Allen et al., 2007
-
Upload
danny-allen -
Category
Documents
-
view
231 -
download
0
Transcript of Allen et al., 2007
-
8/6/2019 Allen et al., 2007
1/12
THE JOURNAL OF GENE MEDICINE R E S E A R C H A R T I C L EJ Gene Med 2007; 9: 287298.Published online in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/jgm.1018
Development of strategies for conditional RNAinterference
Danny Allen*
Paul F. Kenna
Arpad Palfi
Helena P. McMahon
Sophia Millington-WardMary OReilly
Pete Humphries
G. Jane Farrar
Department of Genetics, Trinity
College Dublin, Dublin 2, Ireland
*Correspondence to: Danny Allen,
Department of Genetics, Trinity
College Dublin, Dublin 2, Ireland.
E-mail: [email protected]
Received: 19 September 2006
Revised: 22 December 2006
Accepted: 22 January 2007
Abstract
Background RNA interference (RNAi) represents a powerful tool with
which to undertake sequence-dependent suppression of gene expression.
Synthesized double-stranded RNA (dsRNA) or dsRNA generated endoge-nously from plasmid or viral vectors can be used for RNAi. For the latter,
polymerase III promoters which drive ubiquitous expression in all tissues
have typically been adopted. Given that dsRNA molecules must contain few
5 and 3 over-hanging bases to maintain potency, employing polymerase II
promoters to drive tissue-specific expression of RNAi may be problematic due
to potential inclusion of nucleotides 5 and 3 of siRNA sequences.
Methods To circumvent this, polymerase II promoters in combination with
cis-acting hammerhead ribozymes and short-hairpin RNA sequences have
been explored as a means to generate potent dsRNA molecules in tissues
defined by the promoter in use.
Results The novel constructs evaluated in this study produced functional
siRNA which suppressed the enhanced green fluorescent protein (eGFP) both
in vitro and in vivo (in mice). Additionally, the constructs did not appear
to elicit a significant type-1 interferon response compared to traditional
H1-transcribed shRNA.
Conclusions Given the potential off-target effects of dsRNAs, it would
be preferable in many cases to limit expression of dsRNA to the tissue of
interest and moreover would significantly augment the resolution of RNAi
technologies. Notably, the system under evaluation in this study could readily
be adapted to achieve this objective. Copyright 2007 John Wiley & Sons,
Ltd.
Keywords RNA interference; ribozymes; polymerase II promoters; gene therapy
Introduction
Use of double-stranded RNA (dsRNA) to modulate gene expression, or
RNA interference (RNAi), has been adopted extensively subsequent to the
breakthrough paper of Andrew Fire and colleagues in 1998 demonstrat-
ing potent sequence-specific gene silencing in Caenorhabditis elegans [1].
Observation of an interferon response in mammalian cells to long dsRNA
molecules precipitated the use of short dsRNA molecules or small inter-
fering RNA (siRNA) to circumvent this response [2]. Much of the initialresearch was focused on exploration of the utility of synthesized siRNAs,
which elicit transient suppression of a target gene. The transience of siRNA-
based suppression promoted the emergence of chemically protected siRNA
Copyright 2007 John Wiley & Sons, Ltd.
-
8/6/2019 Allen et al., 2007
2/12
288 D. Allen et al.
molecules incorporating modifications thereby providing
molecules with longer half-lives [3].
An alternative means of overcoming transient suppres-
sion involves engineering vector(s) from which functional
siRNAs may be expressed [4 9]. Short hairpin RNAs
(shRNAs) expressed from such vectors are processed
intracellularly into functional siRNAs [10]. Expression
of shRNAs can be achieved using various systems; e.g.
ubiquitously expressing polymerase III promoters such
as the H1 or U6 promoters which utilize short initia-
tion and termination signals have been employed [48].
However, the majority of mammalian promoters are poly-
merase II promoters and typically use more complex
initiation and termination signals than their polymerase
III counterparts. The cytomegalovirus (CMV) promoter, a
ubiquitous polymerase II promoter, has been employed to
drive expression of shRNAs; typically, shRNA sequences to
be expressed have been placed juxtaposed to the transcrip-
tional start site [11]. In contrast to CMV, transcriptionalstart sites for many polymerase II promoters are ill defined
or multiple transcriptional start sites may be utilized.
Nevertheless, there are clear advantages to targeting
RNAi-based suppression to specific tissues particularly
in the light of potential off-target effects associated
with RNAi-based suppression identified from microarray
studies [12]. Additionally, such tissue specificity would
increase the resolution of RNAi technology, in principle,
mirroring the resolution achieved with conditional gene
targeting.
Materials and methods
Construction of RNAi plasmids
Polymerase chain reactions (PCRs) were carried out
under the following conditions. The PCR reaction had
a final volume of 20 l containing 5 pmol of forward
and reverse primer, 0.5pmol of forward and reverse
template oligonucleotide, 0.2 M dATP, dTTP, dCTP, and
dGTP, 5 l 10 buffer and 1 unit of Taq polymerase
(10 buffer = 500 mM KCl, 100 mM Tris, pH 9, 0.1%
gelatin (v/v), 1% Triton X and 15 mM MgCl2
). The
standard PCR cycle run was; 94 C for 5 min followed
by 35 cycles of 94 C for 1 min, 55 C for 1 min and 72 C
for 1.2 min, ending with a final step of 72 C for 10 min.
All primer and template oligonucleotide sequences are
detailed in Table 1. PCR products were cloned into
pCDNA3.1 (Invitrogen) using restriction enzyme sites
incorporated into the forward and reverse primers. Colony
PCR screens were carried out to detect positive colonies.
DNA from positive colonies was sequenced to ensure
synthesis fidelity of the cloned PCR products.
