841 (Wild-type), B = Water control, C = RU2409 (pckA-).

Strain RU2409 (Figure 5.2.7., A) was unaffected in its ability to form effective

symbiosis. Plants were green and healthy indicating an adequate supply of fixed nitrogen.

Plant nodules were also red in colour as for those plants inoculated by 3841 (Wild-type).

The water control showed no nodulation and plants were stunted for growth and appeared

nitrogen starved (Figure 5.2.7., B). This confirms the earlier observation that

gluconeogenesis is not required by R. leguminosarum for symbiotic nitrogen fixation

(McKay et al., 1985). The detectable PEPCK activity of isolated R. leguminosarum

bacteroids was hypothesised to be a consequence of the low level of sugars supplied to the

bacteroid. In cells grown on C4 dicarboxylates and gluconeogenic substrates, pckA is highly

expressed but on addition of sugars the pckA expression is repressed. Therefore in

bacteroids only low concentrations of sugars are being received, not enough for bacteroid

metabolism or repression of pckA, but sufficient to act as precursors for biosynthesis.

5.2.3 Ligand recognition properties of the Gst.

During the identification of the Gst it appeared not to transport the common amino

acids, such as glutamate. As it appeared specific for GABA the kinetics of its uptake were

determined using various 3H GABA concentrations in standard uptake assays (Figure

5.2.8.).

A B C

210

GABA µM

0 20 40 60

Rat

e (n

mol

-1 3 H

GA

BA

mg-1

pro

tein

min

-1)

0

10

20

30

40

50

Figure 5.2.8. Kinetics of GABA uptake by RU1736 (aapJQM- braEF- gst+). Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

The Gst has a Km of 8.45 ± 1.36 µM and a Vmax of 42.56 ± 2.07 nmols-1 mg-1 protein

min-1 for GABA. The affinity of the Gst for GABA is closer to that determined for the

GabP secondary transporter from E. coli (Km of 12 µM) than to that of the R.

leguminosarum Bra (Km of 288 nm) (Brecthel and King, 1998; Hosie et al., 2002a).

However, although the Gst has a lower affinity for GABA than the Bra it has a higher Vmax,

which may indicate why the growth rate of RU1736 (aapJQM- braEF- gst+) appears faster

than that of 3841 (Wild-type).

Compared to other proteobacteria GstABCD is closest in homology to the putrescine

/ spermidine PotABCD transport system of E. coli. The affinity (Km) of PotD for putrescine

is 1.5 µM and for spermidine 0.1 µM (Kashiwagi et al., 1990). Putrescine and spermidine

are natural polyamines that are ubiquitous in almost all prokaryotic cells. Polyamines are

known to be involved in the biosynthesis of nucleic acids and proteins as well as to mediate

cell growth and proliferation (Igarashi and Kashiwagi, 1999). Putrescine is metabolised to

spermidine by the addition of an aminopropyl group from decarboxylated S-

adenosylmethionine through the activity of spermidine synthase (Tabor et al., 1986).

211

Putrescine is also metabolised to GABA by putrescine transaminase and subsequent

oxidation, although neither of the genes encoding the proteins for this pathway have been

identified (Shaibe et al., 1985). GABA is an open chain four carbon molecule with a

carboxyl and amino group at the distal ends (Figure 5.2.9., A). Putrescine is also an open

chain four carbon molecule that has an amino group at either end (Figure 5.2.8., B).

Spermidine is larger is size than both GABA and putrescine and is an open chain seven

carbon molecule with an amino group at the distal ends and also in the centre between the

fourth and fifth carbon atom (Figure 5.2.9., C).

212

Figure 5.2.9. The conformation of GABA, putrescine and spermindine. A = GABA, B = Putrescine and C = Spermindine.

To determine if putrescine and spermidine were also solutes of the Gst the effect of

their inhibition on GABA (25 µM 0.125 µCi 3H) uptake was determined (Table 5.2.9.)

Inhibitory Solute (0.5 mM) Rate (nmol-1 mg-1 protein min-1) SEM

Control 25.37 2.94 GABA 0.38 0.38 Putrescine 23.20 0.91 Spermidine 28.28 0.56

Table 5.2.9. Inhbition of GABA uptake in RU1736 (aapJQM- braEF+ gst+) by the polyamines putrescine and spermidine. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

The polyamines putrescine and spermidine were both unable to inhibit GABA

uptake by the Gst in strain RU1736 (aapJQM- braEF- gst+) and only GABA itself inhibited

uptake. The Gst may be able to transport these polyamines but the affinity of these solutes

will be lower than for GABA. The affinity of PotD for putrescine and spermidine is higher

than the affinity of GstA for GABA. As neither polyamine could inhibit uptake this

suggests that the GABA is not an auxiliary solute of a spermidine / putrescine transporter.

The crystal structure of PotD from E. coli has been determined in complex with its primary

ligand spermidine (Sugiyama et al., 1996). Analysis of the residues in PotD essential to

ligand binding may highlight the changes in GstA that give it a differing solute specificty.

The substrate binding site is found in the cleft between two domains, with

alternating β-α-β topology, that show an open and closing movement dependent on ligand

binding (Spurlino et al., 1991). Based on the crystal structure site directed mutagenesis of

residues proposed to be important for spermidine binding identified eight critical and five

moderately important residues (Sugiyama et al., 1996; Kashiwagi et al., 1996). The

A B

C

213

backbone of spermidine is accommodated and anchored by van der Waals interactions in a

hydrophobic box formed by Trp34, Tyr37, Trp229, Trp255 and Tyr293. Four acidic

residues Glu56, Asp168, Glu171 and Asp257 are important for recognising the charged

nitrogen atoms of spermidine through ionic interations. The terminal amino group of

spermidine forms salt bridges with the carboxyl side chains of Asp168 and Glu171 and also

forms hydrogen bonds with Tyr85 and Gln327. The secondary amino group is recognised

by the side chain of Asp257, whilst the first amino group forms a salt bridge with the side

chain of Glu36 and forms hydrogen bonds with Thr35.

GABA does not contain the additional aminopropyl group of spermidine and also

has a carboxyl group at the opposite end of the molecule in place of one of the amino

groups. Binding of putrescine to PotD indicates that the residues that bind the diaminobutyl

moiety of spermidine are not important for putrescine and neither is Trp255 that binds the

backbone of the aminopropyl group of spermidine (Vassylyev et al., 1998). This suggests

that the conservation of these residues will also not be important for binding of GABA to

GstA. Sequence alignment of R. leguminosarum GstA with E. coli PotD may therefore

identify residues important for binding of the methylene backbone and the amino group of

GABA. It may also highlight changes in the residues of GstA that in PotD bind the primary

amino group and aminopropyl group of spermidine (Figure 5.2.10.).

214

Figure 5.2.10. ClustalW 1.83 alignment the R. leguminosarum GstA and E. coli PotD, http://www.ebi.ac.uk/clustalw/. Removal of signal peptide had no effect on alignment of mature proteins. * = residues conserved by all, : = residues conserved according to type, i.e. polar, non- polar, aromatic, aliphatic etc, . = residues that are semi-conserved.

The similarity of GABA to spermidine is through the first four methyl groups of the

molecules backbone and also through its secondary amino group. Of the residues that form

the hydrophobic box to accommodate the backbone of spermidine Trp34, Trp229, Trp255

and Tyr293 were shown to be critical, whilstTyr37 was moderately important. Of these five

residues three are conserved in GstA. Of the two that are not conserved one is Tyr35, which

site directed mutagenesis showed not to be critical, and the other is Trp255, which

accommodates and contacts the backbone of spermidines additional aminopropyl group that

is absent from GABA. The residue Asp257 is critical for the recognition of the

diaminobutyl moiety of spermidine and is conserved between GstA and PotD. This suggests

that this residue in GstA binds the amino group of GABA. There is no other conservation

between GstA and PotD of the residues important for binding the amino groups of

spermidine apart from Asp257. In particular the three acidic residues of PotD critical for the

recognition of the charged first and terminal amino groups of spermidine (Glu36, Asp168,

Glu171) are neutral residues in GstA (Gly32, S160, Gly163 respectively).

To determine what constraints there are on solute structure for transport by the Gst

the inhibitory effect of a range of common amino acid and GABA analogs determined on

GABA (25 µM 0.125 µCi 3H) uptake.

215

Inhibitory Solute (0.5 mM)

Con

trol

GA

BA

L-G

luta

mat

e

L-A

spar

tate

L-A

lani

ne

D-A

lani

ne

L-le

ucin

e

D-L

euci

ne

L-H

istid

ine

Rat

e (n

mol

-1 3 H

GA

BA

mg-1

pro

tein

min

-1)

0

10

20

30

40

Figure 5.2.11. Inhibition of GABA uptake by RU1736 (aapJQM- braEF- gst+) with a range of common amino acids. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

No inhibition was observed by any common amino acids regardless of the isomer, as

a range of L- and D- isomers were tested (Figure 5.2.11.). This confirms the earlier

assumption, based on glutamate leucine and AIB uptake, that this system is not an amino

acid permease with broad solute specificity like that of the Bra, the only other defined R.

leguminosarum GABA transporter.

The inhibition of uptake by GABA analogs was used in characterising the

stereospecificity of the GabP of E. coli and B. subtilis (King et al., 1995a; King et al.,

1995b Brechtel et al., 1996; Brechtel and King, 1998). Using a number of the same

compounds the determinants for solute specificity for the Gst were identified (Figure

5.2.12.; Figure 5.2.13.).

216

4-A

min

obut

yric

Aci

d

Am

inoi

sobu

tyric

Aci

d

L-2-

Am

inob

utyr

ic A

cid

D-2

-Am

inob

utyr

ic A

cid

DL-

3-A

min

obut

yric

Aci

d

3-Pi

perid

ine

Carb

oxyl

ic A

cid

3-A

min

oben

zoic

Aci

d

4-A

min

oben

zoic

Aci

dInhibitory Solute (0.5 mM)

Con

trol

But

yric

Aci

d

Rat

e (n

mol

-1 3 H

GA

BA m

g-1 p

rote

in m

in-1

)

0

10

20

30

40

50

Figure 5.2.12. Inhibition of GABA uptake by RU1736 (aapJQM- braEF- gst+) by a number of GABA analogs. Cells grown overnight in 10 mM glucose 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values.

GABA is a four-carbon molecule with the amino group and carboxyl group at the

distal ends. The fact that putrescine was unable to inhibit GABA uptake by RU1736

highlights a greater affinity for compounds that contain either at least one carboxyl group or

less than one amino group (Table 5.2.9.). Butyric acid was unable to inhibit GABA uptake

indicating that solutes containing an amino group are preferentially transported over those

that do not (Figure 5.2.12.). Both molecules are C4 with a terminal carboxyl group, but

butyric acid lacks an amino group. In addition to this apparent affinity for compounds with

one amino and one carboxyl group, these groups must be at or next to the terminal ends.

Amino-isobutyric acid and both the L- and D- isomers of α-aminobutyric acid are, like

GABA, C4H9NO2 compounds. However, the position of the amino group in all three

217

compounds lies next to the carboxyl group and neither compound is capable of inhibiting

GABA uptake. D-L-α-aminobutyric acid was capable of GABA uptake inhibition but not to

the same degree as GABA itself. The position of the amino group in relation to the carboxyl

group can be seen to be important in the solute recognition and binding. If the position of

the amino group is at C3 or C4 then the ability to inhibit GABA uptake increases. There is

therefore a preference for compounds with C- and N-groups at the distal ends and

specificity is correlated to the distance between them.

218

Carbon Chain Length of Inhibitory Solute (0.5 mM)

Control C2 C3 C4 C5 C6

Rat

e (n

mol

-1 3 H

GA

BA

mg-1

pro

tein

min

-1)

0

5

10

15

20

25

30

35

Figure 5.2.13. Inhibition of GABA uptake by RU1736 (aapJQM- braEF- gst+) by a number open chain amino acid compounds of differing carbon chain length. Cells grown overnight in 10 mM glc 10 mM NH4

+ AMS. Number of replicates is n = ≥ 3 with standard error values. Control = no inhibition, C2 = glycine, C3 = β-alanine, C4 = GABA, C5 = 5- aminopentanoic acid, C6 = 6-aminohexanoic acid.

As GABA is an open chain molecule, and we have demonstrated that the amino and

carboxyl groups must be at the terminal ends, the ligand affinity for compounds of varying

carbon chain length was investigated using other open chain compounds with terminal

amino and carboxyl groups (Figure 5.2.13.). C4 and C5 compounds were both strong

inhibitors of GABA uptake, whilst C3 was a weak inhibitor. C3 molecules appear unable to

bridge the gap between the residues required for binding of the amino and carboxyl groups,

whereas the C5 compound is able to bend its carbon backbone in order to enable

recognition. As the C6 molecule cannot inhibit to the same extent it indicates its affinity is

reduced either due to its size it is not accommodated in the binding cleft, or that the rotation

of the molecule in order for residues to bind the amino and carboxyl groups prevents the

backbone being accommodated in the hydrophobic box.

As mentioned before GABA is an open chain molecule with all bonds capable of

free rotation. We therefore determined whether this ability is important for solute

219

recognition by using compounds which contain an amino and carboxyl group separated by

2, 3 or 4 carbon atoms but are conformationally constrained in cyclic amino acid analogs

(Figure 5.2.12.). The ability of 3-Piperidinecarboxylic acid, 3-aminobenzoic acid and 4-

aminobenzoic acid to inhibit uptake in a similar pattern to that of the open carbon

compounds indicates that the free rotation of bonds is not essential for ligand recognition.

As expected 3-aminobenzoic acid has the greatest inhibitory effect on GABA uptake as the

amino acid and carboxyl groups are separated by four carbon atoms. However, the fact that

the 3-piperidinecarboxylic acid can inhibit to a greater extent than the 4-aminobenzoic acid

shows that the 4 carbon molecule separation of the amino and carboxyl group when

conformationally constrained can no longer be accommodated as easily for solute binding.

5.2.4 Regulation of the gst operon.

The Tn5 insertions upstream of gstABCD in RU2228 (aapJQM- braEF- gst+

pRL100244-) and RU2230 (aapJQM- braEF- gst+ pRL100243-) are polar and abolished

GABA uptake, indicating that they are cotranscribed as part of a large operon. To determine

the site of the gst operon’s promoter a suite of promoter probe vectors were created, using

pRU1097/D-TOPO (Karunakarun et al., 2005) (Figure 5.2.14.). This vector allows rapid

one step directional cloning upstream of a promoterless gfpmut3.1 reporter fusion. The

intergenic regions from pRL100240 to gstA were amplified by PCR from RU1736

(aapJQM- braEF- gst+) genomic DNA using primers pairs of Gst1 to Gst16 and Pfu Turbo,

a blunt ended DNA polymerase to ensure high fidelity and prevent capping of the PCR

products.

220

8491 bp

pRL100244

pRL100243

pRL100242

gstR

pRL100245

pRL100246

gstA

pRL100247

Tn5 (RU2228)

Tn5 (RU2230)

HincII (738)

HincII (1101)

Gst 1 (82.8%)

Gst 10 (78.6%)

Gst 2 (83.9%)

Gst 3 (84.0%)Gst 4 (84.6%)

Gst 5 (92.6%)Gst 6 (77.8%)

Gst 7 (88.0%)

Gst 8 (82.8%)Gst 9 (92.0%)

Gst11 (91.7%)Gst12 (86.2%)

Gst13 (96.4%)Gst14 (80.6%)

Gst15 (88.0%)Gst16 (80.0%)

1 2 3 4 5 6 7 8

8491 bp

pRL100244

pRL100243

pRL100242

gstR

pRL100245

pRL100246

gstA

pRL100247

Tn5 (RU2228)

Tn5 (RU2230)

HincII (738)

HincII (1101)

Gst 1 (82.8%)

Gst 10 (78.6%)

Gst 2 (83.9%)

Gst 3 (84.0%)Gst 4 (84.6%)

Gst 5 (92.6%)Gst 6 (77.8%)

Gst 7 (88.0%)

Gst 8 (82.8%)Gst 9 (92.0%)

Gst11 (91.7%)Gst12 (86.2%)

Gst13 (96.4%)Gst14 (80.6%)

Gst15 (88.0%)Gst16 (80.0%)

1 2 3 4 5 6 7 8

Figure 5.2.14. gst promoter reporter fusions. Primers and primer binding for each fragment is included. 1 = pRU1768, 2 = pRU1769, 3 = pRU1770, 4 = pRU1771, 5 = pRU1709, 6 = pRU1710, 7 = pRU1711, 8 = pRU1712.

PCR products were visualised on a 1.5 % agarose gel as bands of between 600 – 900

bp and recovered using Qiagen’s gel extraction kit, before being cloned into pRU1097/D-

TOPO. Recovered clones were PCR screened using the original primer pairs for correct

insertion of the PCR fragment into pRU1097/D-TOPO. Plasmids containing inserts of the

correct size were stocked (pRU1709 – pRU1712 and pRU1768 – pRU1771) and conjugated

into RU1736 (aapJQM- braEF- gst+) (RU2444 – RU24451 respectively).

Promoter probes were tested with TY broth, 10 mM glucose 10 mM NH4+ AMS and

10 mM GABA AMS in attempt to identify regions that exhibit promoter activity (Figure

5.2.15.).

221

Promoter Probe (pRU1097/D-TOPO)

No 1 No 2 No 3 No 4 No 5 No 6 No 7 No 8

Rela

tive

Fluo

resc

ence

(flu

ores

cenc

e / O

D59

5 nm

)

0

10000

20000

30000

40000

50000

60000

70000TY 10 mM Glucose 10 mM NH4

+

10 mM GABA

Figure 5.2.15. Specific fluorescence of reporter fusion vectors in RU1736 (aapJQM- braEF- gst+) for promoter mapping of the gst operon. No 1 = RU2444 (aapJQM- braEF- gst+ x pRU1768 (pRU1097/D-TOPO x pRL100240 – gstR intergenic region)), No 2 = RU2445 (aapJQM- braEF- gst+ x pRU1769 (pRU1097/D-TOPO x gstR – pRL100242 intergenic region)), No 3 = RU2446 (aapJQM- braEF- gst+ x pRU1770 (pRU1097/D-TOPO x pRL100242 – pRL100243 intergenic region)), No 4 = RU2447 (aapJQM- braEF- gst+ x pRU1771 (pRU1097/D-TOPO x pRL100243 – pRL100244 intergenic region)), No 5 = RU2448 (aapJQM- braEF- gst+ x pRU1709 (pRU1097/D-TOPO x pRL100242 – pRL100243 intergenic region)), No 6 = RU2449 (aapJQM- braEF- gst+ x pRU1710 (pRU1097/D-TOPO x pRL100244 – pRL100245 intergenic region)), No 7 = RU2450 (aapJQM- braEF- gst+ x pRU1711 (pRU1097/D-TOPO x pRL100245 – pRL100246 intergenic region)), No 8 = RU2451 (aapJQM- braEF- gst+ x pRU1712 (pRU1097/D-TOPO x pRL100246 – gstA intergenic region)). Cells grown overnight in 10 ml cultures. Number of replicates is n = ≥ 3 with standard error values.

The promoter probes highlight that the genes pRL10241 – gabD4 are cotranscribed

from a promoter near to gstR. The exact location of this promoter is unknown however, as

sequencing of pRU1769 (pRU1097/D-TOPO x gstR – pRL100242 intergenic region)

revealed the PCR fragment was not in the correct orientation. There is an active promoter

upstream of gstR but this may act only to ensure expression of the GntR like negative

regulator. This family of regulators is best studied in B. subtilis where the first gene of the

gluconate operon encodes GntR, which binds to the DNA at the site of the operons

promoter inhibiting RNA polymerase binding and formation of a closed complex at this site

222

for transcription (Fujita and Fujita, 1987). Binding of the repressor to the operon’s promoter

was inhibited by addition of gluconate allowing expression of the downstream genes. As to

whether the gstR promoter may allow expression entire gst operon when the negative

regulator is sequestered or inactivated is unknown.

To determine more accurately the expression of genes of the gst operon qRT-PCR

was carried out on various Gst expressing strains (Table 5.2.10.; Table 5.2.11.; Table

5.2.12.; Table 5.2.13.). For qRT-PCR the comparative CT method (∆∆CT) was used (Bustin,

2002). This involves comparing the Ct values for genes using RNA of mutant strains with a

control or calibrator such as RNA from the wild-type or parent strain. The Ct values of both

the calibrator and the samples of interest are normalized to an appropriate endogenous

housekeeping gene, in this case mdh. The comparative Ct method is also known as the 2-∆∆Ct

method, where ∆∆Ct = ∆Ct,sample - ∆Ct,reference. The ∆CT,sample is the Ct value for any sample

normalized to the endogenous housekeeping gene (mdh) and ∆Ct, reference is the Ct value for

the calibrator also normalized to the endogenous housekeeping gene (mdh).

22

3

Stra

in

∆Ct g

stR

∆Ct p

RL

1002

42

∆Ct g

stA

∆Ct g

stB

∆Ct g

abD

4

384

1 (W

ild-ty

pe)

3.29

6.

23

6.77

4.

41

5.34

R

U17

22 (a

apJQ

M- b

raEF

- ) 3.

44

5.88

5.

67

4.52

4.

71

RU

1736

(aap

JQM

- bra

EF- g

st+ )

1.16

0.

03

0.47

-0

.64

1.32

R

U22

28 (a

apJQ

M- b

raEF

- gst

+ p

RL10

0244

- )1.

69

0.00

4.

52

3.30

5.

26

Tab

le 5

.2.1

0. ∆

C t v

alue

s for

gen

es o

f the

gst

ope

ron

in R

. leg

umin

osar

um st

rain

s. Ce

lls g

row

n ov

erni

ght i

n A

MS

(10

mM

glc

10

mM

NH

4+ ).

Stra

in

gstR

pR

L10

0242

gs

tA

gstB

ga

bD4

RU

1722

(aap

JQM

- bra

EF- )

0.90

1.

28

2.14

0.

93

1.55

R

U17

36 (a

apJQ

M- b

raEF

- gst

+ ) 4.

38

61.3

9 78

.79

33.1

3 16

.22

RU

2228

(aap

JQM

- bra

EF- g

st + pR

L100

244- )

3.03

75

.06

4.76

2.

16

1.06

T

able

5.2

.11.

Exp

ress

ion

of g

enes

of t

he g

st o

pero

n in

R. l

egum

inos

arum

mut

ant s

train

s rel

ativ

e to

384

1 (W

ild-ty

pe).

Cells

gro

wn

over

nigh

t in

AM

S (1

0 m

M g

lc 1

0 m

M N

H4+ ).

Stra

in

gstR

pR

L10

0242

gs

tA

gstB

ga

bD4

384

1 (W

ild-ty

pe)

1.11

0.

79

0.47

1.

01

0.65

R

U17

36 (a

apJQ

M- b

raEF

- gst

+ ) 4.

86

48.1

7 36

.75

35.7

5 10

.48

RU

2228

(aap

JQM

- bra

EF- g

st+ p

RL10

0244

- )3.

36

58.8

9 2.

22

2.33

0.

68

Tab

le 5

.2.1

2. E

xpre

ssio

n of

gen

es o

f the

gst

ope

ron

in R

. leg

umin

osar

um st

rain

s rel

ativ

e to

RU

1722

(aap

JQM

- bra

EF- ).

Cells

gro

wn

over

nigh

t in

AM

S (1

0 m

M g

lc 1

0 m

M N

H4+ ).

224

Strain pRL100242 gstA

3841 (Wild-type) 0.13 0.09 RU1722 (aapJQM- braEF-) 0.18 0.21 RU1736 (aapJQM- braEF- gst+) 1.83 1.61 RU2228 (aapJQM- braEF- gst+ pRL100244-) 3.23 0.14

Table 5.2.13. Expression of the downstream genes of the gst operon in R. leguminosarum strains relative to expression of gstR. Cells grown overnight in AMS (10 mM glc 10 mM NH4

+). The qRT-PCR data indicated that increased GABA uptake by strain RU1736

(aapJQM- braEF- gst+), compared to its parent strain RU1722 (aapJQM- braEF-), correlates

with a 36-fold higher expression of the gstABCD genes, encoding the components for an

ABC transport system (Table 5.2.11.; Table 5.2.12.). The expression data for RU2228

(aapJQM- braEF- gst+ pRL100244-) also demonstrated that mutation upstream of the

gstABCD is polar and abolishes expression of these genes, consistent with it also abolishing

GABA uptake in this strain. This confirms the earlier hypothesis that the genes from

pRL100242 to gabD4 are cotranscribed.

The expression of pRL100242 relative to gstR, in strains expressing gstABCD,

indicates there is a promoter in the intergenic region between the two genes. There was an

approximate 2-fold increase in expression between gstR and pRL100242 within strain

RU1736 (aapJQM- braEF- gst+) indicating this upregulation must be due to promoter

activity (Table 5.2.13.). It is not possible to precisely determine from the qRT-PCR data

where the principal promoter for the gst operon is located. To determine its exact location

transcriptional reporter fusions in the gst operon on pRL10 are required. It is hypothesised

though that as there is no detectable GABA transport via the Gst in RU1722 (aapJQM-

braEF-) GstR binds in the intergenic region between gstR and prL100242, either to

terminate transcription from the gstR promoter or to inhibit formation of an open complex

from the operon’s primary promoter.

