A STUDY OF GENETIC TRANSFORMATION SYSTEMS

FOR GROUNDNUT (ARACHIS HYPOGAEA L.) WITH THE

OBJECTIVE TO GENETICALLY ENGINEERING RESISTANCE

TO INDIAN PEANUT CLUMP VIRUS

Thesis submitted for the degree of

Doctor of Philosophy

at the University of Leicester

by

Man-Kim Cheung BSc (London)

Department of Biology

University of Leicester

November 1998

UMI Number: U115886

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed,

a note will indicate the deletion.

Dissertation Publishing

UMI U115886Published by ProQuest LLC 2013. Copyright in the Dissertation held by the Author.

Microform Edition © ProQuest LLC.All rights reserved. This work is protected against

unauthorized copying under Title 17, United States Code.

ProQuest LLC 789 East Eisenhower Parkway

P.O. Box 1346 Ann Arbor, Ml 48106-1346

for mama and baba

&

in memory of Helen Pedley

ABSTRACT

A study of genetic transformation systems for groundnut (Arachis hypogaea L.)with the objective to genetically

engineering resistance to Indian peanut clump virus

Man-Kim Cheung

Indian peanut clump virus (IPCV) causes serious yield losses in groundnut producing areas in India. The lack of natural resistance to IPCV has focused research into the development of novel sources of resistance. Coat protein-mediated resistance (CP-MR) strategy has been widely used to generate virus resistant plants. This approach was evaluated as a potential method for generating resistance to IPCV. In order to produce transgenic groundnut expressing the IPCV CP, an efficient plant regeneration system and gene transfer method were required. To establish a reliable and reproducible plant regeneration system, five previously reported groundnut tissue culture methods were evaluated with four Indian groundnut cultivars: JL24, Plover, Robert-21 and TMV-2. Groundnut regeneration could not be obtained using these five in vitro culture methods. Instead a genotype-independent method for rapidly producing fertile groundnut plants from half of a zygotic embryo with single cotyledon (HESC) explants was developed for cultivars JL24, Plover and TMV-2. A. tumefaciens- and microprojectile bombardment-mediated gene transfer techniques were evaluated for groundnut transformation. In addition, high-level plant expression vectors containing marker genes such luc, uidA-intron and sGFP were developed to detect transformation events. An in planta transformation technique was developed and evaluated using HESC explants. However, no transgenic groundnut plants were recovered. In the absence of a groundnut transformation system, the CP-MR strategy was evaluated in N. benthamiana. Transgenic plants containing the H-IPCV CP gene were found to be highly resistant to H-IPCV. Resistance levels ranged from completely susceptible CP+ plants with virus levels equivalent to H-IPCV infected CP- plants, to resistant CP+ plants where the presence of the infecting virus could not be detected. Transgenic H- IPCV CP+ plants were also shown to be highly resistant to D-IPCV, and partially resistant to L-IPCV.

Acknowledgements

I would like to thank Dave Twell, Amar Kumar and Mike Mayo for their advice, supervision and extraordinary patience. A big round of applause goes to Neil Bate for his friendship, support, humour, sarcasm, tasty recipes, drinking prowess and no nonsense advice. Many thanks also to Caroline Spurr, Jonathan Combe, Simson Leigh, Vicky Davies and Fiona Cooke for their help and pub skills.

0I gratefully acknowledge BBSRC and ODA for providing financial support for this CASE studentship.

0A big slap on the back to the Leicester University Mountaineering Club for a great time. Special mention for Jennie Alcock, Andy Ballard, Rob Downes, Fish, Rouric Fuerst, Gordon Gibbons, Paul Handley, Rachel Leverett, Ali Miller, Doug Ross, Tom Sant and Linus Whitmarsh. Thank you for the some wonderful memories.

0As for the big scary damp nasty freezing dangerous hard stuff, a wee dram of Lagavulin goes to James Steer and Chris Abrams. Cheers for not leaving me up in the Scottish mountains to freeze, for holding onto the rope when I fell and for sticking the pieces back together.

0For Diane Hird

0Once in a lifetime you meet someone who you know will be your perfect partner. You just know. In your heart and in your mind. Thank you for the warmth on cold nights, for help in writing this thesis, for the joy in my laughter, for your happy smile so pleasing to my eyes, for the Coco Chanel blossoming in my head, for cutting my hair so neat and trim, for the apple pie in my tummy, for the cats so purry, for our new home together and for your love of bright colours!!!

Contents

Abbreviations 1

Chapter 1 Introduction1.1 Groundnut (Arachis hypogaea L.) 41 .2 Diseases of groundnut 61 .3 Natural resistance 61 .4 Breeding for resistance 8

1 .5 Groundnut regeneration and transformation 111.5.1 Plant regeneration in groundnut 111.5.2 Plant genetic transformation 131.5.3 Agrobacterium tumefaciens-mediated transformation 141.5.4 Direct DN A transfer-mediated transformation 151 .6 Indian peanut clump virus (IPCV) 171 .7 Genetically engineered plants with protection

against plant viruses 211 .8 The scope of this thesis 23

Chapter 2 Materials and methods2 .1 Materials 262 .2 DNA plasmid vectors 262 .3 Virus isolates 262 .4 M ethods 262 .5 Bacterial growth and storage2.5.1 Bacterial strains and genotypes 272.5.2 Antibiotic selection 272.5.3 Culture of bacteria 282.5.4 Long term storage of bacterial strains 282.5.5 Preparation of competent E. coli cells 282.5.6 Transformation of competent E. coli with plasmid DNA 282.5.7 Preparation of competent A. tumefaciens 292.5.8 Transformation of A. tumefaciens 292 .6 Nucleic acid isolation and purification2.6.1 Small scale isolation of plasmid DNA from E. coli 292.6.2 Medium scale isolation of plasmid DNA from E. coli 302.6.3 Large scale isolation of plasmid DNA from E. coli 312.6.4 Small scale isolation of plant DNA for polymerase chain reaction

(PCR) analysis 32

i

2.6.5 Storage of plant tissue Southern, Northern and Western blotanalysis 32

2.6.6 Small scale isolation of plant DNA 332.6.7 Small scale isolation of total plant RNA 332.6.8 Purification of DNA 342.6.9 Purification of DNA fragments between 10 bp and 200 bp

size from agarose gels 342.6.10 Purification of DNA fragments between 200 bp and 15 kb in

size from agarose gels 352.6.11 Quantification of nucleic acids 352 .7 Enzymatic manipulation of DNA2.7.1 Digestion of plasmid DNA with restriction endonucleases 352.7.2 Repairing 3’ or 5’ DNA overhangs to generate blunt ends 362.7.3 Phosphorylation and annealing of synthetic oligonucleotides 362.7.4 Ligation of DNA fragments 362 .8 Amplification of DNA by polymerase chain

reaction (PCR)2.8.1 Purification of oligonucleotide primers 372.8.2 General PCR 372.8.3 Bacterial colony PCR 372 .9 Gel electrophoresis2.9.1 Agarose gels for the electrophoretic separation of DNA 3 82.9.2 Agarose gels for the electrophoretic separation of genomic DNA 382.9.3 Agarose gels for the electrophoretic separation of RNA 382 .1 0 DNA sequencing2.10.1 Preparation of double stranded DNA template for manual

sequencing 392.10.2 Manual sequencing of double stranded DNA templates 392.10.3 Preparation of the sequencing apparatus and gel 402.10.4 ABI PRISM™ Dye Terminator Cycle Sequencing 402 .11 Transfer of nucleic acids from agarose gels and

immobilisation onto nylon membranes2.11.1 Southern blotting 412.11.2 Northern blotting 422 .1 2 Nucleic acid hybridisation2.12.1 Preparation of 32P radiolabelled DNA probe 422.12.2 Purification of 32P radiolabelled DNA probe 422.12.3 Measurement of radioactive incorporation into the DNA probe 42

ii

2.12.4 Measurement of probe activity 432.12.5 Hybridisation 432 .1 3 Inoculation of N. benthamiana2.13.1 Mechanical inoculation of N. benthamiana plants 442.13.2 Collection and storage of plant material 442 .1 4 Enzyme linked immunosorbent assay (ELISA) 442.14.1 Purification of y-globulin 442.14.2 Conjugation of alkaline phosphatase to y-globulin 442.14.3 Coating microtitre plates with y-globulin 452.14.4 Adding the homogenised plant extract 452 .1 5 Western blotting2.15.1 Sample preparation 452.15.2 Protein assay 452.15.3 SDS-polyacrylamide gel electrophoresis (SDS-PAGE) 462.15.4 Western blotting 462.15.5 Immunological detection 472 .1 6 Detection of plant reporter genes2.16.1 p-Glucuronidase (GUS) fluorimetric assay 472.16.2 p-Glucuronidase (GUS) histochemical localisation 472.16.3 Luciferase (LUC) assays 472.16.4 Green fluorescent protein (GFP) detection 482 .1 7 Plant propagation and tissue culture2.17.1 Seed surface sterilisation 482.17.2 Groundnut propagation 482.17.3 Tobacco propagation 482.17.4 Shoot organogenesis from mature de-embryonated groundnut

cotyledons 492.17.5 Shoot organogenesis from mature de-embryonated groundnut

cotyledon segments 492.17.6 Shoot organogenesis from groundnut leaf discs 502.17.7 Regeneration of shoot meristems from mature groundnut

zygotic embryos 502.17.8 Somatic embryogenesis from mature groundnut zygotic

embryos 502.17.9 Plant regeneration from half of a zygotic embryo with single

cotyledon (HESC) explant 512 .1 8 Plant transformation2.18.1 Tobacco leaf disc transformation 51

iii

2.18.2 T-DNA dependent transient transformation assay for tobaccoseedlings 52

2.18.3 T-DNA dependent transient transformation assay for groundnuttissue 52

2.18.4 A. tumefaciens-mediated in planta transformation of groundnut 532 .1 9 Microprojectile bombardment2.19.1 Equalisation of plasmid DNA 532.19.2 Preparation of the micro- and macro-projectiles 542.19.3 Preparation and bombardment of plant tissues 54

Chapter 3 Groundnut tissue culture and regeneration3 .1 Introduction 573 .2 R esults3.2.1 Shoot organogenesis from mature de-embryonated cotyledons 573.2.2 Shoot organogenesis from mature de-embryonated groundnut

cotyledon segments 593.2.3 Shoot organogenesis from leaf discs 613.2.4 Regeneration of shoot meristems from mature zygotic embryos 623.2.5 Somatic embryogenesis from mature groundnut zygotic embryo

axes 643.2.6 Groundnut regeneration from one half of a zygotic embryo

with single cotyledon (HESC) explants 653 .3 D iscussion3.3.1 Plant regeneration in groundnut 673.3.2 Influence of genotype variation on plant regeneration 683.3.3 Establishing a plant regeneration system: General considerations 693.3.4 Plant regeneration via organogenesis and somatic embryogenesis:

Approaches to evaluating the influence of different auxins and cytokinins 70

3.3.5 Plant regeneration via shoot organogenesis 733.3.6 Plant regeneration via somatic embryogenesis 763.3.7 Plant regeneration via half of a zygotic embryo with single

cotyledon (HESC) explants 80

iv

Chapter 4 Development of in vitro methods of gene transferto groundnut

4 .1 Introduction 1044 .2 R esults4.2.1 Construction of high-level plant expression vectors 1054.2.2 Transient expression analysis of the high-level plant expression

vectors in tobacco and groundnut leaves 1064.2.3 Evaluation of microprojectile bombardment mediated gene

transfer into groundnut 1074.2.4 Construction of a high-level plant expression vector containing

an uidA-intron gene 1084.2.5 Analysis of pRT2 TEV GUS INT in tobacco and groundnut

leaves using transient expression assays 1094.2.6 Construction of pMKC6, a high-level plant expression binary

vector containing an uidA-intron gene 1104.2.7 Evaluation of GUS expression in A. tumefaciens 1104.2.8 Analysis of four different A. tumefaciens strains in tobacco 1114.2.9 Investigation of the susceptibility of a variety groundnut tissue

explants to infection by different A. tumefaciens strains 1124.2.10 Further analysis of A. tumefaciens-mediated transient

transformation of groundnut explants 1134.2.11 Construction of plant expression vectors containing both the

uidA-intron and H-IPCV CP genes 1154.2.12 Functional analysis of pMKCl 1 and pMKC12 in groundnut

using transient expression assays 1154.2.13 Evaluation of in planta transformation of groundnut 1164.2.14 Construction of a high-level plant expression vector containing the

sGFP gene 1174.2.15 Evaluation of sGFP expression in groundnut 1174.2.16 Construction of plants expression vectors containing both sGFP

and H-IPCV CP genes 1184.2.17 Further evaluation of sGFP expression in groundnut 1184 .3 D iscussion4.3.1 High-level plant expression vectors 119

4.3.2 Evaluation of microprojectile bombardment-mediatedtransformation 120

4.3.3 Evaluation of A. tumefaciens-m&diat&d transformation 121

4.3.4 Improving the efficiency in planta transformation 122

V

Chapter 5

5 .15 .25.2.1

5.2.25.2.3

5.2.4

5.2.55.2.6

5.2.7

5.2.8

5.2.9

5 .35.3.1

3.3.2

5.3.3

3.3.4

Chapter 6 6. 16 . 1.1

6 . 1.26.1.36.1.4 6.2 6 .2.1

Evaluation of transgenic N. benthamiana plantscontaining H-IPCV CP gene sequences for resistance to H-IPCV, D-IPCV and L-IPCV Introduction 148R esultsConstruction of the plant expression vector containing the H-IPCV CP gene 148Transformation of N. benthamiana with the H-IPCV CP gene 148Characterisation of the putative transgenic N. benthamiana CP+ lines 149Transgene and RNA analysis of transgenic N. benthamiana CP+ lines 150Evaluation of the susceptibility of N. benthamiana to H-IPCV 151Evaluation of transgenic N. benthamiana CP+ lines for resistance to H-IPCV 153Summary of the initial analysis of the transgenic N. benthamiana CP+ plants and evaluation for resistance to H-IPCV 153Evaluation of transgenic N. benthamiana CP+ plants for resistance to D, H, and L isolates of IPCV 155Analysis of the segregating transgenic N. benthamiana CP+ progeny from line AC20 156D iscussionAnalysis of transgenic N. benthamiana plants containing the H-IPCV CP gene for resistance against infection by H-IPCV 158Susceptibility of transgenic N. benthamiana plants expressing the H-IPCV CP gene to infection by D-IPCV and L-IPCV 159The effect of H-IPCV CP gene copy number, H-IPCV CP levels and transcript abundance on virus resistance 159RNA-mediated resistance 160

DiscussionRegeneration of groundnut 184Plant regeneration from Indian groundnut cultivars 184Effect of genotype on plant regeneration 186Genotypic variation among botanical varieties 188Genetic control of plant regeneration 190In vitro gene transfer into groundnut 193Development and evaluation of plant reporter constructs 193

6.2.2 An evaluation of A. tumefaciens-mediated in plantatransformation of groundnut 193

6.2.3 Cell-fate studies to identify germ line cells 1956.2.4 Microprojectile bombardment-mediated transformation 1956 .3 Evaluation of the CP-MR strategy for conferring

resistance against infection by D-IPCV, H-IPCVand L-IPCV. 196

6.3.1 Evaluation of transgenic N. benthamiana CP lines for resistanceto D-IPCV, H-IPCV and L-IPCV 196

6.3.2 Potential mechanisms of RNA-mediated resistance 1976.3.3 Alternative approaches for plant virus resistance 201

Appendix A Preparation of general solutions, reagents and culture mediums

A 1 Antibiotics 204A 2 Bacterial growth mediums 204A3 General buffers and reagents 205A 4 Solutions for plasmid preparations 206A 5 Electrophoresis buffers and reagents 206A 6 Sequencing gel mixes 207A 7 Virus detection buffers and reagents 208A 8 Plant reporter gene buffers 210A 9 Plant medium 211

Appendix B Construction of plant expression vectorsB1 Construction of pMKC3 214B 2 Construction of pMKCl and pMKC2 215B 3 Construction of pPCV3/pBSII KS+ 216B 4 Construction of pMKC9 217B 5 Construction of pMKC 19 218

References 219

vii

Chapter 1

Introduction

1.1 Groundnut (Arachis hypogaea L.)Groundnut, Arachis hypogaea L., is an important oilseed crop legume widely

cultivated in tropical and subtropical areas of the world. In 1994, an area of approximately 20 million hectares was under groundnut cultivation. This yielded a worldwide groundnut production of over 23 million metric tons (USDA, 1994 cited from Knauft and Wynne, 1995). India, China, the United States of America, Nigeria and Indonesia are the five largest groundnut producers in the world, with India and China accounting for over half of that production. Groundnut seed is an important source of protein, carbohydrate, oil and micronutrients for both humans and animals. In addition, its cultivation provides fixed nitrogen for the soil thereby enhancing soil fertility and reducing the need for artificial fertilisers. Furthermore, groundnut can be grown for animal fodder, and as ground cover which can help reduce soil erosion.

All species of Arachis, including A. hypogaea, are native to South America. The genus Arachis contains both diploid (2n) and tetraploid (4n) species. A. hypogaea is a tetraploid (4n) species which has been classified into two subspecies; A. hypogaea hypogaea and A. hypogaea fastigata. Each subspecies has been further divided into two botanical varieties; hypogaea and hirsuta (subspecies hypogaea); and fastigata and vulgaris (subspecies fastigata). Of the four varieties, hirsuta is the slowest to mature, and consequently this variety is not widely cultivated. Thus, the global production of groundnut is dominated by three botanical varieties; hypogaea, fastigata and vulgaris.

The cultivation of groundnut is influenced by many abiotic (drought, temperature, soil deficiency and toxicity) and biotic (disease, insect pests and weeds) factors. In developed countries, such as the United States and Australia, the demand is for uniform seed with high nutritional content and good flavour. Consequently, the propagation of groundnut is intensely managed, often using artificial fertilisers and pesticides to provide optimum growing conditions. In contrast, the cultivation of groundnut in poorer countries is mainly to provide food and cooking oil for the farmer. Chemical inputs are often minimised in order to reduce costs, and in general, this form of low input farming produces a lower crop yield.

Both methods of cultivation would benefit from the development of groundnut cultivars which are more tolerant to abiotic and biotic stresses would be of benefit to both methods of groundnut cultivation. For example, in high input methods of groundnut propagation, the use of a pest resistant cultivar could reduce pesticide usage without compromising seed quality. This would reduce both the costs of pesticide and the level of pesticide present in the seed and in the surrounding environment. In low input cultivation methods, crop yield could be increased without the application of costly pesticides since the modified plants would be more resistant to pests.

5

1.2 Diseases of groundnutDisease is responsible for some of the most serious problems in groundnut

production worldwide. Thus, a major goal of groundnut breeding programs has been to develop disease resistant cultivars. Groundnut is susceptible to many diseases which reduce seed quality and cause severe yield loss.

The most damaging diseases of groundnut are caused by fungal pathogens especially the foliar types such as rust (Puccinia arachidis), early leafspot (Cerospora arachidicola) and late leafspot (Cercosporidium personatum). These fungal diseases have become a worldwide problem. In India, early and late leafspot have been responsible for yield reductions of 70% (Subrahmanyam et al., 1984), while in test plots in the United States, reductions of over 80% have been reported (Knauft et al., 1988). The roots, pods and stems of groundnut plants are also susceptible to fungal pathogens, for example Aspergillus, Fusarium, Pythium, Rhizoctonia and Sclerotium species. Of these, A. flavus and A. parasiticus are the most serious. These two species of Aspergillus fungi produce aflatoxin on postharvest seed. Aflatoxin is a potent liver toxin and carcinogen, and has been with incidences of cancer in humans and other animals (reviewed in McLean, 1994). Since aflatoxin poses a serious health threat, groundnuts heavily infected with either A. flavus or A. parasiticus cannot be readily exported to countries which operate tight quality controls.

Viral diseases of groundnut are also responsible for substantial yield losses. The most economically important are those caused by; peanut mottle virus (PMV) and peanut stripe virus (PStV), both of which are endemic in the majority of groundnut producing areas of the world; peanut bud necrosis virus (PBNV) in Southeast Asia; tomato spotted wilt virus (TSWV) in the United States; Indian peanut clump virus (IPCV) in India and peanut clump virus (PCV) in Africa; groundnut rosette virus (GRV) in Africa (reviewed in Isleib et al., 1994; Todd et al., 1994).

Groundnut is also host to several very destructive nematode pests. For example Meloidogyne arenaria, which is the major nematode pest of groundnut in the United States and Tylenchorhynchus brevilineatus, prevalent in India, can cause yield reductions of upto 50% (reviewed in Knauft and Wynne, 1995).

1.3 Natural resistanceNatural resistance to some of the aforementioned diseases has been previously

identified in non-cultivated and wild species of Arachis. Unfortunately, inadequate funding has meant that the development and breeding of disease resistance in groundnut has lagged behind that of many other economically important crop species. However, in the last twenty years, significant advances in groundnut breeding and genetics have been made. Breeding for resistance has been supported by the

6

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), and by the Peanut Collaborative Research Support Program (CRSP). This has facilitated the identification of further disease resistant varieties from a number of groundnut germplasm collections. The two major germplasm collections are situated in the Southern Regional Plant Introduction Station (SRPIS) in Georgia, United States and at ICRISAT in Hyderabad, India. Approximately 8 000 accessions of A. hypogaea are present at SRPIS, and nearly 12 000 accessions, which includes both cultivated and wild species of Arachis, are kept at ICRISAT (Knauft and Wynne, 1995). Germplasm collections also exist in many groundnut producing countries including Argentina, Australia, China, Israel, Malawi, Niger, Nigeria, Senegal, South Africa, Taiwan, Thailand and Zimbabwe.

Identifying disease resistance traits in groundnut generally involves the screening of several thousand germplasm lines, including both cultivated and non­cultivated varieties and wild Arachis species, under laboratory and field conditions. Considerable effort has been given to identifying sources of resistance to rust, early and late leafspot, because of their economic importance worldwide. The most extensive research has been conducted at ICRISAT (reviewed in Wynne et al., 1991) where a screen of 12 000 A. hypogaea lines identified 153 which were resistant to rust (Subrahmanyam and McDonald, 1983 cited from Wynne et al., 1991). However, the search for resistance to early and late leafspot has been more difficult with only moderate levels of resistance found (reviewed in Wynne et al., 1991). To complicate matters, resistance to early leafspot has been shown to vary according to geographic location. For example, many lines that were previously identified as highly resistant to early leafspot at ICRISAT and in the United States have been reported to be susceptible in Malawi (Nigam, 1987 cited from Wynne et al., 1991). The failure of the early leafspot resistant lines Malawi may have been caused by a single or a combination of factors such as stability of the resistance mechanism, increased disease pressure, different early leafspot variants/isolates or different environmental and climatic conditions.

Research into groundnut virus resistance has only recently received wider international attention. An exception is GRV. Resistance to GRV was first observed in 1952 when an epidemic destroyed a large collection of germplasm in Senegal with the exception of a few germplasm lines originating from Burkina Faso and Cote d'Ivoire (Sauger and Catharinet, 1954 cited from Subrahmanyam et al., 1994). These lines were found to be resistant to both chlorotic and green rosette virus, and have since been used extensively in rosette resistance breeding programs throughout Africa. Resistance to GRV has been shown to be governed by two independent recessive genes (Nigam and Bock, 1990). In contrast, identifying effective sources of resistance

7

to other viral diseases has not been as easy. Over 7 000 germplasm lines have been evaluated at ICRISAT for resistance to the aphid transmitted TSWV (ICRISAT, 1984 cited from Wynne et al., 1991). Although the field evaluations identified many lines that exhibited some tolerance to TSWV, none were completely resistant to infection (Nigam et al., 1991 cited from Knauft and Wynne, 1995). Researchers at ICRISAT have also screened 10 000 germplasm lines in an attempt to identify resistance to IPCV. However, no resistance to IPCV has been found among the lines evaluated (Mayo et al., 1994).

Many wild Arachis species and their interspecific derivatives have also been screened for disease resistance. Several species have been found to be resistant to foliar and viral diseases (reviewed in Wynne et al., 1991). For example; A. batizocoi, A. cardenasii, A. chacoense, A. correntina, A. duranensis, A. pusilla and A. villosa, which are resistant to rust; A. appressipilia, A. cardenasii, A. chacoense, A. glabrata, A. hagenbeckii, A. paraguariensis, A. repens, A. stenosperma and A. villosulicarpa which are resistant to late leafspot; A. cardenasii, A. chacoense, A. correntina and A . pusilla, which are resistant to TSWV; and Arachis species 30003 which is of particular interest as it is resistant to both early leafspot and GRV.

1.4 Breeding for resistanceProgress has been made towards breeding groundnut cultivars with resistance

to several of the aforementioned diseases. Breeders have developed and released several GRV resistant cultivars in West and southern Africa, and are continuing to introduce rosette resistance to newer cultivars in these areas (Nigam and Block, 1990). Southern Runner, a high yielding late leafspot resistant cultivar, has been developed and released for use in the United States (Wells et al., 1994). Breeding at ICRISAT has focused on generating high yielding cultivars with resistance or tolerance to both rust and leafspot. Several high yield cultivars resistant to rust and moderately resistant to late leafspot are presently being evaluated for release in India.

Resistance mechanisms of in groundnut include; rate-reducing components such as reduced lesion size and number, increased disease incubation and latent periods, thicker groundnut shells which have been associated with resistance to P. myriotylum and Rhizoctonia pod rooting diseases (Godoy et al., 1985 cited from Wynne et al., 1991), the presence of polyphenolic compounds in the seed coat and leaves which appears to confer resistance to Aspergillus species (Turner et al., 1975; Lansden et al., 1982 cited from Wynne et al., 1991) and Puccinia arachidis (Velazhahan and Vidhyasekaran, 1994), and physical barriers to pathogen toxins such as waxy layers on stems and thick walled cortical cells (reviewed in Wynne et al., 1991).

8

Breeding for disease resistance is more difficult than breeding for morphological or agronomic traits. Crop yield and seed quality of the new hybrid cultivars must not be affected by the introduction of disease resistance (Wynne et al.,1991). This requirement is further complicated by the fact that the level of resistance exhibited is dependent on both the host and the disease. For example, plant age and health (Flowerdew, 1993; Buiel and Parlevliet, 1996), pathogen virulence and strain variability (Rao et al., 1993), and more general environmental conditions such as temperature and rainfall (Davis et al., 1993; Butler et al., 1994; Waliyar et al., 1994) can all affect the degree of resistance shown. Healthy plants should normally be able to endure minor infections without substantial impairment to growth or yield. However, the health of the plant is often related to its age. Due to their size, young developing plants are often less tolerant of diseases when compared with more mature plants. Whereas older plants tend to become less vigourous during senescence, and are consequently more susceptible to disease.

Groundnut is normally highly self pollinated, and the breeding methods employed for cultivar development are typical of those for other self pollinating crops. The initial step in a breeding program is the selection of parental lines most capable of producing progeny with the desired traits. Techniques such as mass selection, diallel analysis and test crosses are routinely used to identify appropriate parents. Following hybridisation between the parental lines, the progeny can be screened for the desired agronomic and resistance traits using pedigree, bulk, or back-cross methods (reviewed in Knauft and Wynne, 1995). Unfortunately, there are a number problems associated with breeding for disease resistance in groundnut.

Firstly, many of the effective disease resistance traits are from wild Arachis species. Differences in ploidy level and sexual incompatibility with cultivated A. hypogaea restrict the use of the wild Arachis species. Even when hybrid plants are recovered, differences in the number or compatibility of parental chromosomes may cause sterility. Nevertheless, some wild Arachis species such as A. chacoense, A. cardenasii and A. stenosperma are cross compatible and have been used in the breeding of disease resistant cultivars (reviewed in Wynne et al., 1991). A. cardenasii, a diploid Arachis species with late leafspot resistance, has been used to produce several breeding lines with higher levels of resistance to late leafspot compared to the susceptible parental lines (ICRISAT, 1985 cited from Wynne et a l, 1991).

Secondly, wild Arachis species or unadapted cultivars often have poor yields and irregular seed characteristics. Although crosses between highly adapted cultivars with unadapted cultivars have produced disease resistance lines, these hybrids often retain one or more undesirable feature from the unadapted parent such as low yield or late seed maturation. Furthermore, attempts to improve crop yield and seed uniformity

9

can often result in weakening the disease resistance. This reduction in the efficacy of disease resistance has been previously reported for southern stem rot and Pythium pod rot resistance; progeny derived from crosses between breeding lines and disease resistant lines were of lower quality and less resistant with respect to the both parental lines (Smith et al., 1989 cited from Wynne et al., 1991).

Thirdly, the development of disease resistant cultivars has been hindered by the lack of major resistance genes in groundnut. Many of the natural disease resistant traits such as those against GRV, A. flavus , rust, early and late leafspot are controlled by recessive polygenes which frequently have additive effects (Anderson et al., 1991; Olorunju et al., 1992; Knauft and Wynne, 1995). Consequently, effective disease resistance is largely dependent upon the expression of several minor genes. The complex inheritance and quantitative nature of some of these resistance mechanisms may make it difficult to accumulate enough polygenes to ensure high levels of resistance to one or more disease without compromising the resistance to one disease as selection occurs for another disease.

Although traditional plant breeding methods have been used successfully to generate disease resistant cultivars, the techniques are often both labour intensive and time consuming. The use of wild species to produce interspecific hybrids can result in the transfer many undesirable traits that are difficult to remove whilst still maintaining the desired trait. Even if the desired gene is successfully separated from the linked deleterious genes, its expression and inheritance may be unpredictable in the hybrid background. The advent of in vitro tissue culture such as meristem culture and embryo culture, DNA recombinant technology and genetic plant transformation could greatly assist progress towards increasing both the quality and productivity of groundnut. For example, meristem culture has been used successfully to generate virus-free plants including cassava (Adejare and Coutts, 1981 cited from Matthews, 1991), sweet potato (Frison and Ng, 1981 cited from Matthews, 1991) and various aroids (Zettler and Hartman, 1987 cited from Matthews, 1991). The advantage of meristem cultures is that in a large number of plant species, virus particles are absent from the apical dome. The failure of the virus to infect this meristematic region maybe due to with the competition between the rate of plant cell division and the rate of the virus multiplication and transmission (reviewed in Matthews, 1991). It may also be attributable to the lack of vascular tissues in the meristem which may hinder virus movement into apical dome (Quak, 1977). Another approach would be to use meristem culture in combination with virus elimination methods such as heat treatment (Quak, 1977) or anti-viral chemicals (e.g. Virazole and 2-4 dioxohexahydro-1, 3, 5- triazine) (Kartha, 1986; Long and Cassells, 1986) to obtain virus-free plants.

10

Embryo culture is a technique used in the recovery of plants from seeds which under normal circumstances would not be viable. A mature seed can either be non- endospermous when the embryo utilises the entire endosperm during seed development, or endospermous when the endosperm persists until seed germination whereupon it is utilised as a source of energy and nutrition. Failure of endosperm development causes abortion of the embryo and as a consequence leads to sterility (Johnston et al., 1980). This inability to produce the nutritive endosperm necessary for proper embryo development is one of the main reasons for the low hybridisation frequencies between wild Arachis species and A. hypogaea. Embryo culture of hybrid embryos could be used to overcome some of the limitations associated with interspecific hybridisations (reviewed in Bajaj, 1984).

DNA recombinant technology could be used to exploit novel sources of resistance genes. Screening for dominant plant resistance (R) genes such as the tomato Pto gene, which confers resistance to Pseudomonas syringae pv. tomato (Martin et al., 1994), the tobacco N gene, which confers resistance against tobacco mosaic virus (TMV) (Whitham et al., 1994; Whitham et al., 1996), the rice Xa21 gene, which confers resistance to Xanthomonas campestris pv. vesicatoria (Song, et al., 1995) and the Arabidopsis thaliana RPS2 , which confers resistance against Pseudomonas syringae pv. tomato (Bent et al., 1994; reviewed in Gebhardt, 1997; reviewed in de Wit, 1997), may simplify breeding groundnut with multiple disease resistance. Genes containing motifs characteristic of the serine-threonine protein kinase,A, Xa21 and RPS2 have been recently found in soybean (Yu et al., 1996). Some of these have been mapped close to soybean genes which confer resistance to soybean mosaic virus, peanut mottle virus and Phytophthora root rot. Since soybean belongs to the same taxonomic family as groundnut, it raises the possibility of finding similar resistance genes in groundnut.

1.5 Groundnut regeneration and transformationThe two main prerequisites for genetic transformation are an efficient method

of regenerating fertile plants from transformed cells, tissues or organs, and a method of stably introducing foreign genetic material into the plant genome.

1.5.1 Plant regeneration in groundnutEstablishing an efficient plant regeneration system is critical to the successful

transformation of specific crop species. The potential of recombinant DNA and gene transfer methodologies to genetically modifying plants has stimulated the rapid development of numerous plant tissue culture systems for a diverse range of plant species including both monocotyledonous and dicotyledonous species, and herbaceous

11

and woody species (reviewed in Sharp et al., 1984). Plant tissue culture techniques such as meristem culture, somaclonal propagation, protoplast fusion, anther culture, somatic embryogenesis and organogenesis, are being routinely employed to introduce and develop new breeding lines and varieties in both ornamental and commercial crop species.

Plants can be regenerated from both differentiated tissues such as anther, leaf, meristem and zygotic embryo sections, and undifferentiated tissues including callus and liquid cell suspension cultures. However, it is recognised that there are many environmental and genetic factors affect the response of cells and tissues in culture. Environmental factors include night and day length, night and day temperatures, macro- and micro-nutrients present in the culture medium, hormone type and concentration, and the ratios between different hormones, while genetic factors control cell-, tissue- and organ-specific characteristics such as biochemistry, morphology and physiology (reviewed in Evans et al., 1983). The complex interactions of these various factors can vary markedly between different plant species, between cultivars or genotypes within the same species, and even between individual plants from same cultivar or genotype (reviewed in Evans et al., 1983 and Sharp et al., 1984). Consequently, there are only a limited number of tissue culture techniques which can be easily applied to a wide range of plant species (e.g. shoot tip propagation and haploid culture). More commonly specific tissue culture conditions have to be developed and optimised for the species of interest.

Groundnut callus cultures were initially developed for physiological and morphological studies, and were often recalcitrant to plant regeneration (reviewed in Bajaj, 1984). Regeneration of groundnut plants was first reported from de- embryonated cotyledon sections (Illingworth et al., 1968 cited from McKently et al.,1990). Subsequently, groundnut plants have been regenerated using mature and immature embryo axes (Atreya et al., 1984; Hazra et al., 1989; McKently et al., 1990; Sellars et al., 1990), leaves (Chengalrayan et al., 1994; Eapen and George, 1993a) and cotyledons (Atreya et al., 1984; McKently et al., 1990; Durham and Parrott,1992), either by somatic embryogenesis, shoot organogenesis or by direct development. Although a number of plant regeneration systems have been developed, the efficiency and reliability of these procedures are often highly cell-, tissue-, organ- and genotype/cultivar-dependent (Seitz et al., 1987; McKently et al., 1992; McKently et al., 1995).

Plant regeneration via organogenesis or somatic embryogenesis generally requires the application of hormones. Two most commonly used classes of hormones are the auxins and cytokinins. The activity of auxins stimulates cell division in cultured tissues, whereas cytokinins induce cell differentiation and organogenesis. Auxins

12

including 2,4-dichlorophenoxy-acetic acid (2,4-D), 3,6-dichloro-O-anisic acid (dicamba), indole-3-acetic acid (IAA), 3-indolepropionic acid (IPA), a - naphthaleneacetic acid (NAA), and 4-amino-3,5,6-trichloropicolinic acid (picloram) have been used to regenerate groundnut via somatic embryogenesis (Eapen and George, 1993b; Ozias-Akins et al., 1993; Chengalrayan et al., 1994). When used in conjunction with an auxin, cytokinins promote callus production and shoot organogenesis. Shoot organogenesis in a variety of plants has been induced by cytokinins such as benzyladenine (BA), kinetin (KIN), 6-y-y- dimethylallylaminopurine (2iP) and zeatin (McCormick et al., 1986; Ooms et al., 1987; Freytag et al., 1988). BA has been used to regenerate groundnuts via shoot organogenesis from both leaf and seed explants (McKently et al., 1990; McKently et a l, 1991a).

The frequency of plant regeneration is often dependent upon the type of explants cultured. Variations in shoot organogenesis has been observed in a variety of groundnut seedling (Matand et al., 1994) and seed (Atreya et al., 1984; McKently et a l, 1991a) explants. Hypocotyl and cotyledon explants from eight-day old seedlings are more responsive to shoot organogenesis, and produce a higher number of shoots per explant compared to similarly cultured leaf lamina, whole leaf, leaf without petiole, petiole and intemode explants (Matand et a l, 1994). Similarly, varying frequencies of shoot organogenesis and mean number of shoots per responding explant have been observed in different cotyledon explants derived from ungerminated seed (McKently et al., 1991a).

1.5.2 Plant genetic transformationThe development of in vitro genetic transformation has allowed the

introduction of desirable traits into economically important crop plants (reviewed in Gasser and Fraley, 1989; Christou, 1995). Genetic transformation enables the stable transfer of genetic material from a wide variety of sources; plant, animal, bacterial and viral, which would not be possible using conventional breeding techniques. In addition, the timing, tissue specificity and expression level of the transferred genes can be regulated by using use of modified DNA sequences such as the promoters of nopaline synthase (Depicker et al., 1982), cauliflower mosaic virus (CaMV) (Gardner et al., 1981) and rubisco genes (Moses and Chua, 1988), and viral 5'-untranslated regions (5'-UTR) of alfalfa mosaic virus (A1MV) (Jobling and Gerkhe, 1987) and tobacco mosaic virus (TMV) (Gallie et al., 1987).

The genetic transformation of groundnut has been achieved with Agrobacterium tumefaciens (Eapen and George, 1994; McKently et al., 1995; Cheng et al., 1996) and particle bombardment (Ozias-Akins et a l, 1993; Brar et al., 1994).

13

1.5.3 Agrobacterium tum efaciens-mediated transformationAgrobacterium tumefaciens-mediated plant transformation is one of the most

efficient methods for stably incorporating foreign genetic material into plants (Hooykaas and Schilperoort, 1992; Hiei et al., 1994). This technology has been used successfully to develop transgenic groundnut (Eapen and George, 1994; McKently et al., 1995; Cheng et al., 1996) and other transgenic seed legumes such as soybean (Hinchee et al., 1988) and pea (Puonti-Kaerlas et al., 1990).

A. tumefaciens is a natural plant pathogen responsible for crown gall disease. A. tumefaciens-bas&d transformation systems exploit the natural ability of the bacteria to transfer and integrate DNA into plant chromosomes (reviewed in Zambryski, 1992). Oncogenic A. tumefaciens strains possess a large circular plasmid known as the tumour-inducing (Ti) plasmid. This plasmid contains two sets of genetic elements necessary to facilitate gene transfer to plants; the virulence (vi'r) genes, and the transfer DNA (T-DNA) region. The vir genes encode factors that function in trans to bring about the transfer and stable integration of the T-DNA region into the plant genome. The T-DNA region in oncogenic A. tumefaciens strains generally contain 8-13 genes, including those required for opine production and tumour-induction. The tumour- inducing genes are necessary for tumour-induction and cell proliferation in the transformed plant cells. Highly conserved 25 bp direct repeat sequences border the T-DNA region, and are responsible for defining the region of DNA to be transferred into the plant (reviewed in Zambryski, 1992).

Early experiments demonstrated that heterologous DNA incorporated into the T-DNA could be transferred to the plant along with the existing T-DNA genes (Barton et al., 1983). Subsequent deletion of the tumour-inducing genes from the T-DNA to generate disarmed Ti plasmids did not affect the transfer and integration of the T-DNA to plants. The disarmed Ti plasmids were no longer oncogenic. Foreign DNA could be inserted into the T-DNA region of the Ti plasmid by homologous recombination using an intermediate vector system (Zambryski, 1989).

This technology was dramatically improved by the development of binary vectors. Binary vectors are considerably smaller than Ti plasmids, and only contain the cis acting elements (the T-DNA borders) required for efficient DNA transfer (Hoekema et al., 1983).. The other functions necessary for T-DNA processing, transfer and integration, are encoded by the disarmed Ti plasmid and by the A. tumefaciens chromosome. Binary vectors also contain convenient multiple cloning sites for the introduction of foreign DNA between the T-DNA borders, and a selectable marker for the screening and recovery of transformants (Bevan, 1984).

A. tumefaciens-mediated transformation has been used successfully to produce many stably transformed crop plants including cotton (Umbeck et al., 1987), oilseed

14

rape (Pua et a l., 1987), potato (Ooms et al., 1987), tobacco (Horsch et al., 1985), tomato (McCormick et al., 1986). However, despite its efficacy with many dicotyledonous crop plants, not all economically important crop plants are susceptible to A. tumefaciens-mediaied transformation. Monocotyledonous crops, and cereals in particular such as maize, rice sorghum, and wheat are relatively recalcitrant to infection by A. tumefaciens. The inability of A. tumefaciens to transform many monocotyledons may be due to either poor induction of the A. tumefaciens vir genes or inefficient DNA transfer from the bacterium to the plant (Hohn et al., 1989; Binns, 1990). The induction of the vir genes are strongly dependent upon environmental factors such as pH, sugars and phenolic compounds (Stachel et al., 1986). Optimal vir gene induction occurs at acidic pH and in the presence of phenolic compounds (Stachel and Zambryski, 1986).

Groundnut, a dicot, has previously shown to be susceptible to infection by A. tumefaciens (Lacorte et al., 1991), but as with other legumes (Kumar and Davey,1991), transformation is dependent upon the compatibility of the A. tumefaciens strain and the cultivar genotype and tissue-type. Thus, A. tumefaciens host specificity limits its use to specific groundnut genotypes and tissue-types.

1.5.4 Direct DNA transfer-mediated transformationDirect DNA transfer methods can overcome some of the problems associated

with A. tumefaciens-mediated transformation. The direct DNA transfer approaches encompass a wide array of different techniques, and can be grouped into three main categories: chemical, electrical, and physical.

Using protoplasts as target cells, chemical and electrical mediated gene transfer methods have been successfully used to produce fertile transgenic maize (Omirulleh et al., 1993) and rice (Shimamoto etal., 1988). Depending upon the species and culture conditions, the protoplasts regenerate a cell wall, dedifferentiate, divide mitotically, differentiate into shoots, roots or embryos to produce a fertile plant. Unfortunately, the use of protoplast cultures has been limited since most crops including groundnut have not been successfully regenerated from protoplasts. This regeneration problem of may be due to the type of protoplast cultures used. Protoplast cultures are frequently derived from long-term embryogenic cell suspension cultures which are initiated from embryogenic callus cultures. The age of the suspension cultures and the prolonged period of tissue culture appears to dramatically decrease efficiency of recovering normal fertile plants. In cereals, many morphological and reproductive abnormalities have been observed in plants regenerated from protoplast culture (Liihrs and Lorz, 1988; Potrykus, 1989; Shillito et al., 1989).

15

Direct DNA transfer can also be achieved using physical methods such as macro- and micro-injection, seed soaking, and microprojectile bombardment. Of these, microprojectile bombardment has been shown be a very reliable and effective method for producing transgenic crops including many previously recalcitrant cereals such as rice (Christou et al., 1991), wheat (Vasil et a l., 1992), maize (Fromm et al., 1990; Gordon-Kamm et al., 1990), and legume species such as soybean (Christou et al., 1990) and alfalfa (Pereira and Erickson, 1995). Groundnut has also been successfully transformed using this technique (Ozias-Akins et al., 1993; Brar et al., 1994).

In microprojectile or particle bombardment methods of transformation, nucleic acids are delivered into living cells using high velocity microprojectiles (Klein et al., 1987). DNA or RNA is precipitated onto the surface of small metal particles, often gold or tungsten, of approximately 1 p,m in diameter. Using either an explosive charge (Sanford, et al, 1987), high pressure gas (Sanford, et al., 1991), or electric discharge McCabe and Christou, 1993), the particles are accelerated, under vacuum, to several hundred metres per second. At these high velocities, the particles are able to penetrate the cell wall and plasma membrane, thus enabling the nucleic acids to be directly delivered into the cytoplasm or nucleus where they may stably integrate into genome.

This technique is physical in nature, it circumvents the problem of tissue-type and host specificity often associated with A. tumefaciens-mediated transformation, thereby allowing DNA to be introduced into a much wider range of plant species, cell-, tissue- and organ-types. Although microprojectile bombardment systems can deliver DNA into a broad range of tissue-types, it does not necessarily follow that this will yield stably transformed plants. As with A. tumefaciens-mtdiated transformation, it is imperative to determine the appropriate cell- or tissue-types competent for both transformation and regeneration. The type of explants frequently used for generating transgenic plants via microprojectile bombardment include; embryogenic callus which has been used to produce transgenic groundnut (Ozias-Akins et al., 1993), oat (Somers et al., 1992), spruce (Ellis et al., 1993) and wheat (Vasil et al., 1992); immature embryos which have been used produce transgenic barley (Wan and Lemaux, 1994), maize (Koziel et al., 1993), rice (Christou et al., 1991) and wheat (Weeks et al., 1993); meristems which have been used to produce transgenic common bean (Russel et al., 1993), cotton (McCabe and Martinell, 1993) and soybean (Christou et al., 1990); and suspension cultures which have been used to produce transgenic tobacco (Tomes et al., 1990) and wheat (Gordon-Kamm et al., 1990).

Other important parameters which need to be taken into consideration include the targeting of specific cell layers, predicting the impact area and the after affects of the 'blast' and particles upon the regenerative potential of the explants (reviewed in Christou, 1995). The penetration of particles into different cell layers can be regulated

16

by changing the size and mass of the particles, stopping plate distances, vacuum conditions and in some microprojectile devices the strength of the particle accelerant can also be varied. The effectiveness of particle delivery can then be assessed using histological examination of the bombarded cells or tissues. The physical trauma caused by the gas blast and acoustic shock generated by the device, particle injury and toxicity can all adversely affect the transformation efficiency (Russell et al., 1992). The use of baffles and meshes, which may attenuate the shock of the blast, have been reported to reduce cell death and increase the recovery of transformants from tobacco cell suspension cultures (Russell et al., 1992). Osmotic pretreatment of the target tissues can also be used to partially offset the damage resulting from particles piercing the plant cell wall and rupturing the plasma membrane (Vain et al., 1993). Further improvements in transformation efficiency can be achieved by using other types of metal particles. For example, replacing tungsten with non-toxic gold has been shown to increase plant transformation efficiency (Russell et al., 1992).

The development of different microprojectile bombardment-mediated transformation systems combined with better pre- and post-bombardment tissue culture conditions, has facilitated the production of many transgenic crop plants recalcitrant to A. tumefaciens-mediated transformation strategies (reviewed in Christou, 1995).