Cell transfection and RNA extraction
HeLa cells were cultured in DMEM+ (500 ml Dulbeccos
modified Eagles medium (DMEM), 50 ml foetal calf
serum (FCS), 5 ml 100 mM sodium pyruvate, 5 ml
L-glutamine and 5 ml penicillin/streptomycin) using
standard procedures. All co-transfections (enhanced
green fluorescent protein (eGFP) plasmid + test/control
plasmid) were carried out in triplicate in six-well plates.
Twenty-four hours prior to transfection, 5 105 cells
were plated in each well of a six-well plate and
grown under standard conditions minus antibiotics.
Transfections were carried out using Lipofectamine 2000
as per the manufacturers instructions (Invitrogen).
RNA extraction
Twenty-four hours post-transfection total RNA was
isolated from cells using TRI reagent (MRC) as per the
manufacturers instructions. RNA was then treated with
RNase-free DNase (Promega). RNAs extracted from HeLa
cells were resuspended in 100 l of nuclease-free water
and stored at 80 C. When enriching for small RNAs the
mirVana miRNA isolation kit was used, instead of TRI
reagent, as per the manufacturers instructions (Ambion).
RNA extraction and real-timereverse-transcription (rt)PCR
RNA levels were analyzed using real-time rtPCR carried
out on a Lightcycler (Roche Diagnostics) using the
Table 1. Primer and template oligonucleotide sequences used in this study
tsRNAi Primer Forward CTAGCTAGCTCTAGAGGAtsRNAi Primer Reverse CCCAAGCTTGAATTCCACtsRNAi A eGFP Oligo CTAGCTAGCTCTAGAGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTAGCAAGCTGACCCTGAAGTTCATCAGA
AGAGAACTTCAGGGTCAGCTTGCCGGTCGACGGATCATGATCCGTCCTGATGAGTCCGTGAGGACGAAACAACGAATTCAAGCTTtsRNAi B eGFP Oligo CCTAGCGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCGCAAGCTGACCCTGAAGTTCATGACGGATC
TAGATCCGTCCTGATGAGTCCGTGAGGACGAAACTGGGTCGCTAAAGCCCACCCAGCTGATGAGTCCGTGAGGACGAAACGGTACCGTCGAACTTCAGGGTCAGCTTGCCGGACGGATCATGATCCGTCCTGATGAGTCCGTGAGGACGAAACAACCACCAACGAATTCAAGCTT
tsRNAi C eGFP Oligo CCTAGCGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCTACTGCAAGCTGACCCTGAAGTTCATCAGAAGAGAACTTCAGGGTCAGCTTGCCGAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGTTTTTTGTGTGAAGCTTCCTAGC
tsRNAi A non Oligo CTAGCTAGCTCTAGAGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTATTCTCCGAACGTGTCACGTTTCAGAAGAACGTGACACGTTCGGAGAATTGTCGACGGATCATGATCCGTCCTGATGAGTCCGTGAGGACGAAACAACGAATTCAAGCTT
tsRNAi B non Oligo CCTAGCGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCTTCTCCGAACGTGTCACGTTTGACGGATCTA
GATCCGTCCTGATGAGTCCGTGAGGACGAAACTGGGTCGCTAAAGCCCACCCAGCTGATGAGTCCGTGAGGACGAAACGGTACCGTCACGTGACACGTTCGGAGAATTGACGGATCATGATCCGTCCTGATGAGTCCGTGAGGACGAAACAACCACCAACGAATTCAAGCTT
tsRNAi C non Oligo CCTAGCGGATCCAGTAGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCTACTTTCTCCGAACGTGTCACGTTTCAGAAGAACGTGACACGTTCGGAGAATTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGTTTTTTGTGTGAAGCTTCCTAGC
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
3/12
Polymerase II Promoter-Driven RNAi 289
Table 2. Real-time rtPCR primer sequences
eGFP Forward TTCAAGGAGGACGGCAACATCCeGFP Reverse CACCTTGATGCCGTTCTTCTGCActin Forward TCACCCACACTGTGCCCATCTACGAActin Reverse CAGCGGAACCGCTCATTGCCAATGGGAPDH Forward GAAGGTGAAGGTCGGAGTC
GAPDH Reverse GAAGATGGTGATGGGATTTCPPIA Forward CCCACCGTGTTCTTCGACATPPIA Reverse CCAGTGCTCAGAGCACGAAAOAS1 Reverse CAGCTTCGTACTGAGTTCGCOAS1 Reverse TAGTTCTGTGAAGCAGGTGGIFITM1 Forward CAACACCCTCTTCTTGAACTGGIFITM1 Reverse AGATGTTCAGGCACTTGGCGISGF3 Forward AAGTACCATCAAAGCGACAGCISGF3 Reverse CATTATTGAGGGAGTCCTGGEIF2AK2 Forward ACCTCAGTGAAATCTGACTACCEIF2AK2 Reverse CAGATGATGATTCAGAAGCG
QuantiTect SYBR Green RT-PCR kit (Qiagen). Samples
were run under the following conditions; an rt step (50C,
20 min), followed by an inactivation step (95
C, 15 min)and 35 cycles of an amplification step (94 C, 15 s;
55 C, 20 s; 72 C, 4 s). Mean values, standard deviations
and t-tests were calculated using DataDesk v6.0 (see
below). Differences in levels of expression observed
between samples were deemed statistically significant
at p < 0.05. All real-time rtPCR primer sequences are
detailed in Table 2. The cycle-threshold method of real-
time rtPCR analysis was used for both mRNA relative
quantification and interferon-related gene expression. The
2CT method of determining mean fold changes in gene
expression was used to analyze the interferon-related
gene expression.
Hydrodynamic tail-vein injection
Endotoxin-free plasmid DNA was diluted in sterile
phosphate-buffered saline (PBS). Total injection volumes
per mouse (in ml) were calculated by dividing the weight
of the mouse (in g) by 10. Unanesthetized mice were
restrained in a 50 ml syringe barrel with rubber bungs.