The expression of gstR in the constitutive strains RU1736 (aapJQM- braEF- gst+)

and RU2228 (aapJQM- braEF- gst+ pRL100244-) is approximately 3.5-fold higher than in

3841 (Wild-type) and RU1722 (aapJQM- braEF-) (Table 5.2.11.; Table 5.2.12.). This

suggests that wild-type GstR may also bind to its own promoter negatively affecting

expression, but in constitutively expressing strains GstR activity is reduced, either through

mutation or inducer activity, so there is a rise in expression of both the downstream genes

gstABCD and also in gstR.

225

To determine the effect GstR has on the regulation of the Gst strains RU1736

(aapJQM- braEF- gst+) and RU1816 (gst+) were complemented in trans with gstR amplified

from either 3841 (Wild-type) or RU1736 (aapJQM- braEF- gst+). Complementation with

gstR amplified from both will determine if expression of the Gst in RU1736 (aapJQM-

braEF- gst+) and RU1816 (gst+) is a result of a mutation in the regulator, GstR. Strains were

also complemented with an inframe 3841 (Wild-type) amplified gstR gene deletion to

confirm that a mutation in gstR causes expression of Gst in the constitutively expressing

strains. The gst promoter region, gstR and the intergenic region between gstR and

pRL100242 was amplified by PCR from 3841 (Wild-type) genomic DNA, using primers

p835 and p836 (Figure 5.1.14.). The PCR product was visualised on a 1.5 % agarose gel as

a band of approximately 1.8 kb and recovered using Qiagen’s gel extraction kit before being

cloned into pCR2.1-TOPO (pRU1805). gstR contains two internal HincII restriction sites

that can be utilised to create an inframe deletion. A 363 bp fragment was deleted by

digestion with HincII from pRU1805 (pCR2.1-TOPO x gstR) and the plasmid re-ligated

(pRU1807). For the complementing plasmids gstR was amplified form 3841 (Wild-type)

genomic DNA, RU1736 (aapJQM- braEF- gst+) genomic DNA and pRU1807 (pCR2.1-

TOPO x ∆gstR) using primers p857 and p858. PCR products were visualised on a 0.8 %

agarose gel as bands of between 1.6 – 1.8 kb and recovered using Qiagen’s gel extraction

kit, before being cloned into pRU1097/D-TOPO. The promoter probe vector pRU1097/D-

TOPO was used as this vector also contains a promoterless gfpmut3.1 downstream of the

insertion site. This will allow not only complementation but will also allow expression

analysis to determine where GstR may bind. Plasmids were PCR screened and HindIII

digested to confirm correct fragment insertion and orientation. For all transformations

recovered clones only contained plasmids in which fragments had inserted in the opposite

orientation to the promoterless gfpmut3.1. However, PCR screening and restriction

digestion confirmed the correct fragments were TOPO-ligated into the vector, only in the

wrong orientation. Expression analysis using fluorescence was therefore not carried out.

Plasmids containing gstR fragments amplified from 3841 (Wild-type), RU1736 (aapJQM-

braEF- gst+) and pRU1807 (pCR2.1-TOPO x ∆gstR) fragments were stocked (pRU1815,

pRU1816 and pRU1817 respectively). Plasmids were conjugated into strains RU1736

(aapJQM- braEF- gst+) and RU1816 (gst+) to determine any affect on growth in 10 mM

GABA AMS (Table 5.2.14.)

226

Strain 10 mM Glucose 10 mM NH4

+ 10 mM GABA

RU2498 (aapJQM- braEF- gst+ x pRU1815) +++++ - RU2499 (aapJQM- braEF- gst+ x pRU1816) +++++ +++++ RU2500 (aapJQM- braEF- gst- x pRU1817) +++++ +++++ RU2500 (gst+ x pRU1815) +++++ +++ RU2501 (gst+ x pRU1816) +++++ +++++ RU2502 (gst+ x pRU1817) +++++ +++++

Table 5.2.14. Growth of Gst induced strains on 10 mM GABA AMS, complemented in trans with gstR amplified from either 3841 (Wild-type), RU1736 (aapJQM- braEF- gst-) or pRU1807 (HincII ∆gstR) following 6 days incubation in 10 ml AMS. +++++ = ≥ 7 x 108 CFU ml-1 48 h post inoculation, ++++ = ≥ 7 x 108 CFU ml-1 72 h post inoculation, +++ = ≥ 3.5 x 108 CFU ml-1 72 h post inoculation, ++ = ≥ 3.5x108 CFU ml-1 140 h post inoculation, + = ≥ 2 x 108 CFU ml-1 140 h post inoculation, - = < 2 x 108 CFU ml-1 140 h post inoculation.

Growth on 10 mM GABA of RU1736 (aapJQM- braEF- gst+) was abolished when

gstR amplified from 3841 (Wild-type) was supplied in trans (Table 5.2.14., RU2498).

Growth of RU1816 (gst+) was also significantly inhibited when gstR amplified from 3841

(Wild-type) was supplied in trans (Table 5.2.14., RU2500). However, there was no effect

on growth of RU1736 (aapJQM- braEF- gst+) or RU1816 (gst+) on 10 mM GABA when

gstR amplified from RU1736 (aapJQM- braEF- gst+) was supplied in trans (Table 5.2.14.,

RU2498; Table 5.2.14., RU2501). There was also no effect on growth of RU1736

(aapJQM- braEF- gst+) or RU1816 (gst+) on 10 mM GABA when 3841 (Wild-type) ∆gstR

was supplied in trans (Table 5.2.14., RU2499; Table 5.2.14., RU2502).

This indicates that gstR amplified from 3841 (Wild-type) is able to inhibit

expression of Gst in trans to abolish GABA uptake in strains selected for constitutive

expression. This in trans inhibition of Gst expression is lost when wild-type gstR is mutated

inframe in the coding region of the gene. As gstR amplified from RU1736 (aapJQM-

braEF- gst+) is also unable to inhibit Gst expression in trans it also indicates that there is a

mutation in gstR. Therefore selection of constitutive Gst expression is a selection for a

random mutant in gstR that alters the proteins activity as a negative regulator for the gst

operon.

Microarray and proteomic analysis of S. meliloti indicates expression of the gst

operon in bacteroids. The S. meliloti homolog of pRL100242 (SMa0791) was detected in

proteomic analysis of isolated bacteroids from M. truncatula (Djordjevic, 2004). Expression

of gstA was also shown to be lower in nodulating S. meliloti nif mutant strains, indicating its

227

expression is regulated to occur only in nitrogen fixing bacteroids (Tian et al., 2005).

Expression analysis of gstABCD in R. leguminosarum bacteroids has so far not been

determined. In pea bacteroids the pattern of rRNA and the probable ratio of rRNA to

mRNA are considerably different from RNA of free-living cells making qRT-PCR results

ambiguous (Ramachandran and Poole, Unpublished). Therefore rather than quantitatively

measuring expression RT-PCR was carried out to determine if gstABCD was or wasn’t

expressed in bacteroids (Figure 5.2.16.).

228

A B

Figure 5.2.16. RT-PCR of genes involved in GABA uptake and metabolism (Prell and Poole, Unpublished). A = Bacteroid RNA (250 ng), B = Bacteroid genomic DNA.

Expression of gstABCD would appear to occur in bacteroids. Its expression relative

to that of nifH indicates it is also being transcribed in bacteroids. However, this is only a

rudimentary method of assessing expression and so does not conclusively prove it is

activated in bacteroids. The expression of SSDHs (gabD1 – gabD5) was also investigated

to determine the expression of genes involved in GABA metabolism in bacteroids of R.

leguminosarum. As a control the expression of thiM was also determined, as it is known to

be expressed during early stages of nodulation but not in mature bacteroids (Karunakarun

and Poole, Unpublished)

5.2.5 Symbiotic Phenotype of mutation in gst.

Although it still remains undetermined whether the Gst is expressed in bacteroids

the symbiotic effect of constitutive expression in strains was investigated. Expression of the

Gst is not able to complement the Fix reduced phenotype caused by mutation in aap bra

(Figure 5.2.17.).

gstA

gabD4

gabD3

nifH

gabD1

gabD2

gabD5

thiM

229

Figure 5.2.17. GABA uptake via Gst cannot complement mutation in aap and bra. A = Water control, B = 3841 (Wild-type), C = RU1722 (aapJQM- braEF-), D = RU1736 (aapJQM- braEF- gst+).

Strain RU1736 (aapJQM- braEF- gst+) was unaffected in its symbiotic phenotype

compared to its parent strain RU1722 (aapJQM- braEF-), which was not able to elicit

effective nitrogen fixation. This was expected as mutation in aap bra abolishes the alanine

secretion required for nitrogen fixation. The Gst is an ABC transporter and so is in theory

capable of bi-directional transport, however its solute specificity does not extend to alanine

and so cannot complement the double mutation, which confers the Fix reduced phenotype.

This therefore indicates that if the Gst is to play a role in symbiosis it will likely be for

uptake of a donor amino acid into the bacteroid for amino acid cycling.

An indication of the role GABA may play in stimulating amino acid secretion is that

growth of strain RU1736 (aapJQM- braEF- gst+), but not RU1816 (gst+), in 10 mM GABA

AMS lead to cell flocculation. As strain RU1816 (gst+) was not affected it was hypothesised

that this may be a stress response of high intracellular GABA concentrations, which could

be alleviated by amino acid secretion via Aap and Bra. As the selectable induction of gst

expression leads to constitutive expression then unregulated transport of GABA would

occur in RU1736 (aapJQM- braEF- gst+). To determine if amino acids were indeed

secreted by strains glutamate, aspartate and alanine concentration were determined for

supernatant following growth in 10 mM GABA AMS (Table 5.2.15.).

A B C D

230

Strain Glutamate (nmol-1 ml-1)

Aspartate (nmol-1 ml-1)

Alanine (nmol-1 ml-1)

3841 (Wild-type) ≤ 5.00 ≤ 5.00 ≤ 5.00 RU1816 (gst+) ≤ 5.00 40.39 26.10 RU1736 (aapJQM- braC- gst+) ≤ 5.00 ≤ 5.00 ≤ 5.00

Table 5.2.15. Amino acid concentrations in growth media of strains expressing gst. Cells grown overnight, resuspended, washed and grown for a further 4 hours in 60 mls 10 mM GABA AMS. Number of replicates is n = ≥ 6.

Very low levels of aspartate and alanine were detected in the supernatant from

RU1816 (gst+). As this secretion was absent from RU1736 (aapJQM- braC- gst+) it suggests

that this occurs via Aap and Bra in response to the high intracellular amino acid

concentration. Aspartate and alanine were shown to be secreted by isolated pea bacteroids

on addition of malate and glutamate (Appels and Haaker, 1991). In bacteroids GABA is

readily converted to glutamate by action of GabT so a similar route to aspartate and alanine

secretion would also be expected if GABA were supplied as a donor amino acid (Prell et al.,

2002).

As mutation of aapJ and braC restricts the solute specificity of these two broad

range amino acid transporters to alanine then mutation in gst in concert will allow us to

determine the role of GABA transport via this permease in symbiosis. In the same way

further mutation in braC3 abolishes alanine secretion and causes a loss of effective nitrogen

fixation so should mutation in the uptake system that transports the donor amino acid cause

a loss of effective nitrogen fixation. Although Tn5 mutations have been isolated in genes

encoding the structural components of Gst a markerless gst deletion mutant was preferred,

to prevent the build up of antibiotic resistance markers in mutated strains and also allow

further mutagenesis. The amplification and cloning of gstABCD has been previously

described. Invitrogen GeneJumperTM kanr in vitro mutagenesis was carried out on pRU1704

(pRK415-1 x gstABCD) and recovered kanr colonies PCR screened, using either P631 or

p633 and the Mu End primer. Colonies carrying insertions in gstABCD were indicated by

PCR products of between 0.9 to 4.2 kb. Two clones were identified and stocked (pRU1705

and pRU1706). To determine the exact juncture of the mutation plasmid DNA from both

clones was sequenced using the GeneJumperTM sequencing primers A and B. The

GeneJumperTM kanr mapped to gstA in pRU1705 and gstB in pRU1706. As the juncture of

the GeneJumperTM kanr insertion mapped between two MfeI restriction sites, in gstB of

pRU1706, this plasmid was used for further analysis (Figure 5.2.18.).

231

6377 bp

gstA

gstB gstC

gstD

gabD4

Genejumper kanr (pRU1706)

mfeI (1844)

mfeI (2580)

mfeI (5220)p631 (100.0%)

p633 (100.0%)

GACC AACCTGCTGGCCCGCACCTA T GCCTGGATGGTGCTT

3716420 3716440

6377 bp

gstA

gstB gstC

gstD

gabD4

Genejumper kanr (pRU1706)

mfeI (1844)

mfeI (2580)

mfeI (5220)p631 (100.0%)

p633 (100.0%)

GACC AACCTGCTGGCCCGCACCTA T GCCTGGATGGTGCTT

3716420 3716440

Figure 5.2.18. Genetic arrangement gstABCD and surrounding DNA. The juncture of the GeneJumperTM insertion used for mutagenesis is shown above. Also shown are the primer binding sites and restriction sites used in mutation.

The region containing gstB::Tn GenejumperTM kanr was cloned as a 3.5 kb SphI /

SpeI fragment into pJQ200SK- (pRU1708). Conjugation of pRU1708 (pJQ200SK- x gstB-)

into 3841 (Wild-type), RU1816 (gst+), RU1979 (aapJ- braC-) and RU1736 (aapJQM-

braEF- gst+) lead to direct gene replacement through sucrose selection, on 10% sucrose

10mM NH4+ AMA. Recovered kanr gens colonies were PCR screened for correct integration

using the Mu End primer and Gst13, which is set back from the p633 site used for

amplification. A fragment of 2.3 kb amplified by Gst13 and Mu End indicated correct gene

replacement and colonies that screened correctly were stocked (RU2396, RU2397, RU2398

and RU2399 respectively). To further confirm successful gene replacement and also to

ensure that mutation in gstB abolishes transport via the Gst, GABA (25 µM 0.125 µCi 3H)

uptake assays were performed on the Gst expressing gstB mutant strains, RU2397 (gst+

gstB-) and RU2399 (aapJQM- braEF- gst+ gstB-) (Table 5.2.16.).

232

Strain Rate (nmol-1 mg-1 protein min-1) SEM

RU1816 (gst+) 27.23 2.55 RU2397 (gst+ gstB-) 8.24 0.77 RU1736 (aapJQM- braEF- gst+) 18.37 0.72 RU2399 (aapJQM- braEF- gst+ gstB-) 0.53 0.10

Table 5.2.16. GABA uptake by Gst expressing strains mutated in gstB. Cells grown overnight in AMS (10 mM glc 10 mM NH4

+). Number of replicates is n = ≥ 3 with standard error values.

Strains RU2397 (gst+ gstB-) and RU2799 (aapJQM- braEF- gst+ gstB-) both show a

loss of GABA uptake via the Gst. This indicates that mutation in gstB in RU2396 (gstB-)

and RU2398 (aapJ- braC- gstB-) will also abolish GABA uptake by this system if expressed

in the nodule.

To isolate a markerless gstB deletion pRU1708 (pJQ200SK- x gstB::Tn

GeneJumperTM kanr) was MfeI digested to remove a 1.8 kb region containing the gstB-::Tn

GeneJumperTM kanr (Figure 5.2.18.). This plasmid was then conjugated into RU2398 (aapJ-

braC- gstB-) for direct gene replacement through sucrose selection, on 10% sucrose 10mM

NH4+ AMA. Recovered kans gens colonies were PCR screened for correct integration using

the primers Gst13 and p631. A fragment of 3.4 kb indicated correct gene replacement and

the colony was stocked (RU2504). RU1979 (aapJ- braC-) RU2398 (aapJ- braC- gstB- kanr)

and RU2504 (aapJ- braC- gstB- kans) were plated onto 10 mM GABA AMA. Following 8

days post inoculation large mutant colonies became visible amongst small pin colonies for

strain RU1979 (aapJ- braC-) but not strains RU2398 (aapJ- braC- gstB- kanr) and RU2504

(aapJ- braC- gstB- kans), indicating mutation in the gst of these strains.

Strains RU1979 (aapJ- braC-) and RU2504 (aapJ- braC- gstB- kans) were used to

inoculate onto surface sterilised peas seeds sown into 2l pots to determine if GABA uptake

via the Gst fuelled nitrogen fixation (Figure 5.2.19.; Table 5.2.17.).

233

Figure 5.2.19. Mutation in gst does not abolish symbiotic nitrogen fixation. A = Water control, B = 3841 (Wild-type), C = RU2396 (gstB-), D = RU1979 (aapJ- braC- ), E = RU2504 (aapJ- braC- gstB- kans).

Strain Dry Weight (g) SEM p Value (vs 3841)

Water control 0.52 0.10 1.04 x 10-4 3841 (Wild-type) 1.58 0.09 N / A RU2396 (gstB-) 1.26 0.11 0.06 RU1979 (aapJ- braC-) 1.29 0.12 0.09 RU2504 (aapJ- braC- gstB- kans) 1.31 0.04 0.05

Table 5.2.17. Plant dry weights for gstB mutant strains. Number of replicates is n = ≥ 15 with standard error values. T-Test values are subject to two-tailed distribution and two-sample unequal variance.

The symbiotic phenotype of strain RU2396 (gstB-) (Figure 5.2.19., C.) and RU2504

(aapJ- braC- gstB- kans) (Figure 5.2.19., E) indicate GABA uptake by the Gst is not

important for effective nitrogen fixation.

Analysis of the R. leguminosarum genome sequence allowed identification of a

number of other POPT ABC transport systems that show similarity to the Gst (Young et al.,

2006). To determine if GABA is still being transported into bacteroids plasmid pJPT6 (pJP2

x gabT promoter region) was used a promoter probe for GABA levels in bacteroids. The

gabT promoter was cloned into the stable promoter-probe vector pJP2, suitable for the study

of transcriptional GUS fusions in free-living bacteria and during symbiosis (Prell et al.,

2002). The expression of gabT in R. leguminosarum bv. viciae VF39 was shown to be

induced by GABA and repressed by succinate. To determine if this plasmid can function as

a promoter probe for GABA in R. leguminosarum bv. viciae 3841 pJPT6 (pJP2 x gabT

promoter region) was conjugated into 3841 (Wild-type), RU1816 (gst+), RU1979 (aapJ-

A B C D E

234

braC-) and RU2504 (aapJ- braC- gstB- kans). Strains were not stocked so have no assigned

strain number.

235

Growth Media

10 mM GABA Bacteroid

GU

S A

ctiv

ity (n

mol

-1 m

g-1 p

rote

in m

in-1

)

0

2000

10000

12000

14000

10 mM Glucose10 mM NH4

+

RU1416 (Wild-type x pJP2) 3841 (Wild-type) x pJPT6 RU1816 (gst+) x pJPT6 RU1979 (aapJ- braC-)x pJPT6 RU2504 (aapJ- braC- gstB- kans) x pJPT6

Figure 5.2.20. GUS activity of the gabT promoter probe in bacteroids and free-living strains grown in 10 ml AMS. Number of replicates is n = ≥ 6 with standard error values

The promoter probe pJPT6 (pJP2 x gabT promoter region) shows increased activity

in cells of both 3841 (Wild-type) and RU1816 (gst+) grown in 10 mM GABA AMS,

consistent with its reported activity (Prell et al., 2002). There is no apparent decrease in the

level of gabT expression in bacteroids of RU1979 (aapJ- braC-) and RU2504 (aapJ- braC-

gstB- kans) (Figure 5.2.20.). This would indicate that mutation in braC and gst does not

abolish the presence of GABA in symbiotically effective bacteroids suggesting other

transport mechanisms may be active for GABA uptake. The expression of gabT was shown

to decrease 3-fold over a 24 hour period from its maximal level, 4 hours post inoculation

(Prell et al., 2002). Expression was, however, maintained in cultures grown in 10 mM

GABA 10 mM glutamate AMS. This may explain the difference in the GUS activity

between bacteroids and cells grown in 10 mM GABA AMS.

236

5.3 Discussion.

The data indicate Gst is an ABC transporter of the POPT family with homology to

the PotABCD putrescine / spermidine transport system in E. coli. However, the Gst appears

specific for GABA and not other amino acids or polyamines. The solute specificity of the

Gst is typical of that observed for the secondary APC transporter GabP in E. coli (King et

al., 1995a; King et al., 1995b; Brechtel et al., 1996). The stereospecificity of the Gst was

characterised and the Gst was determined to have a Km of 8.45 ± 1.36 µM and a Vmax of

42.56 ± 2.07 nmols-1 mg-1 protein min-1 for GABA. The affinity of the Gst for GABA is

significantly lower than the Bra, the only other identified transporter in R. leguminosarum

with specificity for GABA (Hosie et al., 2002a). However, the Vmax is significantly higher,

which explains the observed phenotype of strains that are mutated in bra but expressing Gst

having a faster growth rate than 3841 (Wild-type). The solute specificity of the Gst shows

that the recognition of compounds for effective binding requires that they contain at least a

carbon chain of four or five atoms with a carboxyl and an amino group at either end. Other

four carbon open chain compounds such as putrescine and butyric acid lack the carboxyl

and amino groups respectively and are not capable of inhibiting GABA uptake. These

compounds may be bound and transported by the Gst but the affinity is lower than GABA,

indicating that for strong binding to occur interaction of the carboxyl and amino groups is

required with residues on the GstA. The increased affinity for solute binding with both the

amino and carboxyl groups is further highlighted by the reduced ability of a three-carbon

open chain molecule to inhibit GABA uptake. As the terminal groups cannot bridge the gap

for binding with residues of the GstA, for both the amino and carboxyl group, then the

affinity is reduced. As 3-piperidinecarboxylic acid can inhibit GABA uptake it indicates this

transporter may also allow the uptake of large aromatic compounds. The putative protein

products of the upstream genes pRL100243 – pRL100246 encode amongst others a

hydrolase, flavin-dependent oxygenase and an aldehyde dehydrogenase that may be

involved in the release and catabolism of side chains, and breakage of the aromatic ring.

Transposon mutagenesis revealed the Gst was encoded by four genes that form part

of a large (approximately 12 kb) operon under the putative regulation of a negative

regulator GstR, a member of the GntR family. gstA encodes a SBP with 28 % homology to

PotD of E. coli, gstB and gstC encode IMPs with 33 % and 29 % homology to PotB and

PotC of E. coli and gstD encodes a NBD with 40 % homology to PotA of E. coli. TMPred

prediction for the IMPs GstB and GstC indicate both form six putative transmembrane

domains, with the N-termius located in the cell cytoplasm (Hofmann and Stoffel, 1993).

237

Regulation of gst is controlled by the a GntR like regulator, GstR, encoded upstream of

gstABCD and is putatively the first gene of the gst operon. GstR appears to have a high

frequency of mutation in response to growth on GABA as sole carbon as expression of Gst

could be selectively induced in both aap bra double mutants and 3841 (Wild-type).

Whereas gstR amplified from 3841 (Wild-type) and supplied in trans was able to repress

Gst expression, gstR amplified from RU1736 (aapJQM- braEF- gst+) was not. An inframe

deletion in the gstR amplified from 3841 (Wild-type) also abolished the repression of Gst

expression, indicated that there is a likely a mutation in gstR in RU1736 (aapJQM- braEF-

gst+) that allows expression of the distal genes gstABCD. Expression of the genes

downstream from gstR is increased in strains selected for constitutive expression and

transport of GABA. A transposon mutation upstream abolishes expression of gstABCD

indicating all genes of the operon are cotranscribed under the control of the same upstream

promoter. qRT-PCR analysis predicts promoter activity in the intergenic region between

gstR and pRL100242. Whether this is the primary promoter of the gst remains to be

determined. It is also possible that the gstR promoter, identified through a suite of promoter

probe vectors, is the principle promoter for the operon. Expression may be regulated in a

manner similar to the gluconate operon in B. subtilis , the classical model of GntR

regulation (Fujita and Fujita, 1987). In either case it would appear that in 3841 (Wild-type)

GstR binds to the gst promoter region through its helix-turn-helix motif to abolish

transcription of the genes encoding the transport complex. Further work on the regulation

by primer extension analysis would reveal the primary promoter of the gst. Determining the

regulation and action of GstR will also identify if the Gst is expressed in bacteroids.

Streeter, 1987, reported cytosolic concentrations of GABA from soybean nodules at

71µg-1 g-1 fresh weight, whilst more recent NMR studies have put the concentration of

GABA in pea nodules at being 5.72µmol-1 g-1 fresh weight (Scharff et al., 2003). High

GABA concentrations have also been reported in isolated bacteroids in S. meliloti (41 nmol-

1 mg-1 protein) and R. leguminosarum (Miller et al, 1991; Lodwig and Poole, Unpublished).

Given the evident lack of either GDC activity and also lack of a putative GDC gene in the

sequenced genomes of R. leguminosarum, S. meliloti, M. loti, R. etli and B. japonicum, it

appears the GABA shunt pathway does not occur in bacteroids (Jin et al., 1990; Salminen

and Streeter, 1990; Green et al., 2000; Kaneko et al., 2000; Galibert et al., 2001; Kaneko et

al., 2004; Gonzalez et al., Young et al., 2006). However, genes involved in the metabolism

of GABA are highly expressed in bacteroids as the activity of two GABA transaminases (2-

oxoglutarate dependent transaminase and pyruvate dependent transaminase) and SSDH are

all high in isolated pea bacteroids (Prell et al., 2002). As part of an amino acid cycle GABA

238

is therefore highly attractive as the donor amino acid. It is abundant in both bacteroids and

plant cytosol, donates directly for glutamate and alanine synthesis and the enzymes

involved in its metabolism are highly expressed in bacteroids. As mutation of aapJ and

braC abolished all amino acid transport but alanine in free-living cells, then any amino acid

permease involved in uptake of a donor amino acid would require it to be nodule specific.