1.6 Indian peanut clump virusIndian peanut clump virus (IPCV) is responsible for severe yield losses in the

groundnut producing areas of Andhra Pradesh and the Punjab State in India. IPCV infection can be detected as early as 2-3 weeks after germination (Reddy et al., 1983). Initially, characteristic symptoms of IPCV infected plants include stunting and mosaic mottling with chlorotic rings on new quadrifoliate leaves. Later, as infected plants mature, they become bushy and more severely stunted, and the leaves turn dark green. Although infected plants are capable of flowering, the pegs (immature pods) do not develop normal sized pods. Even if infection occurs late during plant development, the seed fail to mature properly (Reddy et al., 1983).

As with other types of viral diseases the symptoms of IPCV infection are caused by virus replication in the plant host cell. This process alters the host cell metabolism and results in biochemical and physiological changes (Walkey, 1991). The mosaic mottling and chlorotic rings are due to the loss or reduced production of chlorophyll. This decrease in chlorophyll production may be associated with the breakdown of chloroplasts. Reduction in plant size is also a frequent symptom of plant virus infection (Matthews, 1991). Stunting can affect all parts of the plant though the severity may vary between different plant organs and structures. Decreased seed size and abundance are also common symptoms of virus infection. Yield reduction is often

17

associated with stunted plants. The effects on growth may be attributed to four possible virus induced metabolic changes; competition for host factors, changes in growth hormones, reduction in the availability of fixed carbon, and a reduction in uptake of nutrients (Matthews, 1991). To date, the precise mechanism by which IPCV induces disease symptoms in groundnut has not been elucidated.

The first reported occurrence of IPCV was in the Punjab State in 1977, where a then unknown disease resulted in severe stunting of groundnut plants. The disease manifest itself only in crops grown in sandy and sandy loam soils. This is of particular importance to Andhra Pradesh, Gujurat, Punjab State and Rajasthan States in India because their groundnut crops are cultivated in sandy soils. The symptoms of this infection resembled a previously observed clump disease of groundnut in W. Africa reported in 1931 which was subsequently shown to be caused by a virus, peanut clump virus (PCV) (Thouvenal et al., 1974 cited from Reddy et al., 1983). Although the Indian isolate displayed similar symptomatology, particle size, genome organisation and transmission route to PCV, the two viruses are not serologically related. Hence, the new virus was named Indian peanut clump virus (IPCV) (Reddy et al., 1983; Nolt et al., 1988). There are three distinct serotypes of IPCV, and these are typified by the Hyderabad (H) isolate from Andhra Pradesh, the Ludhiana (L) isolate from Punjab, and the Talod (T) isolate from Rajasthan (Nolt et al., 1988).

IPCV is a furovirus. The furoviruses are defined as a taxonomic group of fungal transmitted, rod shaped, single stranded RNA viruses with divided, typically bi-partite, genomes. Members include PCV, beet necrotic yellow vein virus (BNYVV), potato mop top virus (PMTV), soil-borne wheat mosaic virus (SBWMV) and rice stripe necrosis virus (RSNV). IPCV can be transmitted either through the seeds of infected plants, or by the soil-borne fungus Polymyxa graminis, a member of the Plasmodiophoromycetes. The phylum Plasmodiophoromycota a lesser known group within the fungal kingdom, and its members are usually necrotrophic endoparasites of vascular plants and stramenopiles (Alexopoulos et al., 1996). Plasmodiophoromycetes have parasitised a diverse range of plant species including both aquatic plants and land plants. However, only a few fungal species are of significant importance: Plasmodiophora brassicae which is responsible for clubroot or finger- and toe-disease of cabbage and related crucifers, and Spongospora subterranae which is a causal agent of powdery scab of potatoes. Other members of the group have been found to act as vectors for various viruses. Of these Polymyxa betae and P. graminis are two of the most important. P. betae is the vector for another furovirus BNYVV. BN Y W causes rhizomania, one of the more devastating of all sugar beet diseases (Rush and Heidel, 1995).

18

P. graminis has been found in the roots of various IPCV-infected plants which suggests that the fungus transmits IPCV via the roots of groundnut plant (Reddy et al., 1988 cited from Maraite et al., 1994). However, precise mechanism by which the fungus acquires and transmits IPCV remains unclear. P. graminis has also been reportedly associated with the transmission of eleven other rod-shaped or filamentous viruses (Maraite, 1991 cited from Maraite et al., 1994). Indeed, this fungal pathogen has a broad host range, including both monocotyledonous and dicotyledonous weed and crop species (Delfosse et al., 1996).

The IPCV genome consists of two distinct positive-sense RNA species, RNA- 1 and RNA-2, which are separately encapsidated into rod shaped particles of 240 nm and 184 nm, respectively (Reddy et al., 1983). RNA-1 from the H isolate has been sequenced and is 5 841 bp in length (Miller et al., 1996). RNA-1 contains three open reading frames (ORF) and these encode for polypeptides with molecular weights (MW) of 129 687 (pl30), 60 188 (p60) and 14 281 (pl4). ORF1 encodes for pl30, a protein containing motifs characteristic of methyl transferase and helicase like activity (Miller et al., 1996). Suppression of the termination codon of ORF1 leads to the production of a translational fusion product of MW 189 975 (p i90) from ORF1 and ORF2. p i90 possesses sequences characteristic of RNA dependent RNA polymerases and may represent the IPCV RNA replicase (Miller et al., 1996). Due to the absence of distinguishing motifs in p i4, the function of this protein remains unresolved (Miller et al., 1996).

RNA-2 from the H isolate has been partially sequenced. The coat protein (CP) gene has been determined and is located on the 5' ORF of RNA-2. The CP gene encodes a polypeptide of MW 23 017 (Wesley et al., 1994). The complete nucleotide sequence of RNA-2 has been obtained from the L isolate (Naidu et al., 1996). RNA-2 is approximately 4 200 bp in length and contains five ORFs. The ORFs are organised in a similar arrangement to those on the RNA-2 of PCV (Naidu et al., 1996). The L isolate CP gene is also encoded by the 5' ORF. The adjacent ORF encodes a polypeptide of MW of 39 000 of unknown function. At the 3' end of RNA-2, there are three overlapping genes which form a triple gene block (TGB). The TGB has been found to be associated with cell to cell movement, and this arrangement has been reported among other furoviruses (Naidu et al., 1996).

IPCV can persist in the soil for several years by residing in the zoospores of P. graminis. The screening of 10 000 groundnut germplasm lines at ICRISAT has failed to identify resistance to IPCV. As a consequence, the development of cultivated groundnut with resistance to IPCV using conventional plant breeding techniques has been limited. In an attempt to reduce the incidence of IPCV infection, several control measures have been tried. These aim to remove the sources of infection in or near the

19

crop. For example, removal of the fungal vector from the soil using different methods of soil management such as soil solarisation and copper sulphate treatment have proven ineffective in eradicating P. graminis.

Another reservoir of infection is living hosts such as perennial weeds, unrelated crops, and remains from a previous crop. The presence of weed species pose a real risk, since P. graminis has a broad host range which include many weed species (Delfosse et al., 1996). Roguing (removal of unwanted plants or weeds) and the use of herbicides can act to reduce the weed populations. For these approaches to be effective, the crop needs to be regularly rogued and/or sprayed with herbicide throughout the growing season because even a late infection of mature groundnut plants by IPCV can cause a serious decrease in yield. Unfortunately, roguing is both time consuming and very labour intensive, and the cost of herbicides and their prolonged use over the growing season limit their uses by many farmers. In addition, the application of herbicides may cause damage to the crop and the surrounding environment.

The use of virus-free seeds could provide an effective means for controlling the spread of disease. For example, in the five years immediately following the introduction of a virus-free seed program for the cultivation of lettuce in the Salinas Valley area of California, yields increased from 140 cartons/hectare to 190 cartons/hectare. Most of the increase was attributed to the reduction of losses caused by the lettuce mosaic virus (Kimble et al., 1975 cited from Matthews, 1991). Producing virus-free vegetative stock may also provide a means for producing a virus- free crop. Virus eradication can be achieved through heat treatment, meristem culture, tissue culture and chemotherapy. Heat treatment has been an effective method eliminating viruses from plant material (Matthews, 1991). The method probably works on direct heat inactivation of the virus. The temperature and duration of treatments can vary widely depending upon the type of virus and the plant material. But in general temperatures of 35-40°C over a period of several weeks are used. As previously discussed, meristem culture and tissue culture systems can be used to generate virus- free plants from virus-free plaint cells and organs. Chemotherapy or use of anti-viral chemicals has not been widely used in the production of virus-free plant material. Many of the anti-viral chemicals such as Virazole and 2-4 dioxohexahydro-1, 3, 5- triazine are synthetic analogs of the purine and pyrimidine bases found in nucleic acids. These chemicals are capable blocking virus replication in infected tissues. Although many anti-viral chemicals can suppress virus symptoms or multiplication, few, if any, eradicate virus (reviewed in Tomlinson, 1982). In addition, the cost and phytotoxicity of many anti-viral chemicals make them unsuitable for crops. However, their use in

2 0

conjunction with tissue culture or meristem culture may prove effective in eliminating certain viruses (Borissenko et al., 1985; Bittner et al., 1987).

Although the use of virus-free plant material have been used successfully to control many virus diseases (reviewed in Matthews, 1991), their uses in the cultivation of groundnut have been limited due to the persistence of IPCV in previously infected soil. The cultivation of virus-free material in IPCV infected soil would soon result in the virus-free material being infected with EPCV.

1.7 Genetically engineered plants with protection against plant viruses

The lack of natural resistance to IPCV has focused research into development of novel sources of resistance. Cross protection has been employed by horticulturists for many years to reduce yield losses for example in tomatoes and potatoes from tomato mosaic virus (ToMV) (Broadbent et al., 1976) and potato spindle toberviroid (Femow et al, 1967), respectively. This practice involves inoculating the susceptible plants with mild strains of virus or viroid in order to prevent more virulent viruses from infecting the plant and causing damage. Several mechanisms have been proposed to account for the protection, these include; competition between the protective and virulent viruses for host factors; RNA interactions involving the RNA molecules from both viruses; and disruption of the uncoating or coating process of virulent virus by CP of the protecting strain (reviewed in Sequeira, 1984). Unfortunately, there are a number of potential risks associated with cross protection; mild strains could undergo mutation producing more virulent strain; interactions between the mild and an unrelated benign virus could result in a disease condition worse than that caused by either virus alone; protective strains may themselves cause small but significant loss in yield.

Sanford and Johnson, (1985) proposed a novel method of engineering pathogen resistant plants by expressing a component derived from the pathogen itself. The method was initially termed parasite derived resistance, then later revised to pathogen derived resistance (PDR) (reviewed in Lomonossoff, 1995). The concept was to express a component of the pathogen at an inappropriate time, or in an inappropriate amount or form to affect the normal life cycle of the infecting pathogen thereby impairing viral replication. The first example of the PDR approach for generating disease resistance was reported in transgenic tobacco plants expressing the tobacco mosaic virus (TMV) CP gene (Powell Abel et al., 1986). In this study, progeny from transgenic plants expressing TMV CP were inoculated with TMV. Transgenic progeny that expressed CP were found to lack symptoms or exhibited a delay in symptom development compared with similarly inoculated control plants. This form of resistance has been referred to as CP-mediated resistance (CP-MR) or

2 1

protection (CP-MP) since resistance was attributed to the expression of the virus CP gene in transgenic plants.

The successful application of the CP-MR approach against TMV stimulated an enormous amount of research into other plant host/virus combinations (reviewed in Fitchen and Beachy, 1993; Gonsalves and Slightom, 1993). The most extensive investigation CP-MR strategy has been conducted with tobacco and TMV. Using the tobacco/TMV system, several reports have suggested that the CP is primarily involved in the inhibition of virion disassembly, although there is some evidence that cell to cell movement is also affected (reviewed in Reimann-Philipp and Beachy, 1993). However, the precise mechanisms by which the CP interferes with virus disassembly and the subsequent infection steps have yet to be fully resolved. Tobacco plants transgenic for the TMV CP have also been reported to confer resistance to other related viruses (Anderson et al., 1989; Nejidat and Beachy, 1990). The extent to which the transgenic plants were able to resist infection appeared to be positively correlated to the degree of amino acid homology between CP of challenge virus and TMV. Thus, the CP-MR strategy has the advantage of providing protection not just against the virus from which the CP was derived but also against closely related viruses.

Other components of virus have also been utilised to produce virus resistant plants. These include, among others, viral replicases (Golemboski et al., 1990; Carr et al., 1992) and movement proteins (Lapidot et al., 1993; Cooper et al., 1995). Expression of viral replicase has been found to confer resistance to variety of plant viruses (reviewed in Carr and Zaitlin, 1993). Several mechanisms have been proposed to account for replicase-mediated resistance. Defective replicase proteins may act by blocking specific replicase recognition sites on the viral RNA, thereby preventing viral translation and the accumulation of virus encoded products, or by competing for host factors necessary for viral replication.

Transgenic plants expressing defective viral movement protein (MP) have been reported to confer broad-range resistance to infection by several unrelated viruses (Cooper et al., 1995; Tacke et al., 1996). Normally, plasmodesmata are too small to allow the passive migration of virus particles. It has therefore been suggested that viral MP has the ability to modify the plasmodesmata to facilitate the cell to cell movement of the virus. Several studies have reported that by expressing defective MP, the cell to cell movement of the inoculated virus can be disrupted, thus preventing the systemic infection of the host (Cooper et al., 1995; Tacke et al., 1996). This form of protection has been termed MP-mediated resistance (MP-MR). The mechanism of resistance is not fully understood. One possible explanation for resistance may be the result of the localisation of defective MP to the plasmodesmata which could interfere with cell to cell movement of the infecting virus by binding to specific MP recognition sites in the

2 2

plasmodesmata, and as a consequence, inhibit the accumulation of the viral MP and so prevent the movement of the infecting virus between adjacent cells (Lapidot et al.,1993).

Recent reports have shown that the expression of viral protein itself is not always necessary to mediate resistance (reviewed in Lomonossoff, 1995). Earlier studies with the CP of potato leafroll virus (PLRV) and potato virus Y (PVY) revealed a lack of correlation between the level of CP and the degree of resistance (Kawchuk et al., 1990; Lawson et al., 1990). Further research with PLRV, indicated that some of most resistant transgenic lines did not exhibit detectable levels of CP (Kawchuk et al, 1991). Subsequently, investigations with transgenic tobacco plants which expressed untranslatable forms of TEV CP indicated resistance was conferred by the CP transcript rather than by protein (Lindbo and Dougherty, 1992). This form of RNA- mediated resistance has been reported with other viruses including PVY (Smith et al.,1994), TSWV (Prins et al., 1996) and cowpea mosaic virus (CPMV) (Sijen et al., 1996). Results from several RNA-mediated resistance studies suggest that the virus resistance mechanism operates in similar manner to homology-dependent gene silencing (Flavell, 1994; Jorgensen et al., 1995; Matzke and Matzke, 1995). A post- transcriptional degradation process has been proposed as the underlying mechanism for virus resistance (Smith et al., 1994; Goodwin et al., 1996; Sijen et al., 1996).

In summary, it would appear that almost any part of the viral genome can be used for PDR. Although resistance can be mediated by either viral protein or mRNA transcript containing viral sequences, the degree of protection conferred by each system differ. Protein-mediated resistance generally offers a moderate level protection against a broad-range of viruses, whereas RNA-mediated resistance confers very high levels of protection but only against closely related viruses.

1.8 The scope of this thesisSince there are no natural sources of resistance to IPCV in groundnut, genetic

engineering and transformation techniques were investigated as a possible approach for producing IPCV resistant groundnut plants. The aim of the work presented in this thesis was to develop an efficient and reliable groundnut transformation method for four economically important Indian cultivars, and to evaluate the CP-MR strategy with a view to genetically engineering resistance against the D, H and L isolates of IPCV in transgenic groundnut plants.

There were three distinct objectives in this project, firstly to develop a reliable and reproducible plant regeneration system for the Indian groundnut cultivars JL24, Plover, Robert-21 and TMV-2. To achieve this, several previously reported efficient

23

groundnut regeneration procedures were selected and applied to the Indian groundnut cultivars.

Secondly, to assess A. tumefaciens- and microprojectile bombardment- mediated gene transfer techniques for the genetic transformation of the Indian groundnut cultivars. In order to investigate the efficiency of the different in vitro gene transfer systems and the competency of groundnut explants for transformation, a variety of promoter/reporter gene fusion plant expression vectors were constructed and used to detect transformation events.

Thirdly, the CP-MR strategy for conferring protection against IPCV was evaluated in N. benthamiana. Transgenic plants containing the H-IPCV CP gene construct had been generated at SCRI prior to this investigation. In this study, twenty transgenic H-IPCV CP lines were analysed for the transgene copy number and expression, and then experimentally tested for resistance against D-IPCV, H-IPCV and L-IPCV.

24

Chapter 2

Materials and Methods

2.1 MaterialsChemicals and reagents were purchased from BDH, Fisher Chemicals, and

Sigma. Restriction enzymes, DNA modifying enzymes, and DNA polymerases were obtained from Boehringer Mannheim, GibcoBRL Life Technologies, Pharmacia Biotech and Promega. Disposable plastic ware was supplied by Nunc, Sarstedt and Sterilin. Manufacturers names have been cited once upon initial use of the appliance and omitted thereafter.

Chemicals quoted as percentage (%) were either determined by volume to volume (v/v) or weight to volume (w/v) ratio. Deionised water (DW) was obtained from an ELGA Elgastat Option 2 water purifier, and autoclaved to generate sterilised deionised water (SDW).

2.2 DNA plasmid vectorsThe phagemid vectors pBS I KS+ and pBS II KS+ were obtained from

Stratagene, pUC19 plasmid vector was supplied by New England BioLabs and the pMOG402 binary vector was obtained from MOGEN.

2.3 Virus isolatesThe D, H and L isolates of Indian peanut clump virus (IPCV) were obtained

courtesy of Dr. R. A. Naidu, and were stored at -20°C either in lyophilised form or resuspended in SDW. A supply of IPCV infected Nicotiana benthamiana plants was maintained by mechanically inoculating four to six week old uninfected plants at six to ten week intervals and propagating in growth chambers at 25 °C with a 16 h photoperiod.

2.4 MethodsAll experimental procedures were conducted on the bench top at room

temperature unless stated otherwise.

2.5 Bacterial growth and storageEscherichia coli (E. coli) and Agrobacterium tumefaciens (A. tumefaciens)

were grown at a temperature of 37°C and 25°C, respectively. Liquid cultures were grown in an orbital shaker at 200 rpm.

26

2.5.1 Bacterial strains and genotypes

E. coli:

Strain Genotype

XL1 Blue recAl, endAl, gyrA96, thi, hsdR17, supE44, relAl, lac, {F\ proAB, laclq, ZDM15, TnlO, (tetR)}

DH5a F, fSOdlacZ, DM15, D(lacZYA-argF), U169, deoR, recAl, endAl, hsdR17, (rK", mK+), supE44, 1", thi-1, gyrA96,

relAl

A. tum efaciens:

Strain Helper Ti plasmid (disarmed)

C58C1 pGV2260 (Deblaere et al., 1985)

C58C3 pTiC58/C3 (Mullineaux, P. unpublished)EHA105 pEHA105 (Lui e ta l., 1992)LBA4404 pAL4404 (De Framond et al., 1983)

2.5.2 Antibiotic selectionFor the appropriate bacteria, the antibiotics were diluted to concentrations stated

below, in milligrams per litre (mg/1). The antibiotics were prepared as described in Appendix Al

Antibiotic E. coil A. tum efaciens

Ampicillin 100 -

Carbenicillin - 100

Chloramphenicol - 50

Gentamycin 10 10

Kanamycin 50 50

Nalidixic acid - 100

Rifampicin - 100

Spectinomycin - 150

27

Streptomycin - 200Tetracycline 10 -

2.5.3 Culture of bacteriaA sterile toothpick was used to transfer a single colony from a bacterial plate to

a sterile universal containing 5 ml of LB (Appendix A2) with antibiotic selection (Section 2.5.2). The culture was incubated overnight (o/n) in a shaker at the temperature appropriate for the bacteria.

To obtain single colonies from a liquid bacterial culture, a cooled flame sterilised loop was used to streak a loop full of culture across the surface of LB agar (Appendix A2) containing antibiotic selection (Section 2.5.2). LB agar plates were prepared by allowing molten LB agar (Appendix A2) to cool to 50°C. The appropriate antibiotics were added to the LB agar and mixed, and then poured into 9 cm petri dishes. Streaked plates were incubated upside down and incubated at the temperature appropriate for the bacteria. Bacterial colonies were normally visible after 16 to 24 h incubation for E. coli, and 40 to 48 h incubation for A. tumefaciens.

2.5.4 Long term storage of bacterial strains0.75 ml of an o/n bacterial culture was briefly vortexed with 0.75 ml of steriled

50% (v/v) glycerol in a screw capped cryogenic storage tube then stored at -80°C. To recover the cells a flamed sterile loop was used to remove a small portion from frozen mixture which was grown as described in Section 2.5.3.

2.5.5 Preparation of competent E. coli cellsBased on a method described by Nishimura et al., (1990). 0.5 ml of o/n culture

was used to inoculate 50 ml of medium A (see Appendix A2) in a 200 ml conical flask. The culture was grown until the bacterial suspension reached an O D ^ of 0.6. The

culture was decanted into a 50 ml tube, kept on ice for 10 min, then centrifuged at 1500 g for 10 min at 4°C in a Sorval RT7 refrigerated centrifuge. The supernatant (s/n) was discarded, the cells gently resuspended in 0.5 ml of ice cold medium A. 2.5 ml of ice cold storage solution B (Appendix A2) was then added and gently mixed without vortexing. 0.1 ml aliquots were dispensed into ice-cooled 1.5 ml tubes and stored at - 80°C until use.

2.5.6 Transformation of competent E. coli with plasmid DNAAn aliquot of frozen competent cells, as prepared in Section 2.5.5, was thawed

on ice. 5 pi of ligation reaction from Section 2.7.4 was mixed with 5 pi of SDW then added to the cells and incubated on ice for 30 min. The cells were heat shocked at 42°C

28

for 60 s then chilled on ice for 1-2 min. 1 ml of LB (Appendix A2) prewarmed to 37°C was added to the cells then transferred to a 10 ml Sterilin tube and incubated in a shaker for 1 h. 300 pi and 600 pi of transformation mixture was spread on LB agar plates containing antibiotic selection (Section 2.5.3) and incubated o/n at 37°C.

2.5.7 Preparation of competent A. tum efaciensBased on a method described by Hofgen and Willmitzer, (1988). 10 ml of 2YT

(Appendix A2) with antibiotic selection (Section 2.5.2) was inoculated with a single colony from an o/n streaked plate and incubated o/n in a 25°C shaker. The o/n culture was used inoculate 200 ml of 2YT with antibiotic selection (Section 2.5.2) then incubated in a 25°C shaker for 3-4 h. The cells were harvested by centrifugation in a refrigerated Sorval RC 5B superspeed centrifuge at 3000 g for 10 min at 4°C. The supernatant was discarded and the surface of the pellet washed with 20 ml of ice cold TE (pH 7.5) (Appendix A3) then discarded, and the cells were gently resuspended in 20 ml of ice cold 2YT . The competent cells were divided in aliquots of 0.5 ml each in ice cooled 1.5 ml tubes and stored at -80°C until use.

2.5.8 Transformation of A. tum efaciensFrozen cells, prepared as described in Section 2.5.7, were thawed on ice. 0.5-

1.0 pg of plasmid DNA in a total volume of 10-20 pi of TE (pH 7.5) (Appendix A3) was added to the cells and mixed by gentle flicking, then incubated on ice for 5 min. The cells were then frozen in liquid nitrogen for 5 min and thawed at 37°C for 5 min. 1 ml of 2YT (Appendix A2) was added to the cells then transferred into a 10 ml Sterilin tube and incubated in a 25°C shaker for 2-4 h. 100-300 pi aliquots were spread onto LB agar plates with antibiotic selection (Section 2.5.3) and incubated at 28-30°C for 40-48 h.

2.6 Nucleic acid isolation and purificationSmall scale isolation of plasmid DNA was used for screening recombinant

plasmid DNA. The medium and large scale isolation of plasmid DNA from E. coli protocols were used to obtain supercoiled plasmid DNA that was suitable for both manual and automated sequencing, enzymatic manipulation and microprojectile bombardment.

2.6.1 Small scale isolation of plasmid DNA from E. coliBased on a method described by Bimboim and Doly, (1979). A single bacterial

colony was grown in 5 ml of LB (Appendix A2) with antibiotic selection as described in Section 2.5.3. 1.5 ml of culture was transferred to a 1.5 ml tube and centrifuged in

29

Eppendorf centrifuge 5415C at 14 000 g for 3 min. The supernatant was discarded and the pellet resuspended in 100 pi of ice-chilled solution 1 (Appendix A4). 200 pi of solution 2 (Appendix A4) was added to the cells. The tube was then gently inverted 5 times and left to stand for 5 min. 150 pi of ice-chilled solution 3 (Appendix A4) was added to the lysate, gently mixed and left on ice for 5 min. The tube was centrifuged at 14 000 g for 5 min. The supernatant was transferred to a fresh 1.5 ml tube. Total nucleic acids were precipitated with the addition of 0.5 ml of isopropanol. The tube was vortexed and left to stand for 5 min before being centrifuged at 14 000 g for 5 min. The supernatant was discarded and the nucleic acid pellet desalted by the addition of 1 ml of 70% (v/v) ethanol followed by centrifugation at 14 000 g for 1 min. The supernatant was removed and the pellet dried at 37°C for 10-15 min. The pellet was resuspended in 25 pi of SDW to give a DNA concentration of 150-300 ng/pl, and stored at -20°C.

2.6.2 Medium scale isolation of plasmid DNA from E. coliBased on a method from Sambrook et al., (1989) but using a different ratio of

alkaline lysis solutions. The ratio of 1:1.5:1.25 for solutions 1, 2 and 3 was used instead of the 1:2:1.5 ratio as this improved the recovery of supercoiled plasmid DNA as opposed to relaxed plasmid DNA (per. comm. Dr. N. Bate). Obtaining supercoiled plasmid DNA was important for microprojectile bombardment because it made it easier to equalise this form of plasmid DNA to other supercoiled plasmid DNA preparations.

50 pi of culture from a 5 ml from an o/n culture grown as described in Section2.5.3 was used to inoculate 50 ml of LB (Appendix A2) with antibiotic selection (Section 2.5.2) in a 200 ml conical flask then incubated in a 37°C shaker for 16 h. The cells were harvested in a 50 ml Sorval polypropylene centrifuge bottle by centrifugation at 10 000 g for 5 min at 4°C. The cells were lysed as described in Section 2.6.2 but with different volumes; 2 ml of solution 1, 3 ml of solution 2 and2.5 ml of solution 3 (Appendix A4). The lysate was centrifuged at 10 000 g for 10 min at 4°C. The supernatant was filtered through Calbiochem miracloth into a fresh bottle and an equal volume of isopropanol was added to the filtered lysate. The mixture was vigourously mixed and left to stand for 5 min prior to centrifugation at 10 000 g for 10 min at 4°C. The supernatant was discarded and the bottle left inverted on tissue paper for 5 min to drain off residual liquid.

The pellet was resuspended in 300 pi of SDW and transferred to a 1.5 ml tube. 300 pi of 8 M lithium chloride was added to the crude nucleic acid solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 10 min. The supernatant was transferred to a fresh tube and an equal volume of isopropanol added. The solutions were vigourously mixed and left to stand at for 5 min before being

30

centrifuged at 14 000 g for 10 min. The supernatant was removed and the pellet resuspended in 200 pi of SDW. 10 pi of RNase A (10 mg/ml) (Appendix A4) was added to the nucleic acid solution and mixed. The solution was spun briefly and then incubated at 37°C for 1 h.

200 pi of phenol/chloroform/isoamylalcohol (Appendix A3) was added to the nucleic acid solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 5 min. The aqueous layer was carefully transferred to a fresh tube. 200 pi of chloroform was added to the phenol extracted solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 5 min. The chloroform extracted aqueous layer was carefully transferred to another fresh tube. The plasmid DNA was precipitated with 100 pi of 5 M ammonium acetate and 600 pi of 100% ethanol. The solutions were vigourously mixed and left to stand for 5 min before being centrifuged at 14 000 g for 5 min. The supernatant was removed and 1 ml of 70% (v/v) ethanol was added to the DNA pellet. The tube was centrifuged at 14 000 g for 1 min to remove salts from the pellet. This desalting step was repeated. The supernatant was removed and the pellet air dried for 30 min then resuspended in 100 pi of SDW for pUC and pBS based plasmids, or 20 pi of SDW for binary plasmids to give a DNA concentration between 0.5-1.0 pg/pl. The plasmid DNA solution was stored at - 20°C.

2.6.3 Large scale isolation of plasmid DNA from E. coliBased on a method from Sambrook et al., (1989) but using the altered alkaline

lysis ratios as described in Section 2.6.2. 400 ml of LB (Appendix A2) with antibiotic selection (Section 2.5.2) in a 1 1 conical flask was inoculated with 400 pi of an o/n culture grown as described in Section 2.3.3. The cells were harvested in a 200 ml Sorval polypropylene centrifuge bottle by centrifugation at 10 000 g for 10 min at 4°C. The cells were lysed as described in Section 2.6.2 but with different volumes; 8 ml of solution 1, 12 ml of solution 2 and 10 ml of solution 3 (Appendix A4).

The pellet was resuspended in 3 ml of SDW and transferred to a 50 ml bottle. 3 ml of 8 M lithium chloride was added to the crude nucleic acid solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 10 min at 4°C. The supernatant was transferred to a fresh tube and an equal volume of isopropanol added. The solutions were vigourously mixed and left to stand at for 5 min before being centrifuged at 14 000 g for 10 min at 4°C. The supernatant was discarded and the bottle left inverted on tissue paper for 5 min to drain off residual liquid. The pellet was resuspended in 0.5 ml of SDW and transferred to a 1.5 ml tube. 40 pi of RNase A (10 mg/ml) (Appendix A4) was added to the nucleic acid solution and mixed. The solution was spun briefly and then incubated at 37°C for 1 h.

31

The tube was then cooled on ice for 5 min before 0.5 ml of 1.6 M NaCl containing 13% (w/v) PEG 8000 was added. The solutions were mixed and left on ice for 1 h. The plasmid preparation was centrifuged at 14 000 g for 5 min. The supernatant was removed and the pellet resuspended in 300 pi of SDW. 300 pi of phenol/chloroform/isoamylalcohol (Appendix A3) was added to the nucleic acid solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 5 min. The aqueous layer was carefully transferred to a fresh tube. This phenol extraction step was repeated. 300 pi of chloroform was added to the phenol extracted DNA solution. The mixture was vigourously vortexed and then centrifuged at 14 000 g for 5 min. The chloroform extracted aqueous layer was carefully transferred to another fresh tube. The plasmid DNA was precipitated, desalted and dried as described in Section 2.6.2. The DNA pellet was resuspended in 200-400 pi of SDW for pUC and pBS based plasmids, or 30-50 pi of SDW for binary plasmids to give a DNA concentration between 0.5-1.0 pg/pl. The plasmid DNA solution was stored at -20°C.

2.6.4 Small scale isolation of plant DNA for polymerase chain reaction (PCR) analysis

Based on a method described by Edwards et al., (1991). A leaf disc was excised from the plant using the lid of a 1.5 ml tube then frozen in liquid nitrogen. The sample was ground on dry ice with a disposable grinder for 1 min. 400 pi of plant genomic DNA PCR extraction buffer (Appendix A3) was added to sample and then vortexed until the sample had thawed. The sample was centrifuged at 14 000 g for 1 min. 300 pi of the supernatant was transferred to a fresh tube and an equal volume of isopropanol was added. The solution was mixed and centrifuged at 14 000 g for 5 min. The supernatant was removed and the pellet desalted with 1 ml of 70% (v/v) ethanol and centrifugation at 14 000 g for 1 min. The supernatant was removed and the pellet air dried for 30 min then resuspended in 100 pi of SDW. Between 0.5-8.0 pi of plant DNA solution was used as template DNA for PCR analysis as described in Section 2.8.2.

2.6.5 Storage of plant tissue for use in Southern, Northern and Western blot analysis

Fresh plant tissue was collected and wrapped in aluminium foil then frozen in liquid nitrogen. The tissue was ground in liquid nitrogen using an RNase free mortar and pestle to yield a free flowing powder. The powder was transferred to a liquid nitrogen cooled 25 ml Sterilin tube and stored at -80°C.

32

2.6.6 Small scale isolation of plant DNAThe Nucleon Phytopure plant DNA extraction kit from Scotlab was used to

isolate genomic plant DNA from 100 mg leaf samples. Leaf material was prepared as described in Section 2.6.5, and 100 mg of the powdered leaf was transferred into a 1.5 ml tube on dry ice. 600 pi of reagent 1 and 20 pi of RNase A (10 mg/ml) (Appendix A4) were added to the sample. The solutions were mixed and 200 pi of reagent 2 was added. The mixture was inverted several times until a homogenous mixture was obtained. The sample was incubated at 65°C for 10 min with regular manual agitation and then placed on ice for 20 min. The sample was removed from the ice and 500 pi of chloroform (prechilled to -20°C) was added followed by 100 pi of Nucleon Phtyopure DNA extraction silica (shaken vigorously prior to use). The sample was incubated at room temperature for 10 min with regular manual agitation, and then centrifuged at 1300 g for 10 min. The aqueous layer was carefully transferred to a fresh tube. 450 pi of isopropanol (prechilled to -20°C) was added to the mixture. This was mixed and centrifuged at 4000 g for 10 min. The supernatant was removed. 400 pi of 70% (v/v) ethanol was added to pellet and centrifuged at 4000 g for 5 min. The supernatant was removed and the pellet air dried for 30 min. The pellet was carefully resuspended in 30-50 pi of SDW to give a DNA concentration between 0.3-0.6 pg/pl.

2.6.7 Small scale isolation of total plant RNATo minimise RNA contamination and RNA degradation; RNA samples were

kept on ice; gloves were always worn and changed frequently when handling RNA samples and reagents; work surfaces were cleansed with 70% (v/v) ethanol and then overlaid with aluminium foil. Sterile disposable plastic ware was used where possible as they were generally RNase free. Glassware, stainless steel spatulas, mortar and pestles were washed in detergent, rinsed thoroughly with fresh DW, and double wrapped in aluminium foil then baked at 240°C for 4 h to inactivate RNases and remove other nucleic acids. Electrophoresis tanks, gel trays and combs were washed with detergent, rinsed in DW, followed by a rinse with 100% ethanol and then air dried.

The QIAGEN RNeasy Plant Total RNA kit was used to isolate total RNA from 100 mg of plant leaf tissue. Leaf material was prepared as described in Section 2.6.5, and 100 mg of powered leaf was transferred to a clean 1.5 ml tube. 450 pi of lysis buffer (RLT) was added to the sample and vortexed vigorously. The lysate was applied onto a QIAshredder and centrifuged at 10 000 g for 2 min. Without disturbing the pellet, the flow through fraction from the QIAshredder was transferred to a fresh1.5 ml tube. 225 pi of 100% ethanol was added to the solution and mixed by pipetting. This mixture was then applied to an RNeasy spin column and centrifuged at

33

10 000 g for 15 s. The flow through was discarded and the microcentrifuge collection tube reused. 700 pi of wash buffer (RW1) was pipetted onto the spin column and centrifuged at 10 000 g for 15 s. The flow through was discarded and the spin column was placed into a new 2 ml microcentrifuge collection tube. 500 pi of wash buffer (RPE) was added to the column and this was then centrifuged at 10 000 g for 15 s. The flow through was discarded and the microcentrifuge collection tube reused. Another 500 pi of RPE was applied to the spin column and centrifuged at 10 000 g for 2 min. The spin column was transferred to a new 1.5 ml tube. 30-50 pi of DEPC treated water applied to the column and centrifuged at 10 000 g for 1 min. The eluate from the column was stored at -80°C. Total RNA quantity and quality was determined as described in Section 2.6.11. The ratio of A260/A28O provided an estimation of RNA purity, and only RNA samples displaying A260/A28O values in the range of 1.7 to 2.0 were regarded as sufficiently pure for further analysis.

2.6.8 Purification of DNAThis procedure was used to purify DNA after enzymatic manipulation. An

equal volume of phenol/chloroform/isoamylalcohol was added to the reaction mixture. This was vortexed and centrifuged at 14 000 g for 5 min. The aqueous layer was carefully transferred to a fresh tube. An equal volume of chloroform was added to the phenol extracted solution. This was vortexed and centrifuged at 14 000 g for 5 min. The aqueous layer was carefully transferred to a fresh tube. 1/10th of volume of 3 M sodium acetate (pH 5.2) and two volumes of 100% ethanol were added to the solution. The mixture was vortexed and left to stand for 5 min before being centrifuged at 14 000 g for 20 min. The supernatant was discarded and the pellet was desalted by the addition 1 ml of 70% (v/v) ethanol and centrifugation at 14 000 g for 1 min. The supernatant was removed and the pellet air dried for 30 min. The pellet was resuspended an appropriate volume of SDW.

2.6.9 Purification of DNA fragments between 10 bp and 200 bp in size from agarose gels

The MERmaid kit from BIO 101 Inc. was used to purify low molecular weight (MW) DNA fragments from agarose gels. The portion of gel containing DNA fragment was excised and transferred to a clean 1.5 ml tube. Three volumes of high salt binding solution and 5-8 pi of resuspended GLASSFOG per pg of DNA were added to the gel slice. This was vortexed vigorously for 15 min and then centrifuged at 10 000 g for 10 s. The supernatant was discarded. The tube was spun briefly and residual traces of liquid were removed. The pellet was resuspended in 300 pi of ethanol wash, vortexed then centrifuged at 10 000 g for 10 s. The supernatant was discarded. This washing

34

step was repeated twice. After the final wash the tube was spun briefly again and residual traces of liquid removed. The pellet was dried at 55°C for 3 min, and the DNA was eluted from the GLASSFOG by resuspending in a volume of SDW equivalent to the volume of GLASSFOG used. The sample was incubated at 55 °C for 5 min, centrifuged at 10 000 g for 1 min, and the supernatant containing the eluted DNA transferred to a clean tube. The elution step was repeated, and the two elutions combined.

2.6.10 Purification of DNA fragments between 200 bp and 15 kb in size from agarose gels

The GENECLEAN II kit from BIO 101 Inc. was used to purify DNA fragments larger than 200 bp from agarose gel. Three volumes of Nal solution was added to the gel slice containing the DNA fragment and incubated at 55°C for 5 min or until the agarose had completely melted. 10 pi of resuspended GLASSMILK was added to the sample and mixed. The suspension was then incubated on ice for 5 min and inverted every 1-2 min. The suspension was centrifuged at 10 000 g for 10 s and the supernatant discarded. The pellet was resuspended in 200 pi of ice cold NEW WASH, centrifuged at 10 000 g for 10 s and the supernatant removed. The wash step was repeated twice. The pellet was dried at 55°C for 3 min and the DNA was eluted from the pellet by resuspending in 20 pi of SDW followed by incubation at 55°C for 5min. The sample was centrifuging at 10 000 g for 1 min and the supernatant containingthe DNA was transferred to a clean tube.

2.6.11 Quantification of nucleic acidsThe concentration and purity of nucleic acids were determined by measuring

the absorbance at 260nm (A26O) and 280nm (A280)- The spectrometric conversions

used were (Sambrook et al., 1989):1 A260 unit of double-stranded DNA = 50 pg/pl 1 A26O unit of single-stranded DNA = 33 pg/pl 1 A26O unit of single-stranded RNA = 40 pg/pl

2.7 Enzymatic manipulation of DNA2.7.1 Digestion of plasmid DNA with restriction endonucleases

Plasmid DNA (0.1-1.0 mg) was digested with 7-10 U of restriction endonuclease in a volume of 20-30 pi for 1-2 hours using the appropriate restriction endonuclease buffer and incubation temperature recommended by the manufacturer. With digestions involving two or more restriction enzymes, a suitable buffer was chosen where all the enzymes were relatively active. If the conditions for simultaneous

35

digestion were unfavourable, the plasmid DNA was purified (Section 2.6.8) between digestions and the conditions changed for the subsequent enzyme, to ensure complete cleavage.

2.7.2 Repairing 3 ’ or 5 ’ DNA overhangs to generate blunt endsThis method was used to convert overhanging ends generated by restriction

endonuclease digestion into blunt ends for cloning. 5' overhangs were repaired using DNA polymerase (Klenow fragment), and 3' overhangs were removed by the 3' to 5' exonuclease activity of the Klenow fragment. The overhangs were blunted by the addition of 1 |xl of 0.5 mM dNTPs and 1-5 U of Klenow fragment to 0.1-1.0 pg of digested DNA in a volume of 20 pi. The reaction mixture was incubated at 30°C for 15 min, and then heat inactivated at 75°C for 10 min. The sample could then either be digested with a second restriction enzyme (Section 2.7.1), or purified as described in Section 2.4.8 and resuspended in 20 pi of SDW to obtain a DNA concentration between 100-200 ng/pl.

2.7.3 Phosphorylation and annealing of synthetic oligonucleotides1-10 pg of purified synthetic oligonucleotide (Section 2.8.1) in a volume of

9.1 pi was mixed with 20.9 pi of kinase buffer (Appendix A3) and incubated at 37°C for 1 h. 70 pi of SDW was added and the oligonucleotides were purified as described in Section 2.6.8. The pellet was resuspended in 10 pi of SDW. Complementary synthetic oligonucleotides were annealed by mixing 5 pi of each oligonucleotide together, and incubated at 94°C for 1 min then annealed at 65°C for 5 min.

2.7.4 Ligation of DNA fragmentsDNA molecules were ligated by combining 25-100 ng of plasmid vector with

the appropriate amount of insert DNA as calculated with the following equation:

Amount of insert = amount of vector DNA (ng) x insert size (kb) x R (ng) vector size (kb) 1

Where R/l represented the ratio of insert DNA to vector DNA which would typically be 3:1 for ligation reactions involving DNA molecules with cohesive ends, and 6:1 or 9:1 when blunt ended DNA fragments were being ligated.

2.8 Amplification of DNA by PCRThe Perkin Elmer DNA Thermal Cycler Model 480 and Promega Taq DNA

polymerase were used in all PCR reactions. To obtain high yields and specificity

36

during PCR amplification, parameters including template quality, concentration of buffer components, denaturation conditions, annealing temperatures and extension times were optimised for each set of specific primer and template combinations.

2.8.1 Purification of oligonucleotide primersBased on a method described by Sawadogo and Von Dyle, (1991). 100 pi of

crude oligonucleotide was transferred to a 1.5 ml tube to which 1 ml of n-butanol was added. The was solution vortexed for 15 s and then centrifuged at 14 000 g for 1 min. The supernatant was carefully removed, the pellet or smear was resuspended in 100 pi of SDW and the n-butanol step repeated. The supernatant was discarded. The was tube spun briefly and residual traces of n-butanol were removed. The pellet was air dried for 30 min, then resuspended in 50-100 pi of SDW and stored at -20°C.

2.8.2 General PCRBased on a method described by Taylor et al., (1994). For a 25 pi PCR

reaction; 0.5-2.0 ng of purified DNA template (Section 2.6.8), 50 ng of each desalted oligonucleotide (Section 2.8.1), 200 pM of dNTPs, lx Promega Taq buffer and 0.5-1.0 U of Promega Taq polymerase were mixed in a chilled sterile 0.5 ml PCR tube, and then centrifuged briefly. Each reaction was overlaid with a drop of paraffin oil.

The thermal cycles used were; 94°C for 60 s, y°C for 60 s and 72°C for z s, and repeated 25 to 30 times. The annealing temperature of the primer (y) was calculated using GeneJockey II, or estimated with the following equation; y = 2x(number of A and T) + 3x(number of C and G). The extension time (z) of 1 kb per min was used to ensure maximum synthesis rates of the PCR target. In addition, rapid thermal ramping (l°C/s or higher) was used to minimise the PCR amplification times.

2.8.3 Bacterial colony PCRA sterile toothpick was used to transfer a very small portion of a colony into a

25 pi PCR reaction mixture, prepared as described in Section 2.8.2, and a drop of paraffin oil placed on top. The bacteria were lysed by incubating the reaction at 94°C for 5 min prior to PCR amplification as described in Section 2.8.2.

2.9 Gel electrophoresisGel electrophoresis was used to separate, purify and visualise both DNA and

RNA; agarose was convenient for separating fragments ranging in size from 40 bp to about 20 kb.

37

2.9.1 Agarose gels for the electrophoretic separation of DNAThe agarose gel concentration used was dependent upon the size of the nucleic

acids to be analysed; low percentage agarose gels were used to resolve high MW nucleic acids; and high percentage agarose gels was used to resolve low MW nucleic acids.

The appropriate amount of agarose was melted in 100 ml of IX TAE (Appendix A5). The molten gel was cooled to 50°C and 3 pi of ethidium bromide (10 mg/ml) was added. The gel was thoroughly mixed, then cast and the comb inserted. After the cast had set for 30 min, the gel was transferred to a gel electrophoresis tank and immersed in sufficient IX TAE to cover the gel surface. DNA samples were mixed with 1/10 volume of the appropriate gel loading dye (Appendix A5) then loaded with 10 pi of an appropriate DNA ladder (100 pg/pl) (Appendix A5) run alongside. The gel was run at approximately 80 V for 1-2 h or until the nucleic acids had separated sufficiently. After electrophoresis, DNA fragments were visualised under ultra-violet light (UV) illumination, and gel images were retained as photographs or digitised computer pictures.

2.9.2 Agarose gels for the electrophoretic separation of genomic DNABased on a method from Sambrook et al., (1989). A 0.7% gel cast was

prepared without ethidium bromide, and ran in IX TAE buffer. Ethidium bromide was omitted from the gel since this has been shown to effect the migration of the DNA fragments (Sambrook et al., 1989). An appropriate amount of loading dye was added to the digested genomic DNA sample, then loaded. The gel was allowed to stand for several minutes to ensure the DNA samples sank to the bottom of the wells. The gel was ran at 15-25 V for 7-8 h as described in Section 2.9.1. After electrophoresis, the gel was stained in 100 ml of IX TAE containing 0.5 pg/pl ethidium bromide for 30 min on a gently rotating platform shaker, and visualised as described in Section 2.9.1.

2.9.3 Agarose gels for the electrophoretic separation of RNABased on a method described by Foumey et al., (1988). All steps involving the

use of formaldehyde were conducted in a fume cupboard, including the running of the gel.

1 g of agarose was melted in 87 ml of SDW and allowed to cool to 70°C. 10 ml of 10X MOPS (Appendix A5) and 5.1 ml of 37% formaldehyde were added and quickly mixed. The gel was cast and left to set for 1 h. The gel was transferred to a gel tank, and immersed in IX MOPS. The wells were flushed clean with buffer before the samples were loaded. 5-10 pg of total RNA dissolved in SDW in a maximum volume of 15 pi was mixed with an equal volume of FSB (Appendix A5). The sample was

38

then incubated at 60-65°C for 5 min and snap cooled on ice. 3 pi of FDE (Appendix A5) and 1 pi of ethidium bromide (1 mg/ml) were added to each sample and loaded. 3 pi of RNA ladder (Appendix A5) was used to size the RNA fragments. This was treated and loaded in a similar manner to the other RNA samples. Saran wrap was placed over the UV transilluminator prior to visualising the gel, in order to prevent contamination from RNases (Section 2.9.1).