Once in position, a lamp was used to warm the mouse-tail
and thereby dilate the tail vein facilitating visualization
and injection with a 3-ml syringe, fitted with a 0.75-cm
26-gauge needle. The syringe needle was placed into the
dilated tail vein and nearly the full length of the needle
inserted into the vein. Once inserted, the complete volume
of solution was injected into the tail vein within 35 s.
Notably, hydrodynamic injection appears to result in a
temporary minor heart failure in the mouse, resulting in
retrograde blood flow which pushes the injected sample
back into the liver.
Direct inferior vena cava injection
Endotoxin-free plasmid DNA was diluted in sterile
Hartmanns solution. Total injection volume per mouse was 500l. Mice were anesthetized prior to injection
using ketamine/xylazine. In anesthetized mice the inferior
vena cava (IVC) was exposed using a midline incision. A
1-ml syringe, fitted with a 30-gauge needle, was used
to deliver the DNA solution. Once the needle had been
inserted, the complete volume of solution was injected
into the IVC within 10 s.
RNA extraction from mouse organs
Forty-eight hours post injection, mice were sacrificed
using CO2 asphyxiation. Organs collected from mice were
homogenized in 1 ml of TRI reagent (MRC) using sterile
polypropylene pellet pestles (Sigma Aldrich). Total RNA
was isolated as per the manufacturers instructions. RNA
was then treated with RNase-free DNase (Promega). RNA
extracted from mouse liver was resuspended in 500 l of
nuclease-free water and stored at 80 C.
Tissue fixation and sectioningOrgans harvested for sectioning were preserved in 4%
paraformaldehyde and stored at 4 C in the dark until
embedded in 6% agar for sectioning. Sections of 100 m
thickness were cut on a vibratome (Leica VT1000s) at
a blade vibrating frequency of 70 Hz and a speed of
0.75 mm/s. Analysis of sections was performed with a
fluorescence microscope (Axiophot; Zeiss Ltd., UK) at
12.5 magnification.
Statistical analysis
Statistics were performed using DataDesk v6.0.
Unpaired two-sample t-tests were performed on the data
to compare the differences between sample means.
Animal handling
All animals used in these experiments complied with the
ARVO statement for the Use of Animals in Ophthalmic and
Vision Research and were also passed by an intuitional
ethics committee and under licence. Mice were held in the
Barrier Mouse Facility in the Smurfit Institute of Genetics
prior and subsequent to experimental procedures. All micewere sacrificed by CO2 asphyxiation.
Results
Expression cassettes have been generated in which a
combination of polymerase II promoters in conjunction
with cis-acting hammerhead ribozymes have been used
to express functional shRNAs targeting eGFP and eGFP
suppression; these have been evaluated initially in cell
culture and subsequently in mice. Three constructs
A C with unifying features, most notably cis-actinghammerhead ribozymes, have been explored. In essence,
cis-acting ribozymes are employed to cleave nucleotides
5 and 3 of antisense and sense sequences comprising
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
4/12
290 D. Allen et al.
dsRNAs thereby promoting generation of functional
siRNAs. In each case, the sequence of one arm of the
cis-acting ribozyme is in part complimentary to either
the sense or antisense sequence used to form siRNAs.
Construct A comprises an shRNA sequence cleaved 5
and 3 by cis-acting hammerhead ribozymes. In contrast,
four cis-acting hammerhead ribozymes are employed in
construct B to generate sense and antisense strands
separately which must hybridize within the cell to
produce functional siRNAs. Construct C comprises a
single hammerhead ribozyme 5 of the sense portion
of the shRNA and a minimal poly-A signal at the
3 end placed juxtaposed to sequence coding for the
antisense portion of the shRNA. In all three eGFP targeting
constructs (AC) the shRNA target sequence was
CGGCAAGCTGACCCTGAAGTTCAT and for the three non-
targeting constructs (A C) the shRNA target sequence
was AATTCTCCGAAC GTGTCACGT. Both target sites are
based on Qiagen control siRNA target sites with thenon-targeting shRNA sequence having no homology to
any known mammalian genes. Both the eGFP-targeting
constructs and the non-targeting constructs were placed
under the control of a cytomegalovirus (CMV) promoter
(Figures 1A1C).
In principle, upon expression of the CMV-driven AC
constructs, the cis-acting hammerhead ribozymes should
self-cleave releasing shRNAs in the case of constructs
A and C and sense and antisense RNA in the case of
construct B. Given that the constructs described above
comprise multiple elements, to ensure that constructs
A C were indeed capable of expressing siRNAs, HeLa cells were transfected with these constructs. Total RNA was
subsequently extracted and enriched for small RNAs using
the mirVana miRNA isolation kit. RNA concentrations
were calculated by absorbance at 260 nm and RNA purity
analyzed using the A260 to A280 ratio. RNA preparations,
enriched for siRNAs, were run on 4% TBE NuSieve3 : 1
agarose gels using a dsRNA ladder (New England
Biolabs) to size RNAs. RNA bands in these samples were
compared to bands present in cells transfected with either
the positive control (H1-shRNA(eGFP)), empty vector
(pCDNA3.1) or untransfected cells. As shown in Figure 2,
the results suggest that constructs AC and the positive
control are all capable of producing siRNA as suggestedby the presence of bands of the correct size in the
RNA samples from these transfections. In contrast no
such bands were observed in the negative controls. It is
notable that whilst design B produces separate sense and
antisense strands of siRNA that have to anneal in vitro
to form siRNAs, it appears that this does indeed occur
(Figure 2).