While expression of the Gst in R. leguminosarum was not fully determined, expression of

the gstA homolog SMa0799 in S. meliloti has been shown to be nodule specific. The protein

encoded by the upstream gene SMa0791 was also identified in proteomic analysis of S.

meliloti bacteroids as being nodule specific. An import system with narrow solute

specificity such as the Gst would also be expected to prevent re-uptake of the secreted

alanine back into the bacteroid. However, mutation in the gst both in 3841 (Wild-type) and

an aapJ braC mutant has no effect on the symbiotic plant phenotype. This indicates that if

GABA is to act as the donor for amino acid cycling then transport via another as yet

unidentified transporter occurs. The use of the GABA inducible gabT promoter, on the

stable reporter fusion vector pJP2, as a reporter fusion indicates levels of GABA are still

present in aapJ- braC- gstB- mutant bacteroids. A number of other POPT ABC transport

systems are present in the R. leguminosarum genome representing putative targets for

further mutation (Young et al., 2006).

239

Chapter 6:- Discussion.

240

Studies on isolated pea bacteroids have previously indicated that alanine was an

accessory secretion product of nitrogen fixation in vitro, but its role in planta was not

determined (Waters et al., 1998; Allaway et al., 2000). Modification of the broad range

amino acids transporters, Aap and Bra, of R. leguminosarum provided an approach for

determining the in vivo effect of alanine secretion, which did not affect the physiological

state of the nodule. Restriction of the specificity for amino acid uptake by mutation in aapJ

and braC established that aliphatic amino acid transport was not abolished in free-living

cultures. An alternative SBP (BraC3) capable of interaction with the BraDEFG membrane

complex was characterised and shown to facilitate uptake of alanine, leucine, valine and

isoleucine. The solute specificity for BraC3 is therefore not as broad as that for BraC and is

similar to the LivJ and BraC SBPs, from E. coli and P. aeruginosa respectively, in its

restriction to the binding and transport of aliphatic amino acids, (Higgins and Ames, 1981;

Hoshino, 1979; Hoshino and Kose, 1990). A strain that was restricted to aliphatic amino

acid uptake was able to establish effective nitrogen fixation but this was abolished on

mutation of the three genes encoding the Aap and Bra SBPs. This indicates that aliphatic

amino acid transport is required for symbiotic nitrogen fixation with pea. Secretion of

alanine to be secreted by isolated pea bacteroids and is the most abundant aliphatic amino

acid present in the nodule. It is therefore proposed that alanine transport via Aap Bra is the

minimum requirement for effective symbiosis. This requirement for alanine transport by

bacteroids was further demonstrated by complementation of the Fix reduced Aap Bra

integral membrane mutant phenotype with the aliphatic amino acid Bra transporter from P.

aeruginosa. The expression of this permease in bacteroids, regulated by the aap promoter

and ribosome binding site, conferred a Fix+ phenotype on plants. There was a slight

reduction in the dry weight, approximately 25 %, but this is expected due to the possible

limits on protein expression and activity between proteobacteria.

A key question is whether the transport of alanine is uptake to supply the cells with

amino acids or secretion to the plant as part of a cycle. Alanine is not regarded as a common

transaminating donor for the biosynthesis of other amino acids. If alanine were being taken

into bacteroids as a donor amino acid then it would have also been expected that the Fix

reduced phenotype of an aap bra mutant would be complemented by the constitutive

expression of the Gst, for GABA transport. This is because there are two routes for GABA

transamination highly expressed in bacteroids, GABA 2-oxoglutarate aminotransferase

(GabT) and GABA pyruvate transaminase (OPT). These would provide glutamate and

alanine. However, expression of Gst showed no complementation of the Aap Bra double

mutant Fix reduced phenotype. If the uptake of alanine by the bacteroids is not required as a

241

donor amino acid then the other possibility is that it may have some requirement as a carbon

source. Double mutation in the alanine catabolic enzymes AldA and Dad had no effect on

the symbiotic plant phenotype indicating alanine secretion not uptake by bacteroids, in

accordance with the earlier observations for isolated pea bacteroids (Appels and Haaker,

1991; Allaway et al., 2000).

By restricting the amino acid specificity of Aap and Bra for aliphatic amino acids it

blocked the uptake of the common transmination donors, glutamate and aspartate. Therefore

if an amino amino acid cycle is in operation between the two symbionts then uptake of the

donor amino acid must occur via another transport permease, as yet unidentified.

Alternatively de novo alanine synthesis and secretion could occur in bacteroids to rid the

cell of excess carbon compounds. To determine the role of de novo amino acid synthesis in

bacteroids the two main pathways for ammonium assimilation, GS / GOGAT and AldA,

were mutated. Mutation of GOGAT had an inhibitory effect on the uptake of amino acids

via Aap and Bra into cells to prevent growth on media with added glutamate. Strains

mutated for GOGAT were also Fix- and electron micrographs of nodule sections

demonstrated they were impaired in their ability to differentiate into mature bacteroids.

Complementation for growth of GOGAT mutants on glutamate was possible by

overexpression of an amino acid permease that can transport glutamate, such as Aap, GltP

or GltS. As well as complementing the growth phenotype overexpression of Aap was also

able to complement the symbiotic phenotype. This shows that bacteroid development

requires a plentiful supply of amino acids. These can be supplied either by de novo

synthesis (GS / GOGAT) or transport via Aap Bra. In addition mature bacteroids do not

need to assimilate NH4 de novo. Any amino acid requirement, for example as part of an

amino acid cycle, can be met in bacteroids by uptake via Aap Bra.

The possibility of GABA acting as a transamination donor for alanine synthesis as

part of a GABA – alanine cycle was explored. The enzyme activity of two GABA

transaminases is high in bacteroids. Both glutamate and alanine synthesis from GABA have

been demonstrated in bacteroids via the action of GABA 2-oxoglutarate transaminase

(GabT) and GABA pyruvate transmaminase (OPT) respectively (Prell et al., 2002; Prell and

Poole, Unpublished). In addition, the enzyme activity of SSDH, which metabolises the

carbon backbone of GABA (succinate semialdehyde), is one of the highest for all catabolic

enzymes in isolated bacteroids. However, GABA transport had only previously been

demonstrated via Bra and restricting the transport to BraC3 abolished all GABA uptake, but

did not affect the plant phenotype. A GABA specific transporter (Gst) was identified

through prolonged growth of strain 3841 on GABA. This showed constitutive expression of

242

the Gst through mutation in the upstream regulator protein GstR. The solute specificity of

this permease was restricted to GABA and its analogues and did not appear to transport

common L-amino acids. Whilst the expression of this permease was indicated in bacteroids

this was not conclusively proved. However, on the basis of enzyme activity and 15N2

labelling data a GABA-alanine cycle was proposed (Figure 6.1.1.).

243

Figure 6.1.1. The GABA alanine cycle for symbiotic nitrogen fixation.

In this model GABA is supplied to the bacteroid for uptake via Bra and other as yet

unidentified transporters, also possibly including the Gst. GABA can then act as the

transaminating donor for either glutamate or alanine, through the action of OPT and GabT /

AatA. Bacteroid alanine secretion can then occur via either Aap or Bra to drive plant

ammonium assimilation. A problem of the original hypothesis using glutamate as the donor

amino acid is that bacteroids are proposed to be inhibited at the 2-oxoglutarate

dehydrogenase already due to the cell’s low redox potential, leading to restricted

metabolism of dicarboxylates. If glutamate acts as the transmaination donor this would

release more 2-oxoglutarate only acting to accentuate the imbalance at this enzyme

complex. In this model with GABA acting as the donating amino succinate semialdehyde

can be metabolised through the highly expressed SSDH to provide reductant for nitrogenase

activity.

6.1 Future work.

To further determine the GABA-alanine cycle in bacteroids two approaches will

address this hypothesis. Mutation of the SSDH, GabT and OPT activity in bacteroids would

prevent GABA metabolism and possibly limit the cycle and the mutant strains ability to

244

establish effective nitrogen fixation. However, the mutation of amino acid transporters has

already been indicated as a strong selective method for determining the role of different

amino acids in symbiosis. As a stain mutated in aapJ braC is limited for alanine uptake then

additional mutation in other transport systems, to abolish the uptake of a donor amino acid,

would be expected to confer a Fix reduced phenotype. Using this method it will be possible

to identify other transport systems and determine their solute specificity with regard to the

donor amino acid for cycling.

Whilst additional mutation in Gst did not affect this strains Fix+ phenotype, use of

the GABA induced gabT promoter as a reporter fusion still indicated the presence of GABA

in bacteroids. 15N2 labelling is also needed to measure the concentration and flux of GABA

in bacteroids as well as indicate other possible donor amino acids. Analysis of the R.

leguminosarum genome also revealed a number of other Gst homologues that may be active

in nodules to allow GABA transport. As mutation in Aap Bra abolishes all amino acid

uptake in free-living cultures then any permease for uptake of a donor amino acid would

likely be nodule specific. Attempts were made to induce expression of additional amino

acid transporters in free-living cultures using Tn5tac (TnB61) mutagenesis on an aapJ braC

gstA mutant strain. However, the frequency of mutation was too low to screen effectively

for growth of mutant colonies on various amino acids. If the frequency of mutation can be

increased this approach presents a good option for identifying previously bacteroid specific

transport systems in free-living cultures. The greater use of transcriptome and proteome

approaches to unlocking the bacteroids physiology may also indicate other transport

systems as mutational targets.

The regulation of the Gst needs to be fully determined to map the operon’s promoter

and identify how GstR acts as a regulator on expression of the distal genes, which encode

the transport complex. Sequencing of the gstR from constitutively expressing strains will

also identify the mutations that restrict its activity. The expression of this permease in

bacteroids also needs to be conclusively demonstrated before its role in symbiosis can be

properly addressed. A series integrated reporter fusions in the gst of 3841 and RU1736

(aapJQM- braEF- gst+) will indicate through GusA activity and nodule staining the areas of

expression in bacteroids. Primer extension analysis from mRNA of RU1736 (aapJQM-

braEF- gst+) would also allow the exact location of the gst promoter to be determined.

The role of Aap and Bra appears to be limited to the secretion of alanine in

bacteroids. As these permeases are predominantly uptake transporters in free-living cultures

to prevent reaccumulation of the secreted alanine a mechanistic switch must occur in

bacteroids, to prevent a futile cycle of alanine secretion and uptake. The intracellular

245

accumulation of amino acids, via other low affinity secondary amino acid transporters, was

shown to inhibit uptake via Aap and Bra. However, this reduction in transport was not

accompanied by a reduction in the transcription and translation of these permeases. This

indicates that the uptake activity of the transporters can be post-translationaly modulated in

response to the intracellular amino acid concentration. Further identification of this

regulatory mechanism will allow greater understanding of how the uptake of amino acids

via Aap and Bra can be inhibited in bacteroids, conclusively proving alanine secretion not

uptake from bacteroids as being essential for nitrogen fixation. A key to identifying the Aap

Bra regulatory mechanism maybe the observation that a GOGAT mutant is inhibited in its

amino acid uptake via Aap and Bra so cannot grow on added glutamate. This inhibition of

growth with added glutamate can be overcome by an unknown secondary mutation that

increases the rate of uptake in cells 10-fold. Possible complementation with a cosmid library

of this strain, for loss of growth with added glutamate, may act to identify this system

through further cosmid transposon mutagenesis. Transcriptome profiling of these strains,

and also wild-type R. leguminosarum grown on media that induces an inhibition of uptake,

may identify fully the regulatory mechanisms that modulated the Aap Bra uptake / efflux

balance.

246

Chapter 7:- References.

247

Abd-Alla, M. H., Koyro, H-W., Yan, F., Schubert, S. & Peiter, E. (2000). Functional

structure of the indeterminate Vicia faba L. root nodule: implications for metabolite

transport. Journal of Plant Physiology. 157. 335 – 343.

Acuna, G., Ebeling, S. & Hennecke, H. (1991). Cloning, sequencing, and mutational

analysis of the Bradyrhizobium japonicum fumC-like gene: evidence for the existence of

two different fumarases. Journal of General Microbiology. 137. 991 – 1000.

Adams, M. D., Wagner, L. M., Graddis, T. J., Landick, R., Antonucci, T. K., Gibson,

A. L. & Oxender, D. L. (1990). Nucleotide sequence and genetic characterization reveal

six essential genes for the LIV-I and LS transport systems of Escherichia coli. Journal of

Biological Chemistry. 265. 11436 – 11443.

Agron PG, Ditta GS, Helinski DR. (1993). Oxygen regulation of nifA transcription in

vitro. Proceedings of the National Academy of Sciences of the United States of America. 90.

3506 – 3510.

Aguilar, O. M., Reilander, H., Arnold, W. & Puhler, A. (1987). Rhizobium meliloti nifN

(fixF) gene is part of an operon regulated by a nifA-dependent promoter and codes for a

polypeptide homologous to the nifK gene product. Journal of Bacteriology. 169. 5393 –

5400.

Alfano, J. R. & Kahn, M. L. (1993). Isolation and characterization of a gene coding for a

novel aspartate aminotransferase from Rhizobium meliloti. Journal of Bacteriology. 175.

4186 – 4196.

Ali, H., Niel, C. & Guillaume, J. B. (1981). The pathways of ammonium assimilation in

Rhizobium meliloti. Archives of Microbiology. 129. 391-394.

Allaway, D., Lodwig, E. M., Crompton, L. A., Wood. M., Parsons, R. Wheeler, T. R. &

Poole, P. S. (2000). Identification of alanine dehydrogenase and its role in mixed secretion

of ammonium and alanine by pea bacteroids. Molecular Microbiology. 36. 508 – 515.

Altschul, S. F., Gish, W., Miller, W., Myers, E.W. & Lipman, D. J. (1990). Basic local

alignment search tool. Journal of Molecular Biology. 215. 403 – 410.

248

Amar, M., Patriarca, E.J., Manco, G., Bernard, P., Riccio, A., Lamberti, A., Defez, R.

& Iaccarino, M. (1994). Regulation of nitrogen metabolism is altered in a glnB mutant

strain of Rhizobium leguminosarum. Molecular Microbiology. 11. 685 – 690.

Ames, G. F. & Lever, J. E. (1972). The histidine-binding protein J is a component of

histidine transport. Identification of its structural gene, hisJ. Journal of Biological

Chemistry. 247. 4309 – 4316.

Ames, G. L. (1986). Bacterial periplasmic transport systems: structure, mechanism

and evolution. Annual Reviews of Biochemistry. 55. 397 – 425.

Amor, B. B., Shaw, S. L., Oldroyd, G. E., Maillet, F., Penmetsa, R. V., Cook, D., Long,

S. R., Denarie, J. & Gough, C. (2003). The NFP locus of Medicago truncatula controls an

early step of Nod factor signal transduction upstream of a rapid calcium flux and root hair

deformation. The Plant Journal. 34. 495 – 506.

Ampe, F., Kiss, E., Sabourdy, F. & Batut, J. (2003). Transcriptome analysis of

Sinorhizobium meliloti during symbiosis. Genome Biology. 4. R15.

Ane, J. M., Levy, J., Thoquet, P., Kulikova, O., de Billy, F., Penmetsa, V., Kim, D. J.,

Debelle, F., Rosenberg, C., Cook, D. R., Bisseling, T., Huguet, T. & Denarie, J. (2002).

Genetic and cytogenetic mapping of DMI1, DMI2, and DMI3 genes of Medicago

truncatula involved in Nod factor transduction, nodulation, and mycorrhization. Molecular

Plant-Microbe Interactions. 15. 1108 – 1118.

Ane, J. M., Kiss, G. B., Riely, B. K., Penmetsa, R. V., Oldroyd, G. E., Ayax, C., Levy,

J., Debelle, F., Baek, J. M., Kalo, P., Rosenberg, C., Roe, B. A., Long, S. R., Denarie, J.

& Cook, D. R. (2004). Medicago truncatula DMI1 required for bacterial and fungal

symbioses in legumes. Science. 303. 1364 – 1367.

Ansari, A. Z., Bradner, J. E. & O’Halloran, T. V. (1995). DNA-bend modulation in a

repressor-to-activator switching mechanism. Nature. 374. 371 – 375.

249

Antognoni, F., Del Duca, S., Kuraishi, A., Kawabe, E., Fukuchi-Shimogori, T.,

Kashiwagi, K. & Igarashi, K. (1999). Transcriptional inhibition of the operon for the

spermidine uptake system by the substrate-binding protein PotD. Journal of Biological

Chemistry. 274. 1942 – 1948.

Appels, M. A. & Haaker, H. (1988). Identification of cytoplasmic nodule associated forms

of malate dehydrogenase involved in the symbiosis between Rhizobium leguminosarum and

Pisum sativium. European Journal of Biochemistry. 171. 512 – 522.

Appels, M. A. & Haaker, H. (1991). Glutamate oxaloacetate transaminase in pea root

nodules - participation in a malate / aspartate shuttle between plant and bacteroid. Plant

Physiology. 95. 740 – 747.

Appleby, C. A. (1984). Leghemoglobin and Rhizobium respiration. Annual. Reviews. Plant

Physiology. 35. 443 – 478.

Aravind, L. & Koonin, E. V. (1998). The HD domain defines a new superfamily of metal-

dependent phosphohydrolases. Trends in Biochemical Sciences. 23. 469 – 472.

Arias, A., Cervenansky, C., Gardiol, A. & Martinez-drets, G. (1979). Phospho-glucose

isomerase mutant of Rhizobium meliloti. Journal of Bacteriology. 137. 409 – 414.

Arcondeguy, T., Huez, I., Fourment, J. & Kahn, D. (1996). Symbiotic nitrogen fixation

does not require adenylation of glutamine synthetase I in Rhizobium meliloti. FEMS

Microbiology Letters. 145. 33 – 40.

Arcondeguy, T., Huez, I., Tillard, P., Gangneux, C., de Billy, F., Gojon, A., Truchet, G.

& Kahn, D. (1997). The Rhizobium meliloti PII protein, which controls bacterial nitrogen

metabolism, affects alfalfa nodule development. Genes and Development. 11. 1194 – 1206.

Arcondeguy, T., Jack, R. & Merrick, M. (2001). PII signal transduction proteins, pivotal

players in microbial nitrogen control. Microbiology and Molecular Biology Reviews. 65. 80

– 105.

250

Ardourel, M., Demont, N., Debelle, F., Maillet, F., de Billy, F., Prome, J. C., Denarie,

J. & Truchet, G. (1994). Rhizobium meliloti lipooligosaccharide nodulation factors:

different structural requirements for bacterial entry into target root hair cells and induction

of plant symbiotic developmental responses. Plant Cell. 6. 1357 – 1374.

Arsene, F., Kaminski, P. A. & Elmerich, C. (1996). Modulation of NifA activity by PII in

Azospirillum brasilense: evidence for a regulatory role of the NifA N-terminal domain.

Journal of Bacteriology. 178. 4830 – 4838.

Arwas, R., McKay, I. A., Rowney, F. R. P., Dilworth, M. J. & Glenn, A. R. (1985).

Properties of organic acid utilization mutants of Rhizobium leguminosarum strain 300.

Journal of General Microbiology. 131. 2059 – 2066.

Arwas, R., Glenn, A. R., McKay, I. A. & Dilworth, M. J. (1986). Properties of double

mutants of Rhizobium leguminosarum which are defective in the utilization of dicarboxylic

acids and sugars. Journal of General Microbiology. 132. 2743 – 2747.

Bach, M. K., Magee, W. E. & Burris, R. H. (1958). Translocation of Photosynthetic

Products to Soybean Nodules and Their Role in Nitrogen Fixation. Plant Physiology. 33.

118 – 124 .

Balakrishnan, L., Venter, H., Shilling, R. A. & van Veen, H. W. (2004). Reversible

transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the

expense of downhill ethidium uptake. Journal of Biological Chemistry. 279. 11273 –

11280.

Banfalvi, Z., Nieuwkoop, A., Schell, M., Besl, L. & Stacey, G. (1988). Regulation of nod

gene expression in Bradyrhizobium japonicum. Molecular and General Genetics. 214. 420

– 424.

Barnett, M. J. & Long, S. R. (1997). Identification and characterization of a gene on

Rhizobium meliloti pSyma, syrB, that negatively affects syrM expression. Molecular Plant-

Microbe Interactions. 10. 550 – 559.

251

Barnett, M. J., Toman, C. J., Fisher, R. F. & Long, S. R. (2004). A dual-genome

Symbiosis Chip for coordinate study of signal exchange and development in a prokaryote-

host interaction. Proceedings of the National Academy of Sciences of the United States of

America. 101. 16636 – 16641.

Barran, L. R., Bromfield, E. S. & Brown, D. C. (2002). Identification and cloning of the

bacterial nodulation specificity gene in the Sinorhizobium meliloti–Medicago laciniata

symbiosis. Canadian Journal of Microbiology. 48. 765 – 771.

Batut, J., Andersson, S. G. & O'Callaghan, D. (2004). The evolution of chronic infection

strategies in the alpha-proteobacteria. Nature Reviews Microbiology. 2. 933 – 945.

Bauer, E., Kaspar, T., Fischer, H. M. & Hennecke, H. (1998). Expression of the fixR-

nifA operon in Bradyrhizobium japonicum depends on a new response regulator, RegR.

Journal of Bacteriology. 180. 3853 – 3863.

Becker, A., Berges, H., Krol, E., Bruand, C., Ruberg, S., Capela, D., Lauber, E.,

Meilhoc, E., Ampe, F., de Bruijn, F. J., Fourment, J., Francez-Charlot, A., Kahn, D.,

Kuster, H., Liebe, C., Puhler, A., Weidner, S. & Batut, J. (2004). Global changes in gene

expression in Sinorhizobium meliloti 1021 under microoxic and symbiotic conditions.

Molecular Plant-Microbe Interactions. 17. 292 – 303.

Becker, H. D. & Kern, D. (1998). Thermus thermophilus: a link in evolution of the tRNA-

dependent amino acid amidation pathways. Proceedings of the National Academy of

Sciences of the United States of America. 95. 12832 – 12837.

Becker, H. D., Min, B., Jacobi, C., Raczniak, G., Pelaschier, J., Roy, H., Klein, S.,

Kern, D. & Soll, D. (2000). The heterotrimeric Thermus thermophilus Asp-tRNA(Asn)

amidotransferase can also generate Gln-tRNA(Gln). FEBS Letters. 476. 140 – 144.

Bergersen, F. J. & Briggs, M. J. (1958). Studies on the bacterial component of soybean

root nodules: cytology and organization in the host tissue. Journal of General

Microbiology. 19. 482 – 490.

252

Bergersen, F. (1965). Ammonia - an early stable product of nitrogen fixation by soybean

root nodules. Australian Journal of Biological Sciences. 18. 1 – 9.

Bergersen, F. J. & Turner, G. L. (1967). Nitrogen fixation by the bacteroid fraction of

breis of soybean root nodules. Biochimica et Biophysica Acta. 141. 507 – 515.

Bergersen, F. J. & Turner, G. L. (1990). Bacteroids from soybean root nodules:

accumulation of poly-β -hydroxybutyrate during supply of malate and succinate in relation

to N2 fixation in flow chamber reactions. Proceedings of the Royal Society of London

Series B-Biological Sciences. 240. 39 – 59.

Berges, H., Checroun, C., Guiral, S., Garnerone, A. M., Boistard, P. & Batut, J.

(2001). A glutamine-amidotransferase-like protein modulates FixT anti-kinase activity in

Sinorhizobium meliloti. BMC Microbiology. 1. 6.

Beringer, J. E. (1974). R factor transfer in Rhizobium leguminosarum. Journal of

General Microbiology. 84. 188 – 198.

Beynon, J. L., Williams, M. K. & Cannon, F. C. (1988). Expression and functional

analysis of the Rhizobium meliloti nifA gene. EMBO Journal. 7. 7 – 14.

Birke, S. R., Green, L. S., Purcell, L. C. & Emerich, D. W. (1998). Insertional

mutagenesis of an AAA-like gene in Bradyrhizobium japonicum leads to increased levels of

malate dehydrogenase and increased acetylene reduction activity by soybean nodules. In

Biological Nitrogen Fixation for the 21st Century. Edited by Elmerich, C., Kondorosi, A. &

Newton, W. E. Kluwer Academic Publishers, Dordrecht.

Blumwald, E., Fortin, M. G., Rea, P. A., Verma, D. P. S. & Poole, R. J. (1985). Presence

of host plasma membrane type H+-ATPase in the membrane envelope enclosing the

bacteroids in soybean root nodules. Plant Physiology. 78. 665 – 672.

Bolanos, L., Redondo-Nieto, M., Rivilla, R., Brewin, N. J. & Bonilla, I. (2004). Cell

surface interactions of Rhizobium bacteroids and other bacterial strains with symbiosomal

and peribacteroid membrane components from pea nodules. Molecular Plant-Microbe

Interactions. 17. 216 – 223.

253

Bolton, E., Higgisson, B., Harrington, A. & O’Gara, F. (1986). Dicarboxylic acid

transport in Rhizobium meliloti. Isolation of mutants and cloning of dicarboxylic acid

transport genes. Archives of Microbiology. 144. 142 – 146.

Borths, E. L., Locher, K. P., Lee, A. T. & Rees, D. C. (2002). The structure of

Escherichia coli BtuF and binding to its cognate ATP binding cassette transporter.

Proceedings of the National Academy of Sciences of the United States of America. 99.

16642 – 16647.