2.10 DNA sequencing2.10.1 Preparation of double stranded DNA template for manual sequencing

10 pg of DNA in a volume of 16 pi was denatured by addition of 4 pi of 1 M NaOH and incubated at RT for 5 min, then neutralised with 6.7 pi of 3 M ammonium acetate (pH 4.8). 2.5 volume of 100% ethanol were added to the denatured DNA and mixed. The sample was incubated at -80°C for 10 min then centrifuged at 14 000 g for 20 min. The supernatant was discarded and the pellet desalted with 200 pi of 70% ethanol and centrifugation at 14 000 g for 1 min. The supernatant was removed and the pellet air dried for 30 min. The pellet was resuspended in 20 pi of SDW.

2.10.2 Manual sequencing of double stranded DNA templatesThe Pharmacia Biotech T7 Sequencing kit was used to sequence double

stranded DNA templates. 10 pi of DNA template (prepared as described in Section 2.10.1) was mixed with 2 pi of primer (10 ng/ml) and 2 pi of annealing buffer. This mixture was vortexed, briefly centrifuged, and then incubated at 65°C for 3 min. This was followed by subsequent incubations at 37°C for 20 min and RT for 10 min, and a brief spin.

Four 1.5 ml tubes were labelled A, C, G and T. 2.5 pi of each dideoxy sequencing mix was aliquotted into the corresponding tube. An appropriate amount of T7 DNA polymerase was diluted to 1.5 U/pl with enzyme dilution buffer. For each primer/DNA template set, 7 pi of enzyme premix was prepared consisting of 1.5 pi of SDW, 3 pi of label mix A, 2 pi of T7 DNA polymerase (1.5 U/pl) and 0.5 pi of 35S labelled dATP. 6 pi of enzyme premix was added to the annealed template, gently mixed and incubated at RT for 5 min. 4.5 pi aliquots were transferred to the side of each tube containing the dideoxy sequencing mixes, spun briefly and incubated at 37°C for 5 min. The reaction was terminated by the addition of 5 pi of stop solution and stored at -20°C.

39

2.10.3 Preparation of the sequencing apparatus and gelThe sequencing apparatus was supplied by Bio-Rad. The front plate was

siliconised in the fume cupboard with 2-3 ml of Sigma coat and allowed to for 20-30 min. The plates were assembled with the rest of the apparatus ensuring the base was flush. To seal the base of the plates, a piece of 3MM Whatman filter paper the size of the base was placed into the casting tray along with 15 ml of sequencing gel mix A (Appendix A6). The sequencing apparatus was positioned on top and then left for 15 min. After the base had sealed, the sequencing gel mix B (Appendix A6) was poured. The apparatus was placed in a horizontal position with the base of the shark tooth comb inserted between the plates and clamped with a bulldog clip. The gel was left to set for 1-2 h.

After the gel had set it was secured into the sequencing tank and 400 ml and 600 ml of IX TBE (Appendix A5) were poured into the tank and back plate reservoir, respectively. The comb was removed and the gel surface flushed thoroughly with the IX TBE. The gel was prewarmed to 55°C. The comb inserted with the teeth penetrating 1 mm into the gel and the wells flushed out.

The sequencing reactions from Section 2.10.2 were boiled at 95°C for 2 min, then quenched on ice. 2.5 pi aliquots of sequencing reaction were loaded in sets of four in the order A, C, G and T. The gel was run at constant power (50 W) for the appropriate length of time depending on whether long or short read sequences were required. After separation, the top plate was removed and a piece of 3MM Whatman was placed over the gel and firmly pressed down. This was carefully peeled off and the gel was covered with cling film. A second piece of filter paper was placed under the gel to provide support. The gel was dried under vacuum at 80°C for 1-2 h and exposed o/n in a autoradiograph cassette containing Amersham X-ray film.

2.10.4 ABI PRISM™ Dye Terminator Cycle SequencingThe ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction kit with

Ampli-Taq® DNA polymerase FS was supplied by Perkin Elmer. For each 20 pi reaction; 8 pi of Terminator Ready Reaction Mix, 300-500 ng of double stranded DNA template and 3.2 pmole of primer were mixed in 0.5 ml PCR tube. The solution was centrifuged briefly then overlaid with a drop of mineral oil. Cycle sequencing was performed in a Perkin Elmer Thermal Cycler Model 480 using the following thermal cycles; rapid thermal ramp to 96°C, 96°C for 30 s; rapid thermal ramp to 50°C, 50°C for 15 s; rapid thermal ramp to 60°C, 60°C for 4 min; repeated for 25 cycles, then rapidly cooled to 4°C.

The extension products were purified by ethanol precipitation. 2 pi of 3 M sodium acetate (pH 5.2) and 50 pi of 95% (v/v) ethanol were placed in a 1.5 ml tube.

40

20 |Xl of PCR reaction was transferred to the ethanol solution, the solution mixed and then incubated on ice for 10 min. The sample was centrifuged at 14 000 g for 30 min. The supernatant was discarded and the pellet washed in 250 p,l of 70% (v/v) ethanol for 1 min. The ethanol was removed and the pellet air dried for 30 min then stored at -20°C. Samples were run on an ABI PRISM sequencer based at Leicester University.

2.11 Transfer of nucleic acids from agarose gels and immobilisation onto nylon membranes

Bio-Rad Zeta-Probe® GT (genomic tested) blotting membrane was used to blot both DNA and RNA. Nucleic acids were bound to the membrane using a Stratagene UV-Stratalinker.

2.11.1 Southern blottingDNA was transferred to Zeta-Probe membrane using techniques described by

Southern, (1975). After electrophoresis, the agarose gel was soaked in 500 ml of depurinating solution (Appendix A3) for 7 min. The gel was then rinsed with SDW and transferred into 500 ml of denaturing solution (Appendix A3) and placed onto a gently moving platform for 15 min. The solution was discarded and replaced with 500 ml of fresh denaturing solution, then left shaking for another 15 min. The gel was then transferred into 500 ml of neutralisation solution (Appendix A3) and placed onto the moving platform for 30 min.

Meanwhile, 5 sheets of Whatman 3MM filter paper and 1 sheet of Zeta-probe membrane were cut to the size of the gel. To prepare the Zeta-probe membrane it was soaked in SDW for 5 min, then in 10X SSC (Appendix A3) for 5 min. In a deep dish, sponges larger than the gel were stacked to a height of 6-8 cm and immersed in 10X SSC to a depth of 3-4 cm. 3 pieces of the pre-cut 3MM were placed centrally on top of the sponge, flooded with 10X SSC, then the gel placed well side down on the 3MM and any air bubbles removed. Strips of old autoradiograph film were positioned along the sides of the gel to ensure only capillary action through the gel. The surface of the gel was flooded with 10X SSC then the pre-wetted Zeta-probe placed on top, and any trapped air bubbles removed. The membrane was soaked with more 10X SSC and the 2 remaining pieces of 3MM were placed on top. Air bubbles were removed before a 15 cm stack of paper towel and a small weight placed on top. During the transfer, an excess of 10X SSC was kept in the dish. The blot was allowed to transfer for 2-24 h depending on gel concentration and DNA fragment size. After transfer, the well positions were marked onto the membrane with a soft lead pencil. The membrane was separated from the gel, rinsed briefly in 2X SSC, air dried for an 1 h. The DNA was

41

UV cross linked to the membrane then placed between two filter papers in a sealed plastic bag, then stored at -20°C.

2.11.2 Northern blottingBased on a method described by Foumey et al., (1988). The Southern blot

procedure as described in Section 2.11.1 was used to transfer RNA, though the gel was soaked in a 500 ml solution containing 0.05 M NaOH and IX SSC for 10 min then twice in 500 ml of 10X SSC for 20 min instead of the depurinating, denaturing and neutralisation solutions.

2.12 Nucleic acid hybridisationThe Stratagene Prime-It II Random Primer Labelling kit and Nuctrap® Probe

Purification Columns and Push Column Beta Shield Device were used to generate and purify 32P radiolabelled DNA probes.

2.12.1 Preparation of 32P radiolabelled DNA probe25 ng of template DNA in a volume of 1-24 pi and 10 pi of random

oligonucleotides primers were placed into a 1.5 ml screw cap tube, and made up to a final volume of 34 pi with SDW. The mixture was incubated at 100°C for 5 min, briefly centrifuged, then left at RT. 10 pi of 5X dCTP primer buffer was added, the solution mixed and transferred to the screw cap tube containing the 5 pi of a -32P dCTP and carefully mixed. 1 pi of Exo (-) Klenow (5U/pl) was added, carefully mixed then incubated at 37-40°C for 10 min. 2 pi of Stop mix was added to 18 pi of STE buffer (Appendix A3) then added to the labelling reaction.

2.12.2 Purification of 32P radiolabelled DNA probeThe Nuctrap push column was pre-soaked by passing 70 pi of STE buffer

(Appendix A3) down using a 10 ml a Luer lock syringe. The labelled probe was then carefully loaded onto the column and filtered through using the syringe. The eluent was collected in a 1.5 ml screw cap tube and another 70 pi of STE buffer was pushed through the column to yield a final volume of 140-150 pi of purified probe.

2.12.3 Measurement of radioactive incorporation into the DNA probe1 pi of probe was dotted onto the centre of a Whatman GF/C glass fibre disc.

An equal volume was added to 500 pi of herring sperm DNA (500 pg/pl) dissolved in 20 mM EDTA to which 125 pi of 50% (v/v) TCA was added. This solution was chilled on ice for 5 min and the precipitate was collected by filtering through a GF/C disc in a filter tower. The filter was then washed twice with 5 ml of 10% (v/v) TCA

42

and once with 5 ml of IMS. Both discs were placed into separate scintillation vials containing 2 ml of liquid scintillant (5% (v/v) POP in toluene). The ratio of incorporated counts (washed filter) to total count (unwashed) was measured on a LKB Wallac liquid scintillation counter.

2.12.4 Measurement of probe activityProbe specific activity was calculated with the following equation:

SA = [ (nCi) (2.2x10)9) (P) ] + { Mi + [ (1.3xl03) (P) (nCi / S)])

Where SA was the specific activity in disintegrations per minute (dpm), pCi was the fiCi of the radiolabelled nucleotide in the reaction mixture, P was the proportion of radiolabelled nucleotide incorporated into the probe DNA as calculated in Section 2.12.3, Mi was the mass of the input DNA template in ng and S was the specific

activity of the radiolabelled nucleotide in Ci/pmole (or pCi/nmole).

2.12.5 HybridisationThe same procedure was used for both Southern and Northern blot

hybridisations. All hybridisation and wash solutions were stored at 65°C. Incubation and wash steps were conducted at 65°C in a Hybaid oven. The labelled probe (Section 2.12.1-4) was denatured at 95-100°C for 5 min then quenched on ice. The Zeta-probe membrane was placed inside a Hybaid hybridisation bottle with the nucleic acid side facing inwards. 15-30 ml of prehybridisation solution (Appendix A3) was added and incubated in the Hybaid oven for 1-2 h. The prehybridisation solution was discarded and replaced with 5-10 ml of fresh prehybridisation solution. 0.5 ml of prehybridisation solution was added to the denatured probe which was then directly aliquotted into the hybridisation bottle and incubated o/n in the Hybaid oven.

The probe was either discarded down the sink or stored at -20°C in a labelled 50 ml tube. The membrane was washed twice in Church wash I (Appendix A3) for 30 min, then twice in Church wash II (Appendix A3) for 30 min. After the washes, if the membrane was to be reprobed, it was left damp otherwise it was air dried for 1 h. The membrane was sealed in a plastic bag and then enclosed in Saran wrap. The membrane was exposed on a Molecular Dynamics Phosphorlmager and the results analysed using ImageQuant software.

43

2.13 Inoculation of N. benthamiana2.13.1 Mechanical inoculation of N. benthamiana plants

The two youngest fully expanded apical leaves (larger than 5 cm) were dusted with carborundum powder and gently rubbed with virus inoculum. Inocula were prepared freshly by either homogenising 2-3 leaves from systemically infected N. bethamiana inoculum plants in 10 ml of SDW, or lyophilised virus was resuspended in SDW to a concentration of 10 ng/ml. After 5 min, the inoculated plants were rinsed with water then propagated under greenhouse conditions.

2.13.2 Collection and storage of plant materialLeaf discs were excised from leaves using a 1.5 ml tube and homogenised with

0.5 ml of extraction buffer (Appendix A7). The homogenate was collected in a labelled1.5 ml tube and stored at -80°C.

2.14 Enzyme linked immunosorbent assay (ELISA)Based on a method described by Clark and Adams, (1977). The antiserum to

D, H and L IPCV were kindly supplied by Dr. R. A. Naidu. Disposable sterile polypropylene plastic ware was used when handling the antiserum and y-globulin.2.14.1 Purification of y-globulin

To 1 ml of antiserum, 9 ml of SDW and 10 ml of neutralised saturated ammonium sulphate solution were added. The solution was mixed and left to precipitate for 40 min. The precipitate was collected by centrifugation at 10 000 g for 10 min. The supernatant was removed, and the pellet resuspended in 2 ml of 1/2X PBS (Appendix A7) over a 30 min period. The antiserum was then dialysed three times against 1/2X PBS, the third change was left o/n at 4°C. The contents of the dialysis bag were transferred to a 1.5 ml tube and the y-globulin was adjusted to approximately 1 mg/ml based upon a spectrometric conversion of 1 A278 unit equal to

1.4 mg/ml of protein, then stored at -20°C.

2.14.2 Conjugation of alkaline phosphatase to y-globulinNeutralised saturated ammonium sulphate was used to precipitate 2000 U of

alkaline phosphatase (AP). The precipitate was centrifuged at 10 000 g for 10 min and the supernatant was discarded. The pellet was resuspended with 1 ml of purified y- globulin (1 mg/ml) and then dialysed three times against IX PBS (Appendix A7), the third change was left o/n at 4°C. The mixture was transferred into a 1.5 ml tube and gluteraldehyde was added to a final concentration of 0.06% (v/v). The mixture was left for a period of 4 h. The gluteraldehyde was removed by dialysis with three changes of

44

IX PBS, with the final dialysis being conducted o/n at 4°C. The AP conjugated y- globulin was stored at 4°C with 5 mg/ml of BSA and 0.02% (w/v) of sodium azide.

2.14.3 Coating microtitre plates with y-globulinThe y-globulin was diluted to 1 |xg/|xl with coating buffer (Appendix A7) then

dispensed in 200 pi aliquots per well into 96 well NUNC plates. The plates were incubated at 37°C for 3 h, and then rinsed three times with PBS-Tween (PBS-T) (Appendix A7). The y-globulin coated plates were stored at -20°C. The frozen plates were rinsed with PBS-T prior to use.

2.14.4 Adding the homogenised plant extractPlant extracts prepared as described in Section 2.13.2 were centrifuged at

14 000 g for 10 min. 200 pi of supernatant was transferred into the appropriately coated well plate then incubated o/n at 4°C. The plates were then washed four times with PBS-T (Appendix A7) and tapped dry. 200 pi of PBS-Marvel (PBS-M) (Appendix A7) was aliquotted into each well, and the plates incubated at RT for 1 h. The PSB-M was discarded and replaced with 200 pi of AP conjugated y-globulin diluted to the appropriate titre (1/1000 for D-IPCV, 1/2000 for H-IPCV and 1/250 for L-IPCV) with conjugate buffer (Appendix A7). The plates were incubated at 37°C for 4 h. The conjugate was discarded and the wells were washed three times with PBS-T. 100 pi of substrate buffer (Appendix A7) was added to each well, incubated at RT and the samples were measured in a Titretek Multiskan Plus at a wavelength of 405nm-

2.15 Western blotting2.15.1 Sample preparation

100 mg of frozen powered leaf material (prepared as described in Section 2.6.5) was centrifuged twice at 14 000 g for 5 min at 4°C. The plant sap was transferred to a fresh 1.5 ml tube between spins. After the second spin the plant sap was transferred to a new 1.5 ml tube, flash frozen and stored at -80°C. Total protein concentration was determined as described in Section 2.15.2.

2.15.2 Protein assayProteins were quantified as described by Bradford (1976) and standardised

with known BSA standards. 10 pi samples were pippetted, in duplicate, into separate wells on 96 well NUNC plate, then mixed with 200 pi of Bio-Rad protein assay solution (diluted 1 in 5 with SDW) and left for 5 min. The absorbance was measured using a Dynatech plate reader.

45

2.15.3 SDS-polyacrylamide gel electrophoresis (SDS-PAGE)Proteins were separated using a Bio-Rad mini Protean II cell with 0.75 mm

spacers and 10 well Teflon combs. The gel apparatus was assembled according to the manufacturers instructions. 4.5 ml of resolving gel (Appendix A7) was poured between the plates, and SDW was then carefully overlaid on top of the resolving gel. The gel was left for a period of 45 min to allow it to set. The SDW overlaying the resolving gel was discarded. The surface of gel was rinsed three times with SDW, and then blotted dry with 3MM Whatman filter paper. The comb was inserted between the plates and the stacking gel was added (Appendix A7). The gel was left for a period of 30 min to allow it set. The gel apparatus was transferred to the electrophoresis tank, running buffer added (Appendix A7) and wells rinsed out.

The protein samples, prepared as described in Section 2.15.1, were mixed with two volumes of SDS-reducing buffer (Appendix A7) and boiled at 95°C for 5 min. The samples were spun briefly then loaded. Protein molecular weight standards (3 pi) (Appendix A7) were run alongside and empty wells were filled with SDS-reducing buffer. The gel was ran at 80-120 V until the dye front migrated off the bottom of the gel.

2.15.4 Western blottingBased upon methods described by Towbin et al., (1979) and Kyhse-Anderson,

(1984). A Biometra Fastblot semi-dry cell was used to transfer proteins onto a solid support. Following electrophoretic separation of the protein, ten sheets of Whatman 3MM filter paper and one piece of Hybond-C super supported pure nitrocellulose membrane were cut to the same size of the resolving gel. The 3MM filter paper was soaked in transfer buffer (Appendix A7). The nitrocellulose membrane was soaked briefly in deionised water and then soaked in transfer buffer for 10 min. Five pieces of soaked 3MM filter paper were stacked on the anode plate. The resolving gel was placed on top of the filter paper, this was followed by the nitrocellulose membrane and then the five remaining pieces of 3MM filter paper. The surface of the top layer was soaked in transfer buffer before each new layer was added. In addition, air bubbles trapped between each new layer were removed before another layer was placed on top. The lid was connected with body of the Fastblot, then precooled cold blocks placed on the lid and the unit was ran at a maximum power limit of 10 W for 30 min. To confirm that the proteins had transferred onto the membrane, the membrane was briefly stained in Ponceau S red (Appendix 7). The positions of the protein molecular weight markers were marked onto the membrane. The Ponceau S red stain was removed with deionised water. To confirm that all the protein had transferred from the gel, the gel was stained with Commassie Brilliant blue R250 (Appendix A7).

46

2.15.5 Immunological detectionIncubation of the nitrocellulose membrane with both antibodies and block

solutions were performed in sealed plastic bags on a rotating platform to ensure that the solutions were distributed evenly over the membrane. Between changes of solutions, the membrane was washed three times for 10 min in TBS-M (Appendix A7). The blot was blocked o/n in TBS-M at 4°C, then treated for 1 h with 4 ml of the relevant purified primary antibody or antiserum, diluted 1 in 1000 with TBS-M. The blot was then incubated with 4 ml of AP conjugated goat anti-rabbit antibodies, diluted 1 in 2000 in TBS-M. After the final wash, the blot was placed in a small tray and 4 ml of BCIP/NBT substrate solution (Appendix A7) was added. The blot was allowed to develop until bands became visible and the reaction was stopped by rinsing with DW.

2.16 Detection of plant reporter genes2.16.1 p-Glucuronidase (GUS) fluorimetric assay

Based upon method a described by Twell et al., (1991). Plant material was homogenised in mortar and pestle with GUS extraction buffer (GEB) (Appendix A8). The homogenate was centrifuged at 14 000 g for 5 min and then kept on ice prior to the assay. 100 pi of plant supernatant was mixed with 400 pi of 4-methyl umbelliferyl glucuronide (MUG) solution (Appendix A8) (prewarmed to 37°C for 5 min) and incubated at 37°C. After 10 min, a 100 pi sample from the reaction mixture was removed added to 100 pi of 0.2 M NaCC>3 in a microtitre plate. This sample was then assayed using an Elmer Perkin fluorimeter. Three additional samples were taken from the reaction mixture at time intervals dependent upon the initial reading.

2.16.2 (3-Glucuronidase (GUS) histochemical localisationBased upon a method described by Jefferson et al., (1987). Samples were

immersed in a solution containing 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide and 1 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) (Appendix A8), then vacuum infiltrated for 5 min and incubated o/n at 37°C. The samples were then cleared in 70% (v/v) ethanol before being analysed.

2.16.3 Luciferase (LUC) assaysBased upon a method described by Twell et al., (1991). Plant material was

homogenised and centrifuged as described in Section 2.16.1 but using ice-chilled LUC extraction buffer (LEB) (Appendix A8). 25 pi of supernatant was placed into a sample tube and assayed in a Bethesda luminometer, where 200 pi of ATP buffer and 200 pi of luciferin (Appendix A8) were automatically added to the sample, and the subsequent

47

the level of luminescence monitored. Each sample was assayed twice to obtain a mean value.

2.16.4 Green fluorescent protein (GFP) detectionMicroscopic examination of plant tissues were conducted under a UV epifocal

microscope fitted with either a DAPI (excitation filter 360-370 nm and emission filter 420-460 nm) or FITC (excitation filter 470-490 nm and emission filter 515-560 nm) filter set.

2.17 Plant propagation and tissue cultureAll the plant cultures plates were sealed with Nescofilm and grown at 25°C

under cool white fluorescent light with a 16 h photoperiod unless stated otherwise.2.17.1 Seed surface sterilisation

Groundnut and tobacco seed were surface sterilised by soaking in 70% (v/v) ethanol for 1 min, then in 10% (v/v) bleach (Domestos) for 15 min followed by five rinses with SDW. For groundnut, in addition to the seed surface sterilisation, the testa were removed from seed before being transferred onto plant medium.

2.17.2 Groundnut propagationSurface sterilised groundnut seeds were used to initiate in vitro grown plants.

The seeds were cultured in Sigma magentas containing MS30 medium (Appendix A9) and incubated at 25°C under cold white light with a 16 h photoperiod. Surface sterilised groundnut seeds were used in the propagation of plants in the Conviron growth cabinet. Seeds were grown in autoclaved soil/sand mix (1:1), at a temperature of 25°C with a 16 h photoperiod.

2.17.3 Tobacco propagationIn vitro grown tobacco plants were cultured on MS 30 medium (Appendix A9)

at 25°C. Nicotiana tabacum cv. Samsun was used in microprojectile bombardment and A. tumefaciens-mediated leaf transformation experiments. The N. tabacum seeds were initially grown on MS30 medium plates (IX MS basal medium and 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar (Appendix A9)). After 3-4 weeks, the most healthy and vigorous seedlings were grown individually in magentas. These were maintained by subculturing nodal explants from 8-10 week old plants onto fresh MS30 medium. This was subsequently repeated every 8-10 weeks to ensure a constant supply of young leaf material.

For kanamycin selection, the MS30 medium was supplemented with kanamycin to a level of 50 mg/1 (Appendix Al). After 3-4 weeks, seedlings with fully

48

developed root systems and green leaves were considered kanamycin resistant. In contrast, the kanamycin sensitive plants were characterised by seedlings with non­penetrant root systems, lack of true leaf development and bleached cotyledons.

2.17.4 Shoot organogenesis from m ature de-em bryonated g roundnu t co ty ledons

Based on a method described by McKently et al., (1990). Surface sterilised mature groundnuts (Section 2.17.1) were separated to give two cotyledon halves; the whole embryonated cotyledon and whole de-embryonated cotyledon. The mature embryo and residual embryonic tissues were removed from both types of cotyledon. The de-embryonated cotyledons were cultured on McKently regeneration medium (IX MS basal salts, 110.96 pM BA (25 mg/ml), 2 mg/1 glycine, 0.5 mg/1 nicotinic acid, 0.1 mg/1 pyridoxine HC1, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar (Appendix A9)).

After one week, all embryonic protrusions growing from the cotyledons were removed, and the cotyledon explants were returned to the same regeneration medium and cultured for a further four weeks. The embryonic protrusions were discarded because these tissues frequently contain pre-existing shoot or axillary meristems. Although the shoot or axillary meristems would readily regenerate into shoots, this type of organised tissue was not very susceptible to A. tumefaciens-mediated transformation.

Shoot buds developing from the cotyledon explant were excised and transferred to MS30 medium (IX MS basal medium, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) supplemented with 4.44 pM BA (Appendix A9) and 5.37 pM NAA (Appendix A9) for 2-3 passages of four weeks each. The unresponsive cotyledon explants were transferred onto fresh medium to encourage shoot formation. When the shoots reached a height >3 cm they were transferred onto MS30 medium supplemented with 5.37 pM NAA to promote root formation.

2.17.5 Shoot organogenesis from m ature de-em bryonated groundnu t cotyledon segm ents

Based on a method described by Atreya et al., (1984). The cotyledons were separated from the embryos, residual embryonic tissue was removed and the cotyledons dissected into three segments; embryo/proximal, middle and distal explants, before being cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar (Appendix A9)) supplemented with 0.0, 2.22, 4.44, 8 .8 8 , 22.19 and 44.38 pM BA (Appendix A9). After four weeks explants were transferred onto the fresh

49

medium, while shoot buds were transferred onto MS basal medium containing 2.22 pM BA and cultured as described in Section 2.17.7.

2.17.6 Shoot organogenesis from groundnut leaf discsBased on a method described by Eapen and George, (1993a). Leaves from 10-

12 day old seedlings were used for initiating cultures. 5 mm leaf discs, including the midrib, were excised from the leaves with a cork borer, and cultured separately in 80 ml glass Sigma tubes with the abaxial side of the leaf disc in contact with the medium. The medium was composed of MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar (Appendix A9)) supplemented with 10 pM BA and 0.5 pM IAA (Appendix A9). After four weeks the leaf discs were transferred to the same medium except that the BA concentration was reduced from 10 pM to 5 pM. Small buds or shoots were subcultured onto MS basal medium with 0.5 pM BA for further shoot development. Shoots >3 cm in height were transferred to 1/2 MS basal medium (Appendix A9) containing 1 pM of NAA for root induction.

2.17.7 Regeneration of shoot meristems from mature groundnut zygotic em bryos

Based on a method described by Barwale et al., (1986). Mature zygotic embryos were excised from the groundnut and the apical and root meristems removed. The embryo explant was dissected longitudinally, cultured in the dark for seven days and then incubated under white light on OR medium (IX MS major salts, 4X minor salts, IX B5 vitamins, 0.2 pM NAA, 5.0 pM thiamine, 12 mM proline, pH 5.8 and 0.6% (w/v) agar (Appendix A9)) containing either 44.38, 89.77 or 133.15 pM BA. The plates were sealed Nescofilm which was then cut to create two one inch slits. After four weeks, shoots were excised and subcultured on MS30 medium (IX MS basal medium, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar (Appendix A9)) supplemented with 22.19 pM BA until they reached 3 cm in height at which time they were transferred onto MS30 medium supplemented with either 0.1, 1.0 or 10.0 pM NAA to promote root development.

2.17.8 Somatic embryogenesis from mature groundnut zygotic embryosBased on a method described by Eapen et al., (1993b). Zygotic embryos were

excised from surface sterilised seeds, and the apical and root meristems were removed. The embryo axes were first dissected in half longitudinally, and then cut in half horizontally to produce a separate apical and root oriented embryo explant. The explants were cultured on MS60 medium (IX MS basal medium, 6% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar (Appendix A9)) supplemented with 0.00, 2.26, 4.52,

50

9.05, 22.62 and 45.25 jiM 2,4-D. After four weeks, developing somatic embryos were excised from the embryo explant and cultured on hormone free MS60 medium. The original embryo explant was transferred onto fresh medium and cultured for a further four weeks.

2.17.9 Plant regeneration from half of a zygotic embryo with single cotyledon

The testa was discarded from the surface sterilised seed, and one of the cotyledons was removed leaving the embryo attached to the second cotyledon. Using a scalpel blade the immature and embryonic leaflets were excised and the embryo axes dissected in half, down the longitudinal axis, to leave an explant with one half of an embryo axis and one cotyledon. The explants were initially cultured dissected side down on filter paper soaked with 1.5 ml of liquid MS basal medium (IX MS basal medium. pH 5.8 (Appendix A9)). The plates were sealed with micropore tape. After the explants had germinated they were turned over. To prevent the germinating seeds from dehydrating 0.5-1.0 ml of liquid MS basal medium was placed onto the filter papers every 2-3 days. When the cotyledon turned green and had developed new shoots and at least two roots >1 cm in length, the explants were then transferred to soil/sand as described in Section 2.17.2.

2.18 Plant transformation2.18.1 Tobacco leaf disc transformation

Based on a method from Draper et al., (1988). 20 ml of LB containing antibiotic selection was inoculated with 5 ml of an o/n culture of A. tumefaciens and incubated at 25°C for 16-20 h as described in Section 2.5.3. Tobacco leaves from plants grown as described in Section 2.17.3 were cut into 1.5-3.0 cm2 pieces and immersed in liquid MS30 (Appendix A9). After approximately 100 leaf discs were prepared, the 20 ml of A. tumefaciens culture was added to the immersed leaf discs and left for 5 min. The leaf discs were removed and briefly dried on sterile filter paper before being placed abaxial side up on MS30 medium (Appendix A9). The leaf discs were cocultivated with the A. tumefaciens for three days. The leaf discs were then transferred onto MS30 medium supplemented with 50 mg/1 kanamycin, 200 mg/1 cefataxime (Appendix Al) and 4.44 (iM BA (Appendix A9). After 3-4 weeks putatively transformed shoots were subcultured onto MS30 medium containing 50 mg/1 kanamycin and 200 mg/1 cefataxime. Shoots that developed roots were transferred to soil and propagated under greenhouse conditions.

51

2.18.2 T-DNA dependent transient transformation assay for tobacco seed lings

Based on a method described by Rossi et al., (1993). Surface sterilised N. tabacum SRI seeds were germinated on filter paper, soaked with 2 ml of SDW, for two weeks. The A. tumefaciens culture was prepared by inoculating 10 ml of YEB (Appendix A2) containing the appropriate antibiotic selection with a single colony and growing o/n as described in Section 2.5.3. The A. tumefaciens strains C58C1, C58C3, EHA105 and LBA4404 were used for the transient transformation assays. These strains contained either the binary plasmids pMKC6 , pMKC12, or pMKC24. The o/n culture was centrifuged in a Sorval refrigerated bench top centrifuge at 3000 g for 10 min. The supernatant was removed and the pellet washed with 10 ml of 10 mM MgSC>4, then resuspended in liquid MS30 (Appendix A9) to an OD600 of 0.6.

Approximately 100 SRI seedlings were transferred to the A. tumefaciens solution, mixed and then subjected to vacuum infiltration at an atmospheric pressure of 25 inches of Mercury for 5 min. Afterwards, the seedlings were dried briefly on sterile blotting paper and transferred onto MS30A (Appendix A9). The seedlings were cocultivated with A. tumefaciens for three days. The seedlings then were washed three times with GEB (Appendix A8) to remove the A. tumefaciens. 30 seedlings were combined into one sample to be fluorimetrically assayed for GUS activity as described in Section 2.16.1. A second set of 30 seedlings were also analysed for GUS expression by the histochemical X-Gluc assay as described in Section 2.16.2.

2.18.3 T-DNA dependent transient transformation assay for groundnut tissue

Based on a method described by Rossi et al., (1993) and similar to the method described in Section 2.18.2 but with the following changes; a 100 ml culture of A. tumefaciens was prepared instead of 10 ml, and the A. tumefaciens pellet was washed with 100 ml of 10 mM MgS0 4 , then resuspended in liquid MS30 (Appendix A9) to an OD600 of 1.0. The A. tumefaciens strains C58C1, C58C3, EHA105 and

LBA4404 were used for the transient transformation assays. These strains contained either the binary plasmids pMKC6 , pMKC12, or pMKC24.

Cotyledons and mature zygotic embryos were excised from surface sterilised seed. The zygotic embryo was then dissected in half down the apical and root meristem axis to produce two zygotic embryo explants. For each transient transformation experiment either 10 cotyledon explants or 20 zygotic embryo explants were transferred to the A. tumefaciens solution, mixed and then subjected to vacuum infiltration at an atmospheric pressure of 25 inches of Mercury for 5 min. Afterwards, the groundnut explants were dried briefly on sterile blotting paper and transferred onto

52

MS30A (Appendix A9). The groundnut explants were cocultivated with the A. tumefaciens for three days on filter papers soaked with 1.5 ml of liquid MS30. The explants were then washed three times with GEB (Appendix A8) before GUS expression was analysed by the histochemical X-Gluc assay (Section 2.16.2).

2.18.4 A. tum efaciens-mediated in planta transformation of groundnutBased on a method described by McKently et al., (1995). The A. tumefaciens

strains EHA105 containing either the binary plasmid pMKC12 or pMKC24 were used for the in planta transformation of groundnut. Mature groundnut seeds were surface sterilised as described in Section 2.17.1. The two cotyledon halves were separated and the de-embryonated cotyledon was discarded. The immature leaflets were removed from the embryo, and the embryo was then wounded in three locations. 1.5-2.0 mm deep cuts were made to through the epicotyl, the two axillary buds, and down the hypocotyledonary axis. The explant was then infected with A. tumefaciens as described in Section 2.18.3. After three days the explants were washed three times with SDW containing augmentin at a concentration of 40 mg/1 (Appendix A l), and cultured on filters papers soaked with 1.5 ml of liquid MS basal (Appendix A9) supplemented with 44.38 pM BA. When the explants developed new leaves they were transferred to the growth cabinet and grown as described in Section 2.17.2. The explants were analysed for the presence of chimeric GUS sectors at the four or five quadrifoliate stage by removing a 5 mm2 piece of leaf from each leaf and histochemically assaying for GUS as described in Section 2.16.2.

2.19 Microprojectile bombardmentA PDS-1000, DuPont gunpowder driven microprojectile device was utilised

for transient expression assays.

2.19.1 Equalisation of plasmid DNABased on a method described by Dr. N. Bate, (per. comm.). For

microprojectile bombardment a plasmid DNA concentration of approximately 1 pg/p 1 was required. To determine the concentrations of the separate plasmid DNA samples 100 pi of each plasmid DNA was aliquotted into separate 1.5 ml tubes and used as the plasmid DNA stock. 5 pi of plasmid DNA from each plasmid DNA stock was mixed with 495 pi of SDW to give a one hundred fold dilution of the plasmid DNA stock. The diluted plasmid DNA was inverted five times, vortexed for 20 s then spun briefly, this mixing cycle was repeated again before the plasmid solution was left to stand for 10 min. 10 pi of plasmid dilution was then mixed with 1 pi of orange G loading dye

53

(Appendix A5) and run on a 1% agarose TAE gel at 80V with 10 pi of 1 kb DNA ladder as described in Section 2.9.1.

The amount of plasmid DNA loaded onto the gel represents a ten fold dilution of the actual plasmid DNA stock concentration because 10 pi of the one hundred fold diluted plasmid DNA stock was run the gel. Therefore, if the plasmid DNA stock concentration was 1 pg/pl the amount of DNA expected in 10 pi diluted plasmid DNA would be 100 ng. In order to obtain plasmid DNA stock concentrations of approximately 1 pg/pl, the diluted plasmid DNA samples run on the agarose gel were compared against the 1.6 kb DNA band of 1 kb DNA ladder which represents 10% of the total amount of DNA in the 1 kb DNA ladder stock. Therefore, for every 1 pg of 1 kb DNA ladder loaded, 100 ng of 1 kb DNA ladder is present in the 1.6 kb DNA band. Thus, by comparing the amount of DNA in the diluted plasmid DNA samples against the 1.6 kb DNA band the appropriate dilutions of the plasmid DNA stocks could be made.

When each plasmid DNA stock concentration was approximately 1 pg/pl, the plasmid DNA stocks were then equalised to the least concentrated plasmid DNA stock as previously described.

2.19.2 Preparation of the microprojectilesBased on a method described by Twell et a l, (1989). For tobacco leaves, 7 pi

of test plasmid DNA and 3 pi of reference plasmid DNA were used. For groundnut tissue 7 pi of test plasmid DNA and 6 pi of reference plasmid DNA were used. The test and reference plasmids were placed in 1.5 ml tubes, and the subsequent solutions were added to the plasmids and mixed by rapid pipetting for 10 s before the next solution was added; 25 pi of tungsten microprojectile solution (10 mg/ml); 25 pi of 1 M CaCl2; and 10 pi of 0.1 M spermidine. The mixtures were incubated at RT for 15 min to allow the DNA to precipitate onto the tungsten particles.

2.19.3 Preparation and bombardment of plant tissuesDuring the DNA/tungsten precipitation step, healthy, in vitro grown JL24

groundnut and tobacco leaves as described in Sections 2.17.2 and 2.17.3, respectively, were selected for bombardment. For tobacco, leaf sections of 6-10 cm2

were subcultured abaxial surface down on MS 30 medium plates (Appendix A9).After the DNA/tungsten solution had been left to precipitate for 15 min, 25 pi

of supernatant was removed and the tube sonicated briefly to break up the DNA/tungsten aggregates. 2 pi of DNA/tungsten suspension was pipetted onto the macroprojectile, which was then loaded into the barrel of the microprojectile bombardment device, followed by an explosive blank charge. A stopping plate was

54

positioned in the chamber and the tobacco leaf sample placed 75 mm away from the stopping plate. The chamber was evacuated to an atmospheric pressure of 84.6 kPa (0.835 atmospheres or 25 inches of mercury), and the charge was set off with a steel punch struck with a hammer. The bombarded leaf samples were cultured on the MS30 medium plates and sealed with Nescofilm. The leaves were incubated for 16 h under continuous illumination at 25°C before being assayed.

For groundnut, cotyledon, leaf and stem tissues were bombarded as described above with the following amendments; 3 |il of DNA/tungsten suspension was used; and the distance between the stopping plate and leaf sample was 50 mm. After bombardment, the groundnut tissues were subcultured on MS30 medium and incubated for 16 h under continuous illumination at 25°C before being either fluorimetrically of histochemically assayed for GUS activity.

55

Chapter 3

Groundnut tissue culture and regeneration

3.1 IntroductionThe main objective of the work described in this chapter was to establish an

efficient and reproducible tissue culture system for four Indian groundnut cultivars; JL24, Plover, Robert-21 and TMV-2. At the outset of this study there was only one reported plant regeneration method for the Indian groundnut cultivars being investigated, and that was for the cultivar TMV-2 (Atreya et al., 1984). TMV-2 groundnut plants were regenerated by embryo axis culture. Mature zygotic embryo axes were cultured on hormone-free Murashige and Skoog (MS) basal medium. This was found to be adequate for supporting the development of whole plants from embryo culture (Atreya et al., 1984). However, plant regeneration did not arise de novo from either undifferentiated or differentiated tissues but from the culturing of the mature groundnut embryo. Therefore, due to the absence of a proper de novo plant regeneration system for the four Indian groundnut cultivars, a range of alternative groundnut in vitro tissue culture systems were evaluated. They included shoot organogenesis from mature cotyledons (McKently et al., 1990), shoot organogenesis from mature cotyledons segments (Atreya et al., 1984) shoot organogenesis from leaf discs (Eapen and George, 1993a), regeneration of shoot meristems from mature zygotic embryos (Barwale et al., 1986), and somatic embryogenesis from mature groundnut zygotic embryos (Eapen and George, 1993b).

Limited growth cabinet space made it difficult to ensure an adequate supply of immature groundnut seed at the correct developmental stage. Consequently, only mature seed or germinated plant material was used to evaluate the various in vitro tissue culture systems.

3.2 ResultsTMV-2 was predominantly used in the initial tissue studies because most of the

seeds were viable and free from contamination, but more importantly germination was reasonably uniform, thereby ensuring a constant supply of plant material of approximately the same developmental stage for tissue culture. In contrast, Robert-21 seeds were found to be non-viable during the evaluation of the shoot organogenesis from mature cotyledons regeneration system, and therefore omitted from tissue culture studies. As the evaluations progressed, the focus of the tissue culture gradually switched from TMV-2 to JL24 due to the diminishing availability of TMV-2 seed.

3.2.1 Shoot organogenesis from mature de-embryonated cotyledonsSurface sterilised mature groundnuts were separated to give two cotyledon

halves; the whole embryonated cotyledon and whole de-embryonated cotyledon. The mature embryo and residual embryonic tissues were removed from both types of

57

cotyledon. To induce shoot organogenesis from the de-embryonated cotyledon, the explants were cultured on McKently regeneration medium (IX MS basal salts, 110.9 pM (25 mg/1) benzyladenine (BA), 2 mg/1 glycine, 0.5 mg/1 nicotinic acid, 0.1 mg/1 pyridoxine HC1, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) (McKently et al., 1990). Pre-existing axillary meristems are known to be present in the axils of germinated seedlings, and can give rise to shoots that are indistinguishable from the primary shoot (Kerstetter and Hake, 1997). To ensure that the shoot regeneration was from adventitious shoot development and not from axillary meristems; embryonic protrusions were removed from the proximal region of the cotyledon seven days after culture initiation. Histological examination of the cotyledon explants should have been conducted to confirm that all the pre-existing shoot or axillary meristems in the proximal region were removed, and also to ensure that the regenerating shoot buds were adventitious in origin. Unfortunately, this was not carried out. Therefore, the precise origin of the regenerated shoot buds remains unresolved. Consequently the regenerated shoots obtained from the cotyledon explants have not been classified as either adventitious or axillary shoots.

Following removal of the embryonic protrusions, the cotyledon explants were returned to McKently regeneration medium and cultured for a further four weeks. The cotyledons from JL24, Plover and TMV-2 enlarged and turned green within 10-14 days. After 14-21 days, the proximal region thickened and green compact callus was observed at the area adjacent to where the embryo axis had been removed (Figure3.1 A). At the distal end, white friable callus formed on the split surface of the cotyledon explants (Figure 3.1 A). Regeneration of shoot buds typically occurred after 14-21 days. These only appeared to develop from the proximal region of the cotyledon, especially from the area where the embryo was previously attached (Figure 3. IB). The majority of shoot buds formed directly from the cotyledonary tissue though a limited number did develop indirectly from the green callus, as shown in Figure 3.1C. The cotyledon explants frequently developed multiple shoots which consisted of clusters of shoot buds at different stages of development. In addition to the normal shoot buds, malformed and fasciated shoots were also found amongst the clusters of shoots as shown in Figures 3.IB and 3.1C.

The shoot buds were transferred to MS30 medium supplemented with 4.44 pM BA and 5.37 pM a-naphthaleneacetic acid (NAA) for 2-3 passages of four weeks each until the shoot buds developed into shoots. The shoots were then cultured on MS30 medium supplemented with 5.37 pM NAA to promote rooting. After six months of culturing during which the shoots were transferred to fresh medium at intervals of four weeks, the shoots had failed to produce roots. Instead the shoots

58

continued to mature and form weak plantlets which developed a limited of number of flowers before dying, or they remained small and unresponsive.

All 81 of the Robert-21 cotyledon explants cultured on the McKently regeneration medium remained completely unresponsive throughout a two month period of continuous tissue culture (Table 3.1). It was suspected that the poor response of the Robert-21 to McKently regeneration medium was due to the culturing of non- viable seed rather than the lack of regeneration potential exhibited by the cotyledon explants. To determine whether the batch of Robert-21 seed being used were viable; twenty seeds were grown under in vivo conditions, and twenty seeds were grown under in vitro conditions. Empirical observations obtained from the other three Indian groundnut cultivars indicated that seed germination generally occurred within twenty- four to forty-eight hours post-planting. Early signs of germination typically included increased swelling of the seed which was followed by rapid elongation of radicle and the seed turning green. After four weeks none of the Robert-21 seeds had germinated. When the seeds were examined there were no apparent indications of germination. Although a viability stain was not used to verify the viability of the seed, it was decided that from the seed germination results that the Robert-21 seed were non-viable, and therefore omitted from further tissue culture studies. In addition, the results from tissue culture of Robert-21 cotyledon explants were not included in statistical analysis of the responses of JL24, Plover and TMV-2 cotyledon explants to McKently regeneration medium.

Significant differences in the frequency of callus regeneration were observed among the three cultivars; JL24, Plover and TMV-2 (X2=36.4, 2 df, P<0.001) (Table3.1). Response ranged from 23.2% for cultivar Plover to 54.8% for TMV-2 (Table3.1). However, the frequency of shoot regeneration between the JL24, Plover and TMV-2 mature cotyledon explants was not significantly different (X2=3.2, 2 df, P<0.95) (Table 3.1). NB. Data from Robert-21 were omitted from the statistical tests.

3.2.2 Shoot organogenesis from mature de-embryonated groundnut cotyledon segments

Cotyledon explants proximal to the embryo axes have been reported to be highly responsive to shoot organogenesis in groundnut (Atreya et al., 1984) and pea (Ozcan et a l , 1992). To evaluate the potential of the cotyledonary area proximal to the embryo axes for plant regeneration, and also to investigate the potential variations in response to shoot organogenesis between different regions on the cotyledon, mature cotyledons were dissected into three segments; the proximal (explants proximal to the embryo axes), middle and distal explant segments, and cultured on MS medium supplemented with different concentrations of BA (0.0-44.38 |xM) (Figure 3.2A). The

59

cotyledon explant segments enlarged and turned pale green within 5-7 days of culture. Callus was observed initiating from the cut surfaces of the cotyledon segments after 7- 12 days of culture. The two types of callus developed from the cotyledon explants, and these could be broadly classified into two groups; green compact callus or white friable callus (Figure 3.2B). The frequency of green compact callus and white friable callus formation varied between the three different cotyledon explants. Furthermore, the proportion of the two types of callus differed between the three types of cotyledon explant and between the different BA concentrations. The data are summarised in Table3.2.

The frequency of callus formation from responsive proximal, middle, and distal cotyledon explant segments were 16.4%-21.4%, 6.3%-19.2% and 10.1%- 20.0%, respectively, over the BA concentration range (2.22-44.38 pM). The proportion of green compact to white friable callus formed by proximal and distal segments was reasonably constant with respect to different concentrations of BA. The ratio of green compact callus to white friable callus exhibited by the proximal segments was about 1:1, as compared to the response from the distal segments which showed a ratio of 4:1 in favour of white friable callus formation. In contrast, the type of callus formed by the middle segment appeared to influenced by the concentration of BA; the greater the concentration of BA, the higher the frequency of the explants producing white friable callus relative to the explants developing green compact callus. No significant differences in the frequency of callus regeneration were observed among the proximal cotyledon explants cultured on MS basal medium with and without BA (X2=0.09, 1 df, P<0.95) (Table 3.2). However, significant differences in the frequency of callus regeneration were observed among the middle cotyledon explants (X2=4.55, 1 df, P<0.05) (Table 3.2) and the distal cotyledon explants (X2=4.16, 1 df, P<0.05) (Table 3.2) cultured on MS basal medium with and without BA. An analysis of variance test indicated that there were significant differences between BA concentration (2.22, 4.44, 8 .88 , 22.19 or 44.38 pM BA) and the frequency of callus regeneration from middle cotyledon explants (F=2.68, 4 df and 626 df, P=0.05) (Table 3.2), but not between BA concentration and the frequency of callus regeneration from distal cotyledon explants (F=1.80,4 df and 626 df, P=0.05) (Table 3.2).