To examine whether the siRNAs being produced by con-
structs AC were indeed functional, suppression studies
were undertaken in HeLa cells using a CMV promoter
to drive expression of the sequences. To determine
the optimal experimental conditions, HeLa cells wereco-transfected with an eGFP reporter plasmid (pEGFP-
C1, Clontech) and varying concentrations of the design
C expression plasmid (between 0.1 and 10 g). eGFP
transcript levels were measured by real-time rtPCR,
normalized using glyceraldehyde-3-phosphate dehydro-
genase (GAPDH), actin and cyclophilin-A expression
and compared to eGFP expression in cells transfected
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
5/12
Polymerase II Promoter-Driven RNAi 291
with the non-targeting design C construct. As shown in
Figure 3, the change in eGFP transcript level was sig-
nificant (p < 0.05) using 1 g of plasmid resulting in
a 53% decrease in expression. At 5 and 10 g of plas-
mid the fold change was also significant (p < 0.05) with
a 73% and 74% decrease in expression, respectively.Constructs AC were then co-transfected with an eGFP
reporter plasmid into HeLa cells as above (5 g of con-
struct with 1 g of eGFP reporter plasmid) (Figure 4).
Constructs AC resulted in approximately 71%, 70% and
73% suppression of eGFP expression, respectively, while
the H1-shRNA(eGFP) positive control resulted in 58%
suppression of the target (when compared to the appro-
priate non-targeting shRNA control). The low level of
suppression with the H1-shRNA(eGFP) may possibly be
attributed to co-transfection of the two plasmids the
target and the suppressor plasmids. Additionally, these
constructs are driven by different promoters, i.e. a CMV-
driven eGFP reporter and a H1-driven shRNA. The data
provide a clear indication that functional siRNAs can be
generated by exploiting hammerhead ribozymes to trim 5
and 3 sequences flanking core elements (sense/antisense
sequences) comprising a dsRNA molecule. Indeed sup-
pression of the eGFP target was achieved by either
expressing shRNA sequences (constructs A and C) or
sense and antisense siRNA sequence (construct B). In prin-
ciple, the same approach could be utilized subsequently
incorporating tissue-specific polymerase II promoters to
provide tissue specificity of RNAi. Trimming of sequences
5 and 3 of the RNAi molecule allows for flexibility in
choice of polymerase II promoter and hence would enabletissue-specific RNAi.
Figure 1. Diagrammatic representation of constructs AC.
(A) Construct A utilizes two cis-acting hammerhead ribozymes
to cleave 5 and 3 of an shRNA sequence. (B) In contrast,
construct B utilizes four cis-acting hammerhead ribozymes,
two that cleave 5 and 3 of the siRNA sense strand and two
that cleave 5 and 3 of the siRNA antisense strand. Sense
and antisense strands must anneal intracellularly to generate
functional siRNAs. (C) Construct C utilizes a single cis-acting
ribozyme to cleave 5 of the shRNA sequence with a minimal
polyadenylation signal immediately 3 of the shRNA sequence.
All three constructs are expressed using a CMV promoter.
Additionally, constructs AC have been generated carryingeither an shRNA sequence targeting eGFP or a non-targeting
control shRNA sequence
In some instances siRNAs and shRNAs have been found
to elicit a type-1 interferon response. It was important
to determine if the presence of additional elements in
the constructs, e.g. cis-acting hammerhead ribozymes,
may potentially result in an increased type-1 interferon
response, which clearly would not be desirable. Todetermine whether constructs A C stimulate a type-1
interferon response the expression of several interferon-
stimulated genes (OAS1, IFITM1, ISGF3g and EIF2AK2)
was compared to their expression levels in cells co-
transfected with either the H1-shRNA(eGFP) positive
control (directed towards the same eGFP target) or
the non-targeting shRNA control. Transcript levels were
measured by real-time rtPCR and normalized using
GAPDH, actin and cyclophilin-A expression. For the
interferon response the 2CT method was used to
determine mean fold changes in gene expression [13].
As shown in Figure 5, the resulting data indicated that
there was no significant change in expression of IFITM1
(p = 0.56) and EIF2AK2 (p = 0.1) with constructs AC
when compared to the non-targeting control construct.
Although OAS1 expression varied, e.g. a 2.3-fold increase
in OAS1 expression was observed with construct A, there
was no significant (p = 0.25) change in OAS1 expression
compared to the H1-shRNA(eGFP) positive control.
Furthermore, ISGF3g expression increased between 2.3-
and 3.5-fold with constructs A C; however, this increase
in ISGF3g expression was not significant (p = 0.24)
compared to the H1-shRNA(eGFP) positive control. In
conclusion, the results obtained suggest that, despite
the inclusion of additional components in constructs A C such as cis-acting hammerhead ribozymes, these
constructs operate in a similar manner to standard H1-
driven shRNA constructs in terms of the immune response
they elicit.
Given that from the in vitro work described above
it is clear that cis-acting ribozymes can act in concert
with shRNA sequences to produce functional siRNAs
and thereby elicit suppression of a target gene in cell
culture, it was timely to explore if this strategy would
also be effective in vivo. Hence eGFP-expressing mice,
C57BL/6-Tg(ACTB-eGFP)1Osb/J (Jackson Laboratories),
were used to explore if functional siRNAs couldbe generated from constructs A C in vivo. C57BL/6-
Tg(ACTB-eGFP)1Osb/J mice express an eGFP gene driven
Figure 2. The four top panels depict photographs of 4% TBE NuSieve3 : 1 agarose gels (under UV light) with a dsRNA ladder and
approx. 2 g of RNA enriched for small RNAs from HeLa cells transfected with the empty vector (pCDNA3.1) (A), positive control
(H1-shRNA(eGFP)) (B), construct A (C), construct B (D), or construct C (E)