Bravo, A. & Mora, J. (1988). Ammonium assimilation in Rhizobium phaseoli by the

glutamine synthetase-glutamate synthase pathway. Journal of Bacteriology. 170. 980 – 984.

Brechtel, C. E., Hu, L. & Kingm S, C. (1996). Substrate specificity of the Escherichia coli

4-aminobutyrate carrier encoded by gabP. Uptake and counterflow of structurally diverse

molecules. Journal of Biological Chemistry. 271. 783 – 788.

Brechtel CE, King SC. (1998). 4-Aminobutyrate (GABA) transporters from the amine-

polyamine-choline superfamily: substrate specificity and ligand recognition profile of the 4-

aminobutyrate permease from Bacillus subtilis. The Biochemical Journal. 333. 565 – 571.

Brewin, N. J. (2004). Plant cell wall remodelling in the Rhizobium-legume symbiosis.

Critical Reviews in Plant Science. 23. 293 – 316.

Broughton, W. J., Jabbouri, S. & Perret, X. (2000). Keys to symbiotic harmony. Journal

of Bacteriology. 182. 5641 – 5652.

Brown, S. M., Oparka, K. J., Sprent, J. I. & Walsh, K. B. (1995). Symplastic transport in

soybean root nodules. Soil Biology and Biochemistry. 27. 387 – 399.

Buchanan-Wollaston, V. (1979). Generalized Transduction in Rhizobium leguminosarum.

Journal of General Microbiology. 112. 135 – 142.

254

Bueno, R., Pahel, G. & Magasanik, B. (1985). Role of glnB and glnD gene products in

regulation of the glnALG operon of Escherichia coli. Journal of Bacteriology. 164. 816 –

822.

Burn, J., Rossen, L. & Johnston, A. W. B. (1987). Four classes of mutations in the nodD

gene of Rhizobium leguminosarum biovar viciae that affect its ability to autoregulate and

/or activate other nod genes in the presence of flavonoid inducers. Genes and Development.

1. 456 – 464.

Bustin, S. A. (2002). Quantification of mRNA using real-time reverse transcription PCR

(RT-PCR): trends and problems. Journal of Molecular Endocrinology. 29. 23 – 39.

Cabanes, D., Boistard, P. & Batut, J. (2000). Symbiotic induction of pyruvate

dehydrogenase genes from Sinorhizobium meliloti. Molecular Plant-Microbe Interactions.

13. 483 – 493.

Cardenas, L., Dominguez, J., Santana, O. & Quinto, C. (1996). The role of the nodI and

nodJ genes in the transport of Nod metabolites in Rhizobium etli. Gene. 173. 183 – 187.

Cardenas, L., Vidali, L., Domínguez, J., Perez, H., Sánchez, F., Hepler, P. K. &

Quinto, C. (1998). Rearrangement of actin microfilaments in plant root hairs responding to

Rhizobium nodulation signals. Plant Physiology. 116. 871 – 877.

Cardenas, L., Feijo, J. A., Kunkel, J. G., Sanchez, F., Holdaway-Clarke, T. L., Hepler,

P. K. & Quinto, C. (1999). Rhizobium Nod factors induce increases in intracellular free

calcium and extracellular calcium influxes in bean root hairs. The Plant Journal. 19. 347 –

352.

Carlson, T.A., Martin, G.B. and Chelm, B.K. (1987). Differential transcription of the two

glutamine synthetase genes of Bradyrhizobium japonicum. Journal of Bacteriology. 169.

5861 – 5866.

Cashel, M., Gentry, D., Hernandez, V., & Vinella, D. (1996). The stringent response. In

Escherichia coli and Salmonella. Edited by Neidhardt, F. ASM Press, Washington.

255

Castano, I., Bastarrachea, F. & Covarrubias, A. A. (1988). gltBDF operon of

Escherichia coli. Journal of Bacteriology. 170. 821 - 827.

Castillo, A., Taboada, H., Mendoza, A., Valderrama, B., Encarnacion, S. & Mora, J.

(2000). Role of GOGAT in carbon and nitrogen partitioning in Rhizobium etli.

Microbiology. 146. 1627 – 1637.

Catoira, R., Galera, C., de Billy, F., Penmetsa, R. V., Journet, E. P., Maillet, F.,

Rosenberg, C., Cook, D., Gough, C. & Denarie, J. (2000). Four genes of Medicago

truncatula controlling components of a nod factor transduction pathway. The Plant Cell. 12.

1647 – 1666.

Cedar, H. & Schwartz, J. H. (1969). The asparagine synthetase of Escherichia coli. I.

Biosynthetic role of the enzyme, purification, and characterization of the reaction products.

Journal of Biological Chemistry. 244. 4112 – 4121.

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. & Prasher, D. C. (1994). Green

fluorescent protein as a marker for gene expression. Science. 263. 802 – 805.

Chan, M. K., Kim, J. & Rees, D. C. (1993). The nitrogenase FeMo-cofactor and P-cluster

pair: 2.2 Å resolution structures. Science 260. 792 – 794.

Chen, F. L. & Cullimore, J. V. (1988). Two isoenzymes of NADH dependent glutamate

synthase in root nodules of Phaseolus vulgaris L. Purification, properties and activity

changes during nodule development. Plant Physiology. 88. 1411 – 1417.

Chen, J., Sharma, S., Quiocho, F. A. & Davidson, A. L. (2001). Trapping the transition

state of an ATP-binding cassette transporter: evidence for a concerted mechanism of

maltose transport. Proceedings of the National Academy of Sciences of the United States of

America. 98. 1525 – 1530.

Chen, J., Lu, G., Lin, J., Davidson, A. L. & Quiocho, F. A. (2003). A tweezers-like

motion of the ATP-binding cassette dimer in an ABC transport cycle. Molecular Cell. 12.

251 – 261.

256

Chen, X. C., Feng, J., Hou, B. H., Li, F. Q., Li, Q. & Hong, G. F. (2005). Modulating

DNA bending affects NodD-mediated transcriptional control in Rhizobium leguminosarum.

Nucleic Acids Research. 33. 2540 – 2548.

Cheng, H. P. & Walker, G. C. (1998). Succinoglycan is required for initiation and

elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. Journal

of Bacteriology. 180. 5183 – 5191.

Chiurazzi, M. & Iaccarino, M. (1990). Transcriptional analysis of the glnB-glnA region of

Rhizobium leguminosarum biovar viciae. Molecular Microbiology. 4. 1727 – 1735.

Chiurazzi, M., Meza, R., Lara, M., Lahm, A., Defez, R., Iaccarino, M. & Espin, G.

(1992). The Rhizobium leguminosarum biovar phaseoli glnT gene, encoding glutamine

synthetase III. Gene. 119. 1 – 8.

Chopra, J., Kaur, N. & Gupta, A. K. (1998). Carbohydrate status and sucrose metabolism

in mungbean roots and nodules. Phytochemistry. 49. 1891 – 1895.

Chopra, J., Kaur, N. & Gupta, A. K. (2002). A comparative developmental pattern of

enzymes of carbon metabolism and pentose phosphate pathway in mungbean and lentil

nodules. Physiologiae Plantarum. 24. 67 – 72.

Christeller, J. T., Laing, W. A. & Sutton, W. D. (1977). Carbon dioxide fixation by lupin

root nodules: I. Characterization, association with phosphoenolpyruvate carboxylase, and

correlation with nitrogen fixation during nodule development. Plant Physiology. 60. 47 –

50.

Coker, G. T. & Schubert, K. R. (1981). Carbon dioxide fixation in soybean roots and

nodules: I. Characterisation and comparison with N2 fixation and composition of xylem

exudates during early nodule development. Plant Physiology. 67. 691 – 696.

Colebatch, G., Desbrosses, G., Ott, T., Krusell, L., Montanari, O., Kloska, S., Kopka,

J. & Udvardi, M. K. (2004). Global changes in transcription orchestrate metabolic

differentiation during symbiotic nitrogen fixation in Lotus japonicus. The Plant Journal. 39.

487 – 512.

257

Copeland, L., Quinnell, R. G. & Day, D. A. (1989a). Malic enzyme activity in bacteroids

from soybean nodules. Journal of General Microbiology. 135. 2005 – 2011.

Copeland, L., Vella, J. & Hong, Z. Q. (1989b). Enzymes of carbohydrate metabolism in

soybean nodules. Phytochemistry. 28. 57 – 61.

Craig, J., Barratt, P., Tatge, H., Dejardin, A., Handley, L., Gardner, C. D., Barber, L.,

Wang, T., Hedley, C. & Martin, C. (1999). Mutations at the rug4 locus alter the carbon

and nitrogen metabolism of pea plants through an effect on sucrose synthase. The Plant

Journal. 17. 353 – 362.

Cren, M., Kondorosi, A. & Kondorosi, E. (1995). NolR controls expression of the

Rhizobium meliloti nodulation genes involved in the core Nod factor synthesis.

Molecular Microbiology. 15. 733 – 747.

Cubo, M. T., Economou, A., Murphy, G., Johnston, A. W. & Downie, J. A. (1992).

Molecular characterization and regulation of the rhizosphere-expressed genes rhiABCR that

can influence nodulation by Rhizobium leguminosarum biovar viciae. Journal of

Bacteriology. 174. 4026 – 4035.

Cullimore, J. V. & Bennett, M. J. (1988). The molecular biology and biochemistry of

plant glutamine synthetase from root nodules of Phaseolus vulgaris L. and other legumes.

Journal of Plant Physiology. 132. 387 - 393.

Curnow, A. W., Tumbula, D. L., Pelaschier, J. T., Min, B. & Soll, D. (1998). Glutamyl-

tRNAGln amidotransferase in Deinococcus radiodurans may be confined to asparagine

biosynthesis. Proceedings of the National Academy of Sciences of the United States of

America. 95. 12838 – 12843.

Davalos, M., Fourment, J., Lucas, A., Berges, H. & Kahn, D. (2004). Nitrogen

regulation in Sinorhizobium meliloti probed with whole genome arrays. FEMS

Microbiology Letters. 241. 33 – 40.

258

David, M., Daveran, M. L., Batut, J., Dedieu, A., Domergue, O., Ghai, J., Hertig, C.,

Boistard, P. & Kahn, D. (1988). Cascade regulation of nif gene expression in Rhizobium

meliloti. Cell. 54. 671 – 83.

Davidson, A. L. (2002). Structural biology. Not just another ABC transporter. Science. 296.

1038 – 1040.

Davidson, A. L. & Chen, J. (2004). ATP-binding cassette transporters in bacteria. Annual

Review of Biochemistry. 73. 241 – 268.

Day, D. A. & Mannix, M. (1988). Malate oxidation by soybean nodule mitochondria and

the possible consequences for nitrogen fixation. Plant Physiology and Biochemistry. 2. 567

– 573.

Day, D. A. & Copeland, L. (1991). Carbon metabolism and compartmentation in nitrogen

fixing legume nodules. Plant Physiology and Biochemistry. 29. 185 – 201.

Day, D. A., Poole, P. S., Tyerman, S. D. & Rosendahl, L. (2001). Ammonia and amino

acid transport across symbiotic membranes in nitrogen-fixing legume nodules. Cell and

Molecular Life Sciences. 58. 61 – 71.

de Bruijn, F. J., Rossbach, S., Schneider, M., Ratet, P., Messmer, S., Szeto, W. W.,

Ausubel, F. M. & Schell, J. (1989). Rhizobium meliloti 1021 has 3 differentially regulated

loci involved in glutamine biosynthesis, none of which is essential for symbiotic nitrogen

fixation. Journal of Bacteriology. 171. 1673 – 1682.

Deguchi, Y., Yamato, I. & Anraku, Y. (1989). Molecular cloning of gltS and gltP, which

encode glutamate carriers of Escherichia coli B. Journal of Bacteriology. 171. 1314 – 1319.

Denarie, J. & Cullimore, J. (1993). Lipo-oligosaccharide nodulation factors: a minireview

new class of signaling molecules mediating recognition and morphogenesis. Cell. 74. 951 -

954.

259

Denarie, J., Debelle, F. & Prome, J. C. (1996). Rhizobium lipo-chitooligosaccharide

nodulation factors - signaling molecules mediating recognition and morphogenesis. Annual

Review of Biochemistry. 65. 503 – 535.

de Philip, P., Batut, J. & Boistard, P. (1990). Rhizobium meliloti FixL is an oxygen sensor

and regulates R. meliloti nifA and fixK genes differently in Escherichia coli. Journal of

Bacteriology. 172. 4255 – 4262.

Demont, N., Debelle, F., Aurelle, H., Denarie, J. & Prome, J. C. (1993). Role of the

Rhizobium meliloti nodF and nodE genes in the biosynthesis of lipo-oligosaccharidic

nodulation factors. Journal of Biological Chemistry. 268. 20134 – 20142.

Deroche, M. E. & Carrayol, E. (1988). Nodule phosphoenolpyruvate carboxylase: a

review. Plant Physiology. 74. 775 – 782.

de Ruijter, N. C. A., Bisseling, T. & Emons, A. M. C. (1999). Rhizobium Nod factors

induce an increase in sub-apical fine bundles of actin filaments in Vicia sativa root hairs

within minutes. Molecular Plant-Microbe Interactions. 12. 829 – 832.

Desbrosses, G. G., Kopka, J. & Udvardi, M. K. (2005). Lotus japonicus metabolic

profiling. Development of gas chromatography-mass spectrometry resources for the study

of plant-microbe interactions. Plant Physiology. 137. 1302 – 1318.

Dibb, N. J., Downie, J. A. & Brewin, N. J. (1984). Identification of a rhizosphere protein

encoded by the symbiotic plasmid of Rhizobium leguminosarum. Journal of Bacteriology.

158. 621 - 627.

Diederichs, K., Diez, J., Greller, G., Muller, C., Breed, J., Schnell, C., Vonrhein, C.,

Boos, W. & Welte, W. (2000). Crystal structure of MalK, the ATPase subunit of the

trehalose/maltose ABC transporter of the archaeon Thermococcus litoralis. EMBO Journal.

19. 5951 – 5961.

Ditta, G., Virts, E., Palomares, A. & Kim, C. H. (1987). The nifA gene of Rhizobium

meliloti is oxygen regulated. Journal of Bacteriology. 169. 3217 – 3223.

260

Dixon, R. & Kahn, D. (2004). Genetic regulation of biological nitrogen fixation. Nature

Reviews. Microbiology. 2. 621 – 31.

Djordjevic, M. A. (2004). Sinorhizobium meliloti metabolism in the root nodule: a

proteomic perspective. Proteomics. 4. 1859 – 1872.

Downie, J. A., Ma, Q. S., Knight, C. D., Hombrecher, G. & Johnston, A. W. (1983).

Cloning of the symbiotic region of Rhizobium leguminosarum: the nodulation genes are

between the nitrogenase genes and a nifA-like gene. EMBO Journal. 2. 947 – 952.

Downie, J. A. & Surin, B. P. (1990). Either of two nod gene loci can complement the

nodulation defect of a nod deletion mutant of Rhizobium leguminosarum bv. viciae.

Molecular and General Genetics. 222. 81 – 86.

Driscoll, B. T. & Finan, T. M. (1993). NAD+-dependent malic enzyme of Rhizobium

meliloti is required for symbiotic nitrogen fixation. Molecular Microbiology. 7. 865 – 873.

Driscoll, B. T. & Finan, T. M. (1996). NADP-dependent malic enzyme of Rhizobium

meliloti. Journal of Bacteriology. 178. 2224 – 2231.

Driscoll, B. T. & Finan, T. M. (1997). Properties of NAD+ and NADP-dependent malic

enzymes of Rhizobium (Sinorhizobium) meliloti and differential expression of their genes in

nitrogen fixing bacteroids. Microbiology. 143. 489 – 498.

Brown, C. M. & Dilworth, M. J. (1975). Ammonia assimilation by Rhizobium

cultures and bacteroids. Journal of General Microbiology. 86. 39 – 48.

Duncan, M. J. & Fraenkel, D. G. (1979). α -Ketoglutarate dehydogenase mutant of

Rhizobium meliloti. Journal of Bacteriology. 37. 415 – 419.

Dunn, M. F. (1998). Tricarboxylic acid cycle and anaplerotic enzymes in rhizobia. FEMS

Microbiology Reviews. 22. 105 – 123.

Dunn, S. D. & Klucas, R. V. (1973). Studies on possible routes of ammonium assimilation

in soybean root nodule bacteroids. Canadian Journal of Microbiology. 19. 1493 – 1499.

261

Duran, S. & Calderon, J. (1995). Role of the glutamine transaminase-ω-amidase pathway

and glutaminase in glutamine degradation in Rhizobium etli. Microbiology. 141. 589 – 595.

Duran, S., Pont, G. D., Huertazepeda, A. & Calderon, J. (1995). The role of glutaminase

in Rhizobium etli: studies with a new mutant. Microbiology. 141. 2883 – 2889.

Duran, S., SanchezLinares, L., HuertaSaquero, A., DuPont, G., HuertaZepeda, A. &

Calderon, J. (1996). Identification of two glutaminases in Rhizobium etli. Biochemical

Genetics. 34. 453 – 465.

Dymov, S. I., Meek, D. J., Steven, B. & Driscoll, B. T. (2005). Insertion of transposon

Tn5tac1 in the Sinorhizobium meliloti malate dehydrogenase (mdh) gene results in

conditional polar effects on downstream TCA cycle genes. Molecular Plant-Microbe

Interactions. 17. 1318 – 1327.

Earl, C. D., Ronson, C. W. & Ausubel, F. M. (1987). Genetic and structural analysis of

the Rhizobium meliloti fixA, fixB, fixC, and fixX genes. Journal of Bacteriology. 169. 1127 –

1136.

Egelhoff, T. T., Fisher, R. F., Jacobs, T. W., Mulligan, J. T. & Long, S. R. (1985).

Nucleotide sequence of Rhizobium meliloti 1021 nodulation genes: nodD is read divergently

from nodABC. DNA. 4. 241 – 248.

Ehrhardt, D. W., Atkinson, E. M. & Long, S. R. (1992). Depolarization of alfalfa root

hair membrane potential by Rhizobium meliloti Nod factors. Science. 256. 998 – 1000.

Ehrhardt, D. W., Atkinson, E. M., Faull, K. F., Freedberg, D. I., Sutherlin, D. P.,

Armstrong, R. & Long, S. R. (1995). In vitro sulfotransferase activity of NodH, a

nodulation protein of Rhizobium meliloti required for host-specific nodulation. Journal of

Bacteriology. 177. 6237 – 6245.

Ehrhardt, D. W., Wais, R. & Long, S. R. (1996). Calcium spiking in plant root hairs

responding to Rhizobium nodulation signals. Cell. 85. 673 – 681.

262

Einsle, O., Tezcan, F. A., Andrade, S. L., Schmid, B., Yoshida, M., Howard, J. B. &

Rees, D. C. (2002). Nitrogenase MoFe-protein at 1.16 A resolution: a central ligand in the

FeMo-cofactor. Science. 297. 1696 – 1700.

El-Guezzar, M., Hornez, J. P., Courtois, B. & Derieux, J. C. (1988). Study of a fructose-

negative mutant of Rhizobium meliloti. FEMS Microbiology Letters. 49. 429 – 434.

El Yahyaoui, F., Kuster, H., Ben Amor, B., Hohnjec, N., Puhler, A., Becker, A., Gouzy,

J., Vernie, T., Gough, C., Niebel, A., Godiard, L. & Gamas, P. (2004). Expression

profiling in Medicago truncatula identifies more than 750 genes differentially expressed

during nodulation, including many potential regulators of the symbiotic program. Plant

Physiology. 136. 3159 – 3176.

Emr, S. D., Hall, M. N. & Silhavy, T. J. (1980). A mechanism of protein localization: the

signal hypothesis and bacteria. The Journal of Cell Biology. 86. 701 – 711.

Encarnacion, S., Calderon, J., Gelbard, A. S., Cooper, A. J. L. & Mora, J. (1998).

Glutamine biosynthesis and the utilization of succinate and glutamine by Rhizobium etli and

Sinorhizobium meliloti. Microbiology. 144. 2629 – 2638.

Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kalo, P. & Kiss, G. B. (2002). A receptor

kinase gene regulating symbiotic nodule development. Nature. 417. 962 – 926.

Engelke, T., Jagadish, M. N. & Pühler, A. (1987). Biochemical and genetic analysis of

Rhizobium meliloti mutants defective in C4-dicarboxylate transport. Journal of General

Microbiology. 133. 3019 – 3029.

Engelke, T., Jording, D., Kapp, D. & Pühler, A. (1989). Identification and sequence

analysis of the Rhizobium meliloti dctA gene encoding the C4-dicarboxylate carrier. Journal

of Bacteriology. 171. 5551 – 5560.

Ercolano, E., Mirabella, R., Merrick, M. & Chiurazzi, M. (2001). The Rhizobium

leguminosarum glnB gene is downregulated during symbiosis. Molecular and General

Genetics. 264. 555 – 564.

263

Espin, G., Moreno, S., Wild, M., Meza, R. & Iaccarino, M. (1990). A previously

unrecognized glutamine synthetase expressed in Klebsiella pneumoniae from the glnT locus

of Rhizobium leguminosarum. Molecular and General Genetics. 223. 513 – 516.

Esseling, J. J., Lhuissier, F. G. P. & Emons, A. M. C. (2003). Nod factor-induced root

hair curling: continuous polar growth towards the point of Nod factor application. Plant

Physiology. 132. 1982 – 1988.

Esseling, J. J., Lhuissier, F. G. & Emons, A. M. (2004). A nonsymbiotic root hair tip

growth phenotype in NORK-mutated legumes: implications for nodulation factor-induced

signaling and formation of a multifaceted root hair pocket for bacteria. The Plant Cell. 16.

933 – 944.

Evans, I. J. & Downie, J. A. (1986). The nodI product of Rhizobium leguminosarum is

closely related to ATP-binding bacterial transport proteins: Nucleotide sequence of the

nodI and nodJ genes. Gene. 43. 95 – 101.

Eymann, C., Homuth, G., Scharf, C. & Hecker, M. (2002). Bacillus subtilis functional

genomics: global characterization of the stringent response by proteome and transcriptome

analysis. Journal of Bacteriology. 184. 2500 – 2520.

Faucher, C., Maillet, F., Vasse, J., Rosenberg, C., van Brussel, A. A., Truchet, G. &

Denarie, J. (1988). Rhizobium meliloti host range nodH gene determines production of an

alfalfa-specific extracellular signal. Journal of Bacteriology. 170. 5489 – 5499.

Fedorova, E., Thomson, R., Whitehead, L. F., Maudoux, O., Udvardi, M. K. & Day, D.

A. (1999). Localization of H+-ATPases in soybean root nodules. Planta. 209. 25 – 32.

Fellay, R., Frey, J., & Krisch, H. (1987). Interposon mutagenesis of soil and water

bacteria: a family of DNA fragments designed for in vitro insertion mutagenesis of Gram-

negative bacteria. Gene. 52. 147 – 154.

Fellay, R., Hanin, M., Montorzi, G., Frey, J., Freiberg, C., Golinowski, W., Staehelin,

C., Broughton, W. J. & Jabbouri, S. (1998). nodD2 of Rhizobium sp. NGR234 is

264

involved in the repression of the nodABC operon. Molecular Microbiology. 27. 1039 –

1050.

Felle, H. H., Kondorosi, E., Kondorosi, A. & Schultze, M. (1996). Rapid alkalinization in

alfalfa root hairs in response to rhizobial lipochitooligosaccharide signals. The Plant

Journal. 10. 295 – 301.

Felle, H. H., Kondorosi, E., Kondorosi, A. & Schultze, M. (1998). The role of ion fluxes

in Nod factor signalling in Medicago sativa. The Plant Journal.13. 455 – 463.

Felle, H. H., Kondorosi, E., Kondorosi, A. & Schultze, M. (1999). Elevation of the

cytosolic free [Ca2+] is indispensable for the transduction of the nod factor signal in alfalfa.

Plant Physiology. 121. 273 – 280.

Felton, J., Michaelis, S. & Wright, A. (1980). Mutations in two unlinked genes are

required to produce asparagine auxotrophy in Escherichia coli. Journal of Bacteriology.

142. 221 – 228.

Feng, J., Li, Q., Hu, H. L., Chen, X. C. & Hong, G. F. (2003). Inactivation of the nod box

distal half-site allows tetrameric NodD to activate nodA transcription in an inducer-

independent manner. Nucleic Acids Research. 31. 3143 – 3156.

Ferraioli, S., Tate, R., Cermola, M., Favre, R., Iaccarino, M. & Patriarca, E. J. (2002).

Auxotrophic mutant strains of Rhizobium etli reveal new nodule development phenotypes.

Molecular Plant-Microbe Interactions. 15. 501 – 510.

Ferson, A. E., Wray, L.V. & Fisher, S. H. (1996). Expression of the Bacillus subtilis

gabP gene is regulated independently in response to nitrogen and amino acid availability.

Molecular Microbiology. 22. 693 – 701.

Figurski, D. H. & Helinski, D. R. (1979). Replication of an origin-containing derivative

plasmid RK2 dependant on a plasmid fraction provided in trans. Proceedings of the

National Academy of Sciences of the United States of America. 76. 1648 – 1657.

265

Filler, W. A., Kemp, R. M., Ng, J. C., Hawkes, T. R., Dixon, R. A. & Smith, B. E.

(1986). The nifH gene product is required for the synthesis or stability of the iron-

molybdenum cofactor of nitrogenase from Klebsiella pneumoniae. European Journal of

Biochemistry. 160. 371 – 377.