Regeneration of shoot buds occurred after 2-3 weeks of culture, they only appeared from the green compact callus formed at the area adjacent to the embryo attachment point on the proximal explant segments. The data are summarised in Table3.3. Shoot buds developed from the proximal segment over the complete range of BA concentrations tested. An analysis of variance test indicated that there were significant differences between BA concentration (0.00, 2.22, 4.44, 8 .8 8 , 22.19 or 44.38 pM BA) and the frequency of shoot regeneration from proximal cotyledon explants

60

(F=3.81, 5 df and 750 df, P=0.01) (Table 3.3). Overall the frequency of shoot organogenesis from the cotyledonary segments was low, with only twelve shoot buds being recovered from a total of 631 cotyledonary explant segments. The shoot buds were cultured as described in Section 3.2.4 to promote shoot and then root regeneration. But as discussed earlier, the shoots failed to develop healthy roots with normal morphology.

3.2.3 Shoot organogenesis from leaf discsHigh frequency plant regeneration via shoot organogenesis from leaf discs was

previously reported in the groundnut (Arachis hypogaea L. ssp. fastigata) var. TAG- 24 (Eapen and George, 1993a). They showed that in vitro regeneration was influenced by the combination of BA and indole-3-acetic acid (LAA), both of which were necessary for the induction of high frequency groundnut regeneration. Leaf discs from Plover and TMV-2 were evaluated using the method described by Eapen and George, (1993a). The leaf discs enlarged and thickened within 10-14 days of culture on MS basal medium supplemented with 10 pM BA and 0.5 pM LAA. Compact green callus initially formed from the basal end of the midribs, then subsequently at the edges of the leaf discs (Figure 3.3 A). After four weeks of culture, profuse callus development was mainly from the basal end of the midrib, although it also continued to develop from the distal end of midrib (Figure 3.3B). Shoot organogenesis was typically observed after 3-4 weeks of culture, and was restricted to the callus at the basal end of the midrib. In general, the shoot buds occurred singly from the callus. Even when multiple shoot buds developed, the buds regenerated from separate positions on the callus. After four weeks, small buds or shoots were subcultured onto MS basal medium with 0.5 pM BA for further shoot development; while the leaf disc explants were transferred onto fresh medium supplemented with 5 pM BA and 0.5 pM IAA. The responses of Plover and TMV-2 leaf discs cultured on the shooting medium are summarised in Table 3.4.

Callus developed from all the leaf discs of both cultivars cultured on the medium, but only 1 (1.4%) Plover and 3 (2.3%) TMV-2 leaf discs developed shoot buds. No significant differences in the frequency of callus regeneration (X2=0.0, 1 df, P=1.0) (Table 3.4), or frequency of shoot regeneration (X2=0.19, 1 df, P<0.95) (Table 3.4) were observed among the two cultivars. Extended culturing of the leaf explants did not lead to further shoot bud development. Furthermore, the callus on the leaf discs eventually turned brown after 8-10 weeks. Shoots >3 cm in height were transferred to rooting medium. The shoots derived from the leaf discs remained unresponsive to the rooting medium after six months of culturing.

61

3.2.4 Regeneration of shoot meristems from mature zygotic embryosTransgenic groundnut plants from two widely cultivated groundnut cultivars

(Florunner and Florigiant) have been obtained via the microprojectile bombardment of shoot meristems from mature embryonic axes (Brar et al., 1994). The benefit of this regeneration system was that it did not rely on tissue culture to induce the shoots. Utilising this method, shoot buds were obtained from the shoot meristems of mature zygotic embryos of JL24 and Plover cultured on OR medium with high concentrations of BA (44.38, 89.77, 133.15, 177.52 or 221.90 pM BA). These data are presented in Tables 3.5 and 3.6. The embryo explants expanded and turned green within 10-14 days of culture. Small amounts of callus formed at the root end of the embryo and on some of the vascular tissue from the dissected surface of the embryo. After 4-6 weeks of culture, shoot regeneration was observed from areas close to where the apical meristem was excised as shown in Figure 3.4. The regenerated shoot meristems were transferred onto shoot elongation medium (MS30 medium supplemented with 22.19 pM BA) to encourage further shoot growth.

Significant differences in the frequency of shoot regeneration were observed among the JL24 zygotic embryo explants cultured on OR medium with and without BA (X2= 168.1, 1 df, P<0.001) (Table 3.5). No shoots were produced from the zygotic explants cultured on OR medium only. The presence of BA was required to induce shoot regeneration. There was, however, no significant difference in the frequency of shoot regeneration observed among the JL24 zygotic embryo explants cultured on OR medium supplemented with either 44.38, 89.77, 133.15, 177.52 or 221.90 pM BA (X2=l . l , 4 df, P>0.99) (Table 3.5). The frequency of shoot regeneration from the JL24 embryo explants only ranged from 79.2% for 177.52 pM BA to 87.0% for 133.15 pM BA. The number of shoots that formed per responsive embryo explant was significantly different among the different BA concentrations (F=2.97, 4 and 217 df, P<0.05) (Table 3.5). Response ranged from 9.9 ± 1 . 4 for 177.52 pM BA to 14.7 ± 1.3 for 133.15 pM BA. t-Test analysis demonstrated that a BA concentration of 133.15 pM stimulated the highest average number of shoots per responsive embryo explant (P<0.05). No significant difference were observed between the four remaining BA concentrations (P>0.1).

Significant differences in the frequency of shoot regeneration were observed among the Plover zygotic embryo explants cultured on OR medium with and without BA (X2= 183.2, 1 df, PcO.OOl) (Table 3.6). As with JL24, the presence of the hormone BA in OR medium was necessary for promoting shoot regeneration. The frequency of shoot regeneration ranged from 70.8% for 177.52 pM BA to 88.4% for 44.38 pM BA. Analysis of the response indicated there was no significant difference in the frequency of shoot regeneration observed between explants cultured on OR

62

medium supplemented with either 44.38, 89.77, 133.15, 177.52 or 221.90 pM BA (X2=6.3, 4 df, P<0.99) (Table 3.6). However, an analysis of variance test indicated that there was a significant difference between BA concentration and the average number of shoots produced per responding explant (F=7.37, 4 and 254 df, P<0.01) (Table 3.6). The average number of shoots produced per responding explant ranged from 12.9 ±1 .6 for 177.52 pM BA to 21.1 ± 1.3 for 221.90 pM BA. f-Tests for small samples were carried out to detect differences in the average number of shoots produced per responsive embryo explant at different BA concentrations. Significant difference were detected between BA concentrations. A BA concentration of 133.15 pM stimulated the highest average number of shoots per responsive embryo explant (P<0.01). No significant differences were observed between the average number of shoots per responsive embryo explant and four other BA concentrations (44.38, 89.77, 177.52 and 221.90 pM BA) (P>0.1).

Due to the lack of success in stimulating root development from the regenerated shoots as previously discussed in Sections 3.2.1, 3.2.2 and 3.2.3, shoots >1 cm in height were cultured on MS30 medium supplemented with either 0.0,0.1, 1.0 or 10.0 pM NAA to induce root formation. Culturing the regenerated shoots on medium containing NAA did lead to rooting, however, the frequency of for both groundnut cultivars was low. The data are presented in Table 3.7. In addition, root formation was frequently restricted to a single, thick, stunted, non branching root per regenerated shoot. Moreover, the roots only emerged from callus formed at the dissected end of the shoot which was previously attached to the embryo axes. However, even when the shoots successfully developed roots, most of the plantlets failed to develop further. As with the plantlets discussed in Section 3.2.1, 3.2.2 and 3.2.3, only small weak plantlets, with one or two of flowers, developed from the regenerated shoot before dying. Alternatively, the dissected end of the shoot turned brown, eventually leading to the necrosis of the entire shoot explant.

No significant differences in the frequency of root regeneration were observed among the JL24 shoot explants cultured on MS30 medium supplemented with either 0.0, 0.1, 1.0 or 10.0 pM NAA (X2=4.39, 3 df, P<0.95) (Table 3.7). The frequency of rooting was poor, and ranged from 4.3% for 0.1 pM to 6.3% for 10.0 pM. For Plover, significant differences in the frequency of root regeneration were observed among the shoot explants cultured on MS30 medium supplemented with either 0.0, 0.1, 1.0 or 10.0 pM NAA (X2=9.77, 3 df, P<0.05) (Table 3.7). The frequency of rooting was poor, and ranged from 3.9% for 10.0 pM to 9.6% for 0.1 pM. However, when only the results from the shoots explants cultured on MS30 medium containing NAA were used for analysis, no significant differences were observed between the

63

frequency of root regeneration at different NAA concentrations (F=1.05, 2 df and 235 df, P=0.05) (Table 3.7).

3.2.5 Somatic embryogenesis from mature groundnut zygotic embryo axes

Regeneration of groundnut via somatic embryogenesis has been previously reported from several types of groundnut tissue (Hazra et al., 1989; Sellars et al., 1990; Baker and Wetzstein, 1992; Gill and Saxena, 1992; Ozias-Akins et al., 1992; Eapen and George, 1993b). Mature zygotic embryo axes of JL24 were evaluated for somatic embryogenesis and subsequent plant development. The embryo explants were cultured on MS medium containing 2,4-D to induce somatic embryogenesis. The embryo explants expanded and turned light green after approximately 2-3 days of culture. Within 7-10 days, callus initiation was observed initially at the apical ends of both the apical-oriented and root-oriented embryo explants, then progressively from the cut surface of the embryo axes and the root ends of the explants. All the concentrations of 2,4-D used stimulated callus development. However, the type of callus initiated did vary markedly according to the concentration of 2,4-D as shown in Tables 3.8 and 3.9. At low concentrations of 2,4-D, between 0.0-4.52 pM, green compact callus developed from some of the apical-oriented and root-oriented explants at a frequency of 12.5%-81.1% and 12.5%-82.1%, respectively. While at higher concentrations of 2,4-D, between 9.05-45.25 pM, green callus initially formed on the embryo explants then subsequently changed to white friable callus within 2-3 weeks of culture (Figure 3.5C). No significant differences in the frequency of callus regeneration were observed among the apical-end oriented explants cultured on MS60 medium supplemented with either 0.00, 2.26, 4.52, 9.05, 22.62 or 45.25 pM 2,4-D (X2=9.43, 5 df, P<0.95) (Table 3.8). There were, however, significant differences in the frequency of callus regeneration among the root-end oriented explants cultured on MS60 medium supplemented with either 0.00, 2.26, 4.52, 9.05, 22.62 or 45.25 pM2,4-D (X2=57.59, 5 df, P<0.001) (Table 3.9). However, if the results from 45.25 pM 2,4-D were omitted from the X2 test there would be no significant difference in the frequency of callus regeneration observed among the root-end oriented explants cultured on MS60 medium supplemented with either 0.00, 2.26, 4.52, 9.05 or 22.62 pM 2,4-D (X2=6.07, 5 df, P<0.95) (Table 3.9).

Structures bearing a shoot and root apex developed from the embryo explants after 3-4 weeks of culture (Figure 3.5A and 3.5B). The physical appearance of these bipolar bodies was characteristic of previously described somatic embryos obtained by somatic embryogenesis from groundnut zygotic embryos (Hazra et al., 1989; Ozias- Akins et al., 1992). Clusters of somatic embryos were frequently observed

64

regenerating from the embryo explants as shown in Figures 3.5A and 3.5B. Within each cluster, somatic embryos of different shapes and sizes and at various states of development could be found. This suggested that somatic embryogenesis in JL24 mature zygotic embryos was asynchronous. The formation of somatic embryos occurred predominantly on the apical-oriented embryo explants with 43.0% of the total number of responsive apical-oriented embryo explants developing somatic embryos, as compared to only 1.3% of the root-oriented embryo explants. An analysis of variance test indicated that there were significant differences between 2,4-D concentration and the frequency of somatic embryogenesis from apical-oriented embryo explants (F=11.35, 5 df and 184 df, P=0.01) (Table 3.8), but no significant differences were observed between 2,4-D concentration and the frequency of somatic embryogenesis from root-oriented embryo explants (F=0.22, 5 df and 61 df) (Table 3.9). Somatic embryogenesis from the apical-oriented embryo explants was highest at 45.25 pM of2,4-D where the frequency of response was 78.1% (P<0.002), producing an average on 5.3 somatic embryos per explant. The frequency of somatic embryogenesis from apical-oriented and root-oriented embryo explants are summarised in Tables 3.8 and 3.9, respectively.

The somatic embryos remained dormant when left attached to the embryo parental explant, even when the explants were transferred to fresh medium. Furthermore, prolonged incubation of the explants on embryo induction medium did not induce additional somatic embryogenesis. Instead, it caused the apical-oriented embryo explant tissues that were in contact with medium to turn brown, this eventually spread to the whole of the explant except the somatic embryos. In contrast, the root- oriented embryo explants continued to produce white friable callus. The somatic embryos derived from the embryo explants were transferred to hormone free medium to promote the germination of the embryos. Of the 356 somatic embryos cultured, 319 developed roots (Figure 3.5C and D) though none of them formed into plantlets.

3.2.6 Plant regeneration from half of a zygotic embryo with single cotyledon (HESC) explants

Attempts to regenerate groundnut plants from mature zygotic embryo axis, cotyledon and leaf explants using the previously discussed in vitro regeneration systems were not successful. The failure to regenerate plants by either shoot organogenesis or somatic embryogenesis led to the evaluation of non tissue culture based regeneration methods. Regeneration of healthy, fertile groundnut plants has been previously achieved through the culturing of mature zygotic embryos (Atreya et a l ,

65

1984; Schall et al., 1993). These culture methods did not involve lengthy and complicated in vitro culture techniques. Results presented in Section 4.2.9, which involved studies between groundnut tissue type and Agrobacterium tumefaciens strain compatibility, indicated that wounded mature JL24 zygotic embryos were highly susceptible to infection by A. tumefaciens. Therefore, the development of a procedure for producing fertile groundnut plants from mature zygotic embryo explants offered an exciting opportunity for the genetic transformation of groundnut. Since the work described in Section 4.2.9 showed that the wounding of the zygotic embryo was important for A. tumefaciens transformation, zygotic embryos were dissected in half along the shoot and root meristem axis in order to expose the embryo tissues to infection. The two cotyledons of the seed were separated into leave one cotyledon explant with an attached zygotic embryo. After the zygotic embryo had been cut in half the explant was subsequently referred to as a half of a zygotic embryo with single cotyledon (HESC) explant. A similar type of zygotic embryo explant had been successfully employed to produce transgenic groundnut using an A. tumefaciens- mediated transformation system of mature zygotic embryo axes (McKently et al., 1995).

The HESC explants (Figure 3.6A) were placed dissected side down on filter paper prewetted with liquid MS basal medium (IX MS basal medium. pH 5.8). The HESC explants germinated after 2-3 days of culture with the embryo axes expanding and turning green (Figure 3.6B). Within 3-7 days, the zygotic embryo axes became well defined, and new leaflets and roots began emerging from the explants (Figure 3.6C). Once the explants had developed 2-3 healthy roots that were >1 cm in length, they were propagated in a growth cabinet. The plantlets matured into healthy plants which flowered and set seed. The seeds were collected and germinated in sterilised soil to ensure that the seed derived from the regenerated plants were viable. The regeneration frequency of JL24, Plover and TMV-2 explants and the number of viable seeds produced are summarised in Table 3.10.

Regeneration frequency ranged from 83.3% for Plover to 100% for JL24, and the average number of seeds produced per regenerated embryo explant ranged from3.2 for JL24 to 5.5 for Plover. An analysis of variance test indicated that there were no significant differences observed between either the three groundnut cultivars (JL24, Plover and TMV-2) and the frequency of regeneration (F=0.57, 2 df and 27 df) (Table 3 .10), or between the three groundnut cultivars and the mean number of seed produced from each regenerated explant (F=2.62, 2 df and 23 df) (Table 3.10). The frequency of seed germination from the regenerated zygotic embryo explants ranged from 59.2% for TMV-2 to 100% for JL24. Both analysis of variance and X2 tests indicated that there were significant differences in the frequency of seed germination among the three

66

cultivars (X2=36.4, 2 df, P<0.001; F=5.85, 2 df and 102 df, P=0.01) (Table 3.10). Seed with the greatest degree of viability were obtained from cultivar JL24, where a 100% frequency of germination was observed (PcO.OOl).

3.3 Discussion3.3.1 Plant regeneration in groundnut

The development of in vitro tissue culture techniques to enable reproducible plant regeneration is essential for the successful exploitation of recombinant DNA and gene transfer technologies for the improvement of major crop species. Plant regeneration has been achieved in a number of legume species (reviewed in Flick et al., 1983; Allavena, 1984; Phillips and Collins, 1984; Tabe et al., 1993). In general, however, in vitro plant regeneration has been limited to a small number of cultivars and genotypes within each legume species, and even then complete regeneration is often restricted to specific cell- or tissue-types (see Tables 3.11, 3.12 and 3.13). Legume regeneration has been difficult, more so with the seed legumes than with the forage legumes (Philips and Collins, 1979; Mroginski and Kartha, 1984). These include a number of economically important seed legume species such as broad bean (Viciafaba L.), chickpea (Cicer arietinum L.), common bean (Phaseolus vulgaris L.), groundnut, lentil (Lens culinaris L.), pea (Pisum sativum L.) and pigeon pea (Cajanus cajan L.), and forage legumes such as alfalfa (Medicago sativa L.), red clover (Trifolium pratense L.) and white clover (T. repens L.).

Plant regeneration in groundnut has been achieved through shoot organogenesis and somatic embryogenesis. Adventitious shoot organogenesis has been previously described in groundnut tissues such as cotyledons (McKently et al.,1989), and leaf tissues or leaf-derived callus tissues (Seitz et al., 1987; McKently et al., 1991; Eapen and George, 1993). Somatic embryogenesis has been obtained from a wide-variety of tissues including immature zygotic embryo axes (Hazra et al., 1989; Sellars et al., 1990; Ozias-Akins et al., 1992), mature zygotic embryos (McKently et al., 1991b), immature leaflets (Chengalrayan et al., 1994), mature leaves (Baker and Wetzstein, 1992), embryonic callus (Ozias-Akins et al., 1992) and embryonic cell suspensions (Durham and Parrott, 1992).

Plant regeneration can be achieved directly or indirectly from cultured cells and tissues. Direct regeneration occurs from a single or group of differentiated cells. Whereas indirect regeneration involves the establishment of a dedifferentiated cell which may undergo a number cell divisions before regeneration into a plant. Plants regenerated from undifferentiated tissue culture may contain somaclonal variations (Larkin and Scowcroft, 1981). Polyploidy, aneuploidy and chromosome rearrangements in the cultured cells can cause genetic instability (Larkin and

67

Scowcroft, 1981). Somaclonal variation can be generated by several different tissue culture methods including callus culture. Therefore, groundnut tissue culture systems which involve a callus phase for plant regeneration should be avoided (reviewed in Reisch, 1983).

3.3.2 Influence of genotype variation on plant regenerationComplete groundnut plants have been successfully regenerated from a variety

of cell-, tissue- and organ-types but significant differences in plant regeneration have been reported between different groundnut genotypes and cultivars (McKently et al., 1990; Sellars et al., 1990). Seitz et al. (1987) studied the effect of genotypic variation on regenerative response in immature leaflet cultures, and found significant differences in callus and root formation among forty-seven groundnut genotypes. Ozias-Akins et al. (1992) observed that somatic embryogenesis and subsequent plant regeneration from immature cotyledons and zygotic embryos varied significantly among seven genotypes. McKently (1995), using a single culture medium to promote somatic embryogenesis from mature zygotic embryos, demonstrated that frequency of somatic embryo formation differed among fourteen groundnut genotypes.

Genotypic influence on the frequency of plant regeneration has also been reported both between and within many other legume species. Oelck and Schieder (1983 cited from Seitz et al., 1987) found significant differences in regeneration potential between the legume species broad bean, groundnut, soybean (Glycine max L.), alfalfa, T. repens, T. resupinatum and Melilotus officinalis Med. Their showed that the regenerative potential between cultivars within the same species were compared, and only the cultivars of T. repens, T. resupinatum and M. officinalis Med. varied significantly. Distinct genotypic variation in regenerative response has been reported among the cultivars of other legumes including soybean (Parrott et al., 1989), pea (Bencheikh and Gallais, 1996) and Lathyrus sativus L. (Gharyal and Maheshwari, 1983).

Genotypic variation is probably the single most important factor determining the efficiency of in vitro tissue culture in both legume and non-legume plant species (reviewed in Evans et al., 1983; Sharp et al., 1984). Genotypic variation not only determines the totipotency of the plant cell, but also their response to the tissue culture conditions (reviewed in Evans et al., 1983; Sharp et al., 1984). Tissue culture conditions have been optimised for a number of groundnut genotypes and cultivars, although many of these are for American varieties not Indian (Seitz et al., 1987; Ozias- Akins et al, 1992; McKently et al., 1995). Unfortunately, groundnut regeneration is very dependent on the genotype in culture. Thus tissue culture systems developed for

68

one genotype may not necessarily be as efficient and reproducible at promoting plant regeneration for a different genotype.

3.3.3 Establishing a plant regeneration system: General considerationsA systematic approach to establishing a plant regeneration system is to study

the response of explants under a range of different tissue culture conditions. Although this can often be laborious and unproductive, it can yield valuable information on the responsiveness of different explants in culture and the sort of tissue conditions which can stimulate either callus formation, organogenesis or somatic embryogenesis. The observations from these preliminary experiments can then be used to focus attention on specific aspects of the tissue culture treatment which may improve the response of the explant. Key components which can affect the efficiency of regeneration include culture medium, carbohydrate source, the type and concentration of hormone, duration of exposure to hormone treatment, temperature and light conditions (reviewed in Evans et al., 1983).

The sequential approach to developing optimum tissue culture conditions can often involve numerous combinations of treatments particularly if the cells or tissues are recalcitrant. Statistical tests are routinely employed to determine whether the various tissue culture conditions have a significant affect on the response of the explants in culture. A probability (P) or least significant difference (LSD) level of 0.05 (5%) or less has been found convenient for ordinary tests of significance in general scientific work (Bailey, 1981). In this way, individual tissue culture conditions can be varied, and their effects on the cultured explant can then be compared. This procedure can be used to optimise either single or a combination of tissue culture conditions. One of the main problems with this approach, as discussed previously, is genotypic variation in regenerative capacity. The age, origin and regenerative potential of the explant used for establishing the tissue culture is also another important consideration since this can dictate both the route of plant regeneration and the time taken to achieve it (reviewed in Evans et al., 1983). Furthermore, plant regeneration may be dependent upon the complex synergistic action of two or more in vitro and/or environmental parameters to create the appropriate tissue culture conditions (reviewed in Evans et al., 1983; Sharp et al., 1984).

To carry out a wide-ranging investigation of numerous tissue culture conditions involving a sufficient number of explants in each treatment for statistical analysis requires an abundant supply of plant material. The plant material used during this work was derived either directly from mature groundnut seed or from germinated plants grown to the appropriate developmental stage. Only mature plant material was used during the evaluation of different tissue culture conditions even though plant

69

regeneration has been successfully achieved from immature groundnut tissues (see Table 3.13). The supply of immature plant material was restricted by the lack of adequate growing facilities. Mature groundnut seed was supplied by ICRISAT, Hyderabad, India. However, the availability of seed from ICRISAT was at times limited. During the groundnut growing season most of the available seed stocks at the research centre were sown for field studies. Stocks would remain low until the end of the groundnut growing season whereupon fresh batches of seed were obtained. The procurement of seed from ICRISAT was further delayed by the Indian governments strict custom and excise regulations imposed on the export of plant material for scientific research.

3.3.4 Plant regeneration via organogenesis and somatic embryogenesis: Approaches to evaluating the influence of different auxins and cytokinins

To thoroughly investigate all the numerous possible tissue culture factors which could influence plant regeneration from all four of the Indian groundnut cultivars would require an enormous amount of time, effort and resources. For example, a systematic approach for evaluating the regenerative potential of mature groundnut seed could involve at least six types of seed explant; whole embryonated cotyledon, whole deembryonated cotyledon, zygotic embryo axis, immature leaflets, sectioned embryonated cotyledon (SEC) and sectioned deembryonated cotyledon (SDC). The regenerative potential of the different seed explants could be studied under varying concentrations of cytokinins and auxins. Adventitious shoot organogenesis, in general, requires both a cytokinin and an auxin in the culture medium. An initial evaluation may involve a simple set of culture conditions such as a single cytokinin and auxin combination e.g. BA or kinetin (KIN) with either IAA or indole-3-butyric acid (IBA). If the six different concentrations of cytokinin (e.g. 0.0, 10.0, 20.0, 30.0, 40.0 and 50 pM) and three different concentrations of auxin (e.g. 0.0, 1.0 and 2.0 |iM) were to be used in the initial evaluation, this would generate 18 randomised treatments.

Plant regeneration via somatic embryogenesis in groundnut and other seed legumes often involves complex and sequential tissue culture treatments (Barwale et al., 1986; Kysely and Jacobsen, 1990; Baker and Wetzstein, 1992; Eapen and George, 1993). Typically, the primary medium used to initiate somatic embryogenesis contains an auxin such as 2,4-D, NAA, picloram or 2,4,5-trichlorophenoxy-acetic acid (2,4, 5- T). The secondary or maturation medium is often similar to the primary medium but with either much lower concentrations of auxin or with no auxins. Abscisic acid (ABA), gibberellic acid (GA3), cytokinins (e.g. BA, KIN, 2iP and zeatin) and

70

activated charcoal can also be included in the secondary medium as these additional components may improve somatic embryo maturation and promote subsequent plant growth (Ammirato, 1983; Eapen and George, 1993; Ozias-Akins et al., 1993). Following culture in the secondary medium, mature somatic embryos can be transferred to a shoot induction medium supplemented with cytokinins (e.g. BA or KIN) and auxins (e.g. IAA, IBA or NAA). Somatic embryos with well developed shoots can either be directly planted into soil, or subcultured onto root induction medium containing NAA or IBA and then transferred into soil after the somatic embryos have formed roots (reviewed in Ammirato, 1983).

In groundnut, the primary and secondary mediums are normally sufficient to induce of somatic embryogenesis and subsequent plant development (Baker and Wetzstein, 1992; Durham and Parrott, 1992; McKently, 1995), though in some tissue culture systems both the shoot and root induction mediums are necessary for complete plant regeneration (Gill and Saxena, 1992; Ozias-Akins et al., 1992; Eapen and George, 1993).

For an evaluation of a two culture medium regime, four separate auxins (e.g.2,4-D, NAA, picloram or 2, 4, 5-T) could be tested at five different concentrations (e.g. 0.0, 10.0, 20.0, 40.0 and 80.0 pM) in the primary medium, and in the secondary medium two concentrations of auxin could be used; 0.0 and 0.5 pM. This would generate a total 22 randomised treatments (20 primary medium treatments and 2

secondary medium treatments). If shoot and root induction mediums were required for plant regeneration this would invariably increase the number of treatments.

If the two previously described shoot organogenesis and somatic embryogenesis approaches were used to evaluate the regenerative capacity of seed explants, then at least 40 treatments per type of seed explant would be required. It is essential to determine whether the responses from the explants are significantly different between various types of explants and treatments, since this would influence which types of explant, tissue culture conditions and routes of plant regeneration to investigate further. In general, two replicates for each treatment, with a minimum of 10 viable explants per treatment, would provide enough data to conduct reliable statistical tests. Therefore 800 samples are required for each type of explant. Given that there are at least six types of seed explant, the total number of explants involved in the initial evaluation would be in excess of 4 800. Although this is a large quantity of plant material, the number of explants is probably similar to that used in the evaluation explants derived from immature seed or growing plants.

Unfortunately, due to the limited availability of plant material, the number treatments involved in the evaluation had to be restricted or delayed. Even if the shoot organogenesis and somatic embryogenesis experiments were separated and initiated at

71

different stages, the time and effort involved in establishing and maintaining all the different tissue culture treatments would still be considerable, especially if the explants and regenerating plantlets have to be repeatedly subcultured onto new culture mediums. In addition, the plant material used in this investigation was also required for the development of in vitro gene transfer methods (see Chapter 4).

An alternative approach would be select explants which have been previously reported to have high regenerative potentials, and to culture them under in vitro conditions which have also been reported to be successful at promoting plant regeneration. Although this method lacks originality it does however have several advantages over the previously described approach. Firstly, by choosing only the types of explants that have a high regenerative capacity it reduces the number of different explants that have to be tested. In groundnut, plant regeneration has been achieved routinely using cotyledons (McKently et al., 1989; Durham and Parrott, 1992; Ozias-Akins et al., 1992), leaf explants (Baker and Wetzstein, 1992; Eapen and George, 1993) and zygotic embryos (Hazra et al., 1989; Sellars et al., 1990), but infrequently from petiole, hypocotyl or intemode explants (Kanyard et al., 1994). Secondly, the influence of key variables including culture medium (Bajaj et al., 1981 cited from Bajaj, 1984; Atreya et al., 1984) carbohydrate source (Eapen and George, 1993) and growth regulators (Eapen and George, 1993a and 1993b) have been previously studied and optimised for a number groundnut genotypes and cultivars. By analysing these results it may be possible to focus attention on a smaller, more specific set of tissue culture conditions critical to plant regeneration. Thirdly, since this alternative approach involves both fewer types of explant and treatments it requires less plant material.

This alternative approach was used to develop an efficient and reliable plant regeneration system for the four Indian groundnut cultivars. It was hoped that by testing several tissue culture systems, one of them may stimulate moderate to high frequencies of plant regeneration in one or more of the Indian cultivars. If this occurred then the strategy for this investigation would switch to using the previously described systematic approach to optimise tissue culture conditions. The in vitro tissue culture systems evaluated were shoot organogenesis from mature cotyledons (McKently et al.,1990), shoot organogenesis from leaf discs (Eapen and George, 1993a), regeneration of shoot meristems from mature zygotic embryos (Barwale et al., 1986), shoot organogenesis from mature cotyledons segments (Atreya et al., 1984) and somatic embryogenesis from mature groundnut zygotic embryos (Eapen and George, 1993b).

72

3.3.5 Plant regeneration via shoot organogenesisInitially groundnut regeneration was attempted via shoot organogenesis. Many

plant species, generally, requires a cytokinin and an auxin in the culture medium to promote adventitious shoot organogenesis (reviewed in Evans et al., 1983; Sharp et al., 1984). Hormone concentrations for seed legume shoot organogenesis are usually highly specific with the concentration of auxins reduced or concentrations of cytokinins increased (Flick et al., 1983). For example, adventitious shoot organogenesis in soybean cotyledonary node and cotyledon explants was induced using 0.2. pM NAA and 13.3 pM BA (Barwale et al., 1986) and 0-2.5 pM IBA and 5-10 pM BA (Mante et al., 1989), respectively. Low auxin to cytokinin ratios have also used by Eapen and George (1993) (0.5 pM IAA and 10 pM BA) and Cheng et al. (1996) (5.4 pM NAA and 44.4 pM BA) to initiate adventitious shoot organogenesis in groundnut leaf explants. However, not all seed legumes require a low auxin to cytokinin ratio to promote adventitious shoots. In pea, prolific shoot regeneration occurred when callus derived from immature cotyledons were cultured on MS medium containing a high auxin (21.5 pM NAA) to cytokinin (2.2 pM BA) ratio (Ozcan et al., 1992). The hormone regimes used in forage legume regeneration can be less specific. Shoot formation from red clover cotyledons and meristems has been induced using 0.03 pM picloram and a wide range of concentrations of BA (0.05-44.4 pM) (Phillips and Collins, 1979 cited from Flick et al., 1983), while plant regeneration from birdsfoot trefoil {Lotus comiculatus L.) only required 0.44 pM BA to induce adventitious shoot development from stem explants (Swanson and Tomes, 1980 cited from Flick et al., 1983).

The plant regeneration method described by McKently et al. (1990), initiated shoot organogenesis from mature cotyledon explants cultured on McKently regeneration medium which contained BA but no auxins. Using this low auxin to cytokinin ratio regeneration medium, McKently et al. (1990) was able to obtain shoot regeneration in 14 groundnut genotypes with an efficiency between 44% to 94%. Adventitious shoot organogenesis from cotyledons has been achieved in other seed legumes using medium supplemented with BA only. For example, with mature soybean cotyledon explants cultured on regeneration medium containing BA at 5.0,7.5 or 10 pM with IBA at 0.0, 1.25 or 2.5 pM, it was found that BA alone was sufficient to promote shoot regeneration (Mante et al., 1989). The highest frequency of shoot regeneration was achieved at 7.5 pM BA with no IBA. In addition, it was shown that the frequency of shoot formation was reduced when IBA was included in the regeneration medium (Mante et al., 1989). High frequency adventitious shoot regeneration (85-90%) from immature pea cotyledons has also been achieved using only BA (Ozcan et al., 1992). Their study evaluated the affects of different auxin

73

(NAA and IBA) to cytokinin (BA) ratios. Only 1 of 16 auxin with cytokinin treatments achieved a shoot regeneration frequency greater than that of the BA treatment alone. The highest frequency of shoot regeneration (93%) occurred at 42.9 pM NAA and2.2 pM BA followed by 17.7 pM BA (90%) and 8.8 pM BA (88%). However, no statistical tests were performed on this data, and without them the results cannot be compared or considered as statistically significant (Ozcan et al., 1992). Nevertheless, this study did show that shoot organogenesis could be induced using a cytokinin (BA).

Shoot buds were obtained from the mature cotyledons of JL24, Plover and TMV-2 using the shoot organogenesis method described by McKently et al. (1990). In this study, shoot buds only appeared to develop from the proximal region of the cotyledon, especially from the area where the embryo was previously attached. The frequency of shoot regeneration from JL24 (10.8%), Plover (5.6%) and TMV-2 (11.5%) was low. This could be due the fact that there was no direct contact between the medium and the wound surface where regeneration occurs. Recalcitrant cotyledon tissues such as those in the middle and distal portions may also influence regeneration. For example, the quiescent parts of the cotyledon could be sequestering or degrading growth regulators and nutrients in the culture medium thereby altering the in vitro conditions for regeneration.

To investigate whether increased surface contact with the culture medium, or the separation of the regenerative from non-regenerative tissues would affect shoot organogenesis, the mature JL24 cotyledons were dissected into proximal, middle and distal segments, and cultured on MS medium containing different concentrations of BA. Shoot bud formation was observed only in the proximal segments explants.

The potential for shoot organogenesis in this region of cotyledon has been previously reported in several other groundnut cultivars (Atreya etal., 1984; McKently et al., 1990), soybean (Mante et al., 1989) and pea (Ozcan et al., 1992). Those studies indicate a possible gradient of regenerative potential from the proximal to the distal region of the cotyledon. However, the changes to the JL24 cotyledon explants did not increase the frequency of shoot regeneration. This probably suggests that cells in this proximal region of the JL24 cotyledon explants either have a lower regenerative capacity or have not been cultured under the optimal in vitro conditions to promote shoot organogenesis. In the latter situation, the addition of an auxin (e.g. LAA, IBA or NAA) in the regeneration medium may improve the frequency of shoot organogenesis (reviewed in Evans et al., 1983; Sharp et al., 1984).

Shoot organogenesis was also evaluated in leaf disc explants. Leaf discs from 10-12 day old Plover and JL24 seedlings were prepared and cultured on MS medium containing 0.5 pM IAA and 10 pM BA as described by Eapen and George (1993a). Shoots regeneration occurred indirectly from a callus intermediary formed at the basal

74

end of the leaf disc midrib. The frequency of shoot regeneration from Plover (1.4%) and TMV-2 (2.3%) were very low compared to that reported in Arachis hypogaea L. ssp. fastigata var. TAG-24 (33.3%) (Eapen and George, 1993a). This could be due to the fact that the tissue culture conditions for callus initiation and shoot organogenesis are different. To achieve high frequency shoot organogenesis, two types of culture medium may be necessary; a callus inducing medium to produce the appropriate type of callus (green and compact), and a shoot inducing medium to stimulate the regeneration of normal shoots.

Callus induction can be stimulated by either the application of auxins or cytokinins (reviewed in Flick et al., 1983). The most commonly used auxins include2,4-D, NAA, IAA, IBA, 2,4,5-T and picloram, the cytokinins include BA and KIN. A high auxin to cytokinin ratio is often used to initiate callus cultures in many, but not all legume species (reviewed in Flick et al., 1983). In general, most legume species require higher concentrations of cytokinin for callus induction than do other dicotyledonous plant species (Flick et al., 1983). The low auxin (0.5 jiM IAA) to cytokinin (10 pM BA) ratio used by Eapen and George (1993a) favours shoot organogenesis rather than callus formation. This may have been appropriate for their groundnut cultivar but not necessarily for Plover and TMV-2. Sequential treatment of Plover and TMV-2 leaf disc explants on callus inducing medium followed by shoot inducing medium may improve shoot regeneration.

Due to low frequencies of shoot organogenesis from cotyledon and leaf disc explants an alternative approach to shoot regeneration was evaluated; plant regeneration via shoot meristems derived from mature embryonic axes. This method had been developed for soybean regeneration (Barwale et al., 1986), and was subsequently used for the successful transformation of groundnut (Brar et al., 1986). Using the method described by Barwale et al. (1986), multiple shoots were obtained from the cultured JL24 and Plover shoot meristems. However, shoots could not be converted into plantlets because they were unable develop a healthy root system. The same problem was encountered with shoots regenerated from the cotyledon and leaf disc explants.

Root formation from regenerated shoots is often more easily achieved in seed legumes than in forage legumes (Flick et al., 1983). Shoots derived from seed legumes quite readily initiate roots when cultured on medium supplemented with an auxin (e.g. IAA, IBA and NAA), or even on hormone-free medium as with soybean (Barwale et al., 1986). Root development among the seed legumes can be very efficient. For example, in pea, 80-90% of regenerated shoots rooted on half strength MS medium containing 4.9 pM IBA (Ozcan et al., 1992), while in groundnut the rooting response of 14 different cultivars ranged from 25% to 95% when the shoots were cultured on MS medium containing 5.4 pM NAA (McKently et al., 1990).

75

In an attempt to stimulate root development, JL24 and Plover shoots were cultured on MS medium supplemented with either 0.1, 1.0 or 10.0 pM NAA. NAA is an auxin often used to initiate of root formation, and has been reported to effective in the several different groundnut cultivars (Atreya et al., 1984; McKently et al., 1990; Dunbar and Pittman, 1992; Eapen and George, 1993a; Brar et al., 1994). Lateral root primordia are generally initiated through the commencement of cell division in the pericycle. Since NAA can stimulate cell division in the pericycle, the inclusion of NAA in the culture medium should promoted root formation. Unfortunately, addition of NAA did not have a significant affect on the root formation of the JL24 and Plover shoots. This poor rooting response may be caused by several factors such as slow cell division and differentiation rates in the pericycle, and the presence of auxin antagonists (e.g. cytokinins) which could inhibit cell division in the pericycle and root primordia initiation. In addition, if root development occurs in two distinct steps; initiation of root primordia followed by root elongation, then different culture mediums may be required. Prolonged culture on root induction medium might inhibit or delay subsequent elongation of the root. This, however, is unlikely to be the cause of the low rooting frequencies because single rooting treatments have been used previously in several groundnut regeneration methods without any reported problems (Atreya et al., 1984; McKently et al., 1990; Dunbar and Pittman, 1992; Eapen and George, 1993a; Brar et al., 1994). The type of auxin used to induce root formation could also be the cause of poor rooting response. To investigate this, regenerated shoot explants could be cultured on medium containing IAA or IBA. Histological examination could be used to follow the progress of root primordia initiation and development. These observations could indicate whether the culture treatments are affective or if additional treatments are required to promote efficient root formation.

3.3.6 Plant regeneration via somatic embryogenesisThe phenomenon of somatic embryogenesis was first observed in cultures of

mature carrot (Daucus carota L.) phloem parenchyma cells derived from the storage taproot (Steward, 1958 cited from Evans et al., 1984). Since then, somatic embryogenesis has been reported in many plant taxa (Williams and Maheswaran,1986). Plant regeneration via somatic embryogenesis has been achieved in several seed legumes including chickpea (Suhasini et al., 1994), groundnut (Hazra et al., 1989), pea (Jacobsen and Kysely, 1984) and soybean (Barwale etal., 1986) (Tables 3.11 and 3.13), and in several forage legumes including alfalfa, red clover, white clover, (Maheswaran and Williams, 1984) (Table 3.13). In somatic embryogenesis, embryos are initiated through the culturing of somatic tissues rather than by maturation of excised zygotic embryos. Somatic embryos develop as bipolar structures bearing an

76

apical and root meristem, both of which are necessary for producing morphologically and developmental^ normal embryos, and eventually whole plants. The development of somatic embryos closely resembles that of zygotic embryos, particularly during the globular and heart/torpedo stages (Zimmerman, 1993). Somatic embryos can develop either indirectly from callus or directly from differentiated tissues without the need of an intermediate callus stage (Williams and Maheswaran, 1986).

Somatic embryogenesis from several groundnut cultivars including some economically important varieties such as Florigiant and Florunner (Brar et al., 1994) has been reported (Hazra et al., 1989; Sellars et al., 1990; Baker et al., 1992; Gill and Saxena, 1992; Eapen and George, 1993b). Chengalrayan et al. (1994) showed that high frequency somatic embryo induction and plant conversion could be induced in JL24. This study was of particular interest since JL24 was one of the four Indian cultivars being evaluated. In this work, however, experiments to evaluate the compatibility of various types of JL24 groundnut explants to A. tumefaciens-mediated transformation showed that the mature zygotic embryo axes were highly susceptible to infection but not the embryo derived leaflets (Section 4.2.10). Therefore, somatic embryogenesis was only attempted with the JL24 mature embryo axes even though there was a plant regeneration system developed for the leaflet explants.

Mature JL24 zygotic embryo axes were divided into two separate embryo explants; one apical-oriented end and one root-oriented end, and then cultured on MS medium supplemented with 2,4-D. Somatic embryogenesis occurred directly from the zygotic embryo explants. The somatic embryos obtained exhibited mainly a broad, fan­shaped morphology. Prolific somatic embryo induction occurred predominantly from the apical-oriented embryo explants. This variation in regenerative capacity had been observed in other tissues from groundnut (Atreya et al., 1984) and pea (Ozcan et al., 1992), and suggests that significant differences in embryogenic potential exist between the apical-oriented and root-oriented embryo explants.

2,4-D has been shown to be one of the more effective auxins at stimulating high frequency somatic embryogenesis in several legume species such as groundnut (Hazra et al., 1989; Eapen and George, 1993b), pea (Kysely and Jacobsen, 1990) and soybean (Lazzeri et al., 1987). The somatic embryos induced from the JL24 embryos did not develop into plants even though almost all the embryos developed normal roots on hormone free medium. This failure of the somatic embryos to convert into plantlets and plants could be associated with the use of 2,4-D. Although 2,4-D is effective at producing high frequency somatic embryogenesis and high average numbers of somatic embryos per explant, problems of plant conversion have been reported in groundnut (Eapen and George, 1993b; Chengalrayan et al., 1994).

77

Wetzstein and Baker (1993), showed that conversion frequency and plant development, but not the rate of conversion were related to embryo morphology. In their study, 2,4-D was used to induce somatic embryogenesis in immature groundnut cotyledon explants. A range of somatic embryos with different morphologies were generated. These embryos were classified into six groups based on axis and cotyledon development, and whether the embryos were single or fused. Embryos with a normal bipolar appearance had a conversion frequency of 40-47%, and developed into single­axis plants. Broad, fan-shaped embryos converted at a frequency of 38%, and often resulted in plants with multiple branches and fused stems. Horn-shaped embryos exhibited the lowest conversion frequency (7%), and these would generally fail to form shoots. Wetzstein and Baker (1993) also found that in more abnormal classes of somatic embryos, lower conversion rates were associated with poorly developed shoot meristems. Abnormal development of either the epicotyl pole (Kerns et al., 1986) or shoot apex (Trigiano et al., 1988) could be responsible for the failure of normal shoot growth and consequently embryo conversion.

Auxins such as dicamba (Eapen and George, 1993b), IPA (Eapen and George, 1993b), NAA (Eapen and George, 1993b), picloram (Ozias-Akins et al., 1992; Eapen and George, 1993b) and 2,4,5-T (Sellars et al., 1990; Eapen and George, 1993b) have also been used promote somatic embryogenesis in groundnut. Eapen and George, (1993b) showed that although dicamba, NAA and picloram were not as effective as2.4-D at stimulating somatic embryogenesis, conversion of the dicamba-, NAA- and picloram-induced somatic embryos was more efficient than 2,4-D-induced embryos. Lazzeri et al. (1987) investigated the affects of hormones on soybean somatic embryogenesis. Their study found that somatic embryo morphology varied depending on the auxin: NAA-induced embryos resembled zygotic embryos more than did the2.4-D-induced embryos. NAA-induced embryos exhibited distinct hypocotyls, cotyledons and shoot meristems. Whereas the 2,4-D-induced embryos had indistinct hypocotyls, poorly-defined cotyledons and no obvious shoot meristem (Lazzeri et al.,1987).

The somatic embryos recovered from the JL24 zygotic embryo axes were induced using 2,4-D, and closely resemble the broad, fan-shaped and faciated-types of embryos described by Wetzstein and Baker (1993) and Lazzeri et al. (1987). This abnormal morphology was probably caused by 2,4-D, and may account for the poor conversion frequency. To overcome this problem, the influence of different auxins (e.g. dicamba, NAA and picloram) on somatic embryogenesis from mature JL24 zygotic embryos and subsequent embryo conversion could be investigated.

Somatic embryogenesis can also be influenced by cytokinins (reviewed in Ammirato, 1983). Primary induction mediums supplemented with an auxin and a

78

cytokinin have been used to promote high frequency somatic embryogenesis in several seed legume species including chickpea (5.6 |iM 2,4-D and 1.2 pM KIN) (Kumar et al., 1994), and winged bean {Psophocarpus tetragonolobus (L.) DC.) (0.5-2.7 pM NAA and 4.4-8.8 pM BA) (Gupta et al., 1997). Sellars et al., (1990) evaluated the potential of somatic embryogenesis from three groundnut cultivars and A . paraguariensis (wild Arachis species). In their investigation immature zygotic embryos were cultured on L2 medium supplemented with various hormone treatments all of which contained an auxin (either 2,4-D, NAA or picloram) and a cytokinin (either BA or KIN). All the treatments were found to be effective at inducing high frequency somatic embryogenesis. In addition, Sellars et al., (1990) found that the frequency of shoot and root development varied between somatic embryos induced by the different treatments and between the Arachis genotypes. However, studies of somatic embryogenesis from groundnut (Eapen and George, 1993b), pea (Kysely and Jacobsen, 1990) and soybean (Lazzeri et al., 1987) showed that the addition of BA, KIN or 2iP to auxin containing medium had either no effect or reduced somatic embryo production.