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
6/12
292 D. Allen et al.
Figure 3. Graph of eGFP transcript levels in HeLa cells co-transfected with construct C at various concentrations and an eGFP
reporter plasmid. To determine the optimal plasmid concentration for further experiments, increasing quantities of construct Cwere co-transfected with an eGFP reporter plasmid. eGFP transcript levels were measured by real-time rtPCR and normalized using
GAPDH, actin and cyclophilin-A expression. The eGFP expression obtained was compared to eGFP expression in cells transfected
with non-targeting constructs. The reduction in eGFP transcript levels was significant (p < 0.05) using 1 g of the construct C
plasmid (53% decrease in mRNA levels). At 5 g and 10 g of plasmid the fold change was also significant (p < 0.05) with a 73%
and 74% decrease in eGFP mRNA, respectively. Error bars represent standard deviation
Figure 4. Graph of eGFP transcript levels in HeLa cells co-transfected with constructs A C and an eGFP reporter plasmid. eGFP
transcript levels were measured by real-time rtPCR and normalized using GAPDH, actin and cyclophilin-A expression. Expression
was compared to eGFP expression in cells transfected with non-targeting constructs. Cells transfected with the positive control
construct (H1-shRNA(eGFP)) showed 58% suppression of eGFP transcript levels. Cells transfected with constructs A, B and C
showed 71%, 70% and 73% suppression of eGFP transcript levels, respectively. Notably, all four eGFP-targeting constructs resulted
in significant eGFP suppression when compared to the appropriate non-targeting shRNA control construct (p < 0.05). Error bars
represent standard deviation
by a chicken beta-actin promoter with a CMV enhancer
[14]. Sixty-four transgenic mice were treated twice over
a 24-h period with 20 g of constructs AC (either the
eGFP-targeting or the non-targeting versions), the H1-
shRNA(eGFP) positive control or the non-targeting H1-shRNA, administered via hydrodynamic tail-vein injection
(total 40 g). Liver, kidney and spleen were harvested
48 h after the second injection. RNA extracted from tissues
was analyzed for eGFP expression by real-time rtPCR and
normalized using GAPDH and ribosomal 18s expression.
eGFP expression in mice injected with eGFP-targeting
constructs AC was compared to eGFP expression in mice
injected with the non-targeting control constructs AC.Results obtained in vivo were similar to those observed
in the experiments undertaken in cell culture (Figure 6).
In liver, the positive control construct H1-shRNA(eGFP)
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
7/12
Polymerase II Promoter-Driven RNAi 293
Figure 5. Graphs of OAS1 (A), IFITM1 (B), ISGF3g (C), and EIF2AK2 (D) transcript levels in HeLa cells co-transfected with constructs
AC, the H1-shRNA(eGFP) or the non-targeting shRNA control and an eGFP reporter plasmid. Transcript levels were measured by
real-time rtPCR and normalized using GAPDH, actin and cyclophilin-A expression. Expression was compared to cells transfected
with either the H1-shRNA(eGFP) positive control (directed towards the same eGFP target) or the non-targeting shRNA control.
The resulting data indicated no significant change in expression of IFITM1 (p = 0.56) and EIF2AK2 (p = 0.1) compared to the
non-targeting control. Although OAS1 expression varied, e.g. a 2.3-fold increase in OAS1 expression was observed with design A,
there was no significant (p = 0.25) change in OAS1 expression compared to the H1-shRNA(eGFP) positive control. Furthermore,ISGF3g expression increased between 2.3- and 3.5-fold with constructs AC; however, this increase in ISGF3g expression was not
significant (p = 0.24) compared to the H1-shRNA(eGFP) positive control. Error bars represent standard deviation
resulted in a 45% decrease in eGFP transcript levels.
Similarily, constructs A C resulted in 43%, 40% and
54% decreases in eGFP transcript levels respectively in
liver. Notably, eGFP suppression with constructs A C
in liver did not differ significantly from the positive
control (p = 0.57). In contrast, all four eGFP-targeting
RNAi constructs demonstrated a significant difference, in
terms of eGFP suppression, from the non-targeting shRNA
negative control construct (p < 0.05). Furthermore, inaddition to liver, eGFP suppression was evaluated in
kidney and spleen. Whilst no eGFP suppression was seen
in kidney or spleen it was established, via the injection
of an eGFP reporter plasmid, that hydrodynamic injection
resulted in preferential delivery to liver with no significant
expression in other organs such as kidney and spleen
(discussed below).
In addition to evaluation using real-time rtPCR,
liver samples from all 64 injected mice were also
taken and preserved in paraformaldehyde for fluorescent
microscopy. The four panels shown in Figure 7A depict
representative 100-m vibratome liver sections (12.5
),under UV light and a GFP filter, from C57BL/6-Tg(ACTB-
EGFP)1Osb/J mice tail vein injected with a total of
40 g of a non-targeting H1-shRNA and non-targeting
constructs A C (A D, respectively). A significant level
of fluorescence can be observed in each of the sections.
In these sections it is possible to view an entire liver
cross-section demonstrating even distribution of eGFP
fluorescence (Figure 7A). In contrast, the four panels in
Figure 7B depict representative 100-m vibratome liver
sections (12.5), under UV light and a GFP filter, from
C57BL/6-Tg(ACTB-EGFP)1Osb/J mice tail vein injected
with a total of 40g of eGPF targeting H1-shRNAand eGFP-targeting constructs AC (AD, respectively).