Finan, T. M., Wood, J. M. & Jordan, C. (1981). Succinate transport in Rhizobium

leguminosarum. Journal of Bacteriology. 148. 193 – 202

Finan, T. M., Wood, J. M. & Jordan, D. C. (1983). Symbiotic properties of C4-

dicarboxylic acid transport mutants of Rhizobium leguminosarum. Journal of Bacteriology.

154. 1403 – 1413.

Finan, T. M., Oresnik, I. & Bottacin, A. (1988). Mutants of Rhizobium meliloti defective

in succinate metabolism. Journal of Bacteriology. 170. 3396 – 3403.

Finan, T. M., McWhinnie, E., Driscoll, B. and Watson, R. J. (1991). Complex symbiotic

phenotypes result from gluconeogenic mutations in Rhizobium meliloti. Molecular Plant-

Microbe Interactions. 4. 386 – 392.

Finnie C, Hartley NM, Findlay KC, Downie JA. (1997). The Rhizobium leguminosarum

prsDE genes are required for secretion of several proteins, some of which influence

nodulation, symbiotic nitrogen fixation and exopolysaccharide modification. Molecular

Microbiology. 25. 135 – 146.

Fischer, H. M., Bruderer, T. & Hennecke, H. (1988). Essential and non-essential

domains in the Bradyrhizobium japonicum NifA protein: identification of indispensable

cysteine residues potentially involved in redox reactivity and/or metal binding. Nucleic

Acids Research. 16. 2207 – 2224.

Fisher, R. F. & Long, S. R. (1993). Interactions of NodD at the nod Box: NodD binds to

two distinct sites on the same face of the helix and induces a bend in the DNA. Journal of

Molecular Biology. 233. 336 – 348.

266

Fitzmaurice, A. M. & O'Gara, F. (1993). A Rhizobium meliloti mutant, lacking a

functional gamma-aminobutyrate (GABA) bypass, is defective in glutamate catabolism and

symbiotic nitrogen fixation. FEMS Microbiology Letters. 109. 195 – 202.

Fortin, M. G., Morrison, N. A. & Verma, D. P. (1987). Nodulin-26, a peribacteroid

membrane nodulin is expressed independently of the development of the peribacteroid

compartment. Nucleic Acids Research. 15. 813 – 824.

Fougere, F., Le Rudulier, D. & Streeter, J, G. (1991). Effects of salt stress on amino acid,

organic acid, and carbohydrate composition of roots, bacteroids, and cytosol of alfalfa

(Medicago sativa L.). Plant Physiology. 96. 1228 – 1236.

Fox, M. A. (2005). Adaptation of Rhizobium to environmental stress. PhD Thesis,

University of Reading.

Fox, M. A., White, J. P., Hosie, A. H. F., Lodwig, E. M. & Poole, P. S. (2006). Osmotic

upshift transiently inhibits uptake via ABC transporters in gram-negative bacteria. Journal

of Bacteriology. 188. 5304 – 5307.

Freidman, A. M., Long, S. R., Brown, S. E., Buikema, W. J. & Ausubel, F. M. (1982).

Construction of the broad host range cosmid cloning vector and its use in the genetic

analysis of Rhizobium mutants. Gene. 18. 289 – 296.

Fry, J. (2000). myo-Inositol catabolism in Rhizobium leguminosarum. PhD Thesis,

University of Reading.

Fujita, Y. & Fujita, T. (1987). The gluconate operon gnt of Bacillus subtilis encodes its

own transcriptional negative regulator. Proceedings of the National Academy of Sciences of

the United States of America. 84. 4524 – 4528.

Furuchi, T., Kashiwagi, K., Kobayashi, H. & Igarashi, K. (1991). Characteristics of the

gene for a spermidine and putrescine transport system that maps at 15 min on the

Escherichia coli chromosome. Journal of Biological Chemistry. 266. 20928 – 20933.

267

Gage, D. J., Bobo, T. & Long, S. R. (1996). Use of green fluorescent protein to visualize

the early events of symbiosis between Rhizobium meliloti and alfalfa (Medicago sativa).

Journal of Bacteriology. 178. 7159 – 7166.

Gage, D. J. (2002). Analysis of infection thread development using Gfp- and DsRed-

expressing Sinorhizobium meliloti. Journal of Bacteriology. 184. 7042 – 7046.

Gage, D. J. (2004). Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia

during nodulation of temperate legumes. Microbiology and Molecular Biology Reviews. 68.

280 – 300.

Galibert, F., Finan, T. M., Long, S. R., Pühler, A., Abola, P., Ampe, F., Balroy-Hubler,

F., Barnett, M. J., Becker, A., Boistard, P., Bothe, G., Boutry, M., Bowser, L.,

Buhrmester, J., Cadieu, E., Capela, D., Chain, P., Cowie, A., Davis, R. W., Dréano, S.,

Federspiel, N. A., Fisher, R. F., Gloux, S., Godrie, T., Goffeau, A., Golding, B., Gouzy,

J., Gurjal, M., Hernandez-Lucas, I., Hong, A., Huizar, L., Hyman, R. W., Jones, T.,

Kahn, D., Kahn, M. L., Kalman, S., Keating, D. H., Kiss, E., Komp, C., Lelaure, V.,

Masuy, D., Palm, C., Peck, M. C., Pohl, T. M., Portetelle, D., Purnelle, B., Ramsperger,

U., Surzycki, R., Thébault, P., Vandenbol, M., Vorhölter, F.-J., Weidner, S., Wells, D.

H., Wong, K., Yeh, K. C. & Batut, J. (2001). The composite genome of the legume

symbiont Sinorhizobium meliloti. Science. 29. 668 – 672.

Galinier, A., Garnerone, A. M., Reyrat, J. M., Kahn, D., Batut, J. & Boistard, P.

(1994). Phosphorylation of the Rhizobium meliloti FixJ protein induces its binding to a

compound regulatory region at the fixK promoter. Journal of Biological Chemistry. 269.

23784 – 23789.

Garcia, M., Dunlap, J., Loh, J. & Stacey, G. (1996). Phenotypic characterization and

regulation of the nolA gene of Bradyrhizobium japonicum. Molecular Plant-Microbe

Interactions. 9. 625 – 636.

Gardiol, A., Arias, A., Cervenansky, C. & Martinezdrets, G. (1982). Succinate

dehydrogenase mutant of Rhizobium meliloti. Journal of Bacteriology. 151. 1621 – 1623.

268

Gardiol, A. E., Truchet, G. L. & Dazzo, F. B. (1987). Requirement of succinate

dehydrogenase activity for symbiotic bacteroid differentiation of Rhizobium meliloti in

alfalfa nodules. Applied and Environmental Microbiology. 53. 1947 – 1950.

Georgiadis, M. M., Komiya, H., Chakrabarti, P., Woo, D., Kornuc, J. J. & Rees, D. C.

(1992). Crystallographic structure of the nitrogenase iron protein from Azotobacter

vinelandii. Science. 257. 1653 – 1659.

Gilles-Gonzalez, M. A., Ditta, G. S. & Helinski, D. R. (1991). A haemoprotein with

kinase activity encoded by the oxygen sensor of Rhizobium meliloti. Nature. 350. 170 –

172.

Gilliland, G. L. & Quiocho, F. A. (1981). Structure of the L-arabinose-binding protein

from Escherichia coli at 2.4 Å resolution. Journal of Molecular Biology. 146. 341 – 362.

Girard, L., Brom, S., Davalos, A., Lopez, O., Soberon, M. & Romero, D. (2000).

Differential regulation of fixN-reiterated genes in Rhizobium etli by a novel fixL-fixK

cascade. Molecular Plant-Microbe Interactions. 13. 1283 – 1292.

Gualtieri, G. & Bisseling, T. (2000). The evolution of nodulation. Plant Molecular

Biology. 42. 181 – 94.

Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaiah, B. W. & Oldroyd, G. E.

(2006). Nodulation independent of rhizobia induced by a calcium-activated kinase lacking

autoinhibition. Nature. 441. 1149 – 1152.

Glenn, A. R. & Dilworth, M. J. (1981). The uptake and hydrolysis of disaccharides by

fast-and slow-growing species of Rhizobium. Archives of Microbiology. 129. 238 – 239.

Glenn, A. R. & Dilworth, M. J. (1984). Methylamine and ammonium transport systems in

Rhizobium leguminosarum. Journal of General Microbiology. 130. 1961 – 1968.

Glenn, A. R., Arwas, R., McKay, I. A. & Dilworth, M. J. (1984a). Fructose metabolism

in wild type, fructokinase negative and revertant strains of Rhizobium leguminosarum.

Journal of General Microbiology. 130. 231 – 237.

269

Glenn, A. R., McKay, I. A., Arwas, R. & Dilworth, M. J. (1984b). Sugar metabolism and

the symbiotic properties of carbohydrate mutants of Rhizobium leguminosarum. Journal of

General Microbiology. 130. 239 – 245.

Goethals, K., Van Montagu, M. & Holsters, M. (1992). Conserved motifs in a divergent

nod box of Azorhizobium caulinodans ORS571 reveal a common structure in promoters

regulated by LysR-type proteins. Proceedings of the National Academy of Sciences of the

United States of America. 89. 1646 – 1650.

Gonzalez, V., Santamaria, R. I., Bustos, P., Hernandez-Gonzalez, I., Medrano-Soto,

A., Moreno-Hagelsieb, G., Janga, S. C., Ramirez, M. A., Jimenez-Jacinto, V., Collado-

Vides, J. & Davila, G. (2006). The partitioned Rhizobium etli genome: genetic and

metabolic redundancy in seven interacting replicons. Proceedings of the National Academy

of Sciences of the United States of America. 103. 3834 – 3839.

Gordon, A. J., Ryle, G. J. A., Mitchell, D. F. & Powell, C. E. (1985). The flux of 14C-

labeled photosynthate through soybean root nodules during N2 fixation. Journal of

Experimental Botany. 36. 756 – 769.

Gottfert, M., Grob, P. & Hennecke, H. (1990). Proposed regulatory pathway encoded by

the nodV and nodW genes, determinants of host specificity in Bradyrhizobium japonicum.

Proceedings of the National Academy of Sciences of the United States of America. 87. 2680

– 2684.

Gottfert, M., Holzhauser, D., Bani, D. & Hennecke, H. (1992). Structural and functional

analysis of two different nodD genes in Bradyrhizobium japonicum USDA110. Molecular

Plant-Microbe Interactions. 5. 257 – 265.

Gottesman, M. M., Fojo, T. & Bates, S. E. (2002). Multidrug resistance in cancer: role of

ATP-dependent transporters. Nature Reviews Cancer. 2. 48 – 58.

Govezensky, D., Greener, T., Segal, G. & Zamir, A. (1991). Involvement of GroEL in nif

gene regulation and nitrogenase assembly. Journal of Bacteriology. 173. 6339 – 6346.

270

Graham, P. H., Sadowsky, M. J., Keyser, H. H., Barnet, Y. M., Bradley, R. S., Cooper,

J. E., De Ley, D. J., Jarvis, B. D. W., Roslycky, E. B., Stijdom, B. W., & Young, J. P.

W. (1991). Proposed minimal standards for the description of new genera and species

of root- and stem-nodulating bacteria. International Journal of Systematic Bacteriology.

41. 582 – 587.

Gray, K. M., Pearson, J. P., Downie, J. A., Boboye, B. E. & Greenberg, E. P. (1996).

Cell-to-cell signaling in the symbiotic nitrogen-fixing bacterium Rhizobium

leguminosarum: autoinduction of a stationary phase and rhizosphere-expressed genes.

Journal of Bacteriology. 178. 372 – 376.

Green, L. S. & Emerich, D. W. (1997). Bradyrhizobium japonicum does not require α -

ketoglutarate dehydrogenase for growth on succinate or malate. Journal of Bacteriology.

179. 194 – 201.

Green, L. S. & Emerich, D. W. (1997). The formation of nitrogen fixing bacteroids is

delayed but not abolished in soybean infected by an α –ketoglutarate dehydrogenase

deficient mutant of Bradyrhizobium japonicum. Plant Physiology. 114. 1359 – 1368.

Green, L. S., Karr, D. B. & Emerich, D. W. (1998). Isocitrate dehydrogenase and

glyoxylate cycle enzyme activities in Bradyrhizobium japonicum under various growth

conditions. Archives of Microbiology. 169. 445 – 451.

Green, L. S., Li, Y. Z., Emerich, D. W., Bergersen, F. J. & Day, D. A. (2000).

Catabolism of α -ketoglutarate by a sucA mutant of Bradyrhizobium japonicum: Evidence

for an alternative tricarboxylic acid cycle. Journal of Bacteriology. 182. 2838 – 2844.

Green, J., Scott, C. & Guest, J. R. (2001). Functional versatility in the CRP-FNR

superfamily of transcription factors: FNR and FLP. Advances in Microbial Physiology. 44.

1 – 34.

Green, L. S., Waters, J. K., Ko, S. & Emerich, D. W. (2003). Comparative analysis of the

Bradyrhizobium japonicum sucA region. Canadian Journal of Microbiology. 49. 237 – 243.

271

Gruer, M. J., Bradbury, A. J. & Guest, J. R. (1997). Construction and properties of

aconitase mutants of Escherichia coli. Microbiology. 143. 1837 – 1846.

Grzemski, W., Akowski, J. P. & Kahn, M. L. (2005). Probing the Sinorhizobium meliloti-

alfalfa symbiosis using temperature-sensitive and impaired-function citrate synthase

mutants. Molecular Plant-Microbe Interactions. 18. 134 – 141.

Guest, J. R. & Russell, G. C. (1992). Complexes and complexities of the citric acid cycle

in Escherichia coli. Current Topics in Cellular Regulation. 33. 231 - 247.

Gutierrez, D., Hernando, Y., Palacios, J. M., Imperial, J. & Ruiz-Argueso, T. (1997).

FnrN controls symbiotic nitrogen fixation and hydrogenase activities in Rhizobium

leguminosarum biovar viciae UPM791. Journal of Bacteriology. 179. 5264 - 5270.

Haaker, H. & Klugkist, J. (1987). The bioenergetics of electron transport to nitrogenase.

FEMS Microbiology Reviews. 46. 57 – 71.

Hageman, R. V. & Burris, R. H. (1978). Nitrogenase and nitrogenase reductase associate

and dissociate with each catalytic cycle. Proceedings of the National Academy of Sciences

of the United States of America. 75. 2699 – 2702.

Haser, A., Robinson, D. L., Duc, G. & Vance, C. P. (1992). A mutation in Vicia faba

results in ineffective nodules with impaired bacteroid differentiation and reduced synthesis

of late nodulin. Journal of Experimental Botany. 43. 1397 – 1407.

Herrada, G., Puppo, A. & Rigaud, J. (1989). Uptake of metabolites by bacteroid

containing vesicles and by free bacteroids from French bean nodules. Journal of General

Microbiology. 135. 3165 – 3177.

Hertig C, Li RY, Louarn AM, Garnerone AM, David M, Batut J, Kahn D, Boistard P.

(1989). Rhizobium meliloti regulatory gene fixJ activates transcription of R. meliloti nifA

and fixK genes in Escherichia coli. Journal of Bacteriology. 171. 1736 – 1738.

Higgins, C.F. & Ames, G.F.-L. (1981). Two periplasmic proteins which interact with a

common membrane receptor show extensive homology: complete nucleotide sequences.

272

Proceedings of the National Academy of Sciences of the United States of America. 78. 6038

- 6042.

Higgins, C. F., Hiles, I. D., Whalley, K. & Jamieson, D. J. (1985). Nucleotide binding by

membrane components of bacterial periplasmic binding protein-dependent transport

systems. EMBO Journal. 4. 1033 – 1040.

Higgins, C. F., Hiles, I. D., Salmond, G. P. C., Gill, D. R., Downie, J. A., Evans, I. J.,

Holland, I. B., Gray, L., Buckel, S. D., Bell, A. W. & Hermodson, M. A. (1986). A

family of related ATP-binding subunits coupled to many distinct biological processes in

bacteria. Nature. 323. 448 – 450.

Higgins, C. F. (1992). ABC transporters: from microorganisms to man. Annual Review of

Cell Biology. 8. 67 – 113.

Higgins, C. F. & Linton, K. J. (2004). The ATP switch model for ABC transporters.

Nature Structural and Molecular Biology. 11. 918 – 926.

Hobson, A. C., Weatherwax, R. & Ames, G. F. L. (1984). ATP-binding sites in the

membrane components of histidine permease, a periplasmic transport system. Proceedings

of the National Academy of Sciences of the United States of America. 81. 7333 – 7337.

Hofmann, K. & Stoffel, W. (1993). TMbase - A database of membrane spanning proteins

segments. Biological Chemistry. 374. 166.

Hogg, B., Davies, A. E., Wilson, K. E., Bisseling, T., Downie, J. A. (2002). Competitive

nodulation blocking of cv. Afghanistan pea is related to high levels of nodulation factors

made by some strains of Rhizobium leguminosarum bv. viciae 15. 60 – 68.

Holtel, A. & Merrick, M.J. (1988). Identification of the Klebsiella pneumoniae glnB gene:

nucleotide sequence of wild-type and mutant alleles. Molecular and General Genetics. 215.

134 – 138.

273

Holtel, A. & Merrick, M.J. (1989). The Klebsiella pneumoniae PII protein (glnB gene

product) is not absolutely required for nitrogen regulation and is not involved in NifL-

mediated nif gene regulation. Molecular and General Genetics. 217. 474 – 480.

Hong, G. F., Burn, J. E. & Johnston, A. W. (1987). Evidence that DNA involved in the

expression of nodulation (nod) genes in Rhizobium binds to the product of the regulatory

gene nodD. Nucleic Acids Research. 15. 9677 – 9690.

Honma, M. A. & Ausubel, F. M. (1987). Rhizobium meliloti has three functional copies of

the nodD symbiotic regulatory gene. Proceedings of the National Academy of Sciences of

the United States of America. 84. 8558 – 8562.

Honma, M. A., Asomaning, M. & Ausubel, F. M. (1990). Rhizobium meliloti nodD genes

mediate host-specific activation of nodABC. Journal of Bacteriology. 172. 901 – 911.

Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989). Engineering

hybrid gene without the use of restriction enzymes; gene splicing by overlap extensions.

Gene. 77. 61 – 68.

Hoshino, T. (1979). Transport systems for branched-chain amino acids in Pseudomonas

aeruginosa. Journal of Bacteriology. 139. 705 – 712.

Hoshino, T. & Kose, K. (1990). Cloning, nucleotide sequences, and identification of

products of the Pseudomonas aeruginosa PAO bra genes, which encode the high-affinity

branched-chain amino acid transport system. Journal of Bacteriology. 172. 5531 – 5539.

Hoshino, T., Kose-Terai, K. & Sato, K. (1992). Solubilization and reconstitution of the

Pseudomonas aeruginosa high affinity branched-chain amino acid transport system.

Journal of Bioogical Chemistry. 267. 21313 – 21318.

Hosie, A. H. F. & Poole, P. S. (2001). Bacterial ABC transporters of amino acids.

Research in Microbiology. 152. 259 – 270.

274

Hosie, A. H. F., Allaway, D., Jones, M. A., Walshaw, D. L., Johnston, A. W. B. &

Poole, P. S. (2001). Solute-binding protein-dependent ABC transporters are responsible for

solute efflux in addition to solute uptake. Molecular Microbiology. 40. 1449 – 1459.

Hosie, A. H. F., Allaway, D. A., Galloway, C. S., Dunsby, H. A. & Poole, P. S. (2002a).

Characterisation of a second general amino acid permease of R. leguminosarum with high

similarity to branched chain amino acid transporters (Bra/LIV) of the ABC family. Journal

of Bacteriology. 184. 4071 – 4080.

Hosie, A. H. F., Allaway, D. A. & Poole, P. S. (2002b). A monocarboxylate permease of

Rhizobium leguminosarum is the first member of a new subfamily of transporters. Journal

of Bacteriology. 184. 5436 – 5448.

Howitt, S. M., Udvardi, M. K., Day, D. A. & Gresshoff, P. M. (1986). Ammonia

transport in free-living and symbiotic Rhizobium sp ANU289. Journal of General

Microbiology. 132. 257 – 261.

Hrycyna, C. A., Ramachandra, M., Ambudkar, S. V., Ko, Y. H., Pedersen, P. L.,

Pastan, I. & Gottesman, M. M. (1998). Mechanism of action of human P-glycoprotein

ATPase activity. Photochemical cleavage during a catalytic transition state using

orthovanadate reveals cross-talk between the two ATP sites. Journal of Biological

Chemistry. 273. 16631 - 16634.

Hu, H., Liu, S., Yang, Y., Chang, W. & Hong, G. (2000). In Rhizobium leguminosarum,

NodD represses its own transcription by competing with RNA polymerase for binding sites.

Nucleic Acids Research. 28. 2784 – 2793.

Huerta-Zepeda, A., Ortuno, L., Du Pont, G., Duran, S., Lloret, A., Merchant-Larios,

H. & Calderon, J. (1997). Isolation and characterization of Rhizobium etli mutants altered

in degradation of asparagine. Journal of Bacteriology. 179. 2068 – 2072.

Humbeck, C. & Werner, D. (1989). Delayed nodule development in a succinate transport

mutant of Bradyrhizobium japonicum. Journal of Plant Physiology. 134. 276 – 283.

275

Humbert, R. & Simoni, R. D. (1980). Genetic and biomedical studies demonstrating a

second gene coding for asparagine synthetase in Escherichia coli. Journal of Bacteriology.

142. 212 – 220.

Hung, L. W., Wang, I. X., Nikaido, K., Liu, P. Q., Ames, G. F. & Kim, S. H. (1998).

Crystal structure of the ATP-binding subunit of an ABC transporter. Nature. 396. 703 –

707.

Hunt, S. & Layzell, D. B. (1993). Gas exchange of legume nodules and the regulation of

nitrogenase activity. Annual Review of Plant Physiology. 44. 483 – 511.

Igarashi, K. & Kashiwagi, K. (1999). Polyamine transport in bacteria and yeast. The

Biochemical Journal. 344. 633 – 642.

Indiveri, C., Krämer, R. & Palmieri, F. (1987). Reconstitution of the malate / aspartate

shuttle from mitochondria. Journal of Biological Chemistry. 262. 15979 - 15983.

Ivashina, T. V., Khmelnitsky, M. I., Shlyapnikov, M. G., Kanapin, A. A. & Ksenzenko,

V. N. (1994). The pss4 gene from Rhizobium leguminosarum bv. viciae VF39: cloning,

sequence and the possible role in polysaccharide production and nodule formation. Gene.

150. 111 – 116.

Janausch, I. G., Zientz, E., Tran, Q. H., Kroger, A. & Unden, G. (2002). C4-

dicarboxylate carriers and sensors in bacteria. Biochimica Biophysica Acta. 1553. 39 – 56.

Jiang, P., Peliska, J. A. & Ninfa, A. J. (1998a). Reconstitution of the signal-transduction

bicyclic cascade responsible for the regulation of Ntr gene transcription in Escherichia coli.

Biochemistry. 37. 12795 – 127801.

Jiang, P., Peliska, J. A. & Ninfa, A. J. (1998b). The regulation of Escherichia coli

glutamine synthetase revisited: role of 2-ketoglutarate in the regulation of glutamine

synthetase adenylylation state. Biochemistry. 37. 12802 – 12810.

276

Jin, H. N., Glenn, A. R. & Dilworth, M. J. (1988). Ammonium uptake by cowpea

Rhizobium strain MNF 2030 and Rhizobium trifolii MNF 1001. Archives of Microbiology

149. 308 – 311.

Johnston, A. W. B. & Beringer, J. E. (1975). Identification of the Rhizobium strains in pea

root nodules using genetic markers. Journal of General Microbiology. 87. 343 – 350.

Jones, P. M. & George, A. M. (1999). Subunit interactions in ABC transporters: towards a

functional architecture. FEMS Microbiol Letters. 179. 187 – 202.

Jording, D. & Pühler, A. (1993). The membrane topology of the Rhizobium meliloti C4-

dicarboxylate permease (DctA) as derived from protein fusions with Escherichia coli K12

alkaline-phosphatase (PhoA) and beta-galactosidase (LacZ). Molecular and General

Genetics. 241. 106 – 114.

Jording, D., Uhde, C., Schmidt, R. & Pühler, A. (1994). The C4-dicarboxylate transport

system of Rhizobium meliloti and its role in nitrogen-fixation during symbiosis with alfalfa

(Medicago sativa). Experientia. 50. 874 – 883.

Kaiser, B. N., Finnegan, P. M., Tyerman, S. D., Whitehead, L. F., Bergersen, F. J.,

Day, D. A. & Udvardi, M. K. (1998). Characterization of an ammonium transport protein

from the peribacteroid membrane of soybean nodules. Science. 281. 1202 – 1206.

Kahn, M. L., Kraus, J. & Sommerville, J. E. (1985). A model of nutrient

exchange in the Rhizobium-legume symbiosis. In Nitrogen Fixation Research Progress,

Edited by Evans, H.J., Bottomley, P. J. & Newton, W.E. Martinus Nijhoff, Dordrecht..

Kaneko, T., Nakamura, Y., Sato, S., Asamizu, E., Kato, T., Sasamoto, S., Watanabe,

A., Idesawa, K., Ishikawa, A., Kawashima, K., Kimura, T., Kishida, Y., Kiyokawa, C.,

Kohara, M., Matsumoto, M., Matsuno, A., Mochizuki, Y., Nakayama, S., Nakazaki,

N., Shimpo, S., Sugimoto, M., Takeuchi, C., Yamada, M. & Tabata, S. (2000).