The inclusion of cytokinins in the primary medium treatment may or may not be beneficial for promoting somatic embryogenesis depending upon the groundnut cultivar, but they are important in encouraging somatic embryo maturation (Eapen and George, 1993b; Chengalrayan et al., 1994). Cytokinins, in either the embryo maturation medium or shoot germination medium, have aided the conversion of embryos into plantlets in several seed legumes such as groundnut (Ozias-Akins et al., 1992; Eapen and George, 1993b; Chengalrayan et al., 1994), chickpea (Dineshkumar et al., 1995), pea (Ozcan et al., 1993) and winged bean (Gupta et al., 1997).

Somatic embryos, unlike zygotic embryos, do not normally experience desiccation or dormancy, and therefore may lack the appropriate stimuli to form into plantlets. Many of treatments for promoting somatic embryo maturation and growth are probably designed to mimic the stages which the zygotic embryos undergoes during its development. Durham and Parrott (1992) reported that the frequency embryo conversion in groundnut could be significantly enhanced by subjecting somatic embryos to a short period of desiccation. Incorporation of ABA, BA, KIN, zeatin, gibberellins and activated charcoal in the maturation medium have also been reported to improve embryo development, germination and conversion (reviewed in Ammirato, 1983).

The effect of ABA on somatic embryogenesis has been studied in carrot and Carum (caraway) cultures (reviewed in Ammirato, 1983). ABA has been found to promote embryo maturation but inhibit abnormal embryo proliferation and repress precocious germination (reviewed in Ammirato, 1983). Gibberellins promote seed

79

germination, though little is known about the actual mechanisms involved (Pharis and King, 1985). However, there is increasing evidence to suggest that gibberellins are essential in early stages of zygotic embryogenesis. Swain et al., 1993 found that the lhl allele in pea reduced gibberellins levels in developing seed, and increased seed abortion. Activated charcoal has been used for somatic embryo development in many cultures including groundnut (Eapen and George, 1993b), date palm {Phoenix dactylifera L.) (Tisserat and De Mason, 1980 cited from Ammirato, 1983) and Carica stipulata L. (Litz and Conover, 1980 cited from Ammirato, 1983). Activated charcoal has been shown to absorb compounds that inhibit somatic embryogenesis such as 5- hydroxymethylfurfal (an inhibitor formed by sucrose degradation during autoclaving), auxins, cytokinins (Weatherhead et al., 1978 cited from Ammirato, 1983), phenylacetic and p-OH benzoic acids (Fridborg et al., 1978 cited from Ammirato, 1983). Therefore, by absorbing inhibitors and unwanted growth regulators from the medium, activated charcoal may be improving the conditions for somatic embryo maturation and conversion (reviewed in Ammirato, 1983).

3.3.7 Plant regeneration via half of a zygotic embryo with single cotyledon (HESC) explants

Regeneration of groundnut plants from the direct development of intact or partially intact mature zygotic embryo axes has been previously reported in groundnut (Atreya et al., 1984; Schnall and Weissinger, 1993), indicating that mature embryo axes could potentially be used in the regeneration of groundnut. There are several advantages to using mature zygotic embryo axes.

Firstly, regeneration occurs directly from differentiated embryonic tissues and is therefore, genetically more stable (reviewed in Reisch, 1983). Secondly, regeneration does not require growth regulators. This decreases the chances of the regenerants containing hormone-induced somaclonal variation (reviewed in Flick, 1983). Thirdly, plant regeneration is rapid and therefore, somaclonal variation associated with long-term tissue culture are unlikely to arise (reviewed in Reisch, 1983).

Plants regenerated from embryo axis culture by Atreya et al. (1984) were smaller than normal seedlings. In addition, Schnall and Weissinger (1993) found that the embryo explants took longer to mature and set seed when compared to conventionally grown plants. It was suggested that removal of the cotyledons deprived the germinating embryo axes of important nutrients necessary for normal plant growth (Atreya et al., 1984). Hence, the development of a rapid and simple method for producing fertile groundnut plants from HESC explants. It was based on persuading the modified groundnut explant to germinate under in vitro culture conditions.

80

The HESC explants regeneration system was developed to be used in conjunction with Agrobacterium-mediated transformation but without the need for antibiotics to suppress the A. tumefaciens. In order to prevent over infection by A . tumefaciens, a liquid plant culture medium was used in preference to a solid medium, because the types of agar commonly used to solidify most plant mediums often contain organic nutrients on which bacteria can grow. In addition, the humidity levels inside the tissue culture vessel was reduced by slitting the air tight sealant (per. comm. Dr. J . Wilkinson). The reduction in humidity levels prevented over infection by the A. tumefaciens.

Therefore, to accommodate the aforementioned criteria, the half of a zygotic embryo with single cotyledon explants were cultured on the liquid MS basal medium prewetted filter papers, and sealed with micropore tape. The liquid MS basal medium was sufficient to promote rapid, normal growth of shoots and roots from the dissected embryo axes. The development of the embryo axes did not require the addition of sucrose, or the culturing of the explants on agar solidified MS medium to encourage plant growth as advocated in previous reports (Atreya et al., 1984; Schnall and Weissinger, 1993).

The number of roots present on the germinating embryo axis explants at the time of transfer to soil was reported to influence the subsequent development of the regenerated groundnut plants (Atreya et al., 1984). Therefore, 2-3 healthy roots were allowed to develop from the half of a zygotic embryo with single cotyledon explants prior to their transfer to soil. The importance of allowing the embryo axis explants to develop roots before planting in soil was highlighted by the low regeneration frequency of A. tumefaciens infected embryo with single attached cotyledon (EAC) explants reported by McKently et al. (1995). McKently et al. (1995) directly transferred the EAC explants into soil after they were cocultured with A. tumefaciens, thereby denying the explants the opportunity to initiate any roots. In their study, only 20% of the EAC explants survived the physical wounding and A. tumefaciens infection to germinate. Whereas in this study, A. tumefaciens infected HESC explants (described in Section 3.2.6) exhibited a regeneration frequency of 60%; three times higher than the EAC explants (McKently et al., 1995). After the HESC regeneration system was shown to produce fertile plants from the Indian groundnut cultivars JL24, Plover and TMV-2, the half of a zygotic embryo with single cotyledon explants were then evaluated for the regeneration of transgenic plants via Agrobacterium-mediatQd transformation as described in Section 4.2.13.

Of the six methods of groundnut regeneration studied, only one was successful in producing fertile plants; the half of a zygotic embryo with single cotyledon explants system. Two other methods had potential; somatic embryogenesis from mature zygotic

81

embryo axis explants, and shoot meristems derived from mature embryonic axes. Though it was possible to regenerate shoots and somatic embryos from the mature zygotic embryo axes, converting the regenerated explants into mature plants was still the main problem. In order to address this, a more focused evaluation needs to be conducted to determine the factors influencing the proper development of both the regenerated shoots and somatic embryos explants.

82

Groundnutcultivar

Number of explants

Frequency of callus regeneration (%)

Frequency of shoot bud regeneration (%)

JL24 166 (5)a 28.9 10.8Plover 125 (4) 23.2 5.6

Robert-21 81(2) 0.0 0.0TMV-2 157 (5) 54.8 11.5

Table 3.1 Shoot organogenesis from mature groundnut cotyledons of four Indian groundnut cultivars cultured on McKently regeneration medium (IX MS basal salts, 110.9 |nM BA (25 mg/ml), 2 mg/1 glycine, 0.5 mg/1 nicotinic acid, 0.1 mg/1 pyridoxine HC1, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar). Observations were made eight weeks after the cultures were initiated. a Represents the number of replicates. There were a minimum of 20 explants per treatment. Significant differences in the frequency of callus regeneration were observed among the three cultivars; JL24, Plover and TMV-2 (X2=36.4, 2 df, P<0.001). However, no significant differences in the frequency of shoot regeneration were observed between JL24, Plover and TMV-2 (X2=3.2, 2 df, P<0.95). NB. Data from Robert-21 were omitted from the chi-square statistical test.

83

BAconcentration

(UM)

Number of explants

Frequency of callus regeneration (%)

Proximalsegment

Middlesegment

Distalsegment

0.0 125 18 .4(60.9)a (39. l)b

4 .8(0.0) (100.0)

6 .4(40.0) (60.0)

2.22 132 2 0 .4(40.7) (59.3)

9 .8(69.2) (30.8)

11 .4(20.0) (80.0)

4.44 126 2 1 .4(55.5) (44.5)

6 .3(50.0) (50.0)

1 1 .9(20.0) (80.0)

8.88 129 2 0 .1(42.3) (57.7)

10 .1(30.8) (69.2)

1 0 .8(35.7) (64.3)

22.19 125 1 9 .2(33.3) (66.7)

1 9 .2(12.5) (87.5)

2 0 .0(20.8) (79.2)

44.38 119 16 .8(50.0) (50.0)

10.1(8.3) (91.7)

10 .1(25.0) (75.0)

Table 3 .2 Response of JL24 cotyledon segments to different BA concentrations. Callus development from mature de-embryonated groundnut cotyledon segments cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar) supplemented with either 0.0, 2.22, 4.44, 8.88, 22.19 or 44.38 pM BA. Observations were made four weeks after the cultures were initiated. The experiment was organised in two replicates, with a minimum of 50 explants per treatment. a The percentage of the callus being green and compact, and b the percentage of the callus being white and friable. No significant differences in the frequency of callus regeneration were observed among the proximal cotyledon explants (X2=0.09, 1 df, P<0.95) cultured on MS basal medium with and without BA. However, significant differences in the frequency of callus regeneration were observed among the middle cotyledon explants (X2=4.55, 1 df, P<0.05) and the distal cotyledon explants (X2=4.16, 1 df, P<0.05) cultured on MS basal medium with and without BA. Analysis of variance test indicated that there were significant differences between BA concentration (2.22, 4.44, 8.88, 22.19 or 44.38 pM BA) and the frequency of callus regeneration from middle cotyledon explants (F=2.68, 4 df and 626 df, P=0.05), but not between BA concentration and the frequency of callus regeneration from distal cotyledon explants (F=1.80, 4 df and 626 df, P=0.05).

84

BA concentration (HIM)

Num ber of explan ts

Frequency of shoot regeneration (%)

Proximalsegment

Middlesegment

Distalsegment

0.0 125 0 .0 0 .0 0 .02.22 132 0 .7 0 .0 0 .04.44 126 1 .6 0 .0 0 .08.88 129 3 .9 0 .0 0 .0

22.19 125 1 .6 0 .0 0 .044.38 119 1 .7 0 .0 0 .0

Table 3 .3 Response of JL24 cotyledon segments to different BA concentrations. Shoot regeneration from mature de-embryonated groundnut cotyledon segments cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar) supplemented with either 0.0, 2.22, 4.44, 8.88, 22.19 or 44.38 |xM BA. Observations were made four weeks after the cultures were initiated. The experiment was organised in two replicates, with a minimum of 50 explants per treatment. Analysis of variance test indicated that there were significant differences between BA concentration (0.00, 2.22, 4.44, 8.88, 22.19 or 44.38 pM BA) and the frequency of shoot regeneration from proximal cotyledon explants (F=3.81, 5 df and 750 df, P=0.01).

85

Groundnutcultivar

Number of explants

Frequency of callus regeneration (%)

Frequency of shoot bud regeneration (%)

Plover 72 (3)a 100 1.4 (l)bTMV-2 132 (5) 100 2.3 (3)

Table 3.4 Shoot organogenesis from Plover and TMV-2 leaf discs cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar) supplemented with 10 pM BA and 0.5 pM IAA). Observations were made eight weeks after the cultures were initiated. a Represents the number of replicates and b the number of shoots produced. There were a minimum of 20 explants per treatment. No significant differences in the frequency of callus regeneration (X2=0.0, 1 df, P=1.0), or frequency of shoot regeneration (X2=0.19, 1 df, P<0.95) were observed among the two cultivars.

86

Groundnutcultivar

BA(pM )

Numbero f

explants

Frequency of shoot regeneration

(%)

Average no. of shoots/regenerat­

ing explant± SE

JL24 0 60 (3)a 0.0 0.0 ± 0.044.38 69 (3) 85.5 10.6 ± 0.689.77 71(3) 85.9 11.3 ± 0 .9133.15 77 (3) 87.0 14.7 ± 1.3177.52 24(1) 79.2 9.9 ± 1.4221.90 20(1) 85.0 11.5 ± 1.4

Table 3.5 Effect of BA on shoot regeneration from mature zygotic embryos of JL24 cultured on OR medium (IX MS major salts, 4X minor MS salts, IX B5 vitamins, 0.2 fxM NAA, 5.0 pM thiamine, 12 mM proline, pH 5.8 and 0.6% (w/v) agar) supplemented with either 0.0, 44.38, 89.77, 133.15, 177.52 or 221.90 |iM BA. Observations were made eight weeks after the cultures were initiated. a Represents the number of replicates. There were a minimum of 20 explants per treatment. Significant differences in the frequency of shoot regeneration were observed among the JL24 zygotic embryo explants (X2= 168.1, 1 df, P<0.001) cultured on OR medium with and without BA. No significant differences in the frequency of shoot regeneration were observed among the JL24 zygotic embryo explants (X2= l.l , 4 df, P>0.99) cultured on OR medium supplemented with either 44.38, 89.77, 133.15, 177.52 or 221.90 pM BA. However, analysis of variance test indicated that there was a significant difference between BA concentration and the average number of shoots produced per responding explant (F=2.97, 4 and 217 df, P<0.05).

87

Groundnutcultivar

BA(pM )

Numbero f

explants

Frequency of shoot regeneration

(% )

Average no. of shoots/regenerat­

ing explant± SE

Plover 0 60 (3) 0.0 0.0 ± 0.044.38 86 (3) 88.4 14.3 ± 0.889.77 83 (3) 87.9 16.0 ± 1.0

133.15 78 (3) 87.2 21.2 ± 1.3177.52 24(1) 70.8 12.9 ± 1.6221.90 30(1) 83.3 14.2 ± 1.6

Table 3.6 Effect of BA on shoot regeneration from mature zygotic embryos of Plover cultured on OR medium (IX MS major salts, 4X minor MS salts, IX B5 vitamins, 0.2 |xM NAA, 5.0 jiM thiamine, 12 mM proline, pH 5.8 and 0.6% (w/v) agar) supplemented with either 0.0, 44.38, 89.77, 133.15, 177.52 or 221.90 pM BA. Observations were made eight weeks after the cultures were initiated. a Represents the number of replicates. There were a minimum of 20 explants per treatment. Significant differences in the frequency of shoot regeneration were observed among the Plover zygotic embryo explants (X2= 183.2, 1 df, P<0.001) cultured on OR medium with and without BA. No significant differences in the frequency of shoot regeneration were observed among the Plover zygotic embryo explants (X2=6.3, 4 df, P<0.99) cultured on OR medium supplemented with either 44.38, 89.77, 133.15, 177.52 or 221.90 |iM BA. However, analysis of variance test indicated that there was a significant difference between BA concentration and the average number of shoots produced per responding explant (F=7.37, 4 and 254 df, P<0.01).

88

Groundnutcultivar

NAA (pM) Number of explants

Frequency of root regeneration (%)

JL24 0 68 0.00.1 70 4.31.0 81 4.910.0 111 6.3

Plover 0 103 0.0

0.1 73 9.61.0 89 5.6

10.0 76 3.9

Table 3 .7 Effect of NAA on root regeneration from shoots regenerated from the mature embryo axes of JL24 and Plover. MS30 medium (IX MS basal medium, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) supplemented with either 0.1, 1.0 or10.0 |iM NAA. Observations were made six months after the cultures were initiated. No significant differences in the frequency of root regeneration were observed among the JL24 shoot explants (X2=4.39, 3 df, P<0.95) cultured on MS30 medium supplemented with either 0.0, 0.1, 1.0 or 10.0 pM NAA. Significant differences in the frequency of root regeneration were observed among the Plover shoot explants (X2=9.77, 3 df, P<0.05) cultured on OR medium supplemented with either 0.0, 0.1,1.0 or 10.0 p,M NAA. However, analysis of variance test indicated that there was no significant differences between NAA concentration and the frequency of root regeneration (F=1.05, 2 df and 235 df, P=0.05).

89

2 ,4 -Dconcentration

(pM )

Numbero f

explants

Frequency of explants

producing callus (%)

Frequency of explants

producing embryos (%)

Mean no. of embryos per responding

explants

0.00 32 (2)a 100 .0(37.5)b (62.5)c

0 .0 0 .0

2.26 32 (2) 81 .1(12.5) (87.5)

6 .2 1 6 .0

4.52 32 (2) 8 7 .5(82.1) (17.9)

3 1 .2 4 .1

9.05 32 (2) 78 .1(24.0) (76.0)

53 .1 3 .2

22.62 30 (2) 8 3 .3(0.0) (100.0)

4 6 .7 5 .5

45.25 32 (2) 75(0.0) (100.0)

7 8 .1 5 .3

Table 3.8 Effect of different 2,4-D concentrations on induction of somatic embryos from apical-end oriented mature JL24 zygotic embryo explants. Somatic embryogenesis from mature zygotic embryo explants cultured on MS60 medium (IX MS basal medium, 6% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) supplemented with either 0.00, 2.26, 4.52, 9.05, 22.62 and 45.25 pM 2,4-D. Observations were made four weeks after the cultures were initiated. a Represents the number of replicates. There were a minimum of 14 explants per treatment, b The percentage of green compact callus, and c the percentage of white friable callus. No significant differences in the frequency of callus regeneration were observed among the apical-end oriented explants (X2=9.43, 5 df, P<0.95) cultured on MS60 medium supplemented with either 0.00, 2.26, 4.52, 9.05, 22.62 or 45.25 pM 2,4-D, but significant differences in the frequency of somatic embryogenesis were observed among the apical-end oriented explants (X2=60.99, 5 df, PcO.001). In addition, analysis of variance test indicated that there were significant differences between 2,4-D concentration and the frequency of somatic embryogenesis (F=l 1.35, 5 df and 184 df, P=0.01).

90

2 ,4 -Dconcentration

OiM)

Numbero f

explants

Frequency of explants

producing callus (%)

Frequency of explants

producing embryos (%)

Mean no. of embryos per responding

explants

0.00 32 (2)a 8 7 .5(50.0)b (50.0)c

0 .0 0 .0

2.26 32 (2) 100 .0(18.7) (81.3)

0 .0 0 .0

4.52 31(2) 9 6 .8(6.4) (93.6)

3 .2 4 .0

9.05 32 (2) 8 7 .5(0.0) (100.0)

3 .1 2 .0

22.62 30 (2) 9 3 .3(0.0) (100.0)

0 .0 0 .0

45.25 32 (2) 4 0 .6(0.0) (100.0)

0 .0 0 .0

Table 3.9 Effect of different 2,4-D concentrations on induction of somatic embryos from root-end oriented mature JL24 zygotic embryo explants. Somatic embryogenesis from mature zygotic embryo explants cultured on MS60 medium (IX MS basal medium, 6% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) supplemented with either 0.00, 2.26, 4.52, 9.05, 22.62 and 45.25 pM 2,4-D. Observations were made four weeks after the cultures were initiated. a Represents the number of replicates. There were a minimum of 14 explants per treatment, b The percentage of green compact callus, and c the percentage of white friable callus. Significant differences in the frequency of callus regeneration were observed among the root-end oriented explants (X2=57.59, 5 df, P<0.001) cultured on MS60 medium supplemented with either 0.00,2.26, 4.52, 9.05, 22.62 or 45.25 pM 2,4-D. However, if the results from 45.25 pM2,4-D were omitted from the X2 test there would be no significant differences in the frequency of callus regeneration were observed among the root-end oriented explants (X2=6.07, 5 df, P<0.95) cultured on MS60 medium supplemented with either 0.00,2.26, 4.52, 9.05 or 22.62 pM 2,4-D. No significant differences in the frequency of somatic embryogenesis were observed among the root-end oriented explants (X2=4.01, 5 df, P>0.99) cultured on MS60 medium supplemented with either 0.00,2.26, 4.52, 9.05, 22.62 or 45.25 pM 2,4-D. Analysis of variance test indicated that

91

there were no significant differences between 2,4-D concentration and the frequency of somatic embryogenesis (F=0.22, 5 df and 61 df).

92

Groundnutcultivar

Numbero f

explants

Frequency of regeneration

(% )

Mean number of seed per regenerated

explant ± SE

Frequency of seed

germination

(% )

JL24 5 100.0 3.2 + 0.4 100.0Plover 12 83.3 5.5 ± 0.4 77.2TMV-2 13 92.3 4.8 ± 0.6 59.2

Table 3 .10 Development of groundnut plants from half of a zygotic embryo with single cotyledon (HESC) explants, and the germination frequency of seeds derived from HESC explants. Groundnut regeneration from HESC explants cultured on liquid MS basal medium (IX MS basal medium. pH 5.8). Analysis of variance tests indicated that there were no significant differences between either the three groundnut cultivars (JL24, Plover and TMV-2) and the frequency of regeneration (F=0.57, 2 df and 27 df), or between the three groundnut cultivars and the mean number of seed produced from each regenerated explant (F=2.62, 2 df and 23 df). However, X2 and analysis of variance tests indicated that there were significant differences in the frequency of seed germination were observed among the three cultivars (X2=36.4, 2 df, PcO.OOl; F=5.85, 2 df and 102 df, P=0.01).

93

SPECIES EXPLANT GROWTH REGULATOR (pM)

RESPONSE REFERENCE

Cajanus cajan L. Millsp Mature cotyledon and leaf explants

10TDZ Somatic embryogenesis Sreenivasu etal., 1998

Cicer arietinum L. (cv. BG-256)

Leaf explants 0.4 BA, 1.1 2,4-D and 1.0 picloram

Somatic embryogenesis Dineshkumar et al., 1995

Glycine max L. (cv. Bragg)

Mature cotyledon explants 5-10 BA and 0-2.5 IBA Adventitious shoot organogenesis

Mante et al., 1989

Glycine max L. Merr Immature embryos 43 NAA or 13.3 BA and 0.2 NAA

Somatic embryogenesis or axillary shoot regeneration

Barwale etal., 1986

Glycine max L. Merr Immature cotyledons and embryos

23 2,4-D or 100-150 NAA

Somatic embryogenesis Lazzeri et al., 1987

Pisum sativum L. (cv. Orb and Consort)

Immature cotyledon explants

2.2 BA and 21.5 NAA Adventitious shoot organogenesis

Ozcan etal., 1992

Pisum sativum L. (cv. Orb and Consort)

Immature cotyledon explants

23-181 2,4-D and 27-215 NAA

Somatic embryogenesis Ozcan etal., 1993

Pisum sativum L. (cv. R4111.PF 1/76, PF 5/81, Belinda and var. arvense.)

Immature zygotic embryos and shoot apices

0.2 and 4.0 2,4-D or 0.2, 4.0 and 20.0 picloram

Somatic embryogenesis Kysely and Jacobsen, 1987

Psophocarpus tetragonolobus L. DC

Leaf callus cultures 4.4 BA and 2.7 NAA Somatic embryogenesis Ahmed etal., 1996

Vigna unguiculata L.Walp (cv. C l52)

Leaf callus cultures 9.0 2,4-D Somatic embryogenesis Kulothungan et al., 1995

Table 3.11 Examples of plant regeneration from seed legumes.

SPECIES EXPLANT GROWTH REGULATOR (juM)

RESPONSE REFERENCE

Acacia catechu L. Willd Immature callus cultures 13.9 KIN and 2.7 NAA Somatic embryogenesis Rout et al., 1995

Albizzia lebbeck L. Hypocotyl explants 8.9 BA and 1.1-2.7 NAA Adventitious shoot organogenesis

Reza etal., 1995

Lathyrus sativus L. (cv. P-24)

Root callus cultures 0.9-1.4 KIN and 10.7 NAA

Adventitious shoot organogenesis

Roy et al., 1992

Lotus corniculatus L. .(cv. CUR 8505)

Epicotyl callus cultures 2.2 BA, 2.3 KIN and 0.5- 2.7 NAA

Adventitious shoot organogenesis

Lu et al., 1991

Medicago sativa L. Leaf protoplasts 2.3 BA, 0.5-4.5 2,4-D and 0.3 NAA

Somatic embryogenesis Dos Santos etal., 1980

Stylosanthes guyanensis L.

Hypocotyl, root and stem explants

89 BA and 5.4-10.8 NAA Adventitious shoot organogenesis

Meijer and Broughton, 1981

Tamarindus indica L. Mature cotyledons 5.0 BA Adventitious shoot organogenesis

Jaiwal and Gulati, 1991

Trifolium pratense L. Cotyledon and meristem explants

0.05-44.4 BA and 0.03 picloram

Adventitious shoot organogenesis

Phillips and Collins, 1979

Trifolium repens L.(cv. Osceola)

Immature cotyledon explants

181.0 2,4-D Somatic embryogenesis Parrot, 1991

Table 3.12 Examples of plant regeneration from forage and tree legumes.

GENOTYPE OR EXPLANT GROWTH RESPONSE REFERENCECULTIVAR REGULATOR (pM)

SB-11 Immature zygotic embryos 4.5, 13.6 and 27.1 2,4-D Somatic embryogenesis Hazra e ta l, 1989

F lorunner, Sunrunner, Chico, NC-7, Florigiant, 392-x, 393-7,487B, 435-OL-2, 562A, 803-1, 623B, 640A and 558A

Embryonated and de- embryonated whole and sectioned cotyledon explants

2.2-266.3 BA Adventitious shoot organogenesis

McKently e ta l, 1989

AT127 Leaflet explants 181.0 2,4-D and 0.9 KIN Somatic embryogenesis Baker and Wetzstein, 1992

AT127 Embryogenic cell suspension derived from immature cotyledon explants

181.0 2,4-D Somatic embryogenesis Durham and Parrott, 1992

TAG-24 Leaf explants 10 BA and 0.5 IAA Adventitious shoot organogenesis

Eapen and George, 1993

Toalson and Florunner

Embryogenic callus derived from immature zygotic embryo and cotyledon explants

2.1-12.4 picloram Somatic embryogenesis Ozias-Akins etal., 1993

JL24 Immature leaflet explants 90.5 2,4-D Somatic embryogenesis Chengalrayan et al., 1994

GK-7 Mature zygotic embryos 45.2-181.0 2,4-D Somatic embryogenesis Baker et al., 1995

New Mexico Valencia A

Leaf explants 111.0 BA and NAA Adventitious shoot organogenesis

Cheng et a l, 1996

Table 3.13 Examples of plant regeneration from groundnut (A. hypogaea L.).

Figure 3.1 Shoot organogenesis from mature groundnut cotyledons cultured on McKently regeneration medium (IX MS basal salts, 110.9 (iM BA (25 mg/ml), 2 mg/1 glycine, 0.5 mg/1 nicotinic acid, 0.1 mg/1 pyridoxine HC1, 3% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar). A. The response of a TMV-2 cotyledon after 14-21 days of culture on McKently regeneration medium. Green compact callus can be observed initiating from the proximal region of the cotyledon, and white friable callus can observed at the distal regions of the explant. B. The development of a group of shoot buds directly from the cotyledonary tissues at the proximal region of a JL24 cotyledon. C. Shoot buds forming from the green callus at the proximal region of a JL24 cotyledon.

Figure 3.2 Shoot organogenesis from mature de-embryonated groundnut cotyledon segments cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar) supplemented with 44.38 pM BA. A. JL24 cotyledon segments day 0; I. proximal segment, II. middle segment and III. distal segment. B. Four-week old JL24 cotyledon segments with callus initiating from the proximal, middle and distal explant segments.

A V

m

Figure 3.3 Shoot organogenesis from groundnut leaf discs cultured on MS basal medium (IX MS basal medium, pH 5.8 and 1.0% (w/v) agar) supplemented with 10 pM BA and 0.5 pM IAA. All the leaf discs were from TMV-2. A. A leaf disc showing callus formation from basal end of the midrib and the periphery of the leaf disc after two weeks culture on MS30 medium supplemented with 10 pM BA and 0.5 pM IAA. B. Callus profusion continued predominantly from the basal end of the midrib after four weeks of culture.

B

C

Figure 3.4 Regeneration of shoot meristems from mature zygotic embryos cultured on OR medium (IX MS major salts, 4X minor salts, IX B5 vitamins, 0.2 JJ.M NAA, 5.0 fxM thiamine, 12 mM proline, pH 5.8 and and 0.6% (w/v) agar), containing 44.38 JJ.M BA. Mature zygotic embryo axis explants developing shoots after four weeks of culture on OR medium containing 44.38 p.M BA. A. JL24, B. Plover and C. TMV-2.

Figure 3.5 Somatic embryogenesis from mature zygotic embryo explants cultured on MS60 medium (IX MS basal medium, 6% (w/v) sucrose, pH 5.8 and 0.8% (w/v) agar) supplemented with 45.25 p.M 2,4-D. All the mature embryo explants were from JL24. A and B Apical oriented explants developing multiple somatic embryos within 3-4 weeks of culture. C and D Root formation from the somatic embryos cultured on hormone free MS60 medium.

Figure 3.6 Groundnut regeneration from half of a zygotic embryo with single cotyledon explants cultured on liquid MS basal medium (IX MS basal medium. pH 5.8). All the explants were from JL24. A. Half of a zygotic embryo with single cotyledon explant at day 0. B. Germination of the explant within three days of culture. C. Development of shoots and roots from the explant after 2-3 weeks of culture.

Chapter 4

Development of in vitro methods of gene transfer to groundnut

4.1 In tr o d u c t io nThere are two prerequisites for the genetic transformation of plants. Firstly, the

development of an efficient method of regenerating fertile plants from transformed cells or explants (see Chapter 3). Secondly, a method for stably introducing foreign genetic material into the plant genome. In this chapter the development and evaluation of genetic transformation techniques for groundnut is described. Several reporter genes were used determine the relative susceptibility of various groundnut tissues to different transformation methods. These included firefly luciferase (LUC) (Ow et al., 1986), P-glucuronidase (GUS) (Jefferson et al., 1987) and green fluorescent protein (GFP) (Chalfie et al., 1994).

LUC, isolated from the North American firefly, Photinus pyralis, catalyses the oxidative decarboxylation of luciferin, a 6-hydroxy-benzothiazole, to an excited form of oxyluciferin in the presence of ATP, Mg^+ and 02- The high sensitivity of the

luciferase assay is due to luciferase converting chemical energy to light energy with high quantum efficiency. Moreover, the firefly luciferase exhibits the highest quantum yield among the known luciferases, thereby making it extremely sensitive as a reporter of promoter and translational enhancer activities in transient expression assays.

The uidA gene from E. coli (Jefferson et al., 1987) encodes for the GUS marker protein. GUS is an acid hydrolase that catalyses the cleavage of a wide variety of p-glucuronides, many of which are available commercially. GUS has been shown to be very stable within plant cells (Jefferson et al., 1987). The activity of GUS can be determined both qualitatively and quantitatively. For qualitative analyses, such as the localisation of cell and tissue-specific expression, histochemical assays using 5- bromo-4-chloro-3-indolyl glucuronide (X-gluc) have been used; cleavage of X-Gluc by GUS results in the formation of an indoxyl derivative which undergoes oxidative dimerisation to form a visible insoluble indigo blue precipitate. GUS can be quantitated by using a very sensitive and rapid fluorimetric assay with 4-methyl umbelliferyl glucuronide (MUG); GUS cleaves MUG to yield the fluorescent product 4-methyl umbelliferone (4-MU) which can be measured fluorimetricly with an excitation at 365 nm, emission at 455 nm.

GFP, a novel marker protein isolated from the jellyfish Aequorea victoria, emits green fluorescence (509 nm) when excited with either blue (475 nm) or UV (395 nm) light (Cubitt et al., 1995). GFP owes its visible absorbance and fluorescence to a /?-hydroxybenzylidene-imidazolidinone chromophore. The intrinsic fluorescence of GFP allows for non-invasive analysis which can be performed without destruction of the biological sample (Chalfie etal., 1994; Cubitt et al., 1995). GFP has been shown to function in a wide variety of biological systems, including plants (Niedz et al., 1995; Chui etal., 1996).

104

The detectability of the various reporter genes was enhanced to increase the chances of identifying transformed cells, tissue or organs. To achieve this, the luc reporter gene was subcloned into several high-level plant expression vectors. These vectors were compared using microprojectile bombardment transient-transformation assays, and the most effective vector was then used to increase the expression levels of both the GUS and GFP reporter genes systems.

However, to investigate A.tumefaciens-mediated transformation of groundnut a uidA-intron gene (Vancanneyt et al., 1990) was used instead of the aid A gene (Jefferson et al., 1987). The presence of the intron within the uidA gene prevented its expression in prokaryotic cells, thereby allowing an accurate assessment of T-DNA transfer to plant cells (Vancanneyt et al., 1990).

Although all the high-level plant expression vectors and reporter genes have been demonstrated to function in several plant species such as Nicotiana tabacum and Arabidopsis thaliana, most however have not been evaluated in groundnut. Therefore, the high-level plant expression vectors and the different reporter genes were initially tested in N. tabacum cv. Samsun to ensure that the different promoter/reporter gene fusions were functional prior to their use in groundnut. After the reporter genes were shown to be active in groundnut tissues, plant transformation vectors incorporating both the coat protein gene of the H isolate of IPCV and the relevant reporter gene were constructed for the transformation of groundnut.

4.2 Results4.2.1 Construction of high-level plant expression vectors

In order to optimise reporter gene expression in plant tissues, the potential benefits of including a viral 5' untranslated region (5'-UTR) within a plant transformation vector were investigated. The 5'-UTRs from alfalfa mosaic virus RNA4 (A1MV) (Jobling and Gerkhe, 1987), potato virus S (PVS) (Turner et al., 1994), tobacco etch virus (TEV) (Carrington and Freed, 1990), and tobacco mosaic virus (Cl) (Gallie et al., 1987), were compared to a synthetic 5'-UTR (SYN) (Turner etal., 1994). The nucleotide sequences of the above 5'-UTRs are presented in Figure 4.3. To study effects of the 5'-UTRs upon gene expression, the sequences were subcloned into a plant transient-expression vector containing a duplicated cauliflower mosaic virus (CaMV) 35S promoter (Carrington and Freed, 1990), luc gene (Ow et al., 1986) and a CaMV 35S terminator (Topfer et al., 1987). Furthermore, the 5'- UTRs were designed with an identical sequence around the initiating ATG thereby eliminating differences within the sequences necessary for the initiation of translation. The construction of the plasmids, pRTS2LUC (SYN 5'-UTR), pRT5'2LUC (PVS 5'-

105

UTR), and pRTL2LUC (TEV 5'-UTR) have been previously described (Turner et al., 1994; Bate et al., 1996).

pRT2 A1MV LUC was constructed as detailed in Figure 4.1. A pair of complementary oligonucleotides, AMV1 (5’ TCGAGTTTTTATTTTTAATTTTCTTT CAAATACTTCCAC 3') and AMV2 (5’ C ATGGTGGAAGT ATTTGAA AG A A A ATT AAAAATAAC 3'), representing the 39 bp sequence of the A1MV 5'-UTR were generated. Xhol and Ncol restriction enzyme (RE) sites were incorporated into the positive and negative sense strands, respectively, so that overhanging RE sites would automatically form when the oligonucleotides were annealed. The synthetic A1MV 5' - UTR was subcloned into Xhol/Ncol-digested pRTL2LUC, replacing the TEV 5'- UTR, to give pRT2 A1MV LUC.

pRT2 Q LUC was constructed as detailed in Figure 4.2. The Q 5'-UTR was amplified by PCR in conjunction with specifically designed oligonucleotide primers, Q 5’ (5’ TAGACTCGAGTATTTTTACAACAATTACCAAC 3) and Q 3' (5* GTATGCCATGGTAATTGTAAATAGTAATTG 3’), to introduce a 5’ Xhol site of the 5’-UTR and a 3' Ncol site at the ATG, from a cDNA clone of U 1 strain of TMV (courtesy of Dr. G. Foster). The amplified £2 5'-UTR was digested with Xhol/Ncol and subcloned into Xhol!Ncol-digested pRTL2LUC, replacing the TEV 5'-UTR, to generate pRT2 G LUC. Both constructs were sequenced and no errors were found.

4.2.2 Transient expression analysis of the high-level plant expression vectors in tobacco and groundnut leaves

To investigate the effect of the 5'-UTRs upon LUC expression in tobacco and groundnut leaves, the high-level plant expression vectors were assayed by microprojectile bombardment mediated transient expression assay. The plasmids containing the different 5'-UTRs (test plasmids) were co-precipitated with pRTL2GUS (Carrington and Freed, 1990) (Figure 4.4), a reference plasmid containing the uidA gene, and then bombarded into leaves. Following the introduction of the plasmids, the bombarded leaves were cultured in vitro for twenty-four hours before being assayed. Experiments were conducted in duplicate, with each experiment consisting of triplicate bombardments of each 5'-UTR test plasmid. The inclusion of a reference plasmid was used to minimise the variability between independent bombardment since both plasmids would be targeted to the same cell with equal efficiencies. Each LUC activity was divided by the respective GUS activity to obtain a normalised LUC value which was represented as a ratio of LUC:GUS. The mean LUCiGUS ratio of each 5'-UTR was divided by the mean LUC:GUS ratio of SYN 5’-

106

UTR (pRTS2LUC) to obtain fold increase relative to SYN 5'-UTR. The results are shown in Figure 4.3.

The results showed that the presence of the viral 5'-UTRs significantly enhanced the expression levels of the luc gene in both tobacco and groundnut leaves above the SYN 5-UTR. Analysis of variance tests indicated that there were significant differences between the expression levels of five 5' UTR sequences in both tobacco (F=28.48, 4 and 25 df, P<0.01) and groundnut (F=5.95, 4 and 25 df, PcO.Ol) leaves.

In tobacco leaves, the viral 5'-UTRs resulted in a 2.5- to 5.1-fold greater level of LUC expression than that conferred by the SYN 5'-UTR. The increases in LUC expression contributed by the viral 5’-UTRs relative to the SYN 5'-UTR were 2.5 ± 0.2 (SE) for the A1MV 5'-UTR, 5.1 ± 0.3 for the PVS 5’-UTR, 4.6 ± 0.4 for TEV 5'-UTR and 4.6 ± 0.5 for Q UTR (Figure 4.3).

In groundnut leaves, the viral 5'-UTRs resulted in a 4.2- to 9.6-fold greater level of LUC expression than the SYN 5'-UTR. The increases in LUC expression conferred by the viral 5'-UTRs relative to the SYN 5'-UTR were 4.2 ± 0.9 for the A1MV 5'-UTR, 7.7 ± 1.5 for the PVS 5’-UTR, 9.6 ± 2.4 for the TEV 5’-UTR and 5.9 ± 1 .4 for the £1 5'-UTR (Figure 4.3).

r-Tests conducted on the transient expression results from groundnut leaves showed that the TEV 5'-UTR stimulated significantly higher LUC expression levels than the A1MV 5’-UTR (P=0.01) and Q 5’-UTR (P=0.01), but not the PVS 5'-UTR (P=0.18). Based on these results a high-level plant expression vector incorporating a CaMV 35S promoter with duplicated enhancer (Carrington and Freed, 1990), a TEV 5-UTR (Carrington and Freed, 1990) and CaMV 35S terminator (Topfer et al., 1987) was used to enhance all the plant reporter genes during this study.

4.2.3 Evaluation of microprojectile bombardment mediated gene transfer into groundnut

Microprojectile bombardment was evaluated as a potential method of groundnut transformation. The advantage of this method for gene transfer is that it transcends the problems associated with genotype and tissue Agrobacterium strain specificity reported for groundnut (Mansur et al., 1993) and other legumes (Hobbs et a l , 1989; Byrne et al., 1987). pRTL2GUS, a high copy number vector containing a uidA gene under the transcriptional control of a CaMV 35S promoter with duplicated enhancer, a TEV 5'-UTR and CaMV 35S terminator, was bombarded into JL24 groundnut cotyledons, leaves and stems. Twelve cotyledons, two leaves and six stem samples were bombarded. Tissues were cultured at 25°C for twenty-four hours prior

107

to histochemical analysis. Histochemical analysis of the tissues was performed using 1 mM X-Gluc, incubated at 37°C for twenty-four hours.

Discreet GUS positive foci were detected in all the bombarded groundnut tissues as shown in Figures 4.4A, 4.4B and 4.4C. The mean number of GUS foci observed on cotyledons was 72.0 ± 13.8 (SE), on leaves was 195.5 ± 128.5 and on stems was 49.3 ± 8.9. The sample sizes were too small to allow definitive conclusions to be drawn (Bailey, 1981).

A circular zone of GUS foci surrounding an area of damaged tissue was observed in all the bombarded samples (Figures 4.4A, 4.4B and 4.4C). This zone of injury was about 2-3 mm in diameter, and completely devoid of GUS foci. This damage appears to have resulted from bombardment of the tissues. It has been previously reported that the blast itself rather than the impact of the microprojectiles is the major cause of cell injury (Russell et al., 1992). Furthermore, it was also shown that injured cells from epicentre of the blast could not be regenerated (Russell et al., 1992).

With the substantial damage caused by this bombardment device, and the problems associated in regenerating injured transformed cells, A. tumefaciens- mediated transformation methods for gene transfer into groundnut were investigated instead. However, the microprojectile bombardment device was still used for transient expression assays because it provided a rapid and efficient method for evaluating new plant expression vectors and reporter gene constructs.

4.2.4 Construction of a high-level plant expression vector containing an uidA -in tron gene

A high-level plant expression vector containing a uidA-intron gene was constructed to investigate A. tumefaciens-mediated gene transfer in groundnut. GUS is commonly used an indicator of plant cell transformation early after A. tumefaciens infection. However, one problem of using the uidA gene was that it can be transcribed and translated in A. tumefaciens. Therefore, to overcome this a uidA gene containing an intron was used to prevent prokaryotic expression of GUS.

A PCR based approach was used to clone the uidA-intron gene from p35S GUS INT (Vancanneyt et al., 1990) and into pRTL2GUS (a plant expression vector containing all the elements required for high-level expression as discussed previously in Section 4.2.2). The strategy used is detailed in Figure 4.5. Oligonucleotide primers MKC1 (5' ATAGCCATGGTCCGTCCTGTAGAAACC 3') and MKC2 (5' TAGAG GATCCTCATTGTTTGCCTCCCTGC 3') were used to amplify and introduce an Ncol site and a BamHI site into the 5' and 3' of the uidA-intron gene, respectively.

108

The amplified uidA-intron gene was digested with NcoI/BamHI, and ligated into pRTL2GUS digested with NcoI/BamHI to generate pRT2 TEV GUS INT.

4.2.5 Analysis of pRT2 TEV GUS INT in tobacco and groundnut leaves using transient expression assays

To determine whether pRT2 TEV GUS INT was functional, it was bombarded into tobacco and groundnut leaves. Positive controls pRTL2GUS (Section 4.2.3) and p35S GUS INT/pUC19 were also bombarded into tobacco and groundnut leaves. The plasmid p35S GUS INT was not used directly as a one of the control plasmids since the construct was in a low copy number binary plasmid vector. Instead the uidA-intron gene, CaMV 35S promoter and terminator sequences from p35S GUS INT were subcloned into pUC19 (a high copy number plasmid cloning vector) as a Hindlll fragment to generate p35S GUS INT/pUC19. The new plasmid contained identical promoter and terminator, and reporter gene sequences as that of p35S GUS INT. The cloning strategy is shown in Figure 4.6.

The three GUS plasmids, pRT2 TEV GUS INT, pRTL2GUS and p35S GUS INT/pUC19, were co-precipitated with pRTL2LUC (a reference plasmid expressing the luc gene), and then bombarded into leaves. The use of pRTL2LUC as a reference plasmid was equivalent to that of pRTL2GUS in Section 4.2.2. Both were used to correct for the varying efficiencies of each bombardment event. The GUS activities were normalised to the respective LUC activities to obtain a ratio of GUS:LUC. The mean GUS:LUC ratios derived from a total of six bombardments were then divided by the mean GUS: LUC ratio of p35S GUS INT/pUC19, to obtain relative GUS:LUC activities in terms of fold increase with respect to p35S GUS INT/pUC19. The evaluation was conducted in two separate experiments, with each experiment consisting of triplicate bombardments of each plasmid. The data are presented in Figure 4.7.

The results indicated that the PCR amplified uidA-intron gene was functional in both tobacco and groundnut leaves. Analysis of variance tests indicated that there were significant differences between the expression levels of three GUS vectors in both tobacco (F=80.07, 2 and 17 df, PcO.Ol) and groundnut (F=9.07, 2 and 24 df, PcO.Ol) leaves. pRT2 TEV GUS INT GUS expression levels were 11.3 ± 0.7-fold and 6.5 ± 2.5-fold greater than those exhibited by p35S GUS INT/pUC19 in tobacco and groundnut leaves, respectively. However, when the GUS expression levels of pRTL2GUS and pRT2 TEV GUS INT were compared, the levels from pRT2 TEV GUS INT were approximately three-fold lower than those of pRTL2GUS in both tobacco and groundnut leaves. The only difference between the two vectors was the presence of the intron in pRT2 TEV GUS INT. The splicing of the intron from the

109

uidA-intron transcript could account for variation in GUS expression levels. However, since the uidA-intron gene was generated by PCR, the discrepancy could also be the result of a PCR induced mutation in the uidA-intron coding region. This could result in the production of a less functionally active GUS protein. Nevertheless, the incorporation the uidA-intron gene into the high-level plant expression vector resulted in a significant enhancement of GUS expression levels as compared to that of the original uidA-intron gene construct (f-Test; P=0.01). Thereby making it more efficient as an indicator of A. tumefaciens-mediated transient and stable transformation events.

4.2.6 Construction of pMKC6, a high-level plant expression binary vector containing an uidA-intron gene

A Hindlll/Kpnl fragment containing the uidA-intron gene, CaMV 35S promoter and terminator sequences from pMKC3 (Appendix B l) was subcloned into the binary vector pBIN19 (Bevan, 1984), digested with Hindlll/Kpnl to generate pMKC6. The cloning strategy is presented in Figure 4.8.