Notably, a significant reduction in green fluorescence
can be observed in each of the sections in Figure 7B
compared to those shown in Figure 7A. In these sections it
is possible to view an entire liver cross-section in this case
demonstrating the even distribution of eGFP suppression
(Figure 7B). In summary, the results from in vivo delivery
of constructs AC in mice mirror those obtained in cell
culture and suggest that these constructs incorporating
cis-acting hammerhead ribozymes and shRNA sequences
may be used to generate potent siRNAs in vivo from
polymerase II promoters.To determine whether constructs A C stimulate a
type-1 interferon response in vivo the expression of several
interferon-stimulated genes (OAS1, IFITM1, ISGF3g and
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
8/12
294 D. Allen et al.
Figure 6. Graph of eGFP transcript levels in liver, kidney and spleen from C57BL/6-Tg(ACTB-EGFP)1Osb/J mice. The
H1-shRNA(eGFP) positive control, and both eGFP-targeting and non-targeting constructs AC, were evaluated in vivo subsequent to
hydrodynamic tail-vein injection of C57BL/6-Tg(ACTB-EGFP)1Osb/J mice. A total of 64 mice were treated twice over a 24-h period
with 20 g of plasmid (total of 40 g). eGFP transcript levels were measured by real-time rtPCR and normalized using GAPDH and
ribosomal 18s expression. eGFP expression in mice injected with eGFP-targeting constructs was compared to eGFP expression from
mice injected with non-targeting control constructs. In liver, administration of the positive control construct (H1-shRNA(eGFP))
resulted in a 45% decrease in eGFP transcript levels. Similarly, in liver, constructs AC resulted in 43%, 40% and 54% reductions
in eGFP transcript levels, respectively. Notably, eGFP suppression with constructs A C did not differ significantly from that
achieved with the positive control (p = 0.57). All four targeting constructs resulted in significant eGFP suppression compared to
the non-targeting shRNA negative control (p < 0.05). Due to a lack of plasmid delivery outside of the liver, eGFP expression in
kidney and spleen with all constructs did not differ significantly from the negative controls. A total of eight mice were injected per
construct. Error bars represent standard deviation
EIF2AK2) was compared to their expression levels in
mice transfected with either the H1-shRNA(eGFP) positive
control (directed towards the same eGFP target) or
the non-targeting shRNA control. Transcript levels were
measured by real-time rtPCR and normalized using
GAPDH, actin and cyclophilin-A expression. For the
interferon response the 2CT method was used to
determine mean fold changes in gene expression [13].
As shown in Figure 8, the resulting data indicated that
there was no significant change in expression of IFITM1
(p = 0.33) and EIF2AK2 (p = 0.11) with constructs AC
when compared to the non-targeting control construct.Although OAS1 expression varied between 2.3- to 3.0-fold
compared to the non-targeting control construct, there
was no significant (p = 0.49) change in OAS1 expression
compared to the H1-shRNA(eGFP) positive control.
Furthermore, ISGF3g expression increased between 1.3-
and 2.0-fold with constructs AC; however, this increase
in ISGF3g expression was not significant (p = 0.87)
compared to the H1-shRNA(eGFP) positive control.
Notably, these results are similar to the expression
patterns found in vitro. In conclusion, the results
obtained suggest that, despite the inclusion of additional
components in constructs AC such as cis-actinghammerhead ribozymes, these constructs operate in a
similar manner to standard H1-driven shRNA constructs
in terms of the immune response they elicit in vivo.
As discussed above, in contrast to the suppression
obtained in liver, no significant eGFP suppression was
obtained in kidney or spleen, after tail-vein injection,
irrespective of the construct used (Figure 6). Delivery
of naked DNA has been explored extensively for many
tissues but typically DNA is subject to rapid degradation
by nucleases [15]. However, results from previous studies
suggest that hydrodynamic tail-vein injection in mice may
be used to deliver plasmid DNA effectively to liver [16].
Absence of eGFP suppression in organs other than liver in
the current study may be due to inadequate delivery of
plasmid DNA to those organs. To explore this hypothesisa CMV promoter-eGFP reporter gene construct (CMV-
eGFP) was delivered to wild-type CD-1, C57BL/6 and
129 mice by hydrodynamic tail-vein injection and liver,
kidney, spleen, heart and lung tissues analyzed for eGFP
expression 48 h post-administration of DNA by real-time
rtPCR and fluorescent microscopy. eGFP expression was
found to be almost exclusively limited to liver tissue (data
not shown).
In summary, while high-pressure tail-vein administra-
tion of naked DNA can provide effective in vivo delivery to
mouse liver, delivery to other organs is restricted or absent
using this approach. A prerequisite for in vivo explo-ration of specific RNAi is a means of delivering tsRNAi
constructs to other target organs. Methodologies which
provide delivery of DNA to organs other than liver have
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
9/12
Polymerase II Promoter-Driven RNAi 295
Figure 7. The four panels shown in (A) represent 100-m vibratome liver sections (12.5), under UV light and a GFP filter,
from C57BL/6-Tg(ACTB-EGFP)1Osb/J mice tail vein injected with a total of 40 g of a non-targeting H1-shRNA and non-targeting
constructs AC (AD, respectively). A total of 64 mice were treated twice over a 24-h period with 20 g of plasmid (total of 40 g).
A significant level of green fluorescence can be observed in each of the sections. In these sections it is possible to view an entire liver
cross-section demonstrating the even distribution of eGFP fluorescence. The four panels in (B) represent 100-m vibratome liver
sections (12.5), under UV light and a GFP filter, from C57BL/6-Tg(ACTB-EGFP)1Osb/J mice tail vein injected with a total of 40g
of eGPF targeting H1-shRNA and eGFP-targeting constructs AC (AD, respectively). A significant reduction in green fluorescence
can be observed in each of the sections in (B) compared to those in (A). Again in these sections it is possible to view an entire
liver cross-section demonstrating the even distribution of eGFP suppression achieved subsequent to hydrodynamic injection of the
eGPF-targeting design C construct. A total of eight mice were injected per construct. Scale bars: 500 m
been employed. For example, Wu and colleagues demon-
strated plasmid-based delivery of a luciferase reporter
gene to mouse kidney subsequent to a single injection
into the inferior vena cava (IVC) [17]. Similarly, in the
current study, a CMV-driven eGFP plasmid (40 g) has
been injected into mouse IVC and eGFP expression eval-
uated using real-time rtPCR and fluorescent microscopy.
eGFP expression was observed at both RNA and protein
levels (data not shown) confirming that IVC injection
may be used to deliver plasmid DNA to mouse kid-
ney.Given that constructs A C incorporating cis-acting
hammerhead ribozymes and shRNA sequences have been
found to generate potent siRNAs in vivo from polymerase
II promoters, together with methods for delivery of
DNA to multiple organs, it was timely to engineer a
liver-specific promoter sequence into these constructs.