Complete genome structure of the nitrogen fixing symbiotic bacterium Mesorhizobium loti.

DNA Research. 7. 331 – 338.

277

Kaneko, T., Nakamura, Y., Sato, S., Minamisawa, K., Uchiumi, T., Sasamoto, S.,

Watanabe, A., Idesawa, K., Iriguchi, M., Kawashima, K., Kohara, M., Matsumoto, M.,

Shimpo, S., Tsuruoka, H., Wada, T., Yamada, M. & Tabata, S. (2002). Complete

genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum

USDA110. DNA Research. 9. 189 – 197.

Kannenberg, E. L. & Brewin, N. J. (1994). Host-plant invasion by Rhizobium: the role of

cell-surface components. Trends in Microbiology. 2. 277 – 283.

Karunakaran, R., Mauchline, T. H., Hosie, A. H. F. & Poole, P. S. (2005). A family of

promoter probe vectors incorporating autofluorescent and chromogenic reporter proteins for

studying gene expression in Gram-negative bacteria. Microbiology. 151. 3249 – 3256.

Karr, D. B., Waters, J. K., Suzuki, F. & Emerich, D. W. (1984). Enzymes of the poly-β -

hydroxybutyrate and citric acid cycles of Rhizobium japonicum bacteroids. Plant

Physiology. 75. 1158 – 1162.

Karr, D. B. & Emerich, D. W. (2000). Bradyrhizobium japonicum isocitrate

dehydrogenase exhibits calcium dependent hysteresis. Archives of Biochemistry and

Biophysics. 376. 101 – 108.

Kashiwagi, K., Yamaguchi, Y., Sakai, Y., Kobayashi, H. & Igarashi, K. (1990).

Identification of the polyamine-induced protein as a periplasmic oligopeptide binding

protein. Journal of Biological Chemistry. 265. 8387 – 8391.

Kashiwagi, K., Miyamoto, S., Nukui, E., Kobayashi, H. & Igarashi, K. (1993).

Functions of PotA and PotD proteins in spermidine-preferential uptake system in

Escherichia coli. Journal of Biological Chemistry. 268. 19358 – 19363.

Kashiwagi, K., Pistocchi, R., Shibuya, S., Sugiyama, S., Morikawa, K. & Igarashi, K.

(1996). Spermidine-preferential uptake system in Escherichia coli. Identification of amino

acids involved in polyamine binding in PotD protein. Journal of Biological Chemistry. 71.

12205 – 12208.

278

Keen, N. T., Tamaki, S., Kobayashi, D, & Trollinger, D. (1988). Improved broad-host-

range plasmids for DNA cloning in gram-negative bacteria. Gene. 70. 191 – 197.

Kennedy, I. (1966a). Primary products of symbiotic nitrogen fixation II. Pulse-labelling

of Serradella nodules with 15N2. Biochimica et Biophysica Acta. 130. 285 – 294.

Kennedy, I. R. (1966b). Primary products of symbiotic nitrogen fixation. I Short

term exposure of serradella nodules to 15N2. Biochimica et Biophysica Acta. 130.

285 – 294.

Kim, J. & Rees, D. C. (1992). Crystallographic structure and functional implications of the

nitrogenase molybdenum-iron protein from Azotobacter vinelandii. Nature. 360. 553 – 560.

Kim, S. A. & Copeland, L. (1996). Enzymes of poly-β –hydroxybutyrate metabolism in

soybean and chickpea bacteroids. Applied and Environmental Microbiology. 62. 4186 –

4190.

King, B. J., Layzell, D. B. & Canvin, D. T. (1986). The role of dark carbon dioxide

fixation in root nodules of soybean. Plant Physiology. 81. 200 – 205.

King SC, Fleming SR, Brechtel C. (1995a). Pyridine carboxylic acids as inhibitors and

substrates of the Escherichia coli Gab permease encoded by gabP. Journal of Bacteriology.

177. 5381 – 5382.

King SC, Fleming SR, Brechtel CE. (1995b). Ligand recognition properties of the

Escherichia coli 4-aminobutyrate transporter encoded by gabP. Specificity of Gab

permease for heterocyclic inhibitors. Journal of Biological Chemistry. 270. 19893 – 19897.

Knight, C. D., Rossen. L,, Robertson. J. G., Wells, B. & Downie, J. A. (1986).

Nodulation inhibition by Rhizobium leguminosarum multicopy nodABC genes and analysis

of early stages of plant infection. Journal of Bacteriology. 166. 552 – 558.

Kocharian, S. M., Kocharian, A. M., Meliksetian, G. O. & Akopian, Z. I. (1982).

Escherichia coli K-12 mutants assimilating adenine via a new metabolic pathway. Genetika.

18. 906 – 915.

279

Kondorosi, E., Gyuris, J., Schmidt, J., John, M., Duda, E., Hoffmann, B., Schell, J. &

Kondorosi, A. (1989). Positive and negative control of nod gene expression in Rhizobium

meliloti is required for optimal nodulation. EMBO Journal. 8. 1331 – 1340.

Kondorosi, E., Pierre, M., Cren, M., Haumann, U., Buire, M., Hoffmann, B., Schell, J.

& Kondorosi, A. (1991a). Identification of NolR, a negative transacting factor controlling

the nod regulon in Rhizobium meliloti. Journal of Molecular Biology. 222. 885 – 896.

Kondorosi, E., Buire, M., Cren, M., Iyer, N., Hoffmann, B. & Kondorosi, A. (1991b).

Involvement of the syrM and nodD3 genes of Rhizobium meliloti in nod gene activation and

in optimal nodulation of the plant host. Molecular Microbiology. 5. 3035 – 3048.

Konstantinidis, K. T. & Tiedje, J. M. (2004). Trends between gene content and genome

size in prokaryotic species with larger genomes. Proceedings of the National Academy of

Sciences of the United States of America. 101. 3160 – 3165.

Kouchi, H. & Yoneyama, T. (1986). Metabolism of 13C-labelled photosynthate in plant

cytosol and bacteroids of root nodules of Glycine max. Physiologia Plantarum. 68. 238 –

244.

Kouchi, H., Fukai, K. & Kihara, A. (1991). Metabolism of glutamate and aspartate in

bacteroids isolated from soybean root nodules. Journal of General Microbiology. 137. 2901

– 2910.

Kouchi, H., Shimomura, K., Hata, S., Hirota, A., Wu, G. J., Kumagai, H., Tajima, S.,

Suganuma, N., Suzuki, A., Aoki, T., Hayashi, M., Yokoyama, T., Ohyama, T.,

Asamizu, E., Kuwata, C., Shibata, D., Tabata, S. (2004). Large-scale analysis of gene

expression profiles during early stages of root nodule formation in a model legume, Lotus

japonicus. DNA Research. 11. 263 – 274.

Kretovich, V. L., Karyakina, T. I., Sidelnikova, L. I., Shaposhnikov, G. L. and

Kaloshina, G. S. (1986). Nitrogen fixation and biosynthesis of aspartic acid and alanine by

bacteroids of Rhizobium lupini on various carbon sources. Doklady Akademii Nauk SSSR

291. 1008 – 1011.

280

Krishnan, H. B., Kim, W. S., Sun-Hyung, J., Kim, K. Y. & Jiang, G. (2003). Citrate

synthase mutants of Sinorhizobium fredii USDA257 form ineffective nodules with aberrant

ultrastructure. Applied Environmental Microbiology. 69. 3561 – 3568.

Krishnan, N. & Becker, D. F. (2005). Characterization of a bifunctional PutA homologue

from Bradyrhizobium japonicum and identification of an active site residue that modulates

proline reduction of the flavin adenine dinucleotide cofactor. Biochemistry. 44. 9130 –

9139.

Kumar, S., Bourdes, A. & Poole, P. S. (2005). De novo alanine synthesis by bacteroids of

Mesorhizobium loti is not required for nitrogen transfer in the determinate nodules of Lotus

corniculatus. Journal of Bacteriology. 187. 5493 – 5495.

Kurz, W. G., Rokosh, D. A. & LaRue T. A. (1975). Enzymes of ammonia assimilation in

Rhizobium leguminosarum bacteroids. Canadian Journal of Microbiology. 21. 1009 – 1012.

Lagueree, G., Mazurier, S. I. & Amarger, N. (1992). Plasmid profiles and restriction

fragment length polymorphism of Rhizobium leguminosarum bv. viciae in field populations.

FEMS Microbiology Ecology. 101. 17 – 26.

Laing, W. A., Christeller, J. T. & Sutton, W. D. (1979). Carbon dioxide fixation by lupin

root nodules: II. Studies with C-labeled glucose, the pathway of glucose catabolism, and the

effects of some treatments that inhibit nitrogen fixation. Plant Physiology. 63. 450 – 454.

Lamers, M. H., Perrakis, A., Enzlin, J. H., Winterwerp, H. H., de Wind, N. & Sixma,

T. K. (2000). The crystal structure of DNA mismatch repair protein MutS binding to a GxT

mismatch. Nature. 407. 711 – 717.

Landick, R. & Oxender, D. L. (1985). The complete nucleotide sequences of the

Escherichia coli LIV-BP and LS-BP genes. Implications for the mechanism of high-affinity

branched-chain amino acid transport. Journal of Biological Chemistry. 260. 8257 – 8261.

Larsson, C. H., Nilsson, A., Blomberg, A. & Gustafsson, L. (1997). Glycolytic flux is

conditionally correlated with ATP concentration in Saccharomyces cerevisiae: a chemostat

281

study under carbon- on nitrogen-limiting conditions. Journal of Bacteriology. 179. 7243 –

7250.

Layzell, D. B., Hunt, S. & Palmer, G. R. (1990). Mechanism of Nitrogenase Inhibition in

Soybean Nodules: Pulse-Modulated Spectroscopy Indicates that Nitrogenase Activity Is

Limited by O2. Plant Physiology. 92. 1101 – 1107.

Lee, J. H., Scholl, D., Nixon, B. T. & Hoover, T. R. (1994). Constitutive ATP hydrolysis

and transcription activation by a stable, truncated form of Rhizobium meliloti DctD, a sigma

54-dependent transcriptional activator. Journal of Biological Chemistry. 269. 20401 –

20409.

LeRouge, P., Roche, P., Faucher, C., Maillet, F., Truchet, G., Prome, J.C., Denarie, J.

(1990). Symbiotic host specificity of Rhizobium meliloti is determined by a sulphated and

acylated glucosamine oligosaccharide signal. Nature. 344. 781 – 784.

Levy, J., Bres, C., Geurts, R., Chalhoub, B., Kulikova, O., Duc, G., Journet, E. P., Ane,

J. M., Lauber, E., Bisseling, T., Denarie, J., Rosenberg, C. & Debelle, F. (2004). A

putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal

symbioses. Science. 303. 1361 –1364.

Lewis, T. A., Gonzalez, R. & Botsford, J. L. (1990). Rhizobium meliloti glutamate

synthase: cloning and initial characterization of the glt locus. Journal of Bacteriology. 172.

2413 – 2420.

Li, Y., Parsons, R., Day, D. A. & Bergersen, F. J. (2002). Reassessment of major

products of N2 fixation by bacteroids from soybean root nodules. Microbiology. 148. 1959

– 1966.

Limpens, E., Franken, C., Smit, P., Willemse, J., Bisseling, T. & Geurts, R. (2003).

LysM domain receptor kinases regulating rhizobial Nod factor-induced infection. Science.

302. 630 – 633.

Limpens, E. & Bisseling, T. (2003). Signaling in symbiosis. Current Opinion in Plant

Biology. 6. 343 – 350.

282

Little R, Dixon R. (2003). The amino-terminal GAF domain of Azotobacter vinelandii

NifA binds 2-oxoglutarate to resist inhibition by NifL under nitrogen-limiting conditions.

Journal of Biological Chemistry. 278. 28711 – 28718.

Liu, C. E., Liu, P. Q., Wolf, A., Lin, E. & Ames, G. F. (1999). Both lobes of the soluble

receptor of the periplasmic histidine permease, an ABC transporter (traffic ATPase),

interact with the membrane-bound complex. Effect of different ligands and consequences

for the mechanism of action. Journal of Biological Chemistry. 274. 739 – 747.

Locher KP, Lee AT, Rees DC. (2002). The E. coli BtuCD structure: a framework for ABC

transporter architecture and mechanism. Science. 296. 1091 – 1098.

Locher KP. (2004). Structure and mechanism of ABC transporters. Current Opinion in

Structural Biology. 14. 426 – 431.

Lodwig, E. M. & Poole, P. S. (2003). Metabolism of Rhizobium bacteroids. Critical

Reviews in Plant Sciences. 22. 37 – 78.

Lodwig, E. M., Hosie, A. H. F., Bourdes, A., Findlay, K., Allaway, D. Karunakarun,

R., Downie, J. A. & Poole, P. S. (2003). Amino-acid cycling drives nitrogen fixation in the

legume–Rhizobium symbiosis. Nature. 422. 722 – 726.

Lodwig, E. M., Kumar, S., Allaway, D., Bourdes, A., Prell, J., Priefer, U. & Poole, P. S.

(2004). Regulation of L-alanine dehydrogenase in Rhizobium leguminosarum bv. viciae and

its role in pea nodules. Journal of Bacteriology. 186. 842 – 849.

Lodwig, E. M., Leonard, M., Marroqui, S., Wheeler, T. R,, Findlay. K,, Downie, J. A.

& Poole, P. S. (2005). Role of polyhydroxybutyrate and glycogen as carbon storage

compounds in pea and bean bacteroids. Molecular Plant-Microbe Interactions. 18. 67 – 74.

Loh, J. T. & Stacey, G. (2001). Feedback regulation of the Bradyrhizobium japonicum

nodulation genes. Molecular Microbiology. 41. 1357 – 1364.

Long, S. R. (1989). Rhizobium genetics. Annual Review of Genetics. 23. 483 – 506.

283

Long, S. R. (1996). Rhizobium symbiosis - nod factors in perspective. Plant Cell. 8. 1885 –

1898.

Long, S. R. (2001). Genes and signals in the Rhizobium-legume symbiosis. Plant

Physiology. 125. 69 – 72.

Lucas, M. M., Peart, J. L., Brewin, N. J. & Kannenberg, E. L. (1996). Isolation of

monoclonal antibodies reacting with the core component of lipopolysaccharide from

Rhizobium leguminosarum strain 3841 and mutant derivatives. Journal of Bacteriology.

178. 2727 – 2733.

McKay, I. A., Glenn, A. R. & Dilworth, M. J. (1985). Gluconeogenesis in Rhizobium

leguminosarum. Journal of General Microbiology. 131. 2067 – 2073.

McKay, I. A., Dilworth, M. J. & Glenn, A. R. (1988). C4-dicarboxylate metabolism in

free-living and bacteroid forms of Rhizobium leguminosarum MNF3841. Journal of

General Microbiology. 134. 1433 – 1440.

McKay, I. A., Dilworth, M. J. & Glenn, A. R. (1989). Carbon catabolism in continuous

cultures and bacteroids of Rhizobium leguminosarum MNF 3841. Archives of Microbiology.

152. 606 – 610.

Madsen, E. B., Madsen, L. H., Radutoiu, S., Olbryt, M., Rakwalska, M., Szczyglowski,

K., Sato, S., Kaneko, T., Tabata, S., Sandal, N. & Stougaard, J.. (2003). A receptor

kinase gene of the LysM type is involved in legume perception of rhizobial signals. Nature.

425. 569 – 570.

Magnusson, U., Salopek-Sondi, B., Luck, L. A. & Mowbray, S. L. (2004). X-ray

structures of the leucine-binding protein illustrate conformational changes and the basis of

ligand specificity. Journal of Biological Chemistry. 279. 8747 – 8752.

Manoli, C. & Beckwith, J. (1985). TnphoA: a transposon probe for protein export signals.

Proceedings of the National Academy of Sciences of the United States of America..82. 8129

– 8133.

284

Mantsala, P. & Zalkin, H. (1976). Active subunits of Escherichia coli glutamate synthase.

Journal of Bacteriology. 126. 539 – 541.

Mao, C., Downie, J. A. & Hong, G. (1994). Two inverted repeats in the nodD promoter

region are involved in nodD regulation in Rhizobium leguminosarum. Gene. 145. 87 – 90.

Martinez, M., Palacios, J. M., Imperial, J. & Ruiz-Argueso, T. (2004). Symbiotic

autoregulation of nifA expression in Rhizobium leguminosarum bv. viciae. Journal of

Bacteriology. 186. 6586 – 6594.

MartinezRomero, E. & CaballeroMellado, J. (1996). Rhizobium phylogenies and

bacterial genetic diversity. Critical Reviews in Plant Sciences. 15. 113 – 140.

Marvin, J. S. & Hellinga, H. W. (2001). Manipulation of ligand binding affinity by

exploitation of conformational coupling. Nature Structal Biology. 8. 795 –798.

Matsubara, K., Ohnishi, K. & Kiritani, K. (1992). Nucleotide sequences and

characterization of liv genes encoding components of the high-affinity branched-chain

amino acid transport system in Salmonella typhimurium. Journal of Biochemistry. 112. 93 –

101.

Maxwell, C. A., Vance, C. P., Heichel, G. H. & Stade, S. (1984). CO2 fixation in alfalfa

and birdsfoot trefoil root nodules and partitioning of 14C to the plant. Crop Science. 24. 257

– 264.

McIver, J., Djordjevic, M. A., Weinman, J. J., Bender, G. L. & Rolfe, B. G. (1989).

Extension of host range of Rhizobium leguminosarum bv. trifolii caused by point mutations

in nodD that result in alterations in regulatory function and recognition of inducer

molecules. Molecular Plant-Microbe Interactions. 2. 97 – 106.

Meijer, A.J. & Van Dam, K. (1974). The metabolic significance of anion transport in

mitochondria. Biochimica et Biophysica Acta. 346. 213 – 244.

285

Metzer, E. & Halpern, Y. S. (1990). In vivo cloning and characterization of the gabCTDP

gene cluster of Escherichia coli K-12. Journal of Bacteriology. 172. 3250 – 3256.

Milcamps, A., Ragatz, D. M., Lim, P., Berger, K. A. & de Bruijin, F. J. (1998). Isolation

of carbon- and nitrogen-deprivation-induced loci of Sinorhizobium meliloti by Tn5-luxAB

mutagenesis. Microbiology. 144. 3205 – 3218.

Miles, J. S. & Guest, J. R. (1987). Molecular genetic aspects of the citric acid cycle of

Escherichia coli. Biochemical Society Symposium. 54. 45 – 65.

Miller, J. H. (1972). Experiments in molecular genetics. New York: Cold Spring Harbor

Laboratory Press.

Miller, R. E. & Stadtman, E. R. (1972). Glutamate synthase from Escherichia coli. An

iron-sulfide flavoprotein. Journal of Biological Chemistry. 247. 7407 – 7419.

Miller, R. W., McRae, D. G., Al Jobore, A. & Berndt, W. B. (1988). Respiration

supported nitrogenase activity of isolated Rhizobium meliloti bacteroids. Journal of Cell

Biochemistry. 38. 35 – 49.

Miller, R. W., McRae, D. G. & Joy, K. (1991). Glutamate and gamma-aminobutyrate

metabolism in isolated Rhizobium meliloti bacteroids. Molecular Plant-Microbe

Interactions. 4. 37 – 45.

Mitra, R. M., Shaw, S. L. & Long, S. R. (2004a). Six nonnodulating plant mutants

defective for Nod factor-induced transcriptional changes associated with the legume-

rhizobia symbiosis. Proceedings of the National Academy of Sciences of the United States

of America. 101. 10217 – 10222.

Mitra, R. M., Gleason, C. A., Edwards, A., Hadfield, J., Downie, J. A., Oldroyd, G. E.

& Long, S. R. (2004b). A Ca2+/calmodulin-dependent protein kinase required for

symbiotic nodule development: Gene identification by transcript-based cloning.

Proceedings of the National Academy of Sciences of the United States of America. 101.

4701 – 4705.

286

Miura, T. & Mizushima, S. (1968). Separation by density gradient centrifugation of two

types of membranes from spheroplast membrane of Escherichia coli K12. Biochimica et

Biophysica Acta. 150. 159 – 161.

Miwa, H., Sun, J., Oldroyd, G. E. & Downie, J. A. (2006). Analysis of Nod-factor-

induced calcium signaling in root hairs of symbiotically defective mutants of Lotus

japonicus. Molecular Plant-Microbe Interactions. 19. 914 – 923.

Moris, M., Dombrecht, B., Xi, C., Vanderleyden, J. & Michiels, J. (2004). Regulatory

role of Rhizobium etli CNPAF512 fnrN during symbiosis. Applied Environmental

Microbiology. 70. 1287 – 1296.

Morett, E., Moreno, S. & Espin, G. (1985). Impaired nitrogen fixation and glutamine

synthesis in methionine sulfoximine sensitive (MST) mutants of Rhizobium phaseoli.

Molecular and General Genetics. 200. 229 – 234.

Morett, E. & Buck, M. (1988). NifA-dependent in vivo protection demonstrates that the

upstream activator sequence of nif promoters is a protein binding site. Proceedings of the

National Academy of Sciences of the United States of America. 85. 9401 - 9405.

Morett, E., Cannon, W. & Buck, M. (1988). The DNA-binding domain of the

transcriptional activator protein NifA resides in its carboxy terminus, recognises the

upstream activator sequences of nif promoters and can be separated from the positive

control function of NifA. Nucleic Acids Research. 16. 11469 – 11488.

Morett, E. & Buck, M. (1989). In vivo studies on the interaction of RNA polymerase-

sigma 54 with the Klebsiella pneumoniae and Rhizobium meliloti nifH promoters. The role

of NifA in the formation of an open promoter complex. Journal of Molecular Biology. 210.

65 – 77.

Mortimer, M. W., McDermott, T. R., York, G. M., Walker, G. C. & Kahn, M. L.

(1999). Citrate synthase mutants of Sinorhizobium meliloti are ineffective and have altered

cell surface polysaccharides. Journal of Bacteriology. 181. 7608 – 7613.

Mouritzen, P. & Rosendahl, L. (1997). Identification of a transport mechanism

287

for NH4+ in the symbiosome membrane of pea root nodules. Plant Physiology. 115. 519 –

526.

Mulligan, J. T. & Long, S. R. (1985). Induction of Rhizobium meliloti nodC expression by

plant exudate requires nodD. Proceedings of the National Academy of Sciences of the

United States of America. 82. 6609 – 6613.

Napoli, C. A. & Hubbell, D. H. (1975). Ultrastructure of Rhizobium-induced infection

threads in clover root hairs. Applied Microbiology. 30. 1003 – 1009.

Nakagawa, T., Izumi, T., Banba, M., Umehara, Y., Kouchi, H., Izui, K. & Hata, S.

(2003) Characterization and expression analysis of genes encoding phosphoenolpyruvate

carboxylase and phosphoenolpyruvate carboxylase kinase of Lotus japonicus, a model

legume. Molecular Plant-Microbe Interactions. 16. 281 – 288.

Napolitani, C., Mandrich, L., Riccio, A., Lamberti, A., Manco, G. & Patriarca, E. J.

(2004). Mutational analysis of GstI protein, a glutamine synthetase translational inhibitor of

Rhizobium leguminosarum. FEBS Letters. 558. 45 – 51.

Natera, S. H., Guerreiro, N. & Djordjevic, M. A. (2000). Proteome analysis of

differentially displayed proteins as a tool for the investigation of symbiosis. Molecular

Plant-Microbe Interactions. 13. 995 – 1009.

Nikaido, K. & Ames, G. F. (1999). One intact ATP-binding subunit is sufficient to support

ATP hydrolysis and translocation in an ABC transporter, the histidine permease. Journal of

Biological Chemistry. 274. 26727 – 26735.

Ninfa, A. J. & Atkinson, M. R. (2000). PII signal transduction proteins. Trends in

Microbiology. 8. 172 – 179.

Ninfa, A. J., Jiang, P., Atkinson, M. R. & Peliska, J. A. (2000). Integration of

antagonistic signals in the regulation of nitrogen assimilation in Escherichia coli. Current

Topics in Cell Regulation. 36. 31 – 75.

288

Nohno, T., Saito, T. & Hong, J. (1986). Cloning and complete nucleotide sequence of the

Escherichia coli glutamine permease operon (glnHPQ). Molecular and General Genetics.

205. 260 – 269.

Nygaard, P., Duckert, P. & Saxild, H. H. (1996). Role of adenine deaminase in purine

salvage and nitrogen metabolism and characterization of the ade gene in Bacillus subtilis.

Journal of Bacteriology. 178. 846 – 453.

Obmolova, G., Ban, C., Hsieh, P. & Yang, W. (2000). Crystal structures of mismatch

repair protein MutS and its complex with a substrate DNA. Nature. 407. 703 – 710.

Ocheretina, O. & Scheibe, R. (1997). Cloning and sequence analysis of cDNAs encoding

plant cytosolic malate dehyrogenase. Gene. 199. 145 – 148.

Oldroyd, G. E. & Downie, J. A. (2004). Calcium, kinases and nodulation signalling in

legumes. Nature Reviews. Molecular Cell Biology. 5. 566 – 576.

O'Gara, F., Manian, S. & Meade, J. (1984). Isolation of an Asm- mutant of Rhizobium

japonicum defective in symbiotic N2 fixation. FEMS Microbiology Letters. 24. 241 – 245.