4.2.7 Evaluation of GUS expression in A. tumefaciensA. tumefaciens transformed with pMKC6 was analysed for GUS expression to

determine whether introduction of the intron into the uidA gene suppressed its expression in the prokaryotic environment. pBIN19 (an empty binary vector) and pMKC7 (an equivalent binary vector to pMKC6 but with an intron-free uidA gene) were used as negative and positive controls, respectively. The construction of pMKC7 is detailed in Figure 4.8.

pBIN19, pMKC6 and pMKC7 were transformed into the A tumefaciens strain LBA4404 to generate LBA4404/pBIN19, LBA4404/pMKC6 and LBA4404/pMKC7. Overnight cultures of the bacterial strains were histochemically stained to detect GUS expression. 100 pi of bacterial culture diluted to an OD600 °f 1-0 was incubated with

400 pi of 1 mM X-Gluc solution at 37°C. GUS activity was detectable after 30 minutes in A. tumefaciens containing the constructs without the intron, and after incubation overnight the cells were stained dark blue. In contrast, the cells transformed with pBIN19 and pMKC6 did not stain, and remained so even after two weeks of incubation. The dramatic effect of the intron in abolishing bacterial GUS expression in A. tumefaciens cells is shown in Figure 4.9. Although GUS expression could not be detected visually, it by no means indicated that GUS expression was completely suppressed.

GUS activity in the bacterial cultures were analysed using fluorimetric MUG assays to confirm that GUS expression was inhibited by the intron. In two independent experiments; 500 pi of bacterial culture (OD600 = 10) was mixed with

110

500 |il of GUS extraction buffer (GEB), and then vortexed vigorously for 1 minute. 100 |il of this bacterial solution was then used in a quantitative MUG fluorescence assay. The first three samples were taken at one hourly intervals from the cells containing pBIN19 and pMKC6 with the fourth and final sample taken after 18 hours. Since GUS expression from cells containing pMKC7 was previously shown to be high, a 10-fold dilution of the vortexed bacterial solution was inoculated into the MUG solution, and samples taken at 5 minute intervals. Under the conditions of this experiment, GUS expression was not detected in the A. tumefaciens strains containing pBIN19 or pMKC6. However, the A. tumefaciens strain harbouring pMKC7 exhibited a very high mean GUS activity of 242 444 ± 84 453 pmol 4 MU/min/mg protein. These results suggest presence of intron in the uidA gene dramatically suppressed A. tumefaciens GUS expression. Thus, the uidA-intron gene was utilised in analysing T-DNA transfer to plant cells.

4.2.8 Analysis of four different A. tumefaciens strains in tobaccoMansur et al. (1993) found that the susceptibility of groundnut to infection by

A. tumefaciens was dependent on the compatibility of the bacterial strain and the groundnut tissue type. Accordingly, groundnut explants of JL24 were evaluated for susceptibility to various strains of A. tumefaciens by using the uidA-intron gene as an indicator of transient transformation. In order to investigate this, four disarmed strains of A. tumefaciens were obtained; C58C1, C58C3, EHA105, and LBA4404 (courtesy of Dr. G. Edwards for C58C1 and C58C3; Prof. S. Gelvin for EHA105 (Lui et al.,1992)). The plasmid pMKC6 was introduced into all the strains to obtain the following A. tumefaciens strains; C58Cl/pMKC6, C58C3/pMKC6, EHA105/pMKC6, and LBA4404/pMKC6. Fluorimetric MUG assays were conducted on C58Cl/pMKC6, C58C3/pMKC6, EHA105/pMKC6, and LBA4404/pMKC6, and on negative control strains C58Cl/pBIN19, C58C3/pBIN19, EHA105/pBIN19 and LBA4404/pBIN19 to ensure that there was no GUS expression in these strains. No detectable levels of GUS expression were found in any of the strains.

These strains were tested on 1-2 week old N. tabacum SRI seedlings using a T-DNA-dependent transient transformation assay system (Rossi et al. 1993) to demonstrate that they were functional prior to their use in groundnut. Briefly, overnight bacterial cultures were centrifuged and the supernatant discarded. The bacterial pellet washed with 10 mM MgSC>4 and then resuspended in liquid MS medium to a final A600 of 0.6. Approximately 100 N. tabacum SRI seedlings were

added to the bacterial solution and subjected to vacuum infiltration at 25 inches of mercury for 5 minutes. The seedlings were cocultivated for three days on MS medium. After cocultivation, the infected seedlings were washed with 10 mM MgSC>4 and

111

blotted dry. Thirty infected seedlings were combined into one sample and analysed for GUS expression using the fluorimetric GUS assay. In addition, 30 seedlings were incubated overnight in X-Gluc solution at 37°C for the detection GUS positive foci. As it was not always possible to distinguish individual GUS foci due to their high density. Instead, these seedlings were scored according to the proportion of the cotyledons that stained blue. One point was given for each one-eighth of a blue sector, and therefore the score range would be between 0-8 (Figures 4.10). Two independent experiments were conducted and the results are summarised in Table 4.1.

The results indicated that all four Agrobacterium strains were capable of transient transformation of N. tabacum SRI seedlings. Significant differences in the transformation frequency (X2=11.6, 3 df, P=0.01) and GUS activity (F=15.4, 3 and 4 df, P=0.05) were observed among the four bacterial strains (Table 4.1). Strain C58Cl/pMKC6 exhibited the highest frequency of transient transformation in respect to the number of seedlings with GUS foci (P=0.02). Significant differences in the mean GUS positive sector scores (F=17.1, 3 and 237 df, P=0.01) were observed among the four bacterial strains (Table 4.1), but not between C58Cl/pMKC6, EH A 105/pMKC6 and LBA4404/pMKC6 (F=0.09, 2 and 176 df, P=0.01). These three strains had significantly higher mean GUS sector scores than C58C3/pMKC6 (P=5.2xl0“8).

4.2.9 Investigation of the susceptibility of a variety groundnut tissue explants to infection by different A. tumefaciens strains

The four functional A. tumefaciens strains described in Section 4.2.8 were used to infect groundnut. A T-DNA-dependent transient transformation assay system similar to that used for the tobacco seedlings was utilised for groundnut. The only modification to the aforementioned method was that the bacterial cultures were resuspended to an OD600 of 1.0 instead of the 0.6. A. tumefaciens strains and

groundnut tissue-type specificity was also addressed by inoculating mature cotyledon and mature zygotic embryo axis explants with the four A. tumefaciens strains. Mature cotyledon and zygotic embryo axis explants were obtained from non-germinated JL24 seeds. Cotyledon explants were de-embryonated, and the abaxial and adaxial surfaces scored with a scalpel. Zygotic embryo axis explants were longitudinally dissected in half. The explants were immersed in the bacterial mixture and subjected to vacuum infiltration for five minutes, then cocultivated for three days on filter paper moistened with liquid MS. The explants were rinsed and incubated overnight in X-Gluc solution at 37°C.

The groundnut explants were not fluorimetrically assayed for GUS expression because of the difficulties in detecting low levels of GUS activity in the cotyledon and

112

embryo explants. This problem may have been due to the high oil and protein content of groundnut interfering with the fluorimetric assay. As a consequence, the efficiency of transient transformation was based solely on the frequency and mean number of GUS foci detected on the infected explants. Initially, two independent experiments were conducted with the cotyledon explants and the embryo explants. As the results from the embryo explants appeared promising, two additional experiments were performed using this material. The results are summarised in Table 4.2.

The susceptibility of groundnut to A. tumefaciens infection appeared to be explant dependent. The transformation frequency of the embryo axis explants was significantly higher (between two- to five-times higher) than that of the de- embryonated cotyledon explants (P=0.0009). The majority of the transient transformation events on the embryo explants occurred at the vascular tissues as indicated by the presence of the GUS foci (Figure 4.11). In contrast, the transformation events on the de-embryonated explants occurred mainly at the embryo attachment points.

No significant differences in the transformation frequency were observed among the four A. tumefaciens strains with either de-embryonated (X2=2.35, 3 df, P>0.95) or embryo axis explants (X2=1.32, 3 df, P>0.99) (Table 4.2). The transformation frequency in the de-embryonated explants ranged from 0.0% for C58Cl/pMKC6 to 10% for both C58C3/pMKC6 and EHA105/pMKC6, and in embryo axis explants this ranged from 25.0% for LBA4404/pMKC6 to 31.5% for EH A 105/pMKC6.

An analysis of variance test found no significant difference between the four A. tumefaciens strains and the mean number of GUS foci per de-embryonated explant (F=1.17, 3 and 76 df, P>0.05) (Table 4.2). However, significant differences were observed between the four A. tumefaciens strains and the mean number of GUS foci per embryo axis explant (F=7.83, 3 and 432 df, P=0.01) (Table 4.2). The A. tumefaciens strain EHA105/pMKC6 displayed the highest mean number of GUS foci per explant with 13.9 ± 1.2. This value was about three-fold greater than that of LBA4404/pMKC6 (P=0.006), and about 5.5-fold greater than either C58Cl/pMKC6 (P=0.001) or C58C3/pMKC6 (P=0.0006).

This study showed that embryo axis explants were more susceptible to A. tumefaciens transient transformation than the de-embryonated explants. In addition, out of the four A. tumefaciens evaluated, EHA105 was found to be the most compatible and efficient strain for the JL24 groundnut embryo axis explants.

4.2.10 Further analysis of A. tum efaciens-mediated transienttransformation of groundnut explants

113

Groundnut regeneration has been achieved from immature leaflet explants (Chengalrayan et al., 1994) and from embryo with single cotyledon (EAC) explants (McKently et al., 1995). These explants were evaluated using the previously described transient transformation assay method (Section 4.2.9), to determine their susceptibility to A. tumefaciens infection.

Immature leaflets from one-day old germinated JL24 seeds were infected with A. tumefaciens strains C58Cl/pMKC6, C58C3/pMKC6, EHA105/pMKC6 and LBA4404/pMKC6. Two independent experiments were conducted, and in each experiment forty immature leaflets were inoculated with each strain. After cocultivation with A. tumefaciens, the leaflets were incubated overnight in X-Gluc solution at 37°C. Of the 320 immature leaflets used in the transient transformation assay, none exhibited detectable GUS positive foci.

The failure of A. tumefaciens-mediaicd transformation may been influenced by the developmental stage of the leaflet explants. To address this, leaflets from seven- day old post-germinated seedlings were infected. EHA105/pMKC6 was used in the transient transformation analysis of these older leaflet explants since this strain was previously shown to the most compatible A. tumefaciens strain with JL24 groundnut tissues (Section 4.2.9). Eighty leaflet explants were infected in 2 independent experiments were infected. As with the one-day old leaflets, no GUS foci were detected from the infected seven day old leaflets. The results indicated that neither one- or seven-day old leaflet explants were susceptible to infection by A. tumefaciens.

Previous results (Section 4.2.9) indicated that mature embryo axis explants were susceptible to infection by A. tumefaciens. Further experiments were conducted to study the pattern of transient transformation in these explants, to determine whether they could be used to generate transgenic groundnut. The study consisted of three independent experiments, with each experiment containing a minimum of ten explants. Embryo explants were inoculated with the A. tumefaciens strain EHA105/pMKC6 using the same transient transformation method as described in Section 4.2.9.

The mean transformation frequency of the embryo explants was 91.7% ± 4.4%, and the mean number of GUS foci per explant was 19.2 ± 8.0. This time the number transformation events occurring at the apical meristem was also recorded. The transformation frequency at the apical meristem was 58.9% ± 11.5 with a mean number of GUS foci occurring per apical meristem of 5.5 ± 1.8. This result indicated that groundnut meristematic tissue was susceptible to infection.

The significance of this observation was that chimeric plants could potentially be created using this genetic transformation method. If the germline cells were transformed this could lead to the recovery of transgenic seed. This form of transformation has been previously termed in planta transformation, and has been used

114

successfully to generate transgenic A. thaliana (Feldmann and Marks, 1987; Bechtold et al., 1993), and more importantly, transgenic groundnut (McKently et al., 1995). Hence, the modified T-DNA dependent transient transformation assay system was utilised for in planta transformation of groundnut in conjunction with the HESC explant regeneration system developed in Section 3.2.6.

4.2.11 Construction of plant expression vectors containing both the uidA-intron and H -IPCV CP genes

The H-IPCV CP gene was shown to confer protection against IPCV (Chapter 5). Therefore, as part of the overall objective of producing transgenic groundnut with resistance to infection by IPCV, the H-IPCV CP gene was subcloned into a binary vector along with the uidA-intron gene. The CaMV 35S promoter and terminator, and H-IPCV CP gene sequences from pPCV3/pBSII KS+ (Appendix B3) were excised as a HindllllSmal fragment and ligated into pMKC9 (Appendix B4) digested with Sail (blunted with DNA polymerase (Klenow fragment)) and Hindlll to generate pMKCl 1 as shown in Figure 4.12.

pMKCll was then digested with SacII (blunted with DNA polymerase (Klenow fragment)) and Xhol to liberate a fragment containing both H-IPCV CP and uidA-intron genes. This was subcloned into the binary vector pMOG402 digested with Smal/Xhol to create pMKC12. The cloning strategy is presented in Figure 4.13.

4.2.12 Functional analysis of pM K C ll and pMKC12 in groundnut using transient expression assays

The pM KCll plasmid was bombarded into groundnut leaves to determine whether the uidA-intron gene was still functional. pRT2 TEV GUS INT and p35S GUS INT/pUC19 served as positive controls during the evaluation. The three plasmids were co-precipitated with pRTL2LUC and bombarded into leaves. The ratio of the GUS:LUC activities were calculated as described in Section 4.2.5, and expressed as relative activities with respect to p35S GUS INT/pUC19. The analysis was conducted in two independent experiments, with each experiment composed of triplicate bombardments of each GUS test plasmid. The results are summarised in Figure 4.14.

Significant differences in relative activities (GUS:LUC ratios) were observed among the three GUS plasmids (F=3.76, 2 and 24 df, P=0.05). Relative activities ranged from 1.0 ± 0.1 for p35S GUS INT/pUC19 to 3.8 ± 1.2 for pRT2 TEV GUS INT. The transient expression assays indicated that the uidA-intron gene from pMKCll was functional. GUS expression levels from pMKCll was approximately three-fold greater than that seen for p35S GUS INT/pUC19 (P=0.02), and about 15%

115

lower than that exhibited by pRT2 TEV GUS INT, but this was not considered significantly different (P=0.21).

The binary vector pMKC12, which contained both the H-IPCV CP and uiclA- intron genes, was introduced into the A. tumefaciens strain EHA105 to generate the EHA105/pMKC12 strain. This strain was tested on embryo axis explants using the transient transformation assay described in Section 4.2.9. The assays were conducted in three experiments, with about thirty-eight explants in each experiment. The transformation frequency was about 91.3% ±4.6% but was not significantly different (P=0.45) from the results in Section 4.2.10. The mean number of GUS foci per explant was 11.2 ± 2.2. Although this was about 40% lower than previously reported results from Section 4.2.10 it was not significantly different (P=0.08).

The reduction in the number of transformation events may have resulted from use of pMKC12. pMKC12 differs from the binary vector (pMKC6 (Section 4.2.9)) used in the earlier transient transformation assays in one main respect; the pMKC12 binary vector was approximately 2.3 kb bigger than pMKC6. The differences in the size between pMKC12 and pMKC6 may affect the efficiency of T-DNA transfer. The possibility of strand breakage increases with size of T-DNA being transferred. This could therefore account for the reduction transformation efficiency as determined by GUS activity. Nevertheless, the benefit of having the both the uidA-intron and H- IPCV CP genes in one binary vector out weighed this disadvantage, since it would allow the rapid identification and recovery of putatively transformed tissues or explants early after A. tumefaciens-mtdmitd. transformation.

4.2.13 Evaluation of in planta transformation of groundnutTo investigation the in planta transformation of groundnut, the A. tumefaciens

strain EHA105/pMKC12 was used in conjunction with the HESC explant regeneration system (Section 3.2.6). The groundnut explants were inoculated and cocultivated as previously described in Section 4.2.9. After cocultivation, the explants were rinsed twice with the antibiotic augmentin at a concentration of 200 mg/1 before being cultured on sterile filter papers moistened with liquid MS medium. Once the explants had developed 1-2 healthy roots, the explants were transferred to a 1:1 soil/sand mix and propagated in a growth cabinet. In order to identify putatively transformed groundnut tissues, the plants were assayed for GUS expression by histochemical X-Gluc staining. At the five quadrifoliate leaf stage, a 25-36 mm2 piece of leaf was removed from the base of each leaflet and assayed for GUS expression.

From seven independent experiments, each using about one hundred groundnut seeds, a total of approximately seven hundred HESC explants were inoculated with EHA105/pMKC12. The first four experiments suffered from thrip

116

infestation, with most of the plants being severely affected. In order to prevent the further spread and damage to newly transferred explants, the infected plants and soils were removed and autoclaved. Approximately 63% ± 9% of the explants from the other three experiments survived, and developed into small plantlets. Of the 189 inoculated plants tested, GUS expression could not be detected in any of the leaflet tissue samples. This was unexpected because the transient transformation results indicated that gene transfer events were occurring at the apical meristem (Section 4.2.10).

The lack of transformation events may have been due to several factors such as the failure to detect transformed sectors, the instability of the transformation events or non-proliferation of the transformed cells. To improve the efficiency of locating the putatively transformed sectors, whole explants were analysed for reporter gene expression. In order to facilitate this GFP was used instead of GUS as a reporter of transformation.

4.2.14 Construction of a high-level plant expression vector containing the sG FP gene

To investigate whether GFP functioned in groundnut, a high-level plant expression vector containing a modified GFP gene, sGFP (S65T) (Heim and Tsien, 1996), was introduced into groundnut tissues by microprojectile bombardment, and then analysed for GFP expression. The sGFP gene from pMKC19 (Appendix B5) was excised as an NcoI/HindM fragment and subcloned into pMKC9 (Appendix B4) digested with Ncol/Hindlll to generate pMKC21. This placed the expression of the sGFP gene under the control of the CaMV 35S promoter with a duplicated enhancer and TEV 5'-UTR. The cloning strategy is detailed in Figure 4.15.

4.2.15 Evaluation of sGFP expression in groundnutpMKC21 was bombarded into groundnut leaves. The modified sGFP emits

green fluorescence maximally at 511 nm when excited with UV at 488 nm. Therefore, a UV epifocal microscope fitted with a FITC (excitation filter 470-490 nm and emission filter 515-560 nm) filter set was suitable for detecting sGFP.

sGFP fluorescence was detected in groundnut epidermal and guard cells as shown in Figures 4.16A and 4.16B, respectively. The fluorescence was distinct and could be readily distinguished from the background red auto-fluorescence emitted from the chloroplasts. sGFP fluorescence was uniform throughout the cytoplasm though higher levels of fluorescence appeared to be localised in the nucleus and the periphery of the cell (Figures 4.16A and 4.16B). These results indicated thats GFP could potentially be used as reporter for groundnut transformation.

117

4.2.16 Construction of plants expression vectors containing both s GFP and H-IPCV CP genes

The cloning strategy of pMKC23 and pMKC24 are presented in Figures 4.17 and Figure 4.18, respectively. The TEV 5'-UTR, sGFP gene and CaMV 35S terminator sequences from pMKC21 were excised as an EcoRI/HindM fragment, and subcloned into pMKCl 1 digested with EcoRI/Hindlll to replace the uidA-intron gene, thereby generating pMKC23. pMKC23 was digested with SacII (blunted with DNA polymerase (Klenow fragment)) and Xhol to liberate a fragment containing both H- IPCV CP and sGFP genes. This was then subcloned into pMOG402 (binary vector) digested with Smal/Xhol to create pMKC24.

4.2.17 Further evaluation of sGFP expression in groundnutThe detectability of sGFP was compared with that of GUS prior to the

evaluation of GFP for use in groundnut transformation. This was to ensure that sGFP was as sensitive as GUS for following transformation events. The two reporter genes were compared using a microprojectile-mediated transient expression assay. Equal amounts of pMKCl 1, a plasmid containing both uidA-intron and H-IPCV CP genes, and pMKC23, a plasmid containing both sGFP and H-IPCV CP genes, were co­precipitated and bombarded into groundnut leaves. The bombarded leaves were incubated for 24 hours at 25°C before being analysed for reporter gene expression. The leaves were examined initially for sGFP expression and then incubated overnight in an X-Gluc solution at 37°C for histochemical localisation of GUS. The analysis was conducted in two independent experiments, with each experiment composed of triplicate bombardments.

The mean number of sGFP and GUS positive foci was 99.9 ± 31.4 and 104.8 ± 25.2, respectively. No significant difference was observed between the mean number of sGFP and GUS positive foci (P=0.27). Therefore, this result suggested that the sensitivity of sGFP was comparable to that of the GUS with respect to detecting transient transformation events.

To evaluate sGFP as an indicator for Agrobacterium-mediated transformation, pMKC24, a binary vector containing both sGFP and H-IPCV CP genes, was transformed into the A. tumefaciens strain EHA105 to generate EHA105/pMKC24. To demonstrate that this strain was functional prior to its use with groundnut, EHA105/pMKC24 was tested on N. tabacum SRI seedlings using the T-DNA- dependent transient transformation assay system (Section 2.4.8). The pattern of transformation was similar to that exhibited by the EHA105/pMKC12 (Section 2.4.8), thus indicating that both the A. tumefaciens strain and sGFP gene were functional.

118

However, to investigate the sensitivity of sGFP for identifying transgenic callus and regenerating tissues, pMKC24 was introduced into LBA4404, and then transformed into N. tabacum cv Samsun using an A. tumefaciens-mediated leaf disc transformation system. Intense green fluorescence was observed in putatively transformed callus and shoot primordia as shown Figures 4.19A and 4.19B. The conspicuous nature of the putative transformants meant that they were readily identified among the neighbouring untransformed cells. The putatively sGFP transformed shoots were grown to maturity and allowed to self fertilise to produce T2 generation seed. T2 generation seeds were germinated on MS medium with kanamycin selection. The sGFP expressing seedlings could be readily distinguished from the non- sGFP expressing seedlings as shown Figure 4.19C. The results indicated sGFP could be used to facilitate the identification of putatively transformed cells and tissues without effecting transformation or regeneration efficiencies of the transgenic plants.

4.3 Discussion4.3.1 High-level plant expression vectors

During this study several plant expression vectors were developed for use in the genetic transformation of groundnut. However, many of the vector components had not been previously analysed in groundnut before. These included the viral 5' UTRs, uidA-intron, luc, and sGFP reporter genes. Therefore, to ensure that all the newly the constructed plant expression vectors were functional prior to their use in groundnut, they were evaluated in N. tabacum . N. tabacum was used because most of the vector components such as A1MV 5'-UTR (Datla et al, 1993), PVS 5'-UTR (Turner et a l, 1994), TEV 5'-UTR (Carrington and Freed, 1990), Q 5'-UTR (Gallie et al., 1987), uidA-intron gene (Vancanneyt et al., 1990),and luc gene (Bate et al., 1996) had been previously tested in this particular species of tobacco.

Development of the high expression plant vector series initially involved the use of a CaMV 35S promoter with a duplicated enhancer and a variety of viral 5'- UTRs; A1MV, PVS, TEV and Q. Both the CaMV 35S promoter and viral 5'-UTR sequences have been previously reported as strong enhancers of transgene expression in various types of plant cell (Kay et al., 1987; review of viral 5'-UTRs by Turner and Foster, 1995). In this study, the different viral 5'-UTR constructs were found to increase luc expression in both tobacco and groundnut leaves. The enhancement of reporter gene expression in groundnut by the A1MV (Datla et al., 1993), PVS (Turner et al., 1994), TEV (Carrington and Freed) and Q. 5-UTRs (Dowson Day et al., 1993) were consistent with previous reports in tobacco. However, several of the reports indicated that levels of enhancement of more than 20-fold and 90-fold could be achieved with the A1MV 5'-UTR (Datla et al., 1993) and Q. 5'-UTR (Gallie et al.,

119

1992; De Loose et al., 1995). However, in this study, enhancement by A1MV and £2 5'-UTRs in tobacco were, at best, only 2.5-fold and 4.6-fold, respectively; whereas the levels of enhancement in groundnut were only 4.2-fold and 5.9, respectively.

Several possible explanations could account for this large discrepancy. The most obvious reason was that different reporter genes, expression assay systems and methods for calculating levels of enhancement were used in the previous analyses of viral 5'-UTRs. With regard to the evaluation of four viral 5'-UTRs constructs, the experimental procedures were conducted under identical conditions thereby eliminating differences associated with the aforementioned problems. This, therefore, permitted the results from the different viral 5'-UTRs to be compared directly. This brief study found that the TEV and PVS 5’-UTRs were the most effective enhancers of reporter gene expression in groundnut. Consequently, the TEV 5’-UTR sequence was incorporated into all the high-level plant expression vectors, and used to enhance both GUS and GFP expression. How these and other plant viral 5'-UTRs enhance reporter gene or transgene expression at present remains unresolved. However, there is increasing evidence that 5’-UTRs can have significant affects on transcript stability, export from the nucleus, ribosome recruitment and translation initiation (Kozak, 1991).

4.3.2 Evaluation of microprojectile bombardment-mediated transformation

Two gene transfer strategies were evaluated for the transformation of groundnut; microprojectile bombardment mediated transformation and A. tumefaciens mediated transformation. Genetic transformation of groundnut was first achieved using a microprojectile bombardment-mediated gene transfer approach (Ozias-Akin et al., 1993). Subsequently, transgenic groundnut have been produced by A. tumefaciens mediated transformation (Eapen et al., 1994; McKently et al., 1995; Cheng et al., 1996).

To evaluate the microprojectile-mediated gene transfer technique, a selection of JL24 groundnut tissues were bombarded with tungsten particles coated with pRTL2GUS. GUS positive foci were detected in the bombarded groundnut tissues. However, cells nearest the blast epicentre were severely wounded and no GUS expression could be detected in this area of injured tissue (Figures 4.4A, 4.4B and 4.4C). Russell et al. (1992) reported similar observations in tobacco cell suspensions bombarded with a gunpowder-driven microprojectile device. Their study also found that the primary cause of cell death in bombarded tobacco cell suspension cultures was due to the gas blast and acoustic shock associated with the discharge of the explosive round. Their study also showed that the toxicity of the tungsten contributed to cell

120

injury, and that the use of gold improved transformation efficiencies. Moreover, from the cells the zone of damage could not be regenerated (Russell et al., 1992).

Modem microprojectile-devices such as the DuPont/Bio-Rad PDS-1000 (Russel-Kikkert, 1993) and the ACCELL® electric-discharge particle bomardment systems (McCabe and Martinelli, 1993), use inert propellants and produce blasts which are physically less traumatic to cells. Both of these modifications have been shown to cause less damage (Russell et al., 1992), and would have been very useful for evaluating the microprojectile-mediated transformation of groundnut in this study. The development of the helium-driven microprojectile device eventually led to the transformation and recovery of transgenic groundnut (Ozias-Akins et al., 1993). The groundnut transformation approach developed by Ozias-Akins, (1993) could not be readily applied to the four Indian groundnut cultivars, because an efficient embryogenic callus culture system had not been established for the four Indian groundnut cultivars. A plant regeneration system using an embryogenic callus culture was not developed due to the problems of genetic instability associated with callus cells (as discussed in Section 3.3.1).

4.3.3 Evaluation of A. tum efaciens-mediated transformationSince transgenic groundnut has been generated via A. tumefaciens-medialed

transformation (Eapen et al., 1994; McKently et al., 1995; Cheng et al., 1996), this approach was evaluated for the transformation of the Indian groundnut cultivar JL24. Four A. tumefaciens strains were tested with three groundnut tissue types to determine the optimum bacterial strain and groundnut explant combination. The A. tumefaciens strains were transformed with pMKC6, a high-level plant expression vector containing an uidA-intron gene. GUS expression was used as an indicator of T-DNA transfer efficiency. A uidA-intron gene was used to prevent the GUS expression in the bacteria. A. tumefaciens, as with all prokaryotes, lack the appropriate splicing enzymes required to remove intron sequences from mRNA (Vancanneyt et al., 1990). GUS histochemical and fluorimetric assays confirmed that the A. tumefaciens strains harbouring pMKC6 did not GUS express.

The results from transient transformation assays indicated that the susceptibility of JL24 to A. tumefaciens was dependent upon the type of explant. Of the three explant types evaluated, the embryo axis explants were the most susceptible to infection, followed by the de-embryonated cotyledon explants. The one- and seven- day old leaflets explants did not appear to be susceptible to infection. Mansur et al. (1993) also showed that young groundnut leaflets were as not susceptible to infection by A. tumefaciens in comparison with other groundnut explants. The differences in tissue competence for A. tumefaciens infection observed in this study were consistent

121

with previous results in groundnut (Mansur et al, 1993) and in other legumes (Kumar and Davey, 1991).

In this study, variations in transformation efficiencies were also observed between the A. tumefaciens strains and the types of explants. Embryo explants were found to be significantly more susceptible to infection by A. tumefaciens than the cotyledon explants. Transformation frequencies in embryo explants ranged from 25.0% to 31.5%. This was approximately two- to five-fold greater that observed in the cotyledons explants.

Of the four A. tumefaciens strains tested on the JL24 embryo axis explants, EHA105 overall was the most effective strain for the transformation. EHA105 and a closely related strain EHA101 (Hood et al., 1986), both of which are non-oncogenic derivatives of A281 (Hood et al., 1984), have been used successfully in the genetic transformation of groundnut (McKently et al., 1995; Cheng et al., 1996). Furthermore, the wild-type oncogenic strain of EHA105, A281, has previously been reported to be virulent in groundnut (Lacorte et al., 1991), soybean (Byrne et al., 1987), and pea (Hobbs et al., 1989).

Thus, strain EHA105, in conjunction with pMKC12, was used for subsequent transformation experiments of HESC explants. The in planta methodologies adopted for groundnut transformation have been previously used to produce transgenic groundnut (McKently et al., 1995) and transgenic A. thaliana (Feldmann and Marks, 1987; Bechtold et al., 1993). This approach, however, did not lead to the recovery of transgenic groundnut in the study.

4.3.4 Improving the efficiency of in planta transformationThe failure to identify GUS positive samples may be due in part to (i) the

unpredictable nature of the transformation events and (ii) low transformation frequencies. Since the precise location of competent cell-types on the embryo axis explants has not been thoroughly investigated, this has made the subsequent detection of GUS positive sectors much more difficult. Although GUS was used extensively in this study, it had its limitations. The main drawback was that the detection assays were invasive and often destructive to the biological sample. This limited the usefulness of GUS for monitoring reporter gene expression in vivo. To overcome this problem, GFP was evaluated as an alternative reporter to GUS. Expression of GFP in plants has been reported in both stable (Chiu et al., 1996) and transient expression systems (Neidz et al., 1995). It can be visualised in vivo under UV illumination without causing permanent damage to the plant cell. This would therefore enable non­destructive screening of transformed cells and tissues to be carried out. In addition, GFP, unlike GUS, requires no exogenous substrate, co-factor, or other gene product

122

for detection. Furthermore, modifications of the native GFP gene sequence such as the removal of cryptic splice sites, optimisation of codon usage and shifts in the excitation and emission wavelengths, have improved the use and detection of this marker gene in both monocotyledonous and dicotyledonous plant cells (Chiu et al., 1996; Reichel., et al., 1996; Haseloff et al., 1997).

In this study, the sGFP constructs were introduced into tobacco and groundnut leaf tissues using microprojectile bombardment-mediated transformation. sGFP was found to fluoresce intensely in both tobacco and groundnut cells. The detection of sGFP in groundnut leaf tissues represents the first reported observation of GFP expression in groundnut. Transient expression of sGFP in tobacco and groundnut epidermal and guard cells was discreet and highly localised, thereby making it easier to identify and recover transformed cells or tissues. Moreover, sGFP unlike the GUS reaction product, did not leak into adjacent cells. A. tumefaciens-mediaied tobacco leaf disc transformation experiments using sGFP as the marker, showed that putatively transformed sGFP tobacco callus and shoot primordia could be easily distinguished from their untransformed counterparts. Thus, the development of a sGFP plant expression vector should enable efficient identification transformed cells, and when used in conjunction with the in planta transformation of HESC explants, or with any other groundnut regeneration system, it could eventually facilitate the recovery of the transgenic groundnut.

In planta transformation could be potentially improved by (i) treating the A. tumefaciens strains with phenolic compounds, (ii) the addition of multiple copies of virG genes in A. tumefaciens and (iii) the use of constitutively expressed virG genes in A. tumefaciens.

Phenolic compounds released from wounded plants have been shown to induce the expression of the vir genes in A. tumefaciens (Stachel et al., 1986). Activation of the vir genes is critical for the transfer and integration of the T-DNA into the plant nuclear genome. Acetosyringone is a phenolic compound which have been used induce vir gene expression (Stachel and Zambryski, 1986). Incorporation of acetosyringone in the A. tumefaciens culture medium has resulted in the improvement of transformation efficiency in a number plant species including pea (Davies et al.,1993) and rice (Hiei et al., 1994). However, acetosyringone has little or no effect on A. tumefaciens-mediated transformation of groundnut (Mansur et al., 1993; Cheng et al., 1996). An increase in groundnut transformation frequency was observed when wounded tobacco extracts were included in the A. tumefaciens culture (Cheng et al., 1996). This suggested that vir gene induction may involve more than one phenolic compound. To investigate this, and its possible effect on the transformation

123

frequencies of the HESC explants, various phenolic compounds could be included in A. tumefaciens culture medium.

In an effort to improve the efficiency of A. tumefaciens-medidled transformation of recalcitrant plant species, Lui et al. (1992) and Hansen et al. (1994) investigated the effect of multiple copies and constitutive expression of virG genes inA. tumefaciens, respectively. The vir gene regulatory system operates through two virulence genes: virA and virG. The virA gene is constitutively expressed, and encodes for an inner membrane protein. VirA responds to the presence of plant phenolic compounds and activates VirG by phosphorylation. Phosphorylated VirG functions as a positive transcriptional regulator of itself and other vir genes (reviewed in Stachel and Zambryski, 1986). By increasing virG expression, the expression among the other vir genes will also be elevated. Potentially, this could enhance transformation efficiencies since this would enable the A. tumefaciens to transfer T- DNA immediately without waiting for vir gene induction.

Lui et al. (1992) found that the transient transformation frequency in celery, carrot and rice was influenced by (i) virG gene copy number, (ii) the type of Ti- plasmid (i.e. agropine-, nopaline- or octopine-type) harboured by the A. tumefaciens strain and (iii) the infected plant species. Their results indicated that transient transformation could be significantly enhanced by introducing additional copies of the virG into agropine-type A. tumefaciens strains for rice and celery tissues, and extra virG genes into nopaline-type A. tumefaciens strain for carrot tissues.

Although the multiple virG gene approach has worked efficiently in a number of plant species, it was ineffective in maize (Sahi etal., 1990). It has been shown that a metabolite, 2,4-dihydroxy-7-methoxy-2//-l,4-benzoxazin-3(4//)-one (DIMBOA), found in maize homogenates, specifically inhibited the induction of Ti plasmid vir genes (Sahi et al., 1990). This might provide an explanation as to why maize is inefficiently transformed by A. tumefaciens.

To circumvent this problem of vir gene induction, Hansen et al. (1994) investigated whether a mutant virG gene, WrGN54D, could increase the efficiency of transformation. The mutation in the WrGN54D allowed high-level constitutive expression of the vir genes independent of either virA induction or chemical inducing agents (Pazour et al., 1992 cited from Hansen et al., 1994). Hansen et al. (1994) observed a higher transient transformation rate with the A. tumefaciens strains carrying v/rGN54D than with A. tumefaciens strains carrying virG. In addition, A. tumefaciens strains carrying WrGN54D were found to be more efficient at generating stably transformed cotton and tobacco plants than the control strains carrying wild-type virG gene (Hansen et al., 1994).

124

These studies have offered an insight on possible ways of improving the existing in planta transformation systems. Enhancing virG expression by either chemical or genetic manipulation can significantly improve the efficiency of transformation in both A. tumefaciens susceptible and recalcitrant plant species. The effects of increased virG expression could easily be tested in different groundnut tissues using the modified T-DNA dependent transient transformation assay system.

125

A. tumefaciens s tra in

Frequency of transform ation

(% )a

Mean GUS positive sector

score** ± SE

GUS activity0'± SE

C58Cl/pMKC6 100.0 6.08 ± 0.26 31 994 ±819C58C3/pMKC6 85.5 3.50 ± 0.35 15 845 ± 2 507

EH A105/pMKC6 94.8 5.99 ±0.31 40 432 ± 2 504LB A4404/pMKC6 95.0 6.17 ± 0.32 61 403 ± 8 967

Table 4.1 Transient transformation of N. tabacum SRI seedlings with four different strains of A. tumefaciens containing pMKC6; C58Cl/pMKC6, C58C3/pMKC6, EHA105/pMKC6, and LBA4404/pMKC6. a Frequency of seedlings exhibiting GUS positive foci, b mean GUS positive sector score, where one point was awarded for each one eighth of a GUS positive stained sector on the cotyledons, c GUS activity as measured in pmol 4 MU/min/mg protein and SE. The results were derived from two independent experiments and 30 seedlings were used for each fluorimetric MUG assay and each histochemical X-Gluc assay. Significant differences in the transformation frequency (X2=11.6, 3 df, P=0.01), mean GUS positive sector scores (F=17.1, 3 and 237 df, P=0.01) and GUS activity (F=15.4, 3 and 4 df, P=0.05) were observed among the four bacterial strains.

126

A. tumefaciens strain

Type of explant

Totalnumber

o fexplants

Frequency of transformation3

± SE (%)

Mean no. of GUS foci per explant ± SE

C58C1 cotyledon 20 0.0 ± 0.0 0.0 ± 0.0C58C3 cotyledon 20 10.0 ± 14.1 0.85 ± 2.74

EHA105 cotyledon 20 10.0 ± 0.0 0.45 ± 1.79LBA4404 cotyledon 20 5.0 ±7.1 0.05 ± 0.22

C58C1 embryo 114 29.9 ± 34.2 2.6 ± 3.0C58C3 embryo 108 26.8 ± 34.5 2.4 ± 2.2

EHA105 embryo 102 31.5 ± 25.8 13.9 ± 11.9LBA4404 embryo 112 25.0 ± 32.8 4.1 ± 5.6

Table 4.2 Transient transformation efficiency of mature cotyledon and mature zygotic embryo axis explants inoculated with four different A. tumefaciens strains containing the binary vector pMKC6. a Frequency of explants exhibiting GUS positive foci and SE, standard error. The results for the cotyledon explants were derived from two independent experiments, while the results for the embryo explants were derived from four independent experiments. No significant differences in the transformation frequency were observed among the four A. tumefaciens strains with either de- embryonated (X2=2.35, 3 df, P>0.95) or embryo axis explants (X2=1.32, 3 df, P>0.99). An analysis of variance test found no significant difference between the four A. tumefaciens strains and the mean number of GUS foci per de-embryonated explant (F=1.17, 3 and 76 df, P>0.05). However, significant differences were observed between the four A. tumefaciens strains and the mean number of GUS foci per embryo axis explant (F=7.83, 3 and 432 df, P=0.01).

127

A1MV1: 5' TCGAGTTTTTATTTTTAATTTTCTTTCAAATACTTCCAC 3’

A1MV2: 3' CAAAAATAAAAATTAAAAGAAAGTTTATGAAGGTGGTAC 5'

Oligonucleotides A1MV1 and A1MV2 were annealed to form a A1MV 5'-UTR which contained overhanging Xhol andNcol sites at the 51 and 3' ends, respectively.

S 'T C G A - j^ C 3' T L G G T A C

A1MV 5'-UTR

Hindlll.SphLPstLHinclI XhoLEcoRl

Ncol

CaMV 35S TEV luc reporter CaMV 35Spromoter 5'-UTR gene terminator

pRTL2LUC5.7 Kb

BamHLXbalPstl.SphLHindlll

IDigested with Xhol and Ncol

Hindlll.SphLPstLHinclI Xhol

Ncol

CaMV 35S promoter

Amp1*

BamHLXbalPstl.SphLHindlll

luc reporter gene

CaMV 35S terminator

pRTL2LUC 5.7 Kb

Ligation Hindlll.SphLPstLHinclI XholI Ncol

I

CaMV 35S promoter

| Amp1*

fS /JA1MV

5'-UTR

BamHLXbalPstl.SphLHindlll

luc reporter gene

CaMV 35S terminator

pRT2 A1MV LUC5.6 Kb

Figure 4.1 Construction of pRT2 A1MV LUC.

128

m m m t

cDNA clone from the U 1 strain of TMV

5' TAGACTCGAG, iCCATGGCATAC 3'

Q 5'-UTR was amplified from the cDNA clone using the primers Q 5' and Q 3'.

ATCTGAGCTC GGTACCGTATG Q5'-UTR

Digested with Xhol and Ncol

5'TCGA * , y * c 3^ G G T A C

Hindlll.SphLPstLHinclI XhoLEcoRI

Ncol

'r/z/ACaMV 35S TEV luc reporter CaMV 35Spromoter 5'-UTR gene terminator

pRTL2LUC 5.7 Kb

TQ5-UTR

BamHLXbalPstI.SphI.HindIII

IDigested with Xhol and Ncol

Hindlll.SphLPstLHinclI Xhol

NcolBamHLXbal

PstI.SphI.HindIII

CaMV 35S promoter

AmpR

luc reporter CaMV 35S gene terminator

pRTL2LUC 5.7 Kb

Ligation

Hindlll.SphLPstLHinclI Xhol

NcolBamHLXbal

PstI.SphJ.HindIII i

CaMV 35S promoter

AmpR

Q luc reporter CaMV 35S5'-UTR 8ene terminator

pRT2 Q LUC 5.6 Kb

Figure 4.2 Construction of pRT2 Q LUC.

129

Plasmid: Relative activity(LUC:GUS):

TTTT AATTTT CTTT C A A AT ACITCC ACC AT GG— Ncol

A1MV 5-UTR (pRT2 A1MV LUC)

CTCGAGCTCTAAACACrCCCGAAAATAAnTGACTTAAACAACGYKol-------

CG ACT GTTC AAGCAAATTACTT ACCATGGNcol—

PVS 5 -UTR(pRT5'2 LUC) ■5.1

17.7

CTCGAGAATTCTCAACACAACATATACAAAACAAACGAATCTCA—AGC AAT CAAGCATT CTACTTCTATTGCAGCAATTTAAATCATTT C

TTTT AAAGCAAAAGCAATTTTCTGAAAATnTCACCATTTACGAA

CGATAGCCATGGNcol

TEV 5 -UTR (pRTL2LUC)

CJICG AGTATTTTT AC AAC A ATT ACC AAC AACAACA AAC A AC AAA Yfwl-------

CAACATTACAATTACTATTTACAATTACCATGGNcol—

Q 5-UTR (pRT2QLUC)

14.6

19.6

CTCGAGCTGCAGGCGGCCGCACTAGTGATATCCCGCGGCCATGG Ncol—

SYN 5-UTR (pRTS2LUC)

1.0

-jl.O

HCaM V 35S promoter with a dupliacted enhancer

H5'-UTR I \luc reporter gene HCaM V 35S terminator

H Tobacco leaves HI Groundnut leaves

Figure 4.3 Transient expression analysis of high-level plant expression vectors containing different 5'-UTRs. The 5'-UTR test plasmids were co-bombarded with the reference plasmid pRTL2GUS into tobacco and groundnut leaves. The relative activites represent the mean fold increase in the LUC: GUS ratio of each 5'-UTR nomalised against the LUC:GUS ratio of pRTS2LUC.

130

A■

* ■rV *

•: • #41

* *%

B

• • •r t *

• • • •

T j? *

c

Figure 4.4 Histochemical localisation of transient GUS expression in cotyledon (A), leaf (B) and stem (C) twenty-four hours after bombardment. The distinguishing circular zone of GUS positive foci surrounding the zone of damaged cells can be seen clearly in all the samples.

H.Sp.P.Hc' X.B.Sm

SBS.K

\Sp.H

H.Sp.P.Hc Xh.RI

MSB I

p35S GUS INT 12.6 Kb

B.XP.Sp.H

. i—pRTL2GUS

5.6 Kb

The uidA-intron gene was amplified from the p35S GUS INT using the primers MKC1 and MKC2.

SB5’ AT AGCCATGGivt^vv ,..,.-,..i GGATCCATC 3'

TATCGGTACC CCTAGGTAG

Digested with NcoIIBamHI

SB5’ CATOGt .J,...,,.,;. , G 3'

r ^ ^ CCTAG

Ligation

H.Sp.P.Hc Xh.RI N

Digested with NcoIIBamHI

▼H.Sp.P.Hc

Xh.RIB.X

’.Sp.H

pRTL2 3.8 Kb

B.XSB P.Sp.H

^3 CaMV 35S promoterJCaMV 35S promoter with nRT2 TEV GUS INT

a duplicated enhancer v 5 8 KbI^TEV 5-UTR Z\uidA gene

W\uidA-intron gene 0CaM V 35S terminator 0Ampicillin resistance gene

Figure 4.5 Construction of pRT2 TEV GUS INT. Abbreviations: B, BamHI\ H, HindIII\

He, Hincll\ N, Ncol\ P, PstI; RI, EcoRl\ SB, SnaBI\ Sp, Sphl\ X, Xbal\ Xh, Xhol.

132

H.Sp.P.HcX.B.Sm

SBS.K

P.Sp.H

p35S GUS INT12.6 Kb

Digested with Hindlll

RI.S.K.Sm.B.Hc.P.Sp.H

pUC19 2.7 Kb

Digested with Hindlll

H.Sp.P.HcX.B.Sm

RI.S.K.Sm.B.Hc.P.Sp.H

S.KP.Sp.HSB

pUC19 2.7 Kb

Ligation

RI.S.K.B.Hc.P.Sp.H.Sp.P.Hc X.B.Sm

S.KSB1

P.Sp.HI

9 Np35S GUS INT/

pUC195.3 Kb

BICaMV 35S promoter WriuidA-intron reporter gene ESCaMV 35S terminator 0Ampicillin resistance gene

Figure 4.6 Construction of p35S GUS INT/pUC19. Abbreviations: B, BamHl\

H, H indlll; He, HincII\ K, Kpnl\ P, Pstl\ RI, EcoRI\ SB, SnaBl\ S, Sacl\ Sm, Smal\

Sp, Sphl\ X, Xbal.

133

Plasmid: Relative activity(GUS:LUC):

pRTL2 GUS

m30.8

20.2

pRT2 TEV GUS INT 11.3

6.5

p35S GUS INT/pUC19 1 1 ft

11.0

JCaMV 35S promoter with |T o b acco leavesa duplicated enhancer | | Groundnut leaves

iHCaMV 35S promoter ^T E V 5-UTR □SY N 5-UTR [Z\uidA gene W\uidA-intron gene HCaMV 35S terminator

Figure 4.7 Transient expression analysis of plant expression vectors containing uidA and uidA-intron reporter genes. pRTL2GUS, pRT2 TEV GUS INT and p35S GUS INT/pUC19 were co-bombarded with the reference plasmid pRTL2LUC into tobacco and groundnut leaves. The relative activites represent the mean fold increase in the GUS:LUC ratio of each GUS plasmid nomalised against the GUS:LUC ratio of p35S GUS INT/pUC19.