The CMV promoter in constructs AC was replaced by
2.3 kb of the rat albumin promoter/enhancer sequence,
a promoter previously shown to drive liver-specific gene
expression in vivo [18]. Subsequently, eGFP-targeting and
non-targeting construct C driven by an albumin promoter
were administered by hydrodynamic tail-vein injection. A total of 24 mice were injected. Liver from injected
mice were harvested 48 h post-injection and analyzed
for eGFP expression using real-time rtPCR (Figure 9).
eGFP expression levels were compared to levels in mice
injected with non-targeting control plasmids. Significant
suppression (p < 0.05, DataDesk v6.0) of eGFP expression
was observed approximately 56% suppression of eGFP
expression as evaluated by real-time rtPCR.
In addition, the CMV-driven and albumin-driven eGFP-
targeting and non-targeting construct C plasmids were
injected into the IVC. Approximately 45% suppression
(p < 0.05, DataDesk v6.0) of eGFP expression as
evaluated by real-time rtPCR was observed in mouse
kidney (Figure 10) when the CMV-driven eGFP-targetingconstruct was injected andcompared to that obtained with
a non-targeting control. In contrast, the albumin-driven
construct elicited no suppression of eGFP expression
in mouse kidney. In summary, the albumin promoter
in concert with hammerhead ribozymes and shRNA
sequences can be used to drive expression of functional
siRNAs in liver.
Discussion
In this study a method of generating functional siRNAs, inprinciple from any polymerase II promoter, involving use
of cis-acting ribozymes has been developed and evaluated
both in vitro and in vivo (in mice). As demonstrated such
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
10/12
296 D. Allen et al.
Figure 8. Graphs of OAS1 (A), IFITM1 (B), ISGF3g (C), and EIF2AK2 (D) transcript levels in liver from C57BL/
6-Tg(ACTB-EGFP)1Osb/J mice tail vein injected with constructs AC, the H1-shRNA(eGFP) or the non-targeting shRNA control
and an eGFP reporter plasmid. A total of 40 mice were treated twice over a 24-h period with 20 g of plasmid (total of 40 g).
Transcript levels were measured by real-time rtPCR and normalized using GAPDH, actin and cyclophilin-A expression. Expression
was compared to cells transfected with either the H1-shRNA(eGFP) positive control (directed towards the same eGFP target) or the
non-targeting shRNA control. The resulting data indicated that there was no significant change in expression of IFITM1 ( p = 0.33)
and EIF2AK2 (p = 0.11) with constructs AC when compared to the non-targeting control construct. Although OAS1 expression
varied between 2.3- to 3.0-fold compared to the non-targeting control construct, there was no significant (p = 0.49) change in OAS1expression compared to the H1-shRNA(eGFP) positive control. Furthermore, ISGF3g expression increased between 1.3- and 2.0-fold
with constructs AC; however, this increase in ISGF3g expression was not significant (p = 0.87) compared to the H1-shRNA(eGFP)
positive control. A total of eight mice were injected per construct. Error bars represent standard deviation
an approach may readily be adapted to provide tissue-
specific RNAi by incorporating tissue-specific polymerase
II promoters into constructs AC. Potential advantages
of tissue-specific gene silencing are evident given
results from microarray-based expression profiling studies
highlighting that off-target effects can frequently arise
as a result of RNAi-mediated gene silencing [12].
Additionally, RNAi has been proposed as a means ofgenerating knockout or knockdown transgenic animals
[19]. Tissue-specific RNAi would overcome potential
embryonic lethality in such transgenics and moreover
would provide enhanced resolution for RNAi technology
enabling gene silencing in individual tissue types. Given
these significant advantages a number of approaches to
achieve tissue-specific expression of functional siRNAs
have been proposed. The approaches typically utilize H1
or U6 promoter-driven shRNA constructs carrying loxP
sites in combination with tissue-specific delivery of Cre
recombinase to induce expression of functional siRNAs
[20 23]. Furthermore, tetracycline-based systems havebeen used to demonstrate conditional suppression in vitro
and in vivo [24,25]. In one such approach T7 recombinase
was used in conjunction with T7 promoter-driven shRNAs
and a 3 ribozyme to process shRNAs to achieve
inducible RNAi [25]. In addition, artificially generated
microRNAs (miRNAs) have recently been explored in vitro
as an alternative means of achieving gene silencing
and potentially could be used in combination with a
variety of polymerase II promoters to provide tissue
specificity [26,27]. The strategy explored in vitro and
in vivo in the current study represents an alternativemeans of achieving siRNA-based tissue-specific RNAi
and, in contrast to many of the approaches referred
to above, does not require delivery of Cre recombinase
or doxycycline to elicit tissue-specific expression and
would simply utilize a single cassette to achieve tissue-
specific RNAi. In essence, the approach developed
incorporates the use of polymerase II promoters to drive
tissue-specific expression in conjunction with cis-acting
hammerhead ribozymes to trim the sense and antisense
strands of the dsRNA to produce functional siRNA or
shRNA. Given the almost ubiquitous application of RNAi
in many areas of molecular biology, it is clear thatthere will be multiple applications for systems such as
that described which augment the resolution of RNAi
technology.
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
11/12
Polymerase II Promoter-Driven RNAi 297
Figure 9. Graph of eGFP transcript levels in liver of
C57BL/6-Tg(ACTB-EGFP)1Osb/J mice. The albumin promoter-
driven eGFP-targeting and non-targeting construct C were eval-
uated in vivo subsequent to hydrodynamic tail-vein injection. A
total of 16 mice were treated twice over a 24-h period with 20 g
of plasmid (totalof 40 g). eGFP transcript levels were measured
by real-time rtPCR and normalized using GAPDH and riboso-
mal 18s expression. eGFP expression in mice injected with the
eGFP-targeting construct was compared to eGFP expressionfrom
mice injected with the non-targeting control construct. In liver,
administration of the albumin promoter-driven eGFP-targeting
construct resulted in a 56% decrease in eGFP transcript levels.
Delivery of this construct resulted in significant eGFP suppres-
sion compared to the non-targeting shRNA negative control
(p < 0.05). A total of eight mice were injected per construct.