O’Hara, G. W., Riley, I. T., Glenn, A. R. & Dilworth, M. J. (1985). The ammonium

permease of Rhizobium leguminosarum MNF3841. Journal of General Microbiology. 131.

757 – 764.

Ortuno-Olea, L. & Duran-Vargas, S. (2000). The L-asparagine operon of Rhizobium etli

contains a gene encoding an atypical asparaginase. FEMS Microbiology Letters. 189. 177 –

182.

Osburne, M. S. & Signer, E. R. (1980). Ammonium assimilation in Rhizobium meliloti.

Journal of Bacteriology. 143. 1234 – 1240.

Osteras, M., Finnan , T. M. and Stanley, J. (1991). Site directed mutagenesis and DNA

sequence of pckA of Rhizobium NGR234, encoding phosphoenolpyruvate carboxykinase:

gluconeogenesis and host dependent symbiotic phenotype. Molecular General Genetics.

230. 257 – 269.

289

Ouyang, L. J., Udvardi, M. K. & Day, D. A. (1990). Specificity and regulation of the

dicarboxylate carrier on the peribacteroid membrane of soybean nodules. Planta. 182. 437 –

444.

Ouyang, L. J., Whelan, J., Weaver, C. D., Roberts, D. M. & Day, D. A. (1991). Protein

phosphorylation stimulates the rate of malate uptake across the peribacteroid membrane of

soybean nodules. FEBS Letters. 293. 188 – 90.

Ouyang, L. J. & Day, D. A. (1992). Transport properties of symbiosomes isolated from

siratro nodules. Plant Physiology and Biochemistry. 30. 613 – 623.

Palmer, K. M. & Young, J. P. W. (2000). Higher diversity of Rhizobium leguminosarum

biovar viciae populations in arable soils than in grass soils. Applied and Environmental

Microbiology. 66. 2445 – 2450.

Pardo, M. A., Lagunez, J., Miranda, J. & Martinez, E. (1994). Nodulating ability of

Rhizobium tropici is conditioned by a plasmid-encoded citrate synthase. Molecular

Microbiology. 11. 315 – 321.

Pargent, W. & Kleiner, D. (1985). Characteristics and regulation of ammonium

(methylammonium) transport in Rhizobium meliloti. FEMS Microbiology Letters. 30. 257 –

259.

Patriarca, E.J., Chiurazzi, M., Manco, G., Riccio, A., Lamberti, A., Depaolis, A., Rossi,

M., Defez, R. & Iaccarino, M. (1992). Activation of the Rhizobium leguminosarum glnII

gene by NtrC is dependent on upstream DNA sequences. Molecular and General Genetics.

234. 337 – 345.

Patriarca, E.J., Riccio, A., Tate, R., Colonna-Romano, S., Iaccarino, M. & Defez, R.

(1993). The ntrBC genes of Rhizobium leguminosarum are part of a complex operon subject

to negative regulation. Molecular Microbiology. 9. 569 – 577.

Patriarca, E.J., Tate, R., Fedorova, A., Riccio, A. Defez, R. & Iaccarino, M. (1996).

Downregulation of the Rhizobium ntr system in the determinate nodule of Phaseolus

290

vulgaris identifies a specific developmental zone. Molecular Plant-Microbe Interactions. 9.

243 – 251.

Patriarca, E. J., Tate, R. & Iaccarino, M. (2002). Key role of bacterial NH4+ metabolism

in Rhizobium-plant symbiosis. Microbiology and Molecular Biology Reviews. 66. 203 –

222.

Patschkowski, T., Schluter, A. & Priefer, U. B. (1996). Rhizobium leguminosarum bv.

viciae contains a second fnr/fixK-like gene and an unusual FixL homologue. Molecular

Microbiology. 21. 267 – 280.

Peiter, E. & Schubert, S. (2003). Sugar uptake and proton release by protoplasts from the

infected zone of Vicia faba L. nodules: evidence against apoplastic sugar supply of infected

cells. Journal of Experimental Botany. 54. 1691 – 1700.

Perret, X., Staehelin, C. & Broughton, W. J. (2000). Molecular basis of

symbiotic promiscuity. Microbiology and Molecular Biology Reviews. 64. 180.

Perotto, S., Brewin, N. J. & Bonfante, P. (1994). Colonization of pea roots by the

mycorrhizal fungus Glomus versiforme and by Rhizobium bacteria: immunological

comparison using monoclonal antibodies as probes for plant cell surface components.

Molecular Plant-Microbe Interactions. 7. 91 – 98.

Pingret, J. L., Journet, E. P. & Barker, D. G. (1998). Rhizobium nod factor signaling.

Evidence for a g protein-mediated transduction mechanism. The Plant Cell. 10. 659 – 672.

Pistocchi, R., Kashiwagi, K., Miyamoto, S., Nukui, E., Sadakata, Y., Kobayashi, H. &

Igarashi, K. (1993). Characteristics of the operon for a putrescine transport system that

maps at 19 minutes on the Escherichia coli chromosome. Journal of Biological Chemistry.

268. 146 – 152.

Poole, P.S., Dilworth, M. J. & Glenn, A. R. (1984). Acquisition of aspartase activity in

Rhizobium leguminosarum WU 235. Journal of General Microbiology. 130. 881 – 886.

291

Poole, P. S., Franklin, M., Glenn, A. R. & Dilworth, M.J. (1985). The transport of L-

glutamate by Rhizobium leguminosarum involves a common amino acid carrier. Journal of

General Microbiology. 131. 1441 – 1448.

Poole, P. S., Dilworth, M. J. & Glenn, A. R. (1987). Ammonia is the preferred nitrogen

source in several rhizobia. Journal of General Microbiology 133. 1707 – 1712.

Poole, P. S., Schofield, N. A., Reid, C. J., Drew, E. M. & Walshaw, D. L. (1994).

Identification of chromosomal genes located downstream of dctD that affect the

requirement for calcium and the lipopolysaccharide layer of Rhizobium leguminosarum.

Microbiology. 140. 2797 – 2809.

Poole, P. S., Blyth, A., Reid, C. J. & Walters, K. (1994). myo-Inositol catabolism and

catabolite regulation in Rhizobium leguminosarum bv viciae. Microbiology. 140. 2787 –

2795.

Poole, P., Reid, C., East, A.K., Allaway, D., Day, M., and Leonard, M. (1999).

Regulation of the mdh-sucCDAB operon in Rhizobium leguminosarum. FEMS

Microbiology Letters. 176. 247 – 255.

Poole, P. S. & Allaway, D. (2000). Carbon and nitrogen metabolism in Rhizobium.

Advances in Microbial Physiology. 43. 117 – 163.

Preisig, O., Zufferey, R. & Hennecke, H. (1996a). The Bradyrhizobium japonicum

fixGHIS genes are required for the formation of the high-affinity cbb3-type cytochrome

oxidase. Archives of Microbiology. 165. 297 – 305.

Preisig, O., Zufferey, R., Thony-Meyer, L., Appleby, C. A. & Hennecke, H. (1996b). A

high-affinity cbb3-type cytochrome oxidase terminates the symbiosis-specific respiratory

chain of Bradyrhizobium japonicum. Journal of Bacteriology. 178. 1532 – 1538.

Prell, J., Boesten, B., Poole, P. S. & Priefer, U. B. (2002). A Rhizobium leguminosarum

bv. viciae VF39 gamma-aminobutyrate (GABA) aminotransferase gene (gabT) is induced

by GABA and highly expressed in bacteroids. Microbiology. 148. 615 – 623.

292

Prell, J. & Poole, P. (2006). Metabolic changes of rhizobia in legume nodules. Trends in

Microbiology. 14. 161 – 168.

Prentki, P. & Krisch, H. M. (1984). In vitro insertional mutagenesis with a selectable

DNA fragment. Gene. 29. 303 – 313.

Preston, G. G., Zeiher, C., Wall, J. D. & Emerich, D. W. (1989). Acetate activating

enzymes of Bradyrhizobium japonicum bacteroids. Applied Environmental Microbiology.

55. 165 – 170.

Preston, G. G., Wall, J. D. & Emerich, D. W. (1990). Purification and properties of

acetyl-CoA synthetase from Bradyrhizobium japonicum bacteroids. Journal of

Biochemistry. 267. 179 – 183.

Quandt, J. & Hynes, M. F. (1993). Versatile suicide vectors which allow direct selection

for gene replacement in Gram-negative bacteria. Gene. 127. 15 – 21.

Raczniak, G., Becker, H. D., Min, B. & Soll D. (2001). A single amidotransferase forms

asparaginyl-tRNA and glutaminyl-tRNA in Chlamydia trachomatis. Journal of Biological

Chemistry. 276. 45862 – 45867.

Radutoiu, S., Madsen, L. H., Madsen, E. B., Felle, H. H., Umehara, Y., Gronlund, M.,

Sato, S., Nakamura, Y., Tabata, S., Sandal, N. & Stougaard, J. (2003). Plant recognition

of symbiotic bacteria requires two LysM receptor-like kinases. Nature. 425. 585 – 592.

Rastogi, V. K. & Watson, R. J. (1991). Aspartate aminotransferase activity is required for

aspartate catabolism and symbiotic nitrogen fixation in Rhizobium meliloti. Journal of

Bacteriology. 173. 2879 – 2887.

Rastogi, V., Labes, M., Finan, T. & Watson, R. (1992). Overexpression of the dctA gene

in Rhizobium meliloti: effect on transport of C4 dicarboxylates and symbiotic nitrogen

fixation. Canadian Journal of Microbiology. 38. 555 – 562.

293

Ratajczak, L., Ratajczak, W. & Koroniak, D. (1989). Detection of nodule specific forms

of malate dehydrogenase from root nodules of Lupinus luteus. Biochemical. Physiology.

184. 243 – 248.

Rawsthorne, S. & LaRue, T. A. (1986). Metabolism under microaerobic conditions of

mitochondria from cowpea nodules. Plant Physiology. 81. 1097 – 1102.

Reibach, P. H. & Streeter, J. G. (1983). Metabolism of 14C-labeled photosynthate and

distribution of enzymes of glucose metabolism in soybean nodules. Plant Physiology. 72.

634 – 640.

Reid, C. J., Walshaw, D. L. & Poole, P. S. (1996). Aspartate transport by the Dct system

in Rhizobium leguminosarum negatively affects nitrogen-regulated operons. Microbiology.

142. 2603 – 2612.

Reid, C. J. & Poole, P. S. (1998). Roles of DctA and DctB in signal detection by the

dicarboxylic acid transport system of Rhizobium leguminosarum. Journal of Bacteriology.

180. 2660 - 2669.

Reitzer, L. J. & Magasanik, B. (1982). Asparagine synthetases of Klebsiella aerogenes:

properties and regulation of synthesis. Journal of Bacteriology. 151. 1299 – 1313.

Reitzer, L.J. & Magasanik, B. (1985). Expression of glnA in Escherichia coli is regulated

at tandem promoters. Proceedings of the National Academy of Sciences of the United States

of America. 82. 1979 – 1983.

Reitzer, L.J. & Magasanik, B. (1986). Transcription of glnA in Escherichia coli is

stimulated by activator bound to sites far from the promoter. Cell. 45. 785 – 792.

Reyrat, J. M., David, M., Blonski, C., Boistard, P. & Batut, J. (1993). Oxygen-regulated

in vitro transcription of Rhizobium meliloti nifA and fixK genes. Journal of Bacteriol. 175.

6867 – 6672.

294

Ridge, R. W. & Rolfe, B. G. (1985). Rhizobium sp. degradation of legume root hair cell

wall at the site of infection thread origin. Applied Environmental Microbiology. 50. 717 –

720.

Robbins, J. C. & Oxender, D. L. (1983). Transport Systems for Alanine, Serine, and

Glycine in Escherichia coli K-12. Journal of Bacteriology. 116. 12 – 18.

Roberts, D. M. & Tyerman, S. D. (2002). Voltage-dependent cation channels permeable

to NH4+, K+, and Ca2+ in the symbiosome membrane of the model legume Lotus japonicus.

Plant Physiology. 128. 370 – 378

Robertson, J. G. & Taylor, M. P. (1973). Acid and alkaline invertases in roots and

nodules of Lupinus angustifolius infected with Rhizobium lupini. Planta. 112. 1 – 6.

Robertson, J. G., Lyttleton, P., Bullivant, S. & Grayston, G. F. (1978a). Membranes in

lupin root nodules. I. The role of Golgi bodies in the biogenesis of infection threads and

peribacteroid membranes. Journal of Cell Science. 30. 129 – 149.

Robertson, J. G., Warburton, M. P., Lyttleton, P., Fordyce, A. M. & Bullivant, S.

(1978b). Membranes in lupin root nodules. II. Preparation and properties of peribacteroid

membranes and bacteroid envelope inner membranes from developing lupin nodules.

Journal of Cell Science. 30. 151 – 174.

Robertson, J. G., Wells, B., Bisseling, T., Farnden, K. J. F. & Johnston, A. W. B.

(1984). Immuno-gold localization of leghaemoglobin in cytoplasm in nitrogen-fixing root

nodules of pea. Nature, 311. 254 – 256.

Roche, P., Debelle, F., Maillet, F., Lerouge, P., Faucher, C., Truchet, G., Denarie, J. &

Prome, J. C. (1991). Molecular basis of symbiotic host specificity in Rhizobium meliloti:

nodH and nodPQ genes encode the sulfation of lipo-oligosaccharide signals. Cell, 67. 1131

– 1143.

Roche, P., Maillet, F., Plazanet, C., Debelle, F., Ferro, M., Truchet, G., Prome, J. C. &

Denarie, J. The common nodABC genes of Rhizobium meliloti are host-range determinants.

295

Proceedings of the National Academy of Sciences of the United States of America. 93.

15305 – 15310.

Rohrig, H., Schmidt, J., Wieneke, U., Kondorosi, E., Barlier, I., Schell, J. & John, M.

(1994). Biosynthesis of lipooligosaccharide nodulation factors: Rhizobium NodA protein is

involved in N-acylation of the chitooligosaccharide backbone. Proceedings of the National

Academy of Sciences of the United States of America. 91. 3122 – 3126.

Ronson, C. W. & Primrose, S. B. (1979). Carbohydrate metabolism in Rhizobium trifolii:

identification and symbiotic properties of mutants. Journal of General Microbiology. 112.

77 – 88.

Ronson, C. W., Lyttleton, P. & Robertson, J. G. (1981). C4-dicarboxylate transport

mutants of Rhizobium trifolii form ineffective nodules on Trifolium repens. Proceedings of

the National Academy of Sciences of the United States of America. 78. 4284 – 4288.

Ronson, C. W., Astwood, P. M. & Downie, J. A. (1984). Molecular cloning and genetic

organization of C4-dicarboxylate transport genes from Rhizobium leguminosarum. Journal

of Bacteriology. 160. 903 – 909.

Rosendahl, L., Vance, C. P. & Pedersen, W. B. (1990). Products of dark CO2 fixation in

pea root nodules support bacteroid metabolism. Plant Physiology. 93. 12 – 19.

Rosendahl, L., Dilworth, M. J. & Glenn, A. R. (1992). Exchange of metabolites across

the peribacteroid membrane in pea root nodules. Journal of Plant Physiology. 139. 635 -

638.

Rosendahl, L., Mouritzen, P. & Rudbeck, A. (2001). Nitrogen transfer in the interface

between the symbionts in pea root nodules. Plant and Soil. 230. 31 – 37.

Rossi, M., Defez, R., Chiurazzi, M., Lamberti, A., Fuggi, A. & Iaccarino, M. (1989).

Regulation of glutamine synthetase isoenzymes in Rhizobium leguminosarum biovar viciae.

Journal of General Microbiology. 135. 629 – 637.

296

Rostas, K., Kondorosi, E., Horvath, B., Simoncsits, A. & Kondorosi A. (1986).

Conservation of extended promoter regions of nodulation genes in Rhizobium. Proceedings

of the National Academy of Sciences of the United States of America. 83. 1757 – 1761.

Rubio, L. M. & Ludden, P. W. (2005). Maturation of nitrogenase: a biochemical puzzle.

Journal of Bacteriology. 187. 405 – 414.

Rudbeck, A., Mouritzen, P. & Rosendahl, L. (1999). Characterization of aspartate

transport across the symbiosome membrane in pea root nodules. Journal of Plant

Physiology. 155. 576 – 583.

Ruvkun, G. B. & Ausubel, F. M. (1980). Interspecies homology of nitrogenase genes.

Proceedings of the National Academy of Sciences of the United States of America. 77. 191 –

195.

Ruvkun, G. B. & Ausubel, F. M. (1981). A general method for site-directed mutagenesis

in prokaryotes. Nature. 289. 85 – 88.

Ruvkun, G. B., Sundaresan, V. & Ausubel, F. M. (1982). Directed transposon Tn5

mutagenesis and complementation analysis of Rhizobium meliloti symbiotic nitrogen

fixation genes. Cell. 29. 551 – 559.

Saalbach, G., Erik, P. & Wienkoop, S. (2002). Characterisation by proteomics of

peribacteroid space and peribacteroid membrane preparations from pea (Pisum sativum)

symbiosomes. Proteomics. 2. 325 – 337.

Sack, J. S., Saper, M. A. & Quiocho, F. A. (1989). Periplasmic binding protein structure

and function: refined X-ray structures of the leucine/isoleucine/valine binding protein and

its complex with leucine. Journal of Molecular Biology. 206. 171 – 191.

Saier, M. H. (2000). A functional-phylogenetic classification system for transmembrane

solute transporters. Microbiology and Molecular Biology Reviews. 64. 354 – 411.

Salazar, J. C., Zuniga, R., Raczniak, G., Becker, H., Soll, D. & Orellana, O. (2001). A

dual-specific Glu-tRNA(Gln) and Asp-tRNA(Asn) amidotransferase is involved in decoding

297

glutamine and asparagine codons in Acidithiobacillus ferrooxidans. FEBS Letters. 500. 129

– 131.

Salminen, S. O. & Streeter, J. G. (1987). Uptake and metabolism of carbohydrates by

Bradyrhizobium japonicum bacteroids. Plant Physiology. 83. 535 – 540.

Salminen, S. O. & Streeter, J. G. (1990). Factors contributing to the accumulation of

glutamate in Bradyrhizobium japonicum bacteroids under microaerobic conditions. Journal

of General Microbiology. 136. 2119 – 2126.

Salminen, S. O. & Streeter, J. G. (1992). Labeling of carbon pools in Bradyrhizobium

japonicum and Rhizobium leguminosarum bv. viciae bacteroids following incubation of

intact nodules with 14CO2. Plant Physiology. 100. 597 – 604.

Sambrook, J., Fritsch, E.F., Maniatis, T. (2001). Molecular Cloning – A laboratory

manual. 3rd Edition. Cold Spring Harbor Laboratory Press, NY.

Sanders, J. W., Leenhouts, K., Burghoorn, J., Brands, J. R., Venema, G. & Kok, J.

(1998). A chloride-inducible acid resistance mechanism in Lactococcus lactis and its

regulation. Molecular Microbiology. 27. 299 – 310.

Sanjuan, J., Grob, P., Gottfert, M. & Hennecke, G. (1994). NodW is essential for full

expression of the common nodulation genes in Bradyrhizobium japonicum. Molecular

Plant-Microbe Interactions. 7. 364 – 369.

Sarma, A. D. & Emerich, D. W. (2005). Global protein expression pattern of

Bradyrhizobium japonicum bacteroids: a prelude to functional proteomics. Proteomics. 5.

4170 – 4184.

Scharff, A. M., Egsgaard, H., Hansen, P. E. & Rosendahl, L. (2003). Exploring

symbiotic nitrogen fixation and assimilation in pea root nodules by in vivo 15N nuclear

magnetic resonance spectroscopy and liquid chromatography-mass spectrometry. Plant

Physiology. 131. 367 - 378

Schell, M. A. (1993). Molecular biology of the LysR family of transcriptional

298

regulators. Annual Review of Microbiology. 47. 597 – 626.

Schindelin, H., Kisker, C., Schlessman, J. L., Howard, J. B. & Rees, D. C. (1997).

Structure of ADP x AIF4(-)-stabilized nitrogenase complex and its implications for signal

transduction. Nature. 387. 370 – 376.

Schlaman, H. R., Spaink, H. P., Okker, R. J. & Lugtenberg, B. J. (1989). Subcellular

localization of the nodD gene product in Rhizobium leguminosarum. Journal of

Bacteriology. 171. 4686 – 4693.

Schlaman, H. R., Horvath, B., Vijgenboom, E., Okker, R. J. & Lugtenberg, B. J.

Suppression of nodulation gene expression in bacteroids of Rhizobium leguminosarum

biovar viciae. Journal of Bacteriology. 173. 4277 – 4287.

Schlaman, H. R., Okker, R. J. & Lugtenberg, B. J. (1992). Regulation of nodulation

gene expression by NodD in rhizobia. Journal of Bacteriology. 174. 5177 – 5182.

Schlaman, H. R. M., Philips, D. A. & Kondorosi, E. (1998). Genetic organization and

transcriptional regulation of rhizobial nodulation genes. The Rhizobiaceae: Molecular

biology of model plant-associated bacteria. Edited by Spaink, H. P., Kondorosi, A. &

Hooykaas, P. J. J. Kluwer Academic Publishers, Dordrecht.

Schluter, A., Patschkowski, T., Quandt, J., Selinger, L. B., Weidner, S., Kramer, M.,

Zhou, L., Hynes, M. F. & Priefer, U. B. (1997). Functional and regulatory analysis of the

two copies of the fixNOQP operon of Rhizobium leguminosarum strain VF39. Molecular

Plant-Microbe Interactions. 10. 605 – 616.

Schluter, A., Nohlen, M., Kramer, M., Defez, R. & Priefer, U. B. (2000). The Rhizobium

leguminosarum bv. viciae glnD gene, encoding a uridylyltransferase / uridylyl-removing

enzyme, is expressed in the root nodule but is not essential for nitrogen fixation.

Microbiology. 146. 2987 – 2996

Sciotti, M. A., Chanfon, A., Hennecke, H. & Fischer, H. M. (2003). Disparate oxygen

responsiveness of two regulatory cascades that control expression of symbiotic genes in

Bradyrhizobium japonicum. Journal of Bacteriology. 185. 5639 – 5642.

299

Screen, S., Watson, J. & Dixon, R. (1994). Oxygen sensitivity and metal ion-dependent

transcriptional activation by NifA protein from Rhizobium leguminosarum biovar trifolii.

Molecular and General Genetics. 245. 313 – 322.

Senior, A. E., al-Shawi, M. K. & Urbatsch, I. L. (1995). The catalytic cycle of P-

glycoprotein. FEBS Letters. 377. 285 – 289.

Seth, A. & Connell, N. D. (2000). Amino acid transport and metabolism in mycobacteria:

cloning, interruption, and characterization of an L-Arginine / gamma-aminobutyric acid

permease in Mycobacterium bovis BCG. Journal of Bacteriology. 182. 919 – 927.

Shaibe E, Metzer E, Halpern YS. (1985). Metabolic pathway for the utilization of L-

arginine, L-ornithine, agmatine, and putrescine as nitrogen sources in Escherichia coli K-

12. Journal of Bacteriology. 163. 933 – 937.

Sharma, P. K., Kundu, B. S. & Dogra, R. C. (1993). Molecular mechanism of host

specificity in legume-rhizobium symbiosis. Biotechnology Advances. 11. 741 – 779.

Shatters, R. G., Somerville, J. E. & Kahn, M. L. (1989). Regulation of glutamine

synthetase II activity in Rhizobium meliloti 104A14. Journal of Bacteriology. 171. 5087 –

5094.

Shaw, S. L. & Long, S. R. (2003). Nod factor elicits two separable calcium responses in

Medicago truncatula root hair cells. Plant Physiology. 131. 976 – 984.

Shearman, C. A., Rossen, L., Johnston, A. W. & Downie, J. A. (1986). The Rhizobium

leguminosarum nodulation gene nodF encodes a polypeptide similar to acyl-carrier protein

and is regulated by nodD plus a factor in pea root exudate. EMBO Journal. 5. 647 – 652.

Sheppard CA, Trimmer EE, Matthews RG. (1999). Purification and properties of

NADH-dependent 5, 10-methylenetetrahydrofolate reductase (MetF) from Escherichia coli.

Journal of Bacteriology. 181. 718 – 725.

300

Shi, L., Twary, S. N., Yoshioka, H., Gregerson, R. G., Miller, S. S., Samac, D. A.,

Gantt, J. S., Unkefer, P. J. & Vance, C. P. (1997). Nitrogen assimilation in alfalfa:

Isolation and characterization of an asparagine synthetase gene showing enhanced

expression in root nodules and dark-adapted leaves The Plant Cell. 9. 1339 – 1356.

Shin, M., Rumi, O., Naoto, O., Takamasa, N., Kiyotaka, M. & Toshiya, S. (2003).

Crystal structure of a full-length LysR-type transcriptional regulator, CbnR: unusual

combination of two subunit forms and molecular bases for causing and changing DNA

bend. Journal of Molecular Biology. 328. 555 – 566.

Scholz, O., Thiel, A., Hillen, W. & Niederweis, M. (2000). Quantitative analysis of gene

expression with an improved green fluorescent protein. p6. European Journal of

Biochemistry. 267. 1565 – 1570.

Simon, R., Priefer, U. & Pühler, A. (1983). A broad host-range mobilization system for in

vivo genetic engineering: Transposon mutagenesis of gram-negative bacteria.

Biotechnology. 1. 784 – 791.