134

pBIN19 11.8 KbpMKC3

5.8 Kb

Digested with Hindllll Kpnl

Digested with Hindlll/Kpnl

Ligation

pRTL2 GUS5.6 Kb

pMKC6 14.9 Kb Digested with

Xhol/Kpnl

Digested with Xhol/Kpnl

Ligation

BCaMV 35S promoter with a duplicated enhancer

^ T E V 5-UTRI I uidA geneF?] uidA-intron geneEH CaMV 35S terminator0 Ampicillin resistance geneBjj Kanamvcin resistance gene (nptll)

pMKC7 14.7 Kb

Figure 4.8 Construction of pMKC6 and pMKC7. Abbreviations: B, BamHI; H, H indlll;

He, H indi; K, Kpnl; N, Ncol; P, PstI; RI, EcoRI; SB, SnaBI; S, SacI; Sm, Smal;

Sp, SphI; X, Xbal; Xh, Xhol, LB, left border; RB, right border.

135

Figure 4.9 Analysis of the GUS expression in Agrobacterium tumefaciens. Overnight bacterial cultures were incubated for 16 hours with X-gluc solution at 37°C. The tube with the dark blue solution contains cells transformed with pMKC7, a plasmid containing an intron-free uidA reporter gene, and the tube with the clear solution contains cells transformed with pMKC6, a plasmid containing a uidA-intron reporter gene.

A B CI

%

ED

m> -

H

•J

I f 3i *

Figure 4.10 Histochemical localisation of transient GUS expression from infected N.

tabacum SRI seedlings. The seedlings were cocultivated with the A. tumefaciens strain EHA105 containing the binary vector pMKC6. The different sizes of GUS positive sectors on the tobacco cotyledons were used to score the efficiency of transient transformation, where one point was awarded for each one eighth of a GUS positive stained sector on the cotyledons. A Seedlings with no GUS positive sectors and a score of 0; B Seedlings with a score of 1 out of 8; C Seedlings with a score of 2 out of 8; D Seedlings with a score of 3 out of 8; E Seedlings with a score of 4 out of 8; F Seedlings with a score of 5 out of 8; G Seedlings with a score of 6 out of 8; H Seedlings with a score of 7 out of 8; I Seedlings with a score of 8 out of 8.

Figure 4.11 Histochemical localisation of transient GUS expression from infected JL24 embryo axis explants. Explants were cocultivated with the A. tumefaciens strain EHA105 containing the binary vector pMKC6.

S.SII.No.X.Spe.B.Sm.P.HcPv.RIN

SBB.X

P. RI. R V. H. Sa.Xh.K

I spMKC96.1Kb

Digested with Sail. Sail was blunted and then digested with Hindlll

K.Xh.Hc.Sa.HB.K.S

B.S.KIrSSSJ S!

RI.P.Sm.Spe.X.No.SII.SI

pPCV3/pBS II KS+ 5.2 Kb

Digested with HindllllSmal

K.Xh.Hc.Sa.HB.K.S

B.S.K RI.P.Sm.Spe.X.No.SII.S

pM KCll 8.4 Kb

HCaMV 35S promoter with a duplicated enhancer

UlCaMV 35S promoter ^ T E V 5-UTR E2] uidA-intron gene 0 C aM V 35S terminator S H-IPCV CP gene 0 Ampicillin resistance gene

Figure 4.12 Construction of pMKCl 1. Abbreviations: B, BamHI\ H, Hindlll.;He, HincII\ K, Kpnl, N, Ncol, No, Notl; P, Pstl, Pv, Pvul; RI, EcoRI\ RV, EcoRV;SB, SnaBl, S, S'ac/; SI I, Sacll, Sm, Smal\ Sp, Sphl; Spe, Spel; X, Xbal, Xh, Xhol Construction of pPCV3/pBSII KS+ and pMKC9 are detailed in Appendices B3 and B4, respectively.

139

‘.RI.RV.H

S.SII.No.X.Spe.B.Sm.RHc B.X

Pv.RI vl

SB 1^.........

B.S.KI

B.K.S Xh.K

pM KCll 8.4 Kb

Digested with Sacll. SacIIwas blunted and then digested with Xhol

RI.Sm.B.X.S.Xh.H

RB

pMOG402 10.0 Kb

LB

DigestedwithSmallXhoI

®CaM V 35S promoter with a duplicated enhancer

I^CaMV 35S promoter UTEV 5-UTR \c]uidA-intron gene 0C aM V 35S terminator ^H -IPCV CP gene 0A m picillin resistance gene ^R epaired kanamycin resistance

gene (nptll)

RI.No.X.Spe.B.Sm.P.Hc B.X

Pv.RI N

SB

LB

f

P.RI.RV.HT.K.S

B.S.K Xh.H

RBpMKC12 15.4 Kb

Figure 4.13 Construction of pMKC12. Abbreviations: B, BamHI\ H, Hindlll,;He, Hinclp K, Kpnl\ N, Ncol- No, Notl\ P, Pstp Pv, Pvup RI, EcoRI- RV, EcoRV- SB, SnaBI; S, Sacl\ SI I, Sacll\ Sm, Smal\ Sp, Sphl\ Spe, Spel\ X, Xbal\ Xh, Xhol\ LB, left border; RB, right border.

Mo.X.Spe.B.Sm.P.HcB.XRl.RV.H

B.K.S Xh

Ligation

140

Plasmid: Relative activity(GUS:LUC):

pRT2 TEV GUS INT

m 3.8

pMKCllwm 3.3

p35S GUS INT/pUC19 ■ 1.0

BCaMV 35S promoter with a duplicated enhancer

^C aM V 35S promoter g|TEV 5'-UTR WluidA-intron gene & H -IP C V C P gene 0C aM V 35S terminator

Figure 4.14 Transient expression analysis pRT2 TEV GUS INT, pMKCl 1 and p35S GUS INT/pUC19. The plasmids were co-bombarded with the reference plasmid pRTL2LUC into groundnut leaves. The relative activites represent the mean fold increase in the GUS:LUC ratio of each GUS plasmid nomalised against the GUS:LUC ratio of p35S GUS INT/pUC19.

141

S.SII.No.X.Spe.B.Sm.P.HcPv.RIN B.X

SB RI.RV.H.Sa.Xh.K1

pMKC96.1Kb

Digested with Ncol/Hindlll

Ligation

N P.Sp.H

S.SII.No.X.Spe.B.Sm.P.Hc Pv.RI

In P.Sp.H.Sa.Xh.K I Itm-;

H.Sp.P.Hc Xh.RI

N P.Sp.H

pMKC19 4.6 Kb

Digested with NcoIIHindlll

pMKC21 4.9 Kb

HCaMV 35S promoter with a duplicated enhancer

EUTEV 5-UTR W] uuidA-intron gene E5I sGFP reporter gene 0 CaMV 35S terminator 0 Ampicillin resistance gene

Figure 4.15 Construction of pMKC21. Abbreviations: B, BamHI\ H, HindIII\ He, Hincll\ K, Kpnl\ N, Ncol; No, NotI\ P, PstI; Pv, Pvul\ RI, EcoRI\ RV, EcoRV\ SB, SnaBI\ S, Sacl\ SII, SacII\ Sm, Smal; Sp, Sphl; Spe, Spel\ X, Xbal; Xh, Xhol. Construction of pMKC19 is detailed in Appendix B5.

142

Figure 4.16 Transient GFP expression from a bombarded epidermal cell (A) and a guard cell (B). The groundnut leaves were bombarded with pMKC21, and visualised under a UV epifocal microscope fitted with FITC (excitation filter 470-490 nm and emission filter 515-560 nm) filter set.

S.SII.No.X.Spe.B.Sm.PHe

Pv.RI4

SB

B.XP.RI.RV.H

B.S.KI

B.K.SXh.K I

pM KCll 8.4 Kb

S.SII.No.X.Spe.B.Sm.P.Hc3.Sp.H

Pv.RI 3.K.SN1

B.S.K1

Xh.K1vaastm vsss's

pMKC23 7.0 Kb

S.SII.No.X.Spe.B.Sm.P.Hc Pv.RI

N P.Sp.H.Sa.Xh.K

I

pMKC21 4.9 Kb

Digested with EcoRIIHindHI

Ligation

Digested with EcoRIIHindHI

N P.Sp.H

BCaMV 35S promoter with a duplicated enhancer

g i CaMV 35S promoter g^TEV 5'-UTR [§3 sGFP reporter gene & H -IP C V C P gene HCaM V 35S terminator 0A m picillin resistance gene

Figure 4.17 Construction of pMKC23. Abbreviations: B, BamHI; H, H indlll; He, HincII; K, Kpnl; N, Ncol; No, Notl; P, PstI; Pv, Pvul; RI, EcoRl; RV, EcoRV;

SB, SnaBI; S, SacI; SII, SacII; Sm, Smal; Sp, SphI; Spe, Spel; X, Xbal; Xh, Xhol.

144

RI.Sm.B.X.S.Xh.H

RB

pMOG402 10.0 Kb

LB

Digested with Sacll. Sacll was blunted and then digested with Xhol

No.X.Spe.B.Sm.P.Hc RSp.H

B.S.KI

B.K.S Xh

DigestedwithSmal/Xhol

shbbcLigation

HCaM V 35S promoter with a duplicated enhancer

BSiCaMV 35S promoter ^ T E V 5'-UTR EjsGFP reporter gene HCaMV 35S terminator fflH-IPCV CP gene 0A m picillin resistance gene ^R epaired kanamycin resistance

gene (nptll)

Figure 4.18 Construction of pMKC24. Abbreviations: B, BamHI; H, Hindlll,He, Hincll\ K, Kpnl', N, Ncol, No, Notl, P, PstI, Pv, Pvul, RI, EcoRl’, RV, EcoRV’, SB, SnaBI:; S, Sad, SI I, Sacll, Sm, Smal; Sp, Sphl; Spe, Spel, X, Xbal\ Xh, Xhol, LB, left border; RB, right border.

No.X.Spe.B.Sm.P.Hc

Pv.RI

pMKC24 14.0 Kb

145

Figure 4.19 GFP fluorescence from putatively transformed N. tabacum cv. Samsun callus (A), shoot primordia (B) and cotyledons (C). The cotyledons represent two Fi generation seedlings; one derived from a non-GFP expressing kanamycin sensitive seedling (left hand side), the other derived from a GFP expressing kanamycin resistant seedling (right hand side). The tobacco leaf discs were transformed with EHA105/pMKC24, and GFP fluorescence was visualised under a UV epifocal microscope fitted with F1TC filter set.

Chapter 5

Evaluation of transgenic N. benthamiana plants containing H-IPCV CP gene sequences for resistance to H-IPCV, D-IPCV and L-IPCV

5.1 IntroductionCoat protein-mediated resistance (CP-MR) has been widely adopted to protect

plants from viruses (reviewed in; Fitchen and Beachy, 1993; Gonsalves and Slightom, 1993). In this work the CP-MR approach was evaluated as a potential method for generating resistance to IPCV. The IPCV coat protein (CP) gene was cloned into a plant expression vector and then transformed in Nicotiana benthamiana using Agrobacterium-mediated transformation. N. benthamiana was chosen as the experimental plant system for two reasons. Firstly, N. benthamiana is a systemic host for IPCV and can be easily infected by mechanical inoculation (Reddy et al., 1983). Secondly, a reliable and efficient transformation system was available for this Nicotiana species. The transgenic progeny derived from the primary transformants were analysed for resistance to three different isolates of IPCV; D, H, and L. Molecular analysis was also conducted on the transgenic progeny to determine the effect, if any, of transgene copy number and H-IPCV CP expression upon resistance to H-IPCV infection.

5.2 Results5.2.1 Construction of the plant expression vector containing the H-IPCV CP gene

The plant expression vector containing the H-IPCV CP gene was constructed as detailed in Figure 5.1. The 1.1 kb cDNA encoding the H-IPCV CP gene (Wesley et al., 1994) was excised from plasmid pPCW356 by digestion with EcoRl and Xbal, then blunt ended with DNA polymerase (Klenow fragment) and ligated in the sense orientation into the Smal site of the plant expression vector pROKII to generate pPCV3. The pROKII vector is a pBIN19 derivative, and contains the cauliflower mosaic virus (CaMV) 35S promoter, a multiple cloning site, and the nopaline synthase (nos) terminator sequences. The cloning of the H-IPCV CP gene into pROKII was carried out by Dr. V. Wesley (Mayo et al., 1994) at the Scottish Crop Research Institute (SCRI), Invergowrie, Scotland.

5.2.2 Transformation of N. benthamiana with the H -IPCV CP geneThe binary plasmid pPCV3 was mobilised into the A. tumefaciens strain

LBA4404, and then transformed into N. benthamiana using a hypocotyl stem section transformation system. Transformants were selected on kanamycin at 40 mg/1. A total of twenty independent putative transgenic CP lines were recovered and these were designated AC 1 to AC20, respectively. The primary transformants were transferred to the greenhouse and allowed to self fertilise to produce T2 generation seed. This work was carried out by Dr. A. Kumar and Ms. K. Webster at SCRI.

148

5.2.3 C haracterisation of the putative transgenic N. benthamiana CP+ lines

Expression of the H-IPCV CP gene was assessed in the primary transformants using Western blot analysis by Dr. M. Mayo and Ms. A. Jolly at SCRI. H-IPCV CP gene expression was detected in three lines, AC8, AC 15 and AC20, at moderate, low and high levels, respectively. However, six other lines, AC2 ,AC6, AC7, AC 10, AC 18 and AC 19, may also have been expressors but the results from those samples were inconclusive. CP expression levels from these six lines were very low. This made it difficult to distinguish them from non-transformed (CP-) plant samples. The remaining eleven lines, AC1, AC3, AC4, AC5, AC9, AC11, AC12, AC14, AC15, AC 16 and AC 17, exhibited no detectable levels of CP expression.

T2 generation transgenic progeny were screened for the expression of both the kanamycin-resistance (neomycin phosphotransferase II (nptll)) and H-IPCV CP genes, and the presence of the H-IPCV CP transgene sequence. To determine if the T2 progeny were kanamycin-resistant, between 30 to 300 T2 seeds from each line were germinated on MS30 plant medium containing kanamycin at 50 mg/1. After three weeks, the T2 seedlings were examined and compared to CP- and transformed control kanamycin-resistant seedlings to provide a comparison between kanamycin-sensitive and kanamycin-resistant phenotypes, respectively. Of the twenty lines, nine produced kanamycin-resistant seedlings; AC7, AC8, AC 10, AC 12, AC 14, AC 15, AC 18, AC 19 and AC20.

The number T-DNAs integrated into the plant genomes was estimated by segregation analysis of the kanamycin-resistance phenotype in the T2 seedlings. Lines AC7 and AC 18, segregated 3:1 for kanamycin-resistance, and therefore possessed one active T-DNA locus. Although line AC 19 segregated 1:1 for kanamycin-resistance in a non-Mendalian manner for a single unlinked gene, it may still contain a single T-DNA locus. This distorted segregation pattern of 1:1 is often associated with T-DNA integration into gametophytic genes, with the consequence of reduced T-DNA inheritance through the affected gamete. Line AC 10 segregated 15:1, suggesting two T-DNA loci. Lines AC14 and AC15 had segregation ratios between 3:1 and 15:1 for kanamycin-resistance indicating the presence of either one or two T-DNA loci. Lines AC8 and AC20 appeared to contain either two or three T-DNA loci as both segregated approximately 33:1 for kanamycin-resistance.

CP expression in the T2 plants was determined by Western blot analysis of soluble protein extracted from twenty pooled T2 seedlings using primary antibodies and alkaline phosphatase (AP) conjugated secondary antibodies specific to the H-IPCV CP (courtesy of Dr. R. A. Naidu). A single protein of 23 000-24 000 kDa was detected on the Western blots in lines AC8, ACM, AC 15, AC 18, AC 19 and AC20

149

(Figure 5.2). The lack of a corresponding band in the non-transformed CP- sample, and the similarity between the size of the detected protein with the 23 kDa H-IPCV CP confirmed the expression of H-IPCV CP.

PCR analysis was used to screen for the H-IPCV CP transgene. DNA was extracted from a pooled sample of ten T2 seedlings and PCR amplified with the oligonucleotide primers IPCV266 (5' CGGTATTCTGTCCTATTACC 3') and IPCV823 (5* GAACTTCTGCTTAAGATCAG 3'). The primers annealed specifically to the H-IPCV CP gene sequence and generated a 557 bp PCR product. A single band of expected size was detected in lines AC7, AC8, AC 10, AC 14, AC 15, AC 17, AC 18, AC 19 and AC20 (Figure 5.3).

The data from screening the putative transgenic CP lines are summarised in Table 5.1. Eight segregating lines; AC7, AC8, AC10, AC14, AC15, AC18, AC19 and AC20, contained both an active kanamycin-resistant gene and the H-IPCV CP gene, though only lines AC8, AC14, AC18, AC19 and AC20 exhibited detectable levels of transgene CP expression. Two lines appear to contain truncated T-DNA copies; line AC 12 with an active ntpll gene but no H-IPCV CP gene, and line AC 17 with low or non expressing H-IPCV CP gene and no ntpll gene. The remaining ten lines contained neither the CP nor ntpll genes.

5.2.4 Transgene and RNA analysis of transgenic N. bentham iana CP+ lines

The initial screen of the putative transgenic CP lines resulted in the identification of eight independent transgenic CP+ lines. These eight CP+ lines were then analysed to determine transgene copy number and H-IPCV CP gene expression levels. Pooled plant material consisting of the two youngest, fully expanded apical leaves from ten T2 segregating kanamycin-resistant plants of between 15 to 20 cm in height were obtained from each transgenic CP+ line. Pooled material was used for two reasons. Firstly, T2 generation progeny were derived from segregating lines, and as such, the individual CP+ plants from each line were not genetically identical. Secondly, transgenic plants had not been evaluated for resistance against H-IPCV infection and therefore could not be related to the response from individual infected plants. However, the mean CP copy number and CP gene expression level could be usefully compared against averaged ELISA values.

Southern blot analysis was used to determine H-IPCV CP gene copy number in the CP+ lines. Collected plant material was homogenised in liquid nitrogen and mixed thoroughly prior to use. Genomic DNA was extracted from the pooled material from each line, digested with Hindlll, then analysed on Southern blots using a 32P labelled H-IPCV CP specific DNA probe. The number and size of H-IPCV CP genes

150

present in each transgenic line was estimated from the hybridisation pattern (Figure 5.4). Most lines contained multiple copies of the transgene, and these appeared to have integrated into different sites within the host genome in the independent CP+ lines. The data are presented in Table 5.2.

RNA was extracted from each pooled transgenic CP+ line along with a similar pool of non-transformed N. benthamiana CP- material. An equal amount of purified total RNA (5.6 fig) from each extraction was used for the Northern blot. H-IPCV CP transcript was detected on the blot using H-IPCV CP specific DNA probes. As shown in Figure 5.5, a single transcript of the expected size, 1.5 kb, was detected in all eight transgenic CP+ lines. This transcript included the 1.1 kb CP gene and its 5' untranslated region, and approximately 400 bp of nos terminator sequence. The same Northern blot was then hybridised with a second 32P labelled probe generated from the Brassica rapa 18S rRNA gene (Da Rocha et al., 1995) (Figure 5.5). The abundance of the H-IPCV CP and 18S ribosome transcripts were quantified with a Molecular Dynamics Phosphorlmager using the ImageQuant software. To correct for unequal loading and transfer of the total RNA onto the blot, H-IPCV CP transcript values were normalised by dividing the original H-IPCV CP transcript value by the respective 18S ribosome transcript value. The normalised H-IPCV CP transcript values are presented in Table 5.2.

To quantify accumulated levels of H-IPCV CP in each transgenic line, Western blot analysis was conducted on soluble protein extracted from the pooled transgenic material, and protein concentration of the plant extracts were determined by the Bradford protein assay (Bradford, 1976). Purified H-IPCV CP was used as a standard for the Western blot analysis, and known amounts were run alongside equal volumes of soluble protein (5 fill) isolated from each transgenic line. The expected 23 kDa CP was only detected in five of the eight CP+ lines (Figure 5.6). CP levels were quantified from the scanned image of the developed Western blot using NIH Image 1.62b7 (National Institutes of Health, USA). The H-IPCV CP expression levels in lines AC8, AC10, AC14 , AC19 and AC20 were 50.2, 21.7, 102.0, 13.1 and 51.1 pg CP per pg total soluble protein, respectively. The data are presented in Table 5.2.

5.2.5 Evaluation of the susceptibility of N. benthamiana to H-IPCVNon-transformed N. benthamiana (CP-) were infected with the H isolate of

IPCV to determine the rate of virus multiplication and spread in CP- plants. Plants of between 8 to 12 cm in height, were mechanically inoculated with freshly prepared inoculum from either H-IPCV infected N. benthamiana, or from H-IPCV free N. benthamiana.

151

To assess the extent of virus multiplication and virus spread in the infected plants, an 'inoculated sample' consisting of a leaf disc from each inoculated leaf, and a 'systemic sample' containing one leaf disc from the first two systemic leaves above the inoculated leaves, were obtained from each plant, and the H-IPCV levels were quantified by enzyme linked immunosorbent assay (ELISA).

Two sets of plants were infected. The first set consisted of twenty CP- plants inoculated with H-IPCV inoculum, and five CP- plants inoculated with H-IPCV free inoculum. Leaf discs were excised from four unsampled H-IPCV infected plants, and from one unsampled H-IPCV non-infected plant on a daily basis for five days beginning the first day following inoculation.

The second set consisted of sixteen and eight CP- plants that were inoculated with H-IPCV and H-IPCV free inoculum, respectively. Leaf discs were excised from four unsampled H-IPCV infected, and two H-IPCV non-infected plants. The samples were collected at three, six, nine and twelve days post-inoculation.

ELISA values from the plants inoculated with H-IPCV free inoculum were averaged to derive mean background ELISA values for inoculated and systemic leaf samples from non H-IPCV infected plants at each time point. These were then used to correct the appropriate ELISA values of the inoculated and systemic samples from each H-IPCV inoculated plant. Corrected ELISA values and the mean of the corrected values were plotted together as shown in Figure 5.7.

The systemic host N. benthamiana was found to be highly susceptible to the H isolate of IPCV when mechanically inoculated. Virus was detected in the inoculated samples from the first day following infection (Figure 5.7A). Virus levels increased rapidly, by five days post-inoculation a twenty-five fold difference was observed between the average ELISA values on day one and day five. Five days post­inoculation, the mean ELISA values in the inoculated level reached a peak OD of 1.9 (Figure 5.7A), and remained approximately constant until twelve days post­inoculation, where a 16.4% decrease was detected in the leaves from the inoculated samples. Virus multiplication in the systemic leaf sample was initiated between the three and five days post-inoculation, and continued to increase so that by twelve days post-inoculation the mean ELISA value was 1.8. This level was comparable to the ELISA values for the inoculated leaves (Figure 5.7B). None of the H-IPCV infected plants developed any visible symptoms on either the inoculated or systemic leaves that were markedly different from mechanically inoculated H-IPCV free control plants. Typically, N. benthamiana infected with H-IPCV develop mosaic symptoms (Reddy et al., 1983). Their absence from the H-IPCV inoculated plants in this study may be due to the fact that the visible symptoms did not have sufficient time to fully develop.

152

5.2.6 Evaluation of transgenic N. benthamiana CP+ lines for resistance to H-IPCV

Transgenic CP+ progeny from lines AC7, AC8, AC 15, AC 18, AC 19 and AC20 were examined for resistance to H-IPCV. Twelve to fifteen week old kanamycin-resistant T2 generation plants of between 15 to 20 cm in height, were mechanically inoculated with H-IPCV. Experiments were performed in duplicate. Each experiment contained ten transgenic CP+ plants from each line and ten non- transformed CP- plants for H-IPCV inoculation, and five transgenic CP+ plants from each line and five non-transformed CP- plants for H-IPCV free inoculation. Based on the results from Section 5.2.5, a seven and fourteen day post-inoculation sampling regime of inoculated leaves was adopted for the evaluation. Determination of the virus levels and processing of the ELISA values were carried out as described in Section 5.2.5.

A broad range of resistance levels were exhibited by the transgenic progeny from the different CP+ lines (Figure 5.8). Of the six lines, three, AC 15, AC 19 and AC20, remained highly resistant for the duration of the experiment. The average ELISA values of AC 15, AC 19 and AC20 were 0.01, 0.05 and 0.1, respectively. 80% of the AC 15, 50% of the AC 19 and 60% of the AC20 transgenic CP+ plants contained no detectable levels of virus in their inoculated leaves. Most of the transgenic progeny from line AC7 contained lower levels of virus in their inoculated leaves when compared to the H-IPCV infected CP- plants. The average ELISA values from the first and second replications were 41.9% and 25.9% of the CP- plants by fourteen days post-inoculation, respectively. In line AC8, a similar decrease in virus accumulation was observed in inoculated leaves, with average ELISA values of 34.7% and 83.8% of the inoculated CP- plants for the first and second replications, respectively. Transgenic progeny from line AC 18 appeared highly resistant in the first replication (Figure 5.8 A), with only 10% of the inoculated CP+ plants exhibiting detectable levels of virus. However, in the second replication, 70% of the inoculated CP+ plants contained detectable levels of virus, and exhibited an average ELISA value of 74.1% of the inoculated CP- plants. The data are summarised in Table 5.3.

5.2.7 Summary of the initial analysis of the transgenic N. benthamiana CP+ plants and evaluation for resistance to H-IPCV

The analysis of the twenty independent CP+ lines found ten putative CP+ lines which contained neither the H-IPCV CP nor ntpll genes. It is probable that non- transformed (escapes) shoots were inadvertently regenerated. This can often occur when shoots are taken from old regeneration medium plates (four weeks or more). Breakdown of the antibiotics (kanamycin) in these plates could lead to a reduction in

153

selection stringency, thereby allowing the regeneration of non-transformed shoots. To reduce the number of non-transformed plants recovered, cocultured explants could be transferred to fresh regeneration/selection medium. Another possible explanation could involve transgene instability or unstably expressed transgene loci. Iglesias et al. (1997) demonstrated that the expression of transgene constructs were affected by the chromosomal integration site and flanking plant DNA sequences. Their study showed that the expression of a hygromycin resistance (hpt) gene at two independent transgene loci in tobacco became unstable after several generations of homozygosity. This may explain why the primary CP+ transformants but not the T2 generation of CP+ transformants exhibited kanamycin resistance.

The eight CP+ lines that were found to contain both the H-IPCV CP and ntpll genes exhibited a wide-range of CP expression levels; one line with high CP expression levels, two lines with moderate levels, two lines with low levels and three lines with no detectable levels. The differences in CP expression levels could be due to either position effects (Peach and Velten, 1991) and/or multiple copies of a transgene at a given locus (Linn et al., 1990).

The identification of five CP expressing lines in the T2 generation was inconsistent with earlier observations from the primary transformants where only three lines were shown to exhibit detectable levels of CP. There are several possible explanations to account for this discrepancy. Firstly, if a proportion of the primary transformants were chimeric, negative results could have been obtained from non- transformed or genetically unstable tissues. Secondly, the antibodies used in the Western blot analysis of the primary transformants were from a different batch from those used for T2 generation of plants. If specificity of the two sets of antibodies were significantly distinct, this could account for the different observations. Thirdly, the different results could have been brought about by experimental error e.g. loading unequal amounts of sample, or inefficient transfer of the proteins from the PAGE gel to the nitrocellulose membrane during a Western blot.

Of the six transgenic CP+ lines evaluated, transgenic progeny from line AC 15 were most resistant to H-IPCV infection. Transgenic lines AC 19 and AC20 were also highly resistant to H-IPCV, but significant levels of virus were detected among several of the inoculated CP+ plants from both these lines. Consequently, transgenic progeny from lines AC 19 and AC20 were not considered as resistant as CP+ plants from line AC15.

The transgenic progeny from lines AC7, AC8 and AC 18 were more susceptible to H-IPCV infection than lines AC 15, AC 19 and AC20. However, lines AC7, AC8 and AC 18 exhibited both a delay and a reduction in virus levels in their inoculated leaves at seven and fourteen days post-inoculation when compared to the H-IPCV

154

inoculated CP- plants. The data indicated that the presence of the H-IPCV CP gene in the transgenic N. benthamiana plants did reduce susceptibility to H-IPCV infection. Moreover, in half of the CP+ lines tested, a high degree of resistance against the virus was observed.

To determine whether there was a relationship between transgene copy number and H-IPCV CP gene expression with susceptibility to H-IPCV, the data from Southern, Northern and Western blot analyses of the CP+ lines were compared with results from the IPCV resistance evaluation. There was no correlation between CP copy number and resistance: single and multiple copies of the CP gene were identified in both susceptible and resistant lines. When the six transgenic lines were ranked in order of CP transcript abundance no obvious correlation, positive or negative, could be discerned between transcript level and the degree of resistance. Similarly, CP quantities did not correlate with the levels of resistance observed in the transgenic CP+ lines. The data are presented in Table 5.4.

However, when the CP+ lines were separated into resistant and susceptible lines and then ranked in terms of average ELISA order with their respective transcript and CP levels (Table 5.5), the level of resistance from infection H-IPCV appears to inversely related CP gene expression levels.

5.2.8 Evaluation of transgenic N. benthamiana CP+ plants for resistance to D, H, and L isolates of IPCV

To determine whether the H-IPCV CP could confer resistance against other IPCV isolates, transgenic progeny from line AC20 were challenged with the D and L isolates of IPCV.

For this study, T2 generation, kanamycin-resistant CP+ plants of between 15 to 20 cm in height, were mechanically inoculated with one of three isolates, D, H or L (courtesy of Dr. R. A. Naidu), at a concentration of 50 ng/ml. Duplicate experiments were performed to evaluate each isolate, and each consisted of ten CP+ plants and five CP- plants inoculated with virus inoculum, and five CP+ plants and five CP- plants inoculated with virus free inoculum. As reported in Section 5.2.6, the inoculated leaves of AC20 were highly resistant to H-IPCV multiplication but the spread of the virus through the CP+ plants was not addressed. To investigate the systemic spread of D-IPCV, H-IPCV, and L-IPCV in H-IPCV CP plants, a systemic leaf sample was taken in addition to the inoculated leaf sample from each plant at fourteen days post­inoculation. Virus levels were determined by ELISA. With the availability of known concentrations of purified virus (courtesy of Dr. R. A. Naidu), a calibration curve of virus concentration against ELISA absorbance was established for each isolate (Figure 5.9). This permitted the ELISA results to be converted to virus concentrations (ng/ml).

155

As expected, transgenic progeny from AC20 exhibited a high level of resistance to H-IPCV (Figure 5.10). AC20 was also found to be highly resistant against D-IPCV infection, but not against L-IPCV (Figure 5.10). Of the twenty CP+ plants challenged with H-IPCV, only four inoculated and two systemic leaf sample contained significant levels of virus (>1.0 ng/ml of virus). The average H-IPCV levels in the inoculated and systemic AC20 leaves were 0.55% and 0.14% of the H-IPCV infected CP- plant samples, respectively. A similar level of resistance was observed amongst the D-IPCV infected transgenic plants. However, one inoculated leaf sample did contain virus levels comparable to D-IPCV inoculated CP- plants. D-IPCV levels in the inoculated and systemic leaf samples, excluding the aforementioned susceptible sample, were 0.06% and 0.02% of the D-IPCV infected CP- plant samples, respectively.

Transgenic line AC20 was partially resistant to L-IPCV infection. Most of the CP+ plants exhibited a reduction in virus accumulation in their inoculated leaves with only three samples being completely susceptible to infection. Eighty-five per cent of the systemic leaf samples contained detectable levels of virus. Overall, however, virus multiplication in the systemic samples was considerably lower than that observed in the CP- infected plants. Average levels of L-IPCV in inoculated and systemic leaves were only 23.44% and 4.47% of their infected CP- plant counterparts.

5.2.9 Analysis of the segregating transgenic N. benthamiana CP+ progeny from line AC20

The relationship between transgene copy number and H-IPCV CP expression with resistance to H-IPCV infection has been briefly discussed in Section 5.2.7. But the results used for that initial analysis were derived from pooled transgenic plant material which had not been evaluated for resistance to H-IPCV infection. Therefore the data did not directly represent the situation in individual CP+ plants, although it did provide a general overview of the relationship between averaged H-IPCV CP expression levels from different segregating lines and resistance.

To determine whether resistance to H-IPCV was correlated to transgene copy number and H-IPCV CP expression, Southern, Northern and Western blot analyses were conducted on transgenic progeny from line AC20. Prior to inoculation with H- IPCV, two fully expanded leaves, six to eight leaves away from the apical leaves, were removed from each of the twenty CP+ plants used in Section 5.9. These leaves were analysed after the CP+ plants were evaluated for resistance to H-IPCV. Ten samples were analysed; five resistant plants with no detectable levels of virus in either the inoculated or systemic leaf samples, and five susceptible plants with virus in one or both of the leaf samples. For the Southern, Northern and Western blot analyses, the

156

same H-IPCV CP gene and 18S rDNA gene specific DNA probes and H-IPCV specific antibodies as described in Section 5.2.3, were used to estimate copy number of transgene in the genome, transcript abundance and CP levels.

Southern blot analysis of the genomic DNA isolated from the individual transgenic plants indicated that all ten plants contained multiple copies of the transgene with most plants possessing between three to four copies in heterozygous or homozygous condition (Figure 5.11 A). The genetic constitution of the transgene in each sample was determined by comparing the intensities of bands relative to other bands from the same sample. The signal intensity of a homozygous band should be approximately twice that found in the corresponding heterozygous band. In Figure5.1 IB, a diagrammatic representation of the Southern blot shows the bands more clearly as well as indicating their estimated sizes and putative homozygous states.

On a Northern blot of total RNA extracted from the transgenic CP+ plants, a single transcript of expected size, 1.1 kb, was detected in each sample (Figure 5.12). The abundance of H-IPCV CP transcript was determined using a Phosphorlmager, and the results normalised against the 18S rRNA transcript to correct for differences caused by loading and blotting the RNA. The levels of the H-IPCV CP transcript in each sample are presented in Figure 5.12. The average level of transcript expression was 13.515, and ranged from 4.842 for sample AC20.20 to 45.559 for sample AC20.4.

Soluble protein extracted from the CP+ plants was analysed by Western blotting. As expected the 23 kDa CP was detected in all the samples. CP expression levels were quantified using NIH Image 1.62b7 densitometry software (Figure 5.13). The average level of CP expression for the ten CP+ plants was 69.3 pg/fig.

The inoculated AC20 H-IPCV levels were ranked in order of highest to lowest, with the results of CP transgene copy number, H-IPCV CP and transcript levels shown alongside (Table 5.6). The data was arranged in this manner to determine whether there was a correlation (positive or negative) between H-IPCV resistance and either CP transgene copy number, H-IPCV CP levels or transcript abundance.

There did not appear to be a strict inverse correlation between either CP copy number or CP gene expression and the level of resistance to H-IPCV. However, trends could be detected between the resistant and non-resistant groups of transgenic plants. Average CP copy number in the ten transgenic plants was 6.3. The resistant plants appeared to possess fewer CP copies per plant than the susceptible plants. The average number of CP copies in the resistant plants was 5.0. This was significantly different (P=0.04) from susceptible plants which contained on average 7.6 copies.

The most striking relationship was between resistance levels and CP transcript expression. Four of the five lowest transcript levels, 10.334, 7.439, 5.254 and 4.842

157

belonged to H-IPCV resistant plants, whereas four of the five highest transcript levels came from H-IPCV susceptible CP+ plants. These results suggested that resistance may be inversely correlated to CP transcript abundance (P=0.03). However, no significant relationship was found between CP levels and resistance (P=0.44).

5.3 Discussion5.3.1 Analysis of transgenic N. benthamiana plants containing the H-IPCV CP gene for resistance against H-IPCV

Transgenic plants containing the H-IPCV CP gene sequence could be protected from H-IPCV infection in both inoculated and systemic leaves. Protection was due to the presence of the CP gene, and unlikely to be the result of T-DNA insertional mutagenesis of a host gene essential for H-IPCV replication because the resistance phenotype was found in three independent CP+ lines where the H-IPCV CP genes had inserted into different loci in the plant genome. The level of protection observed in the infected transgenic plants ranged from completely susceptible CP+ plants with virus levels equivalent to H-IPCV infected CP- plants, to resistant CP+ plants which did not contain any detectable virus in either their inoculated or systemic leaves. Most of the plants which exhibited detectable levels of virus did, however, show delayed and reduced virus accumulation in their inoculated leaves compared to H-IPCV inoculated CP- plants. These results were similar to those previously reported for transgenic plants expressing CP genes for A1MV (Loesch-Fries et al., 1987), cucumber mosaic virus (CMV) (Cuozzo et al., 1988), potato virus X (PVX) (Hemenway et al., 1988), TMV (Powell et al., 1987) and tomato mosaic virus (ToMV) (Sanders et al., 1992).

Low levels of virus could be detected in some of the transgenic plants derived from the highly resistant lines. This variable response could be attributed to the method employed to infect the plants. Plants were mechanically inoculated with the same virus inoculum to ensure that each plant received a similar dose of virus. However, this in itself does guarantee that each cell was infected with the same number the virus particles. Hence, it may account for the different levels of virus in the inoculated leaf samples. Another possible explanation is related to the fact that the transgenic progeny were derived from segregating lines. Transgenic progeny from each line would not necessarily possess the same number of transgenes. Segregating progeny may respond differently to infection according to transgene copy number, organisation and expression. Goodwin et al. (1996) generated isogenic transgenic plants containing an untranslatable TEV CP gene in order to reduce transgene copy number and transgene insertion site variation. This approach could also be used to produce isogenic N. benthamiana plants containing the H-IPCV CP gene. Despite this, transgene expression and virus resistance levels may still be variable.

158

5.3.2 Susceptibility of transgenic N. benthamiana plants expressing the H-IPCV CP gene to infection by D-IPCV and L-IPCV

The transgenic plants from line AC20 were also evaluated for resistance from infection by two other isolates of IPCV, D and L. CP+ plants were found to be highly resistant to D-IPCV infection. After inoculation with purified D-IPCV, most of the inoculated and systemic leaf samples contained less than 0.5 ng/ml of virus. The D- IPCV levels were considerably lower than that of infected CP- plants, which frequently had in excess of 860 ng/ml virus in their inoculated and systemic leaves. The degree of resistance against D-IPCV observed in the transgenic plants was comparable to H-IPCV.

Protection against L-IPCV infection was more limited, though levels of virus in the inoculated and systemic leaves were still lower than those of infected CP- plants. This type of response to closely related strains has been reported previously for several viruses including CMV (Namba et al., 1991), TEV (Lindbo and Dougherty, 1992) and TMV (Nejidat andBeachy, 1990). In transgenic tobacco containing the CP of the U1 strain of TMV, resistance to TMV and its close relatives was high, but weaker against more distantly related tobamoviruses (Nejidat and Beachy, 1990). Their study suggested that resistance was correlated with CP amino acid sequence homology i.e. the closer the similarity between the CP of the infecting virus and transgene CP, the greater the level of resistance (Nejidat and Beachy, 1990).

The degree of difference between the three IPCV CP amino acid sequences was relatively small, with the amino acid homology level falling between 60% and 66% (Dr. M.A Mayo, per. comm.). H-IPCV CP has a slightly greater amino acid identity to the D-IPCV CP than the L-IPCV CP (Naidu et al., 1996). This may account for the higher level of protection observed in the transgenic plants against D-IPCV when compared to L-IPCV.

5.3.3 The effect of H-IPCV CP gene copy number, H-IPCV CP levels and transcript abundance on virus resistance

Reduction in H-IPCV accumulation in inoculated leaves of the transgenic progeny from the six independent transgenic lines did not correlate to CP levels. For lines AC8 and AC 20, there was less than 2% difference between their average CP levels, yet most of the transgenic progeny from line AC8 were susceptible to infection by H-IPCV, whereas the majority of AC20 plants remained highly resistant. If high levels of CP were necessary for mediating resistance, then all the low CP expressing lines should be vulnerable to infection by H-IPCV. This was the case for lines AC7 and AC 18 but not for line AC 15. Transgenic progeny from line AC 15 were the most resistant CP+ plants evaluated, and interestingly, exhibited no detectable levels of CP.

159

These observations were confirmed when transgenic progeny from line AC20 were individually analysed for resistance and CP gene expression. Similar results have been reported for potato leafroll virus (PLRV) (Kawchuk et al., 1990) and potato virus Y (PVY) (Lawson et al., 1990). In these two studies, resistance was shown not to be correlated to CP expression. In the case of the transgenic potato PLRV CP+ plants, detectable levels of CP were not required to facilitate high level resistance against PLRV (Kawchuk et al., 1991).

Although the degree of protection against H-IPCV infection appeared to be independent of CP level, and the most resistant transgenic plants exhibited CP expression levels below sensitivity of detection by Western blotting, it did not necessarily indicate redundancy of CP in mediating resistance to the H-IPCV. One approach to determine whether CP was essential for conferring protection would be to prevent translation of the CP transcript. This could be achieved by introducing premature stop codons or mutating the initiator AUG. This type of approach has been used to investigate the role of CP expression in CP-MR. Powell et al. (1990) generated transgenic tobacco plants containing a TMV CP gene lacking an initiation codon. Their study found that the transgenic plants containing the altered gene were completely susceptible to infection by TMV. This result demonstrated that in the case of TMV, the TMV CP and not RNA was necessary for resistance in transgenic tobacco plants (Powell et al., 1990). In contrast, Lindbo and Dougherty (1992) found that transgenic tobacco plants containing an untranslatable form of the TEV CP gene sequence did not develop symptoms when inoculated with TEV. Their study demonstrated that resistance against TEV was mediated by the TEV CP transgene transcript rather than by the TEV CP. This represented the first demonstration of viral CP RNA-mediated protection (Lindbo and Dougherty, 1992).

5.3.4 RNA-mediated resistanceNorthern blot analyses of the transgenic plants containing the H-IPCV CP

gene, and results from the evaluation D-IPCV and L-IPCV infection of transgenic progeny from line AC20, suggested that resistance to H-IPCV infection could indeed be RNA-mediated rather than protein-mediated. As discussed in Sections 5.2.8 and 5.2.10, an inverse correlation between CP-transcript and resistance was observed. These results were similar to those previously reported for PVY (Smith et al., 1994), TEV (Goodwin et al., 1996) and cowpea mosaic virus (CPMV) (Sijen et al., 1996). Several studies of RNA-mediated protection have found that highly resistant plants were often characterised by low transgene mRNA steady state levels relative to their transcription rates.

160

A post-transcriptional RNA degradation mechanism was proposed to account for the discrepancy between the low steady state levels of transgene mRNA and the high transcription rate of the transgene (Goodwin et al., 1996; Prins et al., 1996; Sijen et al., 1996). The RNA degradation mechanism could be activated in response to transgene transcript abundance exceeding the cells tolerated RNA threshold level. The activated degradation mechanism could then function to reduce the level of that particular transcript (Smith et al., 1994; Goodwin et al., 1996). In the case of transgenes containing viral sequences, the mechanism could act against both the transcript mRNA and any other mRNA molecule with high nucleotide sequence homology to the transgene, including the viral RNA from which the transgene was derived. The proposed mechanism would therefore explain why, in many cases, resistance was inversely correlated with low steady state transcript levels, and moreover, account for the highly specific nature of this protection system.

If resistance to H-IPCV was mediated by this proposed RNA degradation mechanism, then results from the Northern blot analyses would have to be interpreted with the proviso that some of the transcripts may have been affected by the resistance mechanism. Presumably transcript levels in the resistant transgenic lines were sufficient to activate the RNA degradation mechanism. Consequently, transcript levels and CP levels in these lines should be lower. However, the levels of transcript and CP from the resistant lines were not consistently low. This suggested that the RNA degradation mechanism may be rate limited.

It would follow that if transcription of the transgene produced levels of transcript in excess of the capacity of the post-transcriptional degradation mechanism, the undegraded transcript would accumulate. The level of accumulated transcript would exist in a dynamic state, influenced not only by the rate of RNA degradation, but also by the rate of transcription (which would act to elevate transcript levels) and by the rate of translation. Assuming the rates of RNA degradation and metabolism were relatively similar among the three resistant lines, the only differences between the lines were H-IPCV CP gene copy number and their positions within the genome. The differences in CP expression levels could be due to either position effects (Peach and Velten, 1991) and/or multiple copies of a transgene at a given locus (Linn et al., 1990; Hobbs et al., 1993).

This may provide a possible explanation for the inverse correlation between resistance and transcript levels observed among the three resistant lines (AC 15, AC 19 and AC20). Line AC 15 yielded the most resistant transgenic progeny, yet exhibited the lowest transcript level of the three resistant lines. This suggested that the post- transcriptional degradation mechanism in line AC 15 still had the capacity to degrade the infecting viral RNA, and thereby prevent further multiplication of the virus.

161

Analysis of line AC20 found that it contained five independent copies of the transgene, and exhibited higher CP transcript levels than line AC 15. However, line AC20 was not as resistant as line AC 15. The multiple transgenes in line AC20 could be responsible for the lower levels of resistance. Expression from the multiple transgenes could raise transcript levels near to or above the limit of the RNA degradation mechanism. Therefore, upon infection, some of viral RNAs may escape degradation. Consequently, this could lead multiplication of the virus and the breakdown of resistance. This rate limited post-transcription degradation mechanism could also account for the inverse correlation between resistance and transcript levels observed in the three susceptible transgenic lines. However, low transgene expression in the susceptible plants could equally be responsible for the poor resistance levels. The transgene transcript levels in those plants, even with the presence of viral CP RNA, may have been insufficient to activate the resistance mechanism.

The analysis of the data from the individual transgenic progeny from line AC20 suggests that transgene copy number may have a strong influence over the activation of the RNA degradation mechanism. Susceptible plants, on average, had high transgene copy numbers and transcript levels. Whereas, highly resistant plants contained fewer copies of the transgene and had lower transcript levels. It would appear that transgene expression levels from the plants possessing fewer copies of the transgene were better at eliciting a RNA degradation mechanism compared to the transgenic plants containing more copies of the transgene. This may indicate that multiple copies of the transgene in the same genome could inadvertently suppress H-IPCV CP gene expression. Similar reports of suppression of transgene expression induced by multiple transgenes have been reported in transgenic tobacco (Hobbs et al., 1993; Meyer and Saedler, 1996).

The reduced resistance levels in the susceptible CP+ plants could, therefore, be due to possible two factors. Firstly, low H-IPCV CP transcript levels. Down regulation of transgene expression may have prevented transcript levels from reaching the activation threshold level of the resistance mechanism. Secondly, multiple transgenes. Expression of the multiple transgenes may have produced H-IPCV CP transcript levels exceeding the capacity of the post transcriptional degradation mechanism. Therefore, any additional RNAs with high sequence homology to the H- IPCV CP gene, such as those from infecting H-IPCV, may elude degradation. In order to establish whether resistance to infection by H-IPCV was the result of post- transcriptional degradation, Northern blot analysis and nuclear run-on studies would need to be conducted on resistant and susceptible transgenic plants to measure steady state transgene transcript levels and transcription rates.

