Altocumulus:Harvesng Computa)onalResourcesfrom...
Transcript of Altocumulus:Harvesng Computa)onalResourcesfrom...
![Page 1: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/1.jpg)
Altocumulus: Harves)ng Computa)onal Resources from Devices at the Edge of the Cloud
1st Interna0onal Workshop on the Swarm at the Edge of the Cloud ·∙ September 29, 2013
![Page 2: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/2.jpg)
Altocumulus: Harves)ng Computa)onal Resources from Devices at the Edge of the Cloud
1. Trends in Cloud Compu)ng and Embedded Systems
2. The Altocumulus Idea
3. Our Research Efforts Toward Altocumulus
![Page 3: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/3.jpg)
Columbia University
iCloud Service opens
Amazon opens Web Services (IaaS, PaaS)
Google App Engine starts
AppStore for smart devices opens
Amazon starts Web-‐based Retail Services
Hadoop is developed
Rising Embedded Systems amid the Clouds
2000
2002
2004
2006
2008
2010
2012
1Ghz Mobile CPU Clock
2014
DOCSIS 3.0 (250Mbps), LTE (300Mbps)
iPhone is released
Android phone is released
2Ghz Mobile CPU Clock
DOCSIS 2.0 deployment (43Mbps)
PDA has 300MHz CPU clock frequency
3G/IMT-‐2000 (2Mbps/384Kbps)
Cloud World Embedded World
3x Global Electricity Use by Data Centers (2000-‐2010)
Cloud Costs now exceeded $130B
150x Network Bandwidth (2001-‐2011)
6x Clock Freq. (2002-‐2012)
1.4B STBs 1.5B Smart Devices 200M Mobile Sensors
by 2014
![Page 4: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/4.jpg)
Columbia University
Central Cloud
Altocumulus
Router
Edge Device
LAN
WAN
Cloud Layer
Intermediate Layer
Edge Layer
• A cloud formed by collec)ng resources from edge devices – Small-‐Sized – Less Costs – Short Latency due to Close Distance – Pre-‐processing, Data Compression, Edge-‐Analy)cs
Altocumulus: an Intermediate Cloud
![Page 5: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/5.jpg)
Columbia University
Altocumulus: a Poten)al Applica)on
• Weather Data Analysis • Tradi)onal Approach
– Analyzes the Na)onal Clima)c Data Center (NCDC) dataset • Sky ceiling height, Visibility
distances, Temperature, and Atmospheric pressure
– From more than 10,000 Weather Sta)ons
– Central Data Processing
• With Altocumulus – Regional Altocumuli – Altocumulus does data-‐
collec)ng, pre-‐processing – Local + Central Processing
![Page 6: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/6.jpg)
Columbia University
OpenMPI on a Broadband Network of STBs
R. Neill, L. P. Carloni et al., “Embedded Processor Virtualiza)on for Broadband Grid Compu)ng”, IEEE/ACM Interna)onal Conference on Grid Compu)ng (Grid) 2011
• A Heterogeneous System – A Unix Cluster – An Embedded Cluster
with 64 Set-‐top Boxes – DOCSIS 2.0 Network – Complete Ver)cal
Subset of Cable Head-‐end System
ATGGTTGCTACGCTTCGCAGCATTACCAT -‐-‐GGT-‐GCT-‐CG-‐-‐TCGC-‐-‐-‐-‐-‐-‐-‐CCAGCAAGG ATCGTTCCT-‐-‐-‐-‐-‐-‐-‐-‐CAG-‐-‐-‐-‐-‐-‐-‐-‐TGAAAGGAT GAGGTGGATA-‐-‐-‐-‐-‐-‐CCGTGTCAGGCATGTA GAGCT-‐-‐-‐T-‐-‐-‐-‐-‐-‐-‐CC-‐-‐-‐-‐-‐A-‐-‐CATGT-‐GGCCTG GAGGTTGCTAGT-‐-‐CCCATCGCATTGAACA
• DNA Sequencing Case Study – Workers execute Parallel
MSA Algorithm – Distributed Compu)ng
using Open MPI Opera)ons – Scales similarly to the Unix
Cluster
Embedded Cluster Altocumulus
R. Neill, A. Shabarshin, and L. P. Carloni, “A Heterogeneous Parallel System Running Open MPI on a Broadband Network of Embedded Set-‐Top Devices”, ACM Interna)onal Conference on Compu)ng Fron)ers (CF) 2010
![Page 7: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/7.jpg)
Columbia University
MapReduce Compu)ng System on an Embedded Cluster
Y. Jung, R. Neill, and L. P. Carloni, “A Broadband Embedded Compu)ng System for MapReduce U)lizing Hadoop”, IEEE Interna)onal Conference on Cloud Compu)ng Technology and Science (CloudCom) 2012, Best Paper Award
• Hadoop – A Distributed Data
Processing Framework – For Large Data Sets – High-‐Available
• Hadoop Distributed File System (HDFS) – Replicated, Reliable, and
Scalable
• MapReduce – Simple Parallel Data Processing
Framework
Hadoop Slaves
Altocumulus
![Page 8: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/8.jpg)
Columbia University M. Szczodrak, O. Gnawali, and L. P. Carloni, “Dynamic Reconfigura)on of Wireless Sensor Networks to Support Heterogeneous Applica)ons”, IEEE Interna)onal Conference on Distributed Compu)ng in Sensor Systems 2013
Protocol Stack • layered system design of applica)on and
communica)on protocols • consists of applica)on, network, MAC and radio layers
Programming Language – Swii Fox • Models run-‐)me execu)on as finite state machine
Heterogeneous Sensor Apps
Altocumulus
Fennec Fox: Enabling execu)on of mul)ple heterogeneous applica)ons on the low-‐power wireless network
![Page 9: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/9.jpg)
Columbia University
netShip: a CAD tool for Large-‐scale, Heterogeneous Distributed Embedded Systems
VP VP
VP VP
VP
VP
VM VM VM
Edge Altocumulus Cloud
Model Simula)on
Scale out
Virtual Machine
Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm
Scale up
Virtual Machine
Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm
Scale up
Virtual Machine
Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm Virtual Pla>orm
Scale up
Virtual Pla>orm
Scale up
Virtual Machine
Y. Jung, J. Park, M. Petracca, and L. P. Carloni, “netShip: A Networked Virtual Plajorm for Large-‐Scale Heterogeneous Distributed Embedded System”, Design Automa)on Conference (DAC) 2013
• A Simula)on Environment – For Altocumulus – Heterogeneity – Scalability – Based on virtual plajorm – Supports Design, Test,
Simula)on
• The VP-‐on-‐VM model – Horizontal Scalability
• By adding VM • Uses dynamic VM crea)on
– Ver)cal Scalability • By adding VP • Uses dynamic resource management
![Page 10: Altocumulus:Harvesng Computa)onalResourcesfrom ...ptolemy.berkeley.edu/projects/terraswarm/pubs/117/AltocumlusHarvestig...Altocumulus:Harvesng Computa)onal"Resources"from" DevicesattheEdgeoftheCloud"](https://reader034.fdocuments.us/reader034/viewer/2022050402/5f7fd8bdc891cc20f45733b1/html5/thumbnails/10.jpg)
Columbia University
Conclusion
• Altocumulus is – Small-‐sized – Low-‐latency – Low-‐costs – On the edge of the cloud
• We are developing suppor)ng frameworks – OpenMPI – Hadoop Distributed File System & MapReduce – FennecFox
• and CAD tool for Altocumulus systems – netShip allows us to design, simulate, and analyze heterogeneous applica)ons without physical deployment