Simon, R., Quandt, J. & Klipp, W. (1989). New derivatives of transposon Tn5 suitable

for mobilization of replicons, generation of operon fusions and induction of genes in gram-

negative bacteria. Gene. 80. 161 – 169.

Singh, R., Karamdeep, L., Bhullar, S. S. & Gupta, A. K. (1994). Metabolism of free

sugars in relation to the activities of enzymes involved in sucrose metabolism and nitrogen

assimilation in the developing nodules of chickpea plant. Plant Physiology and

Biochemistry. 32. 875 – 882.

Skorupska, A., Janczarek, M., Marczak, M., Mazur, A. & Krol, J. (2006). Rhizobial

exopolysaccharides: genetic control and symbiotic functions. Microbial Cell Factories. 16.

5 – 7.

Smit, G., Swart, S., Lugtenberg, B. J. & Kijne, J. W. (1992). Molecular mechanisms of

attachment of Rhizobium bacteria to plant roots. Molecular Microbiology. 6. 2897 – 2903.

301

Smith, M. T. & Emerich, D. W. (1993). Alanine dehydrogenase from soybean nodule

bacteroids - kinetic mechanism and pH studies. Journal of Biological Chemistry. 268.

10746 – 10753.

Soto, M. J., Sanjuan, J. & Olivares, J. (2001). The disruption of a gene encoding a

putative arylesterase impairs pyruvate dehydrogenase complex activity and nitrogen

fixation in Sinorhizobium meliloti. Molecular Plant-Microbe Interactions. 14. 811 – 815.

Soupene, E., Foussard, M., Boistard, P., Truchet, G. & Batut, J. (1995). Oxygen as a

key developmental regulator of Rhizobium meliloti N2-fixation gene expression within the

alfalfa root nodule. Proceedings of the National Academy of Sciences of the United States of

America. 92. 3759 – 3763.

Spaink, H. P., Wijffelman, C. A., Pees, E., Okker, R. J. H. & Lugtenberg, B. J. J.

(1987a). Rhizobium nodulation gene nodD as a determinant of host specificity. Nature. 328.

337 – 340.

Spaink, H. P., Okker, R. J. H., Wijffelman, C. A., Pees, E. & Lugtenberg, B. J. J.

(1987b). Promoters in the nodulation region of the Rhizobium leguminosarum Sym plasmid

pRL1JI. Plant Molecular Biology. 9. 27 – 39.

Spaink, H. P., Sheeley, D. M., van Brussel, A. A., Glushka, J., York, W. S., Tak, T.,

Geiger, O., Kennedy, E. P., Reinhold, V. N. & Lugtenberg, B. J. (1991). A novel highly

unsaturated fatty acid moiety of lipo-oligosaccharide signals determines host specificity of

Rhizobium. Nature. 354. 125 – 130.

Squartini, A., van Veen, R. J., Regensburg-Tuink, T., Hooykaas, P. J. & Nuti, M. P.

(1988). Identification and characterization of the nodD gene in Rhizobium leguminosarum

strain 1001. Molecular Plant-Microbe Interactions. 1. 145 – 149.

Stracke, S., Kistner, C., Yoshida, S., Mulder, L., Sato, S., Kaneko, T., Tabata, S.,

Sandal, N., Stougaard, J., Szczyglowski, K. & Parniske, M. (2002). A plant receptor-like

kinase required for both bacterial and fungal symbiosis. Nature. 417. 959 – 962.

302

Streeter, J. G. (1981). Seasonal distribution of carbohydrates in nodules and stem exudate

from field grown soya bean plants. Annals of Botany. 48. 441 – 450.

Streeter, J. G. (1987). Carbohydrate, organic acid, and amino acid composition of

bacteroids and cytosol from soybean nodules. Plant Physiology. 85. 768 – 773.

Streeter, J. G. (1989). Estimation of ammonium concentration in the cytosol of soybean

nodules. Plant Physiology. 90. 779 – 782.

Suganuma, N., Yamamoto, A., Itou, A., Hakoyama, T., Banba, M., Hata, S.,

Kawaguchi, M. & Kouchi, H. (2004). cDNA macroarray analysis of gene expression in

ineffective nodules induced on the Lotus japonicus sen1 mutant. Molecular Plant-Microbe

Interactions. 17. 1223 – 1233.

Sugiyama, S., Vassylyev, D. G., Matsushima, M., Kashiwagi, K., Igarashi, K. &

Morikawa, K. (1996). Crystal structure of PotD, the primary receptor of the polyamine

transport system in Escherichia coli. Journal of Biological Chemistry. 271. 9519 – 9525.

Summers, M. L., Denton, M. C. & McDermott, T. R. (1999). Genes coding for

phosphotransacetylase and acetate kinase in Sinorhizobium meliloti are in an operon that is

inducible by phosphate stress and controlled by phoB. Journal of Bacteriology. 181. 2217 –

2224.

Sun, D.X., & Setlow, P. (1991). Cloning, nucleotide sequence, and expression of the

Bacillus subtilis ans operon, which codes for L-asparaginase and L-aspartase. Journal of

Bacteriology. 173. 3831 – 3845.

Sutton, J. M., Lea, E. J. & Downie, J. A. (1994). The nodulation-signaling protein NodO

from Rhizobium leguminosarum biovar viciae forms ion channels in membranes.

Proceedings of the National Academy of Sciences of the United States of America. 91. 9990

- 9994.

Swanson, J. A., Mulligan, J. T. & Long, S. R. (1993). Regulation of syrM and nodD3 in

Rhizobium meliloti. Genetics. 134. 435 – 444.

303

Szafran, M. M. & Haaker, H. (1995). Properties of the peribacteroid membrane ATPase

of pea root nodules and its effect on the nitrogenase activity. Plant Physiology. 108. 1227 –

1232.

Szeto, W. W., Zimmerman, J. L., Sundaresan, V. & Ausubel, F. M. (1984). A

Rhizobium meliloti symbiotic regulatory gene. Cell. 36. 1035 – 1043.

Szeto, W. W., Nixon, B. T., Ronson, C. W. & Ausubel, F. M. (1987). Identification and

characterization of the Rhizobium meliloti ntrC gene: R. meliloti has separate regulatory

pathways for activation of nitrogen fixation genes in free living and symbiotic cells. Journal

of Bacteriology. 169. 1423 – 1432.

Tabor CW, Tabor H, Xie QW. (1986). Spermidine synthase of Escherichia coli:

localization of the speE gene. Proceedings of the National Academy of Sciences of the

United States of America. 83. 6040 – 6044.

Tabrett, C. A. & Copeland, L. (2000). Biochemical controls of citrate synthase in

chickpea bacteroids. Archives of Microbiology. 173. 42 – 48.

Tate, R. (1995). Soil microbiology (symbiotic nitrogen fixation). John Wiley and Sons,

Inc., New York, N.Y. 307 – 333.

Tate, R., Riccio, A., Merrick, M. & Patriarca, E. J. (1998). The Rhizobium etli amtB

gene coding for an NH4+ transporter is downregulated early during bacteroid differentiation.

Molecular Plant-Microbe Interactions. 11. 188 – 198.

Tate, R., Cermola, M., Riccio, A., Iaccarino, M., Merrick, M., Favre, R. & Patriarca,

E. J. (1999). Ectopic expression of the Rhizobium etli amtB gene affects the symbiosome

differentiation process and nodule development. Molecular Plant-Microbe Interactions. 12.

515 – 525.

Tate, R., Mandrich, L., Spinosa, M. R., Riccio, A., Lamberti, A., Iaccarino, M. &

Patriarca, E. J. (2001). The GstI protein reduces the NH4+ assimilation capacity of

Rhizobium leguminosarum. The endocytosis as a key step for gene regulation in developing

nodules. Molecular Plant-Microbe Interactions. 14. 823 – 831.

304

Tate, R., Ferraioli, S., Filosa, S., Cermola, M., Riccio, A., Iaccarino, M. & Patriarca, E.

J. (2004). Glutamine utilization by Rhizobium etli. Molecular Plant-Microbe Interactions.

17. 720 – 728.

Thony-Meyer, L. & Kunzler, P. (1996). The Bradyrhizobium japonicum aconitase gene

(acnA) is important for free-living growth but not for an effective root nodule symbiosis.

Journal of Bacteriology. 178. 6166 – 6172.

Thummler, F. & Verma, D. P. S. (1987). Nodulin-100 of soybean is the subunit of sucrose

synthase regulated by the availability of free heme in nodules. Journal of Biological

Chemistry. 262. 14730 – 14736.

Tian, Z-H., Zou, H-S., Li, J., Zhang, Y-T., Liu, Y., Yu, G-Q., Zhu, J-B., Rüberg, S.,

Becker, A. & Wang, Y-P. (2006). Transcriptome analysis of Sinorhizobium meliloti nodule

bacteria in nifA mutant background. Chinese Science Bulletin. 51. 2079 – 2086.

Tirichine, L., Imaizumi-Anraku, H., Yoshida, S., Murakami, Y., Madsen, L. H., Miwa,

H., Nakagawa, T., Sandal, N., Albrektsen, A. S., Kawaguchi, M., Downie, A., Sato, S.,

Tabata, S., Kouchi, H., Parniske, M., Kawasaki, S. & Stougaard, J. (2006).

Deregulation of a Ca2+ / calmodulin-dependent kinase leads to spontaneous nodule

development. Nature. 441. 1153 – 1156.

Toledano, M. B., Kullik, I., Trinh, F., Baird, P. T., Schneider, T. D. & Storz, G. (1994).

Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: a

mechanism for differential promoter selection. Cell. 78. 897 – 909.

Trakhanov, S., Vyas, N. K., Luecke, H., Kristensen, D. M., Ma, J. & Quiocho, F. A.

(2005). Ligand-free and -bound structures of the binding protein (LivJ) of the Escherichia

coli ABC leucine / isoleucine / valine transport system: Trajectory and dynamics of the

interdomain rotation and ligand specificity. Biochemistry. 44. 6597 – 6608.

Trepp, G. B., van de Mortel, M., Yoshioka, H., Miller, S. S., Samac, D. A., Gantt, J. S.

& Vance, C. P. (1999). NADH-glutamate synthase in alfalfa root nodules. Genetic

regulation and cellular expression. Plant Physiology. 119. 817 – 828.

305

Trinchant, J. C., Guerin, V. & Rigaud, J. (1994). Acetylene reduction by symbiosomes

and free bacteroids from broad bean (Vicia faba L.) nodules (Role of Oxalate). Plant

Physiology. 105. 555 – 561.

Trlnick, M. J., Dilworth, M. J. & Grouods, M. (1976). Factors affecting the reduction of

acetylene by root nodules of Lupinus species. New Phytology. 77. 357 – 370.

Turner, S. L & Young, J. P. (2000). The glutamine synthetases of rhizobia: phylogenetics

and evolutionary implications. Molecular Biology and Evolution. 17. 309 – 319.

Tyerman, S. D., Whitehead, L. F. & Day, D. A. (1995). A channel like

transporter for NH4+ on the symbiotic interface of N2 fixing plants. Nature. 378. 629 – 632.

Udvardi, M. K., Price, G. D., Gresshoff, P. M., & Day, D. A. (1988a). A dicarboxylate

transporter on the peribacteroid membrane of soybean nodules. FEBS Letters. 231. 36 – 40.

Udvardi, M. K., Salom, C. L. & Day, D. A. (1988b). Transport of L-glutamate across the

bacteroid membrane but not the peribacteroid membrane from soybean root nodules.

Molecular Plant-Microbe Interactions. 1. 250 – 254.

Udvardi, M. K. & Day, D. A. (1989). Electrogenic ATPase activity on the peribacteroid

membrane of soybean (Glycine max L.) root nodules. Plant Physiology. 90. 982 – 987.

Udvardi, M. K. & Day, D. A. (1990). Ammonia (14C-methylamine) transport across the

bacteroid and peribacteroid membranes of soybean root nodules. Plant Physiology. 94. 71 –

76.

Udvardi, M. K., Ou Yang, L.-J., Young, S. & Day, D. A. (1990). Sugar and amino acid

transport across symbiotic membranes from soybean nodules. Molecular Plant-Microbe

Interactions. 3. 334 – 340.

Udvardi, M. K., Lister, D. L. & Day, D. (1992). Isolation and characterisation of an ntrC

mutant of Bradyrhizobium (Parasponia) sp. ANU289. Journal of General Microbiology.

138. 1019 – 1025.

306

van Batenburg, F. H. D., Jonker, R. & Kijne, J. W. (1986) Rhizobium induces marked

root hair curling by redirection of tip growth: a computer simulation. Physiology of Plants

66. 476 – 480.

Vance, C. P., Reibach, P. H. & Pankhurst, C. E. (1987). Symbiotic properties of Lotus

pedunculatus root-nodules induced by Rhizobium loti and Bradyrhizobium sp (Lotus).

Physiology of Plants. 69. 435 – 442.

Vance, C. P. & Gantt, J. S. (1992). Control of nitrogen and carbon metabolism in root

nodules. Physiologia Plantarum. 85. 266 – 275.

Vance, C. P., Gregerson, R. G., Robinson, D. L., Miller, S. S. & Gantt, J. S. (1994).

Primary assimilation of nitrogen in alfalfa nodules: molecular features of the enzymes

involved. Plant Science. 101. 51 – 64.

Vance, C. P., Miller, S. S., Gregerson, R. G., Samac, D. A., Robinson, D. L. & Gantt, J.

S. (1995). Alfalfa NADH-dependent glutamate synthase: structure of the gene and

importance in symbiotic N2 fixation. The Plant Journal. 8. 345 – 358.

Vance, C. P., Graham, P. H. & Allan, D. L. (2000). Biological nitrogen fixation. Phos-

phorus: a critical future need. In Nitrogen Fixation Molecules to Crop Productivity. Edited

by Pedrosa, F. O., Hungria, M., Yates, M. G. & Newton, M. E. Kluwer Academic

Publishers, Dordrecht.

van der Heide, T. & Poolman, B. (2002). ABC transporters: one, two or four

extracytoplasmic substrate-binding sites? EMBO Reports. 3. 938 – 943.

van Rhijn, P. J., Feys, B., Verreth, C. & Vanderleyden, J. (1993). Multiple copies of

nodD in Rhizobium tropici CIAT899 and BR816. Journal of Bacteriology. 175. 438 – 447.

van Rhijn, P. & Vanderleyden, J. (1995). The Rhizobium-plant symbiosis.

Microbiological Reviews. 59. 124 – 142.

307

van Workum, W. A. T., Van Slageren, S., Van Brussel, A. A. N. & Kijne, J. W. (1998).

Role of exopolysaccharides of Rhizobium leguminosarum bv. viciae as host plant-specific

molecules required for infection thread formation during modulation of Vicia sativa.

Molecular Plant-Microbe Interactions. 11. 1233 – 1241.

Vasse, J., Billy, F., Camut, S., Truchet, G. & Centre National de la Recherche

Scientifique (1990). Correlation between ultrastructural differentiation of bacterioids and

nitrogen fixation in alfalfa nodules. Journal of Bacteriology. 172. 4295 – 4306.

Vassylyev, D. G., Tomitori, H., Kashiwagi, K., Morikawa, K. & Igarashi, K. (1998).

Crystal structure and mutational analysis of the Escherichia coli putrescine receptor.

Structural basis for substrate specificity. Journal of Biological Chemistry. 273. 17604 –

17609

Verdon, G., Albers, S. V., Dijkstra, B. W., Driessen, A. J. & Thunnissen, A. M. (2003).

Crystal structures of the ATPase subunit of the glucose ABC transporter from Sulfolobus

solfataricus: nucleotide-free and nucleotide-bound conformations. Journal of Molecular

Biology. 330. 343 – 358.

Virts, E. L., Stanfield, S. W., Helinski, D. R. & Ditta, G. S. (1988). Common regulatory

elements control symbiotic and microaerobic induction of nifA in Rhizobium meliloti.

Proceedings of the National Academy of Sciences of the United States of America. 85. 3062

– 3065.

Vitousek, P. M., Mooney, H. A., Lubchenco, J. & Melillo, J. M. (1997). Human

domination of Earth's ecosystems. Science. 277. 494 – 499.

Voegele, R. T., Mitsch, M. J. & Finan, T. M. (1999). Characterization of two members of

a novel malic enzyme class. Biochimica Et Biophysica Acta. Protein Structure and

Molecular Enzymology. 1432. 275 – 285.

Vyas, N. K., Vyas, M. N. & Quiocho, F. A. (1991). Comparison of the periplasmic

receptors for L-arabinose, D-glucose/D-galactose and D-ribose. Journal of Biological

Chemistry. 266. 5226 – 5237.

308

Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Denarie

J, Long SR. (2000). Genetic analysis of calcium spiking responses in nodulation mutants of

Medicago truncatula. Proceedings of the National Academy of Sciences of the United States

of America. 97. 13407 – 13412.

Wais, R. J., Keating, D. H. & Long, S. R. (2002). Structure-function analysis of nod

factor-induced root hair calcium spiking in Rhizobium-legume symbiosis. Plant Physiology.

129. 211 – 224.

Walker, S. A. & Downie, J. A. (2000). Entry of Rhizobium leguminosarum bv. viciae into

root hairs requires minimal nod factor specificity, but subsequent infection thread growth

requires nodO or nodE. Molecular Plant-Microbe Interactions. 13. 754 – 762.

Walker, S. A., Viprey, V. & Downie, J. A. (2000). Dissection of nodulation signaling

using pea mutants defective for calcium spiking induced by nod factors and chitin

oligomers. Proceedings of the National Academy of Sciences of the United States of

America. 97. 13413 – 13418.

Wallace, B., Yang, Y. J., Hong, J. S. & Lum, D. (1990). Cloning and sequencing of a

gene encoding a glutamate and aspartate carrier of Escherichia coli K-12. Journal of

Bacteriology. 172. 3214 – 3220.

Walshaw, D. L. & Poole, P. S. (1996). The general L-amino acid permease of Rhizobium

leguminosarum is an efflux system that also influences efflux of solutes. Molecular

Microbiology. 21. 1239 – 1252.

Walshaw, D. L., Lowthorpe, S., East, A. & Poole, P. S. (1997a). Distribution of a sub-

class of bacterial ABC polar amino acid transporter and identification of an N-terminal

region involved in solute specificity. FEBS Letters. 414. 397 – 401.

Walshaw, D. L., Wilkinson, A., Mundy, M., Smith, M. & Poole, P. S. (1997b).

Regulation of the TCA cycle and the general amino acid permease by overflow metabolism

in Rhizobium leguminosarum. Microbiology. 143. 2209 – 2221.

309

Walshaw, D. L., Reid, C. J. & Poole, P. S. (1997c). The general amino acid permease of

Rhizobium leguminosarum strain 3841 is negatively regulated by the Ntr system. FEMS

Microbiology Letters. 152. 57 – 64.

Wang, L., Helmann, J. D. & Winans, S. C. (1992). The A. tumefaciens transcriptional

activator OccR causes a bend at a target promoter, which is partially relaxed by a plant

tumor metabolite. Cell. 69. 659 – 667.

Wang, Y. P., Birkenhead, K., Boesten, B., Manian, S. & O’Gara, F. (1989). Genetic

analysis and regulation of the Rhizobium meliloti genes controlling C4 dicarboxylic acid

transport. Gene. 85. 135 – 144.

Wang, Y. K., Lee, J. H., Brewer, J. M. & Hoover, T. R. (1997). A conserved region in

the σ54-dependent activator DctD is involved in both binding to RNA polymerase and

coupling ATP hydrolysis to activation. Molecular Microbiology. 26. 373 – 386.

Waterhouse, R. N., Smyth, A. J., Massonneau, A., Prosser, I. M. & Clarkson, D. T.

(1996). Molecular cloning and characterisation of asparagine synthetase from Lotus

japonicus: Dynamics of asparagine synthesis in N-sufficient conditions. Plant Molecular

Biology. 30. 883 – 897.

Waters, J. K., Karr, D. B. & Emerich, D. W. (1985). Malate dehydrogenase from

Rhizobium japonicum 311b-143 bacteroids and Glycine max root nodule mitochondria.

Biochemistry. 24. 6479 – 6486.

Waters, J. K., Hughes, B. L., Purcell, L. C., Gerhardt, K. O., Mawhinney, T. P. &

Emerich, D. W. (1998). Alanine, not ammonia, is excreted from N2 fixing soybean nodule

bacteroids. Proceedings of the National Academy of Sciences of the United States of

America. 95. 12038 - 12042.

Watson, R. J., Chan, Y. K., Wheatcroft, R., Yang, A. F. & Han, S. (1988). Rhizobium

meliloti genes required for C4-dicarboxylate transport and symbiotic nitrogen fixation are

located on a megaplasmid. Journal of Bacteriology. 170. 927 – 934.

310

Watson, R. J. (1990). Analysis of the C4-dicarboxylate transport genes of Rhizobium

meliloti: nucleotide sequence and deduced products of dctA, dctB and dctD. Molecular

Plant-Microbe Interactions. 3. 174 – 181.

Welsh, M. J., Robertson, A. D. & Ostedgaard, L. S. (1998). Structural biology. The ABC

of a versatile engine. Nature. 396. 623 – 624.

Wemmer, D. E. (2003). The energetics of structural change in maltose-binding protein.

Proceedings of the National Academy of Sciences of the United States of America. 100.

12529 - 12530.

Wienkoop, S. & Saalbach, G. (2003). Proteome analysis. Novel proteins identified at the

peribacteroid membrane from Lotus japonicus root nodules. Plant Physiology. 131. 1080 –

1090.

Wild, J. & Klopotowski, T. (1981). D-Amino acid dehydrogenase of Escherichia coli

K12: positive selection of mutants defective in the enzyme activity and localization of the

structural gene. Molecular and General Genetics. 181. 373 – 378.

Whitehead, L. F. & Day, D. A. (1997). The peribacteroid membrane. Physiologia

Plantarum. 100. 30 – 44.

Whitehead, L. F., Day, D. A. & Tyerman, S. D. (1998). Divalent cation gating of an

ammonium permeable channel in the symbiotic membrane of soybean nodules. The Plant

Journal. 16. 313 – 324.

Witty, J. F. & Minchin, F. R. (1990). Oxygen diffusion in the legume root nodule. In

Nitrogen Fixation: Achievments and objectives, pp. 285-292. Edited by Gresshoff, P. M.,

Roth, L. E., Stacey, G. & Newton, W. E.. Chapman and Hall, New York.

Xu, W., Zhou, Y. & Chollet, R. (2003). Identification and expression of a soybean nodule-

enhanced PEP-carboxylase kinase gene (NE-PpcK) that shows striking up-/down-regulation

in vivo. The Plant Journal. 34. 441 – 445.

311

Yamato, I., Anraku, Y. & Hirosawa, K. (1975). Cytoplasmic membrane vesicles of

Escherichia coli. A simple method for preparing the cytoplasmic and outer membranes.

Journal of Biochemistry. 77. 705 – 718.

Yarosh, O. K., Charles, T. C. & Finan, T. M. (1989). Analysis of C4-dicarboxylate

transport genes in Rhizobium meliloti. Molecular Microbiology. 3. 813 – 823.

Yao, P. Y. & Vincent, J. M. (1969). Host specificity in the root hair "curling factor" of

Rhizobium sp. Australian Journal of Biological Sciences. 22. 413 – 423.

Yoshida, K., Fujita, Y. & Ehrlich, S. D. (1999). Three asparagine synthetase genes of

Bacillus subtilis. Journal of Bacteriology. 181. 6081 – 6091.

Young, J. P. W., Crossman, L. C., Johnston, A. W. B., Thomson, N. R., Ghazoui, Z. F.,

Hull, K. H., Wexler, M., Curson, A. R. J., Todd, J. D., Poole, P. S., Mauchline, T. H.,

East, A. K., Quail, M. A., Churcher, C., Arrowsmith, C., Cherevach, I., Chillingworth,

T., Clarke, K., Cronin, A., Davis, P., Fraser, A., Hance, Z., Hauser, H., Jagels, K.,

Moule, S., Mungall, K., Norbertczak, H., Rabbinowitsch, E., Sanders, M., Simmonds,

M., Whitehead, S. & Parkhill, J. (2006). The genome of Rhizobium leguminosarum has

recognizable core and accessory components. Genome Biology. 7. R34.

Yurgel, S., Mortimer, M. W., Rogers, K. N. & Kahn, M. L. (2000). New substrates for

the dicarboxylate transport system of Sinorhizobium meliloti. Journal of Bacteriology. 182.

4216 – 4221.

Yurgel, S. N. & Kahn, M. L. (2004). Dicarboxylate transport by rhizobia. FEMS

Microbiology Reviews. 28. 489 – 501.

Yuvaniyama, P., Agar, J. N., Cash, V. L., Johnson, M. K. & Dean, D. R. (2000). NifS-

directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proceedings of

the National Academy of Sciences of the United States of America. 97. 599 – 604.

Zakhia, F. & de Lajudie, P. (2001). Taxonomy of rhizobia. Agronomie. 21. 569 – 576.

312

Zehr, J. P., Crumbliss, L. L. & Church, M. J. (2003). Nitrogenase genes in PCR and RT-

PCR reagents: implications for studies of diversity of functional genes. Biotechniques. 35.

996 – 1002.

Zheng, S. & Haselkorn, R. (1996). A glutamate / glutamine / aspartate / asparagine

transport operon in Rhodobacter capsulatus. Molecular Microbiology. 20. 1001 – 1011.

Zhu, W. & Becker, D. F. (2003). Flavin redox state triggers conformational changes in the

PutA protein from Escherichia coli. Biochemistry. 42. 5469 – 5477.