This study has shown that transgenic plants containing the H-IPCV CP gene sequence could be protected from infection H-IPCV and D-IPCV. However, there are

162

still several important questions that need to be addressed. From a genetic and biochemical perspective, the resistance mechanism needs to be studied further to determine whether protection was protein- or RNA-mediated. In order to achieve this, untranslatable H-IPCV CP gene sequences would have to be constructed, and transformed into tobacco plants for evaluation. Analysis of the transgenic plants containing the modified H-IPCV CP gene may provide results to indicate whether resistance was related to CP expression levels. From an agronomic perspective, the H-IPCV gene sequences need to be evaluated in groundnut under field conditions. In field conditions, groundnut roots can be subjected to repeated infections by P. graminis, the fungal vector for IPCV. By exposing the transgenic CP+ plants to these harsher conditions it would demonstrate the true potential of the H-IPCV CP gene sequence for conferring resistance to infection by H-IPCV. Moreover, the stability of the resistance mechanism could be studied under field conditions.

163

Transgenicline

Kanam ycinresistan t

Number of T-DNA loci

H-IPCV CP detected

H-IPCV CP gene present

AC1 no - no noAC2 no - no noAC3 no - no noAC4 no - no noAC5 no - no noAC6 no - no noAC7 yes 1 no yesAC8 yes 2-3 yes yesAC9 no - no no

AC10 yes 2 no yesAC11 no - no noAC12 yes 2 no noAC13 no - no noAC14 yes 1-2 yes yesAC15 yes 1-2 yes yesAC16 no - no noAC17 no - no yesAC18 yes 1 yes yesAC19 yes 1 yes yesAC20 yes 2-3 yes yes

Table 5.1 Characterisation of the putative transgenic N. benthamiana lines. T2 generation transgenic progeny were screened for the expression of both the kanamycin resistance (ntpll) and H-IPCV CP genes, and the presence of H-IPCV CP transgene sequence.

164

Transgenicline

Number of T-DNA loci

H-IPCV copy number

Transcriptexpression

level

Coat protein expression

level (pg/jig)

AC7 1 2 1.766 0 .0

AC8 2-3 4 13.165 50.2AC10 2 2 5.181 21.7AC14 1-2 3 23.550 102.0

AC15 1-2 2 3.878 0 .0

AC18 1 4 4.733 0 .0

AC19 1 1 7.894 13.1AC20 2-3 5 29.480 51.1

Table 5.2 Summary of the data from the analysis of the transgenic CP+ lines. T- DNA loci and H-IPCV CP gene copy numbers were estimated by segregation analysis of the kanamycin resistance phenotype and Southern blotting of genomic DNA isolated from transgenic plants. H-IPCV CP gene expression levels were determined by Northern blot and Western blot assays. H-IPCV CP transcript levels were obtained by dividing the H-IPCV CP transcript value by the respective 18S ribosome transcript value.

165

Transgenicline

Num ber of p lan ts

analysed

AverageELISA

Standarderro r

Number of plants with

ELISA values < 0 .00

AC7 20 0.51a (0.52^, 0 .49c)

0 .12d 0/20

A C 8 20 1.01

(0.43, 1.59)0.18 3/20

AC15 20 0.01

(0 .0 1 , 0 .00)0.002 16/20

AC18 19 0.67 (0.00, 1.41)

0.23 11/19

AC19 18 0.05 (0 .0 1 , 0 .1)

0.02 9/18

AC20 20 0.1

(0.04, 0.02)0.05 12/20

CP- 20 1.57 (1.25, 1.90)

0.17 0/20

Table 5.3 Resistance evaluation of transgenic N. benthamiana CP+ lines to mechanical inoculation with H-IPCV. a Average ELISA value from both replications, b average ELISA value from the first replication and c average ELISA value from the second replication, d Standard error was derived from both replications.

166

ATransgenic line H-IPCV CP gene

copy numberResistant

AC7 2 No

AC8 4 No

AC15 2 Yes

AC18 4 No

AC19 1 Yes

AC20 5 Yes

BTransgenic line Normalised transcript

levelResistant

AC20 29.48 Yes

AC8 13.16 No

AC19 7.89 Yes

AC18 4.73 No

AC15 3.88 Yes

AC7 1.77 No

CTransgenic line CP expression level

(Pg/Pg)

Resistant

AC20 51.1 Yes

AC8 50.2 No

AC19 13.1 Yes

AC7 0.0 No

AC15 0.0 Yes

AC18 0.0 No

Table 5.4 Comparisons between H-IPCV CP gene copy number (A), transcript abundance (B) and CP expression levels (C) with resistance to H-IPCV infection.

167

ATransgenic

lineMean ELISA

valueH-IPCV CP gene copy

number

Transcriptlevel

CP expression

level (pg/pg)

AC15 0.01 2 3.878 0.0AC19 0.05 1 7.894 13.1AC20 0.10 5 29.480 51.1

BTransgenic

lineMean ELISA

valueH-IPCV CP gene copy

number

Transcriptlevel

CP expression

level (pg/pg)

AC7 0.51 2 1.766 0.0AC18 0.67 4 4.733 0.0AC8 1.01 4 13.165 50.2

Table 5.5 Average ELISA values obtained from the evaluation of CP+ lines to infection by H-IPCV were compared against CP copy number, transcript abundance and CP expression levels in the resistant (A) and susceptible (B) lines. Data for the transcript abundance and CP expression levels were obtained from Northern and Western blot assays conducted on pooled samples of ten uninfected CP+ plants from each of the transgenic lines.

168

Transgenicline

Virusconcentration

(ng/ml)

CP copy number

Transcriptlevel

CP expression level (pg/pg)

A C 20.16 63.04 6 12.010 (5)a 47.9 (8)aA C 20.2 18.3 8 8.776 (7) 65.1 (5)A C 20.9 1.94 9 12.963 (3) 84.4 (3)A C 20.4 0.52 9 45.559 (1) 112.5 (2)

A C 20.18 0.26 6 12.407 (4) 44.9 (9)A C 20.6 0.00 7 15.568 (2) 116.9 (1)A C 20.7 0.00 6 10.334 (6) 67.2 (4)

A C 20.8 0.00 3 7.439 (8) 57.5 (6)A C 20.10 0.00 7 5.254 (9) 63.2 (7)A C 20.20 0.00 2 4.842 (10) 34.0 (10)

Table 5.6 Comparison between H-IPCV inoculated AC20 CP+ plant virus levels with their respective H-IPCV CP gene copy number, transcript abundance and CP expression levels. Data for the transcript abundance and CP expression levels were obtained from Northern and Western blot assays conducted on leaf samples removed from each plants prior to inoculation with H-IPCV. The AC20 CP+ plants are ranked in accordance with the amount of H-IPCV detected in their inoculated leaves, highest at the top and lowest at the bottom. The transcript abundance and CP expression levels of each AC20 CP+ plant were also given a rank, 1 to 10 (a), in order of highest to lowest values, respectively.

169

B.X.Sa.P.Sp.H B.Sm.K.SB.S.KI

pPCW356 3.8 Kb

I Digestion with I EcoRI and Xbal

pROKII 11.2 Kb

Digestion with Smal

K.SB.XE.S.K

pROKII 11.2 KbRepair of overhangs

with DNA polymerase (Klenow fragment)

BS.K

Ligation f t

3.K.SH B.S.K RI.B

pPCV3 12.3 Kb

0 H -IPCVCP gene sequence S^CaMV 35S promoter U nos terminator 0Am picillin resistance gene 0§Kanamycin resistance gene (nptll) HT-DNA right and left borders

Figure 5.1 Construction of the plant expression vector containing the H-IPCV CP gene

sequence. Abbreviations: B, BamHI\ H, Hindlll; K, Kpnl; P, Pstl\ RI, EcoRI’, S, SacI’,

Sa, Sail; Sm, Smal\ Sp, Sphl\ X, Xbal.

170

23 kDa protein (H-IPCV CP)

i-4>~££S

v<

N p rrU U U<3 3 *<3

i r i O t ^ o o o N O ^ H f ^ r o T f i ^ s o r - o o a s o ^ ' ^ n n n U U H?1HHHHHHHHriai £> > o u u o u o u o y u o u ^Esi2

1>■Wsa.

0>*-*

2-

Figure 5.2 Analysis of H-IPCV coat protein expression in the twenty independent transgenic CP lines. Total soluble protein was extracted from three week old seedlings, and separated on a 12% SDS-polyacrylamide gel. The H-IPCV CP was detected by Western blot analysis using primary antibodies specific to the H-IPCV CP and alkaline phosphatase (AP) conjugated secondary anti-rabbit antibodies.

557 bp DNA fragment (H-IPCV CP gene)

Figure 5.3 Detection of the H-IPCV CP gene sequence in the putative transgenic CP lines by PCR analysis. Total genomic DNA was extracted from three week old seedlings, and amplified with primers specific to the H-IPCV CP gene sequence. The H-IPCV CP primers generate a PCR amplified fragment of 557 bp in size. The PCR results from thirteen of the twenty independent CP lines are shown in this gel. Lines AC 10 and AC20 contain the correct sized PCR fragment.

A

B

9.85

.417.62

7.537.00

7.026.547.09

5.87 5.786.505.18

4.41 4.40 4.34 4.27 4.344.01

3.894.103.36

3.053.04

CP- AC7 AC8 AC10 AC14 AC15 AC18 AC19 AC20

Figure 5.4 Southern blot analysis of transgenic CP+ plants. DNA was extracted from pooled plant material and hybridised with H-IPCV CP gene specific DNA probes as shown in A. B is a diagrammatic representation of the bands on the Southern blot including the estimated sizes of each band in Kb.

CP- AC7 ACS AC10 AC14 AC15 AC18 AC19 AC200.000 1.766 13.165 5.181 23.550 3.878 4.733 7.894 29.480

Figure 5.5 Northern blot analysis of transgenic CP+ plants. RNA was extracted from pooled plant material and hybridised with H-IPCV CP gene specific DNA probes (A), and then hybridised with the Brassica rapa 18S rRNA gene-specific DNA probes (B). The hybridised transcripts were quantified using a Phosphorlmager, and the H-IPCV CP transcript values normalised against the 18S ribosom e transcript values.

H-IP

CV

CP-10

ng

23 kDa protein (H-IPCV CP)

i 1 JL ^33 jrj E E

Figure 5.6 Western blot analysis of transgenic CP+ plants. Total soluble protein was separated on a 12% SDS-polyacrylamide gel, and the H-IPCV CP was detected by W estern blot analysis using antibodies specific to the H-IPCV CP.

Inoculated leaves Systemic leaves

1 2 3 4 5Days post-inoculation

1 2 3 4 5Days post-inoculation

B Inoculated leaves Systemic leaves

3 6 9 12Days post-inoculation

3 6 9 12Days post-inoculation

Figure 5.7 Evaluation of nontransformed N. benthamiana (CP-) plants to susceptibility to H-IPCV infection. CP- plants were inoculated mechanically with H-IPCV, and the inoculated and systemic leaves were sampled at daily intervals (A) and three day (B) intervals. Virus levels were quantified by ELISA. Each sample is represented by an open circle and the mean ELISA value at each post-inoculation is shown as the column.

176

7 days post-inoculation 14 days post-inoculation

1.5 -

0.5 -

ft ft g 83 S* * y ^ ^

g S3 S3SiS|S|

B

2L5 -

1.5 -

1 -

0.5 -

o

8 °

8 o

o o o

o o -0-1 oo o

LqJLoJLqJ o

g s ss m e

2JS -

15 -

O— -O— —O- —Qg s sSI Si «

0.5 -

Figure 5.8 Evaluation of transgenic CP+ plants for resistance to H-IPCV. T2 generation transgenic progeny from lines AC7, AC8 , AC 15, AC 18, AC 19 and AC20 and non-transformed CP- plants were inoculated mechanically with H-IPCV in two replications, A and B. Inoculated leaves were sampled at 7 and 14 days post inoculation, and virus levels determined by ELISA. Each sample is represented by an open circle, and the mean ELISA values from each line is shown as a column.

177

2.1

2.0-

1.9-

1.8 -

1.7-

1.6

1.5

1.4-

1.3-

1.2-

- ~ A —1. 1-

1.0 -

0.9-

0.8 -

0.7-

0.6 -

0.5-

0.4-

0.3-

0.2-

JD0. 1-

— - g100010 1001.0

D-IPCV

H-IPCV

- - O - L-IPCV

Virus concentration (ng/ml)

Figure 5.9 Calibration curve of virus concentration against absorbance. Known quantities of each isolate were diluted in plants sap then analysed by ELISA, and the aborbance values plotted against virus concentration.

178

Inoculated leaves Systemic leaves10000.000

1 0 0 0 . 0 0 0 -

100.000 -

1 0 . 0 0 0 -

1.000

0 . 1 0 0 -

0.010

B10000.000

1000.000 -

j j * 1 0 0 . 0 0 0 -

g 10.000

1.000 -

0.100 -

0.010

o

o

4-

Figure 5.10 Evaluation of transgenic progeny from line AC20 for resistance to the D, H and L isolates of IPCV. For the investigation, two replications were used, A and B. The inoculated and systemic leaves were sampled at fourteen days post-inoculation.

179

.41 Kb

5.78 Kb

4.34 Kb

oo © ©o\©<N

00

Figure 5.11 Southern blot analysis of DNA extracted from individual transgenic AC20 sibling plants with H-IPCV CP gene specific DNA probes (A). The diagramatic representation of the Southern blot shows the bands more clearly and the possible genetic constitution at each locus; = homozygous, and = = hemizygous (B).

Figure 5.12 Northern blot analysis of transgenic progeny from line AC20. RNA was extracted from leaf material and hybridised with H-IPCV CP gene specific DNA probes(A), and then hybridised with the Brassica rapa 18S rRNA gene-specific DNA probes(B). The hybridised transcripts were quantified using a Phosphorlmager, and the H-IPCV CP transcript values normalised against the 18S rRNA transcript values.

Figure 5.13 Western blot analysis of transgenic progeny from line AC20. Total soluble protein was separated on a 12% SDS-polyacrylamide gel, and the H-IPCV CP was detected by Western blot analysis using antibodies specific to the H-IPCV CP

Chapter 6

Discussion

Groundnut is a major oilseed crop and food legume. Over the last two decades, considerable effort has been invested to improve this crop using conventional breeding programs. Useful traits such as resistance to disease, insects and abiotic stress have been transferred to cultivated varieties from non-cultivated groundnut and wild Arachis species (reviewed in Wynne et al., 1991; Knauft and Wynne, 1995). However, natural barriers to interspecific and intergenic hybridisation limit the use of non-cultivated species. Genetic transformation could provide an alternative tool for the introduction of genetic material into important crop varieties (reviewed in Gasser and Fraley, 1989; Christou, 1995). Used in conjunction with modem plant breeding and hybrid seed production procedures, recombinant DNA techniques could provide a more rapid approach to incorporate desirable traits into economically important groundnut varieties (Brarer al., 1993; Ozias-Akins et al., 1993; McKently et al., 1995). As discussed in Chapter 1, diseases of groundnut reduce crop yield and quality worldwide. Of particular interest is peanut clump disease caused by Indian peanut clump virus (IPCV). IPCV is responsible for serious yield loss in the Andhra Pradesh and the Punjab States of India. Unfortunately, no natural sources of resistance against IPCV have been identified, and despite agricultural practices designed to manage or control the disease, losses are still significant. Thus, genetic engineering methodologies were investigated as one approach for developing IPCV resistant groundnut plants.

The work described in this thesis has focused on the development of a genetic transformation system for four economically important Indian groundnut cultivars, and the evaluation of the coat protein-mediated resistance (CP-MR) strategy, with a view to genetically engineering groundnut plants with resistance to H-IPCV and other closely related viruses. This focused on three distinct areas:

Firstly, the development of a reliable and reproducible plant regeneration system for Indian groundnut cultivars JL24, Plover, Robert-21 and TMV-2.

Secondly, the investigation of A. tumefaciens- and microprojectile bombardment-mediated gene transfer techniques for the genetic transformation of groundnut.

Thirdly, the evaluation of transgenic H-IPCV CP N. benthamiana for resistance to infection by D-IPCV, H-IPCV and L-IPCV.

6.1 Regeneration of groundnut6.1.1 Plant regeneration from Indian groundnut cultivars

Recent advances in tissue culture techniques have resulted in the regeneration of complete plants from a limited number of groundnut cultivars. Plants have been regenerated via shoot and root organogenesis from callus cultures derived from anthers (Mroginski and Fernandez, 1980), immature leaflets (Mroginski et al., 1981; Pittman

184

et al., 1983), de-embryonated cotyledons (Sastri et al., 1982) and mature leaves (Eapen and George, 1993a). Atreya et al. (1984) and Schall and Weissinger (1993) have developed plants directly from cultured intact zygotic embryo axes. Regeneration of groundnut has also been achieved through somatic embryogenesis from cultured immature zygotic embryos (Hazra etal., 1989; Sellars et al., 1990; Ozias-Akins et al., 1992), mature zygotic embryo axes (McKently, 1991), immature leaflets (Baker and Wetzstein, 1992) and immature de-embryonated cotyledons (Ozias-Akins et al., 1992).

In this study, six tissue culture systems were evaluated for plant regeneration from four Indian groundnut cultivars. The objectives were to (i) assess the response of the various explants to the different tissue culture systems, (ii) determine the most appropriate explant and tissue culture conditions for efficient plant regeneration and (iii) based on these observation, to develop a reliable and efficient plant regeneration system for use with either A. tumefaciens- or microprojectile bombardment-mediated transformation.

Tissue culture and regeneration studies described in Chapter 3 demonstrated that groundnut plants could be directly regenerated from cultured half of a zygotic embryo with single cotyledon (HESC) explants. Using this procedure, fertile seed were obtained from three Indian groundnut cultivars; JL24, Plover and TMV-2. There were several advantages to the HESC regeneration system: (i) rapid plant regeneration,(ii) no complicated in vitro culture techniques involved, (iii) plant regeneration achieved on a simple culture medium, (iv) cultivar-independent plant regeneration, (v) the reduced tissue culture period decreased the probability of somaclonal mutations and (vi) the zygotic embryos were susceptible to infection by A. tumefaciens.

Of the other five tissue culture methods evaluated, only two exhibited significant potential for high frequency plant regeneration; somatic embryogenesis from mature zygotic embryo axes, and regeneration of shoot meristems from mature zygotic embryos. Using these two tissue culture methods, it was possible to regenerate somatic embryos and shoots from mature JL24 zygotic embryo explants at a high frequency. However, conversion of the regenerated explants into plantlets was not successful. Several factors which may improve the development of both somatic embryos and shoots into plants have been discussed in detail in Chapter 3. Regeneration by shoot organogenesis from leaf discs, mature de-embryonated cotyledon and mature de-embryonated segment explants was also investigated. The frequency of shoot induction from these explants was low, and the shoots which were obtained from the responsive explants did not develop properly into plants.

The failure to promote plant regeneration from the three Indian cultivars (JL24, Plover and TMV-2) using five tissue culture systems which had been previously shown to effective at promoting high frequency groundnut regeneration (McKently et

185

al., 1990; Atreya et al., 1984; Eapen and George, 1993a; Barwale et al., 1986; Eapen and George, 1993b) may have been due to culture conditions and/or genotypic variation. Tissue culture conditions can be extremely variable between different legume species and between genotypes or cultivars of the same species particularly with regards to the type and concentration of hormone present in the culture medium. However, different genotypes often do not respond identically in tissue culture, and much effort has been devoted to developing standard tissue culture techniques for different genotypes (Seitz et al., 1987; McKently et al., 1990; Sellars et al., 1990; Ozias-Akins et al., 1992). Responses can vary dramatically with respect to: (i) the frequency of organogenesis or somatic embryogenesis, (ii) the development of the regenerated explant and (iii) the frequency of plant regeneration.

6.1.2 Effect of genotype on plant regenerationThe effect of genotype on plant regeneration has been studied in a number of

legume species. Genotypic variation in regenerative capacity has been observed among forage legumes such as alfalfa (Brown and Atanassov, 1985), white clover (Bhojwani et al., 1984) and red clover (Keyes et al., 1980; Oelck and Schieder, 1983), and among seed legumes including groundnut (Sellars et al., 1990; Ozias-Akins et al., 1992; McKently, 1995), pea (Kysely and Jacobsen, 1990; Bencheikh and Gallias, 1996a) and soybean (Parrott et al., 1989).

One of the earliest investigations indicating that genotypic variation may influence plant regeneration in groundnut was reported by Sellars et al. (1990). They compared the response of intact, immature zygotic embryos and cotyledons explants of three genotypes (Comet, McRan and NC-7) cultured on various hormonal treatments. Sellars et al. (1990) found that the interactions of genotype and culture medium on the frequency and number of somatic embryos formed were significantly different. Moreover, Sellars et al. (1990) demonstrated that interactions between genotype and culture medium treatment during somatic embryogenesis had a significant affect on the subsequent development of both shoots and roots from the induced somatic embryos. However, since Sellars et al. (1990) only conducted statistical tests on the combined data from all the genotypes, both within and between culture treatments, the individual effects of genotype and culture medium on somatic embryogenesis could not be evaluated from their study. The absence of the appropriate statistical tests prevented direct comparisons between: (i) the effects of genotype on somatic embryogenesis and regeneration within treatments, and (ii) the effects of various culture treatments on the separate genotypes.

Ozias-Akins et al. (1992) evaluated somatic embryogenesis from immature zygotic embryo and cotyledon explants of seven groundnut genotypes. In contrast to

186

Sellars et al. (1990), Ozias-Akins et al. (1992) used a single culture medium for somatic embryo induction. By doing this, Ozias-Akins et a l (1992) demonstrated that somatic embryo formation and plant regeneration were significantly different among genotypes. In addition, Ozias-Akins et al. (1992) observed a strong correlation between the frequency and number of somatic embryos formed per responding explant in most of the genotypes tested. These observations were confirmed by McKently (1995) from in vitro culture of mature zygotic embryo axes from fourteen genotypes using a single medium treatment. Furthermore, both Ozias-Akins et al. (1992) and McKently (1995) have suggested that genotypes which exhibited a propensity for high frequency of somatic embryogenesis may also display a high capacity for developing somatic embryos. However, genotypes with the highest competence for somatic embryo production do not necessarily give the highest rate of embryo conversion to plants (Sellars et al., 1990; Ozias-Akins et al., 1992). The same type of relationship between frequency and number of somatic embryos formed has also been observed in pea (Ozcan et al., 1993) and soybean cotyledons (Parrott et al., 1989; Tian et al.,1994).

Distinct genotypic variations have been observed among morphogenic responses. Using cotyledon cultures, McKently et al. (1990) tested the regenerative capacity of 14 genotypes, and found significant differences in the frequencies of shoot and root organogenesis. However, McKently et al. (1990) did not determine whether the following were correlated (i) the frequency and number of shoots formed, (ii) the frequency and number of roots formed and (iii) the frequency of shoot and root formation. Examination of their results (McKently et al., 1990) suggests there were no simple patterns of correlation among genotypes. For example, genotypes Chico, 487- B, and 392B-1 exhibited similar shoot organogenesis frequencies (71 to 75%), and similar average number of shoots per responsive explant (6.1 to 6 .6). In contrast, Florunner, which exhibited a lower shooting frequency (44%), produced on average twice the number of shoots per responsive explant (13.1). In another example, genotypes Florigiant, NC-7, 487-B, 392B-1 and Chico all displayed similar shoot organogenesis frequencies (70 to 75%). But when the rooting frequencies were compared, the response level among genotypes Florigiant, NC-7, 487-B and 392B-1 (60 to 69%) were approximately twice as high as that observed in the Chico genotype (25%). These observations have indicated that certain regenerative responses may be correlated amongst some genotypes, but not necessarily in others. The inconsistent nature of the response frequency and subsequent plant regeneration may make it difficult to establish the most appropriate in vitro culture conditions for previously untested genotypes.

187

6.1.3 Genotypic variation among botanical varietiesThe majority of the groundnut genotypes evaluated in the genotypic variation

studies (McKently etal., 1990; Sellars et al., 1990; Ozias-Akins et al., 1992; Baker et al., 1995; McKently, 1995) belong to one of three botanical varieties; hypogaea, vulgaris and fastigata. By grouping the genotypes according to botanical variety, and comparing the genotypic responses within each botanical variety, it may be possible to determine the response of untested genotypes derived from one of botanical varieties. Although there have been a several reports which have included genotypes from all three botanical varieties in their investigations (McKently et al., 1990; Sellars et al., 1990; Ozias-Akins et al., 1992), only a small number studies have conducted direct comparisons among: (i) genotypes within botanical varieties and (ii) genotypes between botanical varieties.

Seitz et al. (1987) evaluated the callus, shoot and root formation potential in immature leaflet cultures from 47 cultivars. The cultivars consisted of 19, 12 and 16 genotypes from the botanical varieties hypogaea, vulgaris and fastigata, respectively. They found significant genotypic differences for callus and root formation but not for shoot development. Seitz et al. (1987) also statistically analysed the genotypes according to botanical variety, and demonstrated that significant differences for root formation existed between genotypes from botanical variety hypogaea and the genotypes of the both vulgaris and fastigata botanical varieties, but not between the genotypes of the vulgaris and fastigata botanical varieties. Seitz etal. (1987) suggested that the variation in root formation between botanical varieties could be correlated to the relationship between the subspecies and botanical varieties. Both vulgaris and fastigata botanical varieties belong to the fastigata subspecies, whereas the botanical variety hypogaea belongs to the hypogaea subspecies. Therefore, the response of among genotypes from vulgaris and fastigata botanical varieties should be more similar than between genotypes of hypogaea botanical variety since the genotypes of vulgaris and fastigata botanical varieties share a greater degree of genetic homogeneity than with the genotypes of hypogaea botanical variety. The statistical analyses of root formation frequencies among genotypes of the three botanical varieties support this hypothesis (Seitz et al., 1987). Further statistical tests showed genotypic variations for callus production and root formation among genotypes within the botanical varieties fastigata and hypogaea, respectively. However, Seitz et al. (1987) did not detect significant differences in shoot organogenesis among genotypes within the hypogaea, vulgaris and fastigata botanical varieties.

These results suggest that the capacity to develop shoots de novo in botanical varieties fastigata and hypogaea was independent of the ability to produce callus and root, respectively. Similar observations were made by McKently et al. (1990) but at

188

the genotypic level. The data presented by Seitz et al. (1987) and McKently et al. (1990) strongly suggested that a genetic component for regenerative capacity exists in groundnut.

Genotypic variation among botanical varieties has been observed in somatic embryogenesis. McKently (1995) studied the effect of genotype on somatic embryogenesis and subsequent plant regeneration from mature zygotic embryo axes and found significant differences among the 14 genotypes evaluated. In addition, when the genotypes were grouped according to botanical variety (hypogaea, vulgaris and fastigata), significant differences among botanical varieties for frequency and number of somatic embryos formed were observed. Genotypes from botanical varieties hypogaea and vulgaris exhibited a higher frequency of somatic embryogenesis and produced more somatic embryos than those from botanical variety fastigata. The potential for somatic embryogenesis was only correlated at the botanical variety level and not at the subspecies level, unlike the situation of root formation described by Seitz etal. (1987).

The studies of genotype variation by Seitz et al. (1987), McKently et al. (1990) and McKently (1995) have shown that the different morphogenic and embryogenic responses can vary dramatically among: (i) genotypes within and between botanical varieties, (ii) between botanical varieties and (iii) subspecies. Their findings have several important implications on the development of tissue culture and plant regeneration methods. Firstly, it can not be assumed that genotypes highly competent for one particular morphogenic response will be competent for a different morphogenic response. Secondly, the frequency of response, be it organogenesis or somatic embryogenesis, does not necessarily correlate with subsequent plant development. Thirdly, the response of different genotypes from the same botanical variety or subspecies can vary significantly even when cultured under identical in vitro conditions.

These variations in regeneration potential among groundnut genotypes make it difficult to determine the most suitable tissue culture conditions for a wide-range of genotypes. An appropriate approach to developing an efficient regeneration system would be culture a variety of groundnut cells, tissues or organs, from different developmental stages, on a wide range of hormone treatments. If the explants were responsive to a particular hormone treatment, this could then be further investigated to determine whether the efficiency of regeneration could be improved by the addition of different hormones and micronutrients, or by changing environmental conditions such as temperature, photoperiod and aeration. Although the use of a sequential tissue culture approach is both complex and labour intensive, it can provide detailed information on the factors required to promote high a frequency of response and plant

189

regeneration. Several reports including those of Seitz et al. (1987), Ozias-Akins et al (1992) and McKently (1995) have suggested that frequency of response and subsequent plant regeneration could be potentially improved by modifications to regeneration medium and tissue culture conditions. However, in some situations it may not be possible to establish in vitro conditions necessary for both high response frequency and efficient plant regeneration. For example, it may be better to select tissue culture conditions which stimulated low frequencies of response and high plant regeneration rates, rather than conditions which only promoted high frequencies of response but low plant regeneration.

6.1.4 Genetic control of plant regenerationStudies among groundnut genotypes and botanical varieties have shown that

variations in plant regeneration can range from no to high response, and that the different tissue culture responses (e.g. callus production, shoot organogenesis, root formation, somatic embryogenesis and somatic embryo conversion) were not necessarily correlated (Seitz et al., 1987; McKently et al., 1990; Sellars et al., 1990; Ozias-Akins et a l, 1992; McKently, 1995). From these observations four principal genetic factors could be considered to influence the efficiency of plant regeneration: (i) the presence of 'regeneration genes', (ii) their strength (iii) possible additive effects and (iv) their inheritibility. This would therefore suggest that groundnut genotypes lacking the appropriate set of regeneration genes may not respond efficiently to tissue culture and prove difficult to regenerate.

Presently, there have been no reports on the study of the genetic control of plant regeneration in groundnut. However, the genetic analysis of plant regeneration has been conducted in other plant species including monocotyledon and legume crop species. For example, in wheat, systematic studies of a number of culturable and recalcitrant cultivars and their reciprocal crosses have found that anther culture responses in the Fi hybrids were intermediate between those of the two parent cultivars (Bullock et al., 1982 cited from Kudirka et al., 1986). Their investigation showed that regenerative potential could be inherited, and that it was controlled by the nuclear genome. Lazar et al. (1984 cited from Kudirka et al., 1986) analysed five spring wheat cultivars and their reciprocal crosses for callus formation, embryoid induction and plant regeneration, and found that the regenerative response could be divided into additive and dominant genetic effects. In rice, anther cultures established from inter-varietal, inter-subspecific and inter-specific hybrids have been shown to exhibit responses ranging between those of the parents, with the female parent having the greater genetic influence than the male (reviewed in Loo and Xu, 1986). These observations were confirmed by Quimio and Zapata (1990). Using diallel analysis,

190

Quimio and Zapata (1990) demonstrated that callus production and plant regeneration from rice anther cultures were affected in reciprocal crosses. In maize, it has been demonstrated that regenerative potential could be increased by crossing high embryogenic capacity lines with recalcitrant lines (Beckert and Qing, 1984; Hodges et a l, 1986).

Among forage legume species, extensive studies have been carried out in alfalfa (Bingham et al., 1975; Brown and Atanassov, 1985; Ray and Bingham, 1989) and Trifolium species (Keyes etal., 1980; Oelck and Schieder, 1983; Bhojwani et aL, 1984). In alfalfa, Bingham et al. (1975) and Ray and Bingham (1989) were able to produce lines with increased embryogenic frequency. This was achieved by selecting the most highly regenerable clones after two stages of recurrent regeneration. The process of recurrent regeneration involves three basic steps which can be performed repeatedly: (i) the induction of plant regeneration from primary explant tissue, (ii) determining which of the primary explant tissue samples were the most responsive and(iii) inducing plant regeneration in explant tissues from the regenerated explants derived from the most responsive primary explant tissue samples. This form of tissue culture selection permits the recovery of clones with distinct phenotypes, and may represent an effective method for identifying clones with high regenerative potential.

In another important forage legume, red clover, Keyes et al. (1980) found that significant variations in callus growth, colony vascularisation, root initiation, chlorophyll production and somatic embryogenesis were attributed to additive genetic effects. The tissue culture responses were also shown to be highly heritable (Keyes et al., 1980). This raises the possibility of selecting and breeding cultivars with strong regenerative traits in order to generate new hybrids or genotypes which could be used in tissue culture studies, and then eventually in plant transformation experiments.

Considerable genotypic variation for regenerative capacity has been observed in seed legumes such as groundnut (Sellars et al., 1990; Ozias-Akins et al., 1992; McKently, 1995), pea (Kysely and Jacobsen, 1990; Bencheikh and Gallias, 1996a) and soybean (Parrott et al., 1989). However, there have been few reports directly addressing the issue of genetic control of plant regeneration from seed legumes. In pea, an extensive investigation into somatic embryogenesis has been conducted on five genotypes of P. sativum and one genotype of P. arvense, the Fi hybrids, F2

generation (self-crosses of Fi) and F3 families (derived from the crosses between two distinct F2 lines; strong and weak embryogenic phenotypes) (Bencheikh and Gallias, 1996b). They found that the six genotypes could be separated into two distinct groups based on their contribution to somatic embryogenic potential. They suggested that the control of somatic embryogenesis in pea is probably determined by two genetic systems, each partially dominant and acting independently. Analysis of genotypes and

191

crosses indicated that most of the recessive genes favourable to embryogenesis were present at one locus, whereas the dominant genes, both favourable and unfavourable, were located at the other locus (Bencheikh and Gallias, 1996b). Although Bencheikh and Gallias (1996b) detected weak interactions between the two separate genetic systems, they concluded that overall the genetic control of somatic embryogenesis in pea was relatively simple.

Bencheikh and Gallias (1996b) observed a strong heritability of genes which controlled somatic embryogenesis, and demonstrated that it was possible to predict the somatic embryogenic potential of hybrids through the analysis of the parental lines. This approach could prove invaluable in the development of new genotypes with high embryogenic capacity or other tissue culture phenotypes. However, Bencheikh and Gallias (1996b) failed to discuss several important factors relating to plant regeneration via somatic embryogenesis including: (i) embryo morphology, (ii) conversion frequency and (iii) subsequent plant development. As previously discussed (see Sections 3.3.6, 6.1.2 and 6.1.3), the ability of explants to respond efficiently to in vitro culture does not necessarily correlate with their capacity for plant maturation. Therefore, to gain a better understanding of plant regeneration and to develop a holistic approach towards tissue culture, the genetic control of explant response and subsequent plant development have to be investigated.

A preliminary step in developing regeneration techniques would be to identify genotypes which are conducive to in vitro manipulation. Analysis of tissue culture response and plant development among genotypes, Fi hybrids and subsequent generations may indicate how plant regeneration is genetically controlled, and perhaps the number genes involved. Unfortunately, this type of study is both labour intensive and time consuming. In addition, this approach may prove impractical, given the difficulty of generating sufficient Fi seed for testing purposes. The use of molecular markers to detect quantitative trait loci (QTLs) could provide a more efficient method for detecting loci involved in plant regeneration. The most reliable method for identifying genotypes with high regenerative capacity would be to directly screen for the genes involved in plant regeneration. However, progress towards identifying genes regulating regeneration have been limited (reviewed in Zimmerman, 1993). These approaches, along with better tissue culture conditions (as discussed in Chapter 3), will significantly improve the development of transgenic plants from groundnut and other economically crop species.

192

6.2 In vitro gene transfer into groundnut6.2.1 Development and evaluation of plant reporter constructs

A. tumefaciens- and microprojectile bombardment-mediated gene transfer techniques were evaluated for the genetic transformation of groundnut. In order to investigate the efficiency of these two in vitro gene transfer systems, a variety of promoter/reporter gene fusion plant expression vectors were constructed and used as indicators of transformation events.

In this study, the sGFP (S65T) gene (Heim and Tsien, 1996), a modified GFP gene with increased expression and improved resistance to photobleaching, was tested in both tobacco and groundnut tissues. Transient expression analysis showed that sGFP was functional in both these plant species.

There are several possible problems associated with the use of GFP. Firstly, overexpression of GFP can be cytotoxic and cause problems in regeneration (reviewed in Cubitt et al., 1995). Moreover, plant regeneration from highly GFP fluorescent Arabidopsis thaliana tissues has proved difficult (Haseloff and Siemering, 1998). Secondly, sensitivity of GFP detection is much lower than enzymatic reporter systems such as (3-glucuronidase or luciferase (reviewed in Rainer, 1998). The brightness of GFP is influenced by factors which do not necessarily affect enzymatic reporter systems such as background fluorescence, photobleaching, post-translational maturation, and quantum yield.

Neither of these problems were apparent in this study. sGFP was stably transformed into N. tabacum. Putatively transformed tobacco callus and shoot primordia exhibited green fluorescence indicative of sGFP activity. The expression of sGFP made it very easy to distinguish between transformed and non-transformed plant cells. In addition, the recovery of high sGFP expression plants from bright callus demonstrated that sGFP had litde or no significant inhibitory effect on plant regeneration in tobacco. In groundnut, co-bombardment of the sGFP and GUS high- level plant expression constructs showed that the detectability of sGFP in groundnut tissues was comparable to that of GUS. This work suggests that sGFP is a useful marker for groundnut transformation, especially for real-time in vivo visualisation of the development of transformed cells and tissues.

6.2.2 An evaluation of A. tumefaciens-mediated in planta transformation of groundnut

Initial studies found that the susceptibility of groundnut to infection by A. tumefaciens was strongly dependent upon the bacterial strain, and tissue- and explant-type (Chapter 4). Similar variations in strain and tissue-type compatibility have been previously reported in groundnut (Lacorte et al., 1991; Mansur et al., 1993;

193

McKently et al., 1995). Of the three explant types evaluated, the mature zygotic embryo axis explants appeared most competent for transformation, and of the fourA. tumefaciens strains tested, EHA105 was the most effective strain for transformation. Based on these preliminary results, a potential method for groundnut transformation was developed which involved A. tumefaciens-mediated in planta transformation of HESC explants (Chapter 3).

HESC explants were wounded and co-cultured with the EHA105 strain harbouring a binary vector that contained a uidA-intron reporter gene. After co­cultivation, the infected explants were allowed to grow to the five quadrifoliate stage before being screened for the presence of GUS-positive sectors. It was envisaged that by deliberately wounding the zygotic embryo axis and exposing this area to infection by A. tumefaciens, some of the germ line or meristematic cells would be transformed and result in transgenic sectors. These sectors would eventually contribute to the germ line of the plant. Consequently, when the plants were allowed to flower, self and set seed, a proportion of the resulting progeny would be transformed. Every cell of these progeny would contain the transgene, unlike their parents which were sectorial chimeras.

There were several advantages to this transformation method: (i) a complex tissue culture and plant regeneration system was not necessary for obtaining viable mature seed, (ii) the recovery of transgenic plants could be achieved rapidly because the infected explants did not have to undergo de novo regeneration and (iii) the likelihood of acquiring somaclonal variations was significantly lower since the route of plant regeneration did not involve tissue culture. This type of in planta transformation strategy has been previously used to generate transgenic groundnut (McKently et al.,1995) and A. thaliana (Feldmann and Marks, 1987; Bechtold et al. 1993).

The screening for GUS-positive leaf tissue failed to identify any transformed sectors. This may have been due to several factors including: (i) the failure to locate transformed GUS-positive tissues, (ii) unstable transformation events, (iii) the failure to transform the appropriate cells or tissues and (iv) inefficient transformation.

To improve the likelihood of locating transformed sectors, sGFP could be used instead of GUS as the transformation marker. The data presented in Chapter 4 suggested that the use of sGFP has two significant advantages over that of GUS. Firstly, no background fluorescence was observed in any of the groundnut tissues tested, nor in any of the A. tumefaciens strains containing the sGFP plant expression vectors. Secondly, since the detection of sGFP is non-destructive, the entire explant/plant can to be analysed for sGFP expression rather than just small tissue samples. This would increase the chances of identifying transformed cells. Moreover,

194

since sGFP can be visualised in vivo it could be used to determine both stability of the transformation events, and to study the fate of transformed cells and tissues.

6.2.3 Cell-fate studies to identify germ line ceilsIn dicotyledonous species, the shoot meristem consists of three cell layers,

designated LI, L2 and L3 (Satina et al., 1940 cited from Huala and Sussex, 1993). Each cell layer gives rise to separate cell lineages; LI forms the epidermis, L2 is the source of the germ line cells and L3 together with L2 contribute to the rest of the vegetative tissues. In the inflorescence meristem, these three cell layers differentiate into specific flower parts; LI forms the epidermis, L2 develops into the sporogenic tissues such as parietal cells, pollens grains and embryo sacs, and L3 with L2 contribute to the ovary wall, placenta and tapetum (Drews and Goldberg, 1989; Goldberg et al., 1993). Therefore, to generate transgenic groundnut plants from the HESC explants using the in planta transformation technique, cells in L2 cell layer of the meristem have to be stably transformed.

One possible approach to determine which cells in the floral meristem have been transformed is to use genetic markers visible in each cell layer. By using visible markers such as the uidA gene (Jefferson et al., 1987) and the genes involved in the anthocyanin pathway including Bperu (Goff et al., 1990) and Cl (Cone et al., 1986), Leduc et al. (1994) and Sautter et al. (1995) were able to detect transient expression of marker genes in individual cells, and to determine their position within the wheat meristems. The use of GFP may prove invaluable for studying cell-fate and lineage since this novel marker can be visualised non-destructively in vivo and in real time.

6.2.4 Microprojectile bombardment-mediated transformationMicroprojectile bombardment has been used to generate a number of

economically important transgenic crops including cereal, legume and woody species (reviewed in Christou, 1995). The advantages of this form of direct DNA transfer technique over A. tumefaciens-mcdiaied transformation have been discussed in Chapter 1. Using the ACCELL® particle bombardment system (an electric-discharge driven device (McCabe and Martinelli, 1993)), Brar et al. (1994) succeeded in recovering transgenic groundnut plants from bombarded shoot meristems of mature zygotic embryo axes.

Advances in microprojectile bombardment technologies and the increasing availibility of the bombardment devices have made the direct gene transfer approach more attractive as a means of generating transgenic groundnut. Bombardment devices such as the DuPont/BioRad PDS1000 helium microprojectile (Russel-Kikkert, 1993) and the ACCELL® electric-discharge particle bombardment systems (McCabe and

195

Martinelli, 1993) cause considerably less damage to the recipient tissue compared to the gunpowder-driven devices because the accelerating forces in the modem devices can be regulated. In addition, the development of focusing devices for the new microprojectile bombardment systems have enabled biolistic particles to be targeted accurately in a given area (Sautter et al., 1991; Torisky et al., 1996).

Sautter et al. (1991) developed a biolistic micro-targeting technique suitable for accurately transferring DNA into target areas as small as 100 fim in diameter. Leduc et al. (1994) and Sautter et al. (1995) demonstrated that this micro-targeting system could be adapted to efficiently deliver marker genes to wheat meristems: vegetative apical shoot meristems of seedlings, shoot meristems of immature pro-embryos and floral meristems, and that the targeted cells survived particle bombardment. Furthermore, Leduc et al. (1994) and Sautter et al. (1995) were able to produce marker gene expressing sectors of varying sizes in all three meristem types, with some containing more than fifty cells (Sautter et al., 1995). These results suggested that besides using this approach for cell-fate studies, it could be used to investigate meristem-specific genes and promoters, and to generate transgenic plants via transformation of germ line cells.

The work of Brar et al. (1994) indicated that the shoot meristems of zygotic embryo axes were competent for genetic transformation. McKently et al. (1995) also used zygotic embryo axes to produce transgenic groundnut plants using A . tumefaciens-mtdiated transformation. Both Brar et al. (1994) and McKently et al.(1995) realised that plant regeneration from either shoot meristems of zygotic embryo axes or directly from zygotic embryo axes, respectively, could be achieved without de novo regeneration by in vitro culture. However, both Brar et al. (1994) and McKently et al. (1995) were unable to determine which cells or tissues in zygotic embryo axes contributed to germ line cells. The use of micro-targeting techniques, such as those described by Leduc et al. (1994) and Sautter et al. (1995) and the availability of GFP could lead to: (i) the rapid identification of germ line transformation events, (ii) non-invasive cell-fate studies, (iii) the improvement of transformation efficiencies and (iv) the recovery of the transgenic groundnut plants.

6.3 Evaluation of the CP-MR strategy for conferring resistance against infection by D-IPCV, H-IPCV and L- IPCV.6.3.1 Evaluation of transgenic N. benthamiana CP lines for resistance to D-IPCV, H-IPCV and L-IPCV

CP-MR studies described in Chapter 5 indicated that transgenic plants containing the H-IPCV CP gene sequence were protected against infection by H-

196

IPCV. Of the six transgenic CP+ lines evaluated, three (AC 15, AC 19 and AC20) were found to be highly resistant to H-IPCV, while the other three lines (AC7, AC8 and AC 18) exhibited only moderate degrees of resistance to infection. The levels of protection ranged from completely susceptible CP+ plants with virus levels equivalent to H-IPCV infected CP- plants, to resistant CP+ plants which did not contain any detectable amounts of virus either in their inoculated or systemic leaves. In addition, transgenic H-IPCV CP+ plants were found to be highly resistant to D-IPCV, but only moderately resistant to L-IPCV.

Initial analysis of the Southern, northern and western blot assays, indicated that resistance to H-EPCV infection in the six transgenic CP+ lines was not correlated to either transgene copy number or to H-IPCV CP gene expression levels. However, when the transgene copy number and H-IPCV CP gene expression data from the six CP+ lines were separated into resistant and susceptible lines, and then analysed, transgene transcript levels appeared to be inversely correlated to resistance levels. Furthermore, analysis with CP+ progeny from line AC20 suggested an inverse correlation between transgene transcript level and resistance. These observations are similar to results previously reported for PVY (Smith et al., 1994), TEV (Goodwin et al., 1996) and CPMV (Sijen et al., 1996). As discussed in Chapter 5, resistance to H- IPCV could be RNA-mediated. To investigate whether H-IPCV resistance was protein- or RNA-mediated, transgenic tobacco plants containing an untranslatable form of the H-IPCV CP gene could be generated and evaluated for resistance to H-IPCV.

6.3.2 Potential mechanisms of RNA-mediated resistanceTransgenic plants expressing untranslatable vims-derived sequences have been

found to be resistant against virus infection and replication (Lindbo et al., 1993; Smith et a l, 1994; Sijen et al., 1996; reviewed in Baulcombe, 1996). Resistant transgenic plants frequently exhibited high nuclear transgene transcription rates but low transgene steady state mRNA levels (Lindbo et al., 1993; Smith et al., 1994; Goodwin et al., 1996). These observations suggested that a post-transcriptional degradation mechanism was responsible for both the decrease in transgene transcript and virus resistance.

This type of resistance in transgenic plants expressing vims-derived sequences has been suggested to be a form of gene silencing, known as post-transcriptional gene silencing (Smith et al., 1994; Mueller et al., 1995; Sijen et al., 1996). The other type of gene silencing is transcriptional silencing. Such gene silencing often occurs when multiple copies of homologous sequence are present in the plant genome, and is characterised as a decrease in the accumulation of specific mRNAs and decreased gene expression (Finnegan and McElroy, 1994; Flavell, 1994; Matzke and Matzke, 1995).

197

Transcriptional silencing is generally associated with DNA methylation within the promoter region, and manifests as a lack of transcriptional activity (Matzke and Matzke, 1995; Park etaL, 1996), whereas post-transcriptional gene silencing occurs in the coding sequence (de