Error bars represent standard deviation
Acknowledgements
We would like to thank Sylvia Mehigan and Caroline Woods
who assisted with animal work. The research was supported
by Enterprise Ireland, DEBRA Ireland and the British Retinitis
Pigmentosa Society.
References
1. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC.Potent and specific genetic interference by double-stranded RNAin Caenorhabditis elegans. Nature 1998; 391: 806811.
2. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K,Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 2001; 411:494498.
3. Czauderna F, Fechtner M, Dames S. et al. Structural variationsand stabilising modifications of synthetic siRNAs in mammaliancells. Nucleic Acids Res 2003; 31: 27052716.
4. Brummelkamp TR, Bernards R, Agami R. A system for stableexpression of short interfering RNAs in mammalian cells. Science2002; 296: 550553.
5. Miyagishi M, Taira K. U6 promoter-driven siRNAs with foururidine 3 overhangs efficiently suppress targeted geneexpression in mammalian cells. Nat Biotechnol 2002; 20:497500.
6. Paul CP, Good PD, Winer I, Engelke DR. Effective expression ofsmall interfering RNA in human cells. Nat Biotechnol 2002; 20:505508.
7. Sui G, Soohoo C, Affar el B, et al. A DNA vector-based RNAi
technology to suppress gene expression in mammalian cells.Proc Natl Acad Sci U S A 2002; 99: 55155520.8. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression
of short-interfering RNAs and hairpin RNAs in mammalian cells.Proc Natl Acad Sci U S A 2002; 99: 60476052.
Figure 10. Graph of eGFP transcript levels in kidney of
C57BL/6-Tg(ACTB-EGFP)1Osb/J mice. Both the CMV and
albumin promoter-driven eGFP-targeting and non-targeting
construct C were evaluated in vivo subsequent to direct inferior
vena cava injection. A total of 32 mice were treated with40 g of plasmid. eGFP transcript levels were measured by
real-time rtPCR and normalized using GAPDH and ribosomal
18s expression. eGFP expression in mice injected with the
eGFP-targeting construct was compared to eGFP expression from
mice injected with the non-targeting control construct. In kidney,
administration of the CMV promoter-driven eGFP-targeting
construct resulted in a 46% decrease in eGFP transcript
levels. Delivery of this construct resulted in significant
eGFP suppression compared to the non-targeting shRNA
negative control (p < 0.05). In contrast, administration of the
albumin promoter-driven eGFP-targeting construct resulted in
no significant decrease in eGFP transcript levels. A total of eight
mice were injected per construct. Error bars represent standard
deviation
9. Kawasaki H, Taira K. Short hairpin type of dsRNAs that arecontrolled by tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells. Nucleic
Acids Res 2003; 31: 700707.10. Paddison PJ, Caudy AA, Hannon GJ. Stable suppression of gene
expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A2002; 99: 14431448.
11. Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated genesilencing in vitro and in vivo. Nat Biotechnol 2002; 20:10061010.
12. Jackson AL, Bartz SR, Schelter J, et al. Expression profilingreveals off-target gene regulation by RNAi. Nat Biotechnol 2003;21: 635637.
13. Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-delta deltaC(T)) method. Methods 2001; 25: 402408.
14. Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y.Green mice as a source of ubiquitous green cells. FEBS Lett1997; 407: 313319.
15. Pouton CW, Seymour LW. Key issues in non-viral gene delivery.Adv Drug Deliv Rev 2001; 46: 187203.
16. Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.Efficient delivery of siRNA for inhibition of gene expressionin postnatal mice. Nat Genet 2002; 32: 107108.
17. Wu X, Gao H, Pasupathy S, Tan PH, Ooi LL, Hui KM. Systemicadministration of naked DNA with targeting specificity tomammalian kidneys. Gene Ther 2005; 12: 477486.
18. Postic C, Shiota M, Niswender KD, et al. Dual roles forglucokinase in glucose homeostasis as determined by liverand pancreatic beta cell-specific gene knock-outs using Cre
recombinase. J Biol Chem 1999; 274: 305315.19. Tiscornia G, Singer O, Ikawa M, Verma IM. A general method forgene knockdown in mice by using lentiviral vectors expressingsmall interfering RNA. Proc Natl Acad Sci U S A 2003; 100:18441848.
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm
-
8/6/2019 Allen et al., 2007
12/12
298 D. Allen et al.
20. Fritsch L, Martinez LA, Sekhri R, et al. Conditional gene knock-down by CRE-dependent short interfering RNAs. EMBO Rep2004; 5: 178182.
21. Tiscornia G, Tergaonkar V, Galimi F, Verma IM. CRErecombinase-inducible RNA interference mediated by lentiviral
vectors. Proc Natl Acad Sci U S A 2004; 101: 73477351.22. Ventura A, Meissner A, Dillon CP, et al. Cre-lox-regulated
conditional RNA interference from transgenes. Proc Natl AcadSci U S A 2004; 101: 10380 10385.23. Coumoul X, Shukla V, Li C, Wang RH, Deng CX. Conditional
knockdown of Fgfr2 in mice using Cre-LoxP induced RNAinterference. Nucleic Acids Res 2005; 33: e102.
24. Szulc J, Wiznerowicz M, Sauvain MO, Trono D, Aebischer P. A versatile tool for conditional gene expression and knockdown.Nat Methods 2006; 3: 109116.
25. Hamdorf M, Muckenfuss H, Tschulena U, et al. An inducibleT7 RNA polymerase-dependent plasmid system. Mol Biotechnol2006; 33: 1321.
26. Dickins RA, Hemann MT Zilfou JT, et al. Probing tumor
phenotypes using stable and regulated synthetic microRNAprecursors. Nat Genet. 2005; 37(11): 12891295Oct 2.27. Zeng Y, Cai X, Cullen BR. Use of RNA polymerase II to transcribe
artificial microRNAs. Methods Enzymol 2005; 392: 371380.
Copyright 2007 John Wiley & Sons, Ltd. J Gene Med 2007; 9: 287298.
DOI: 10.1002/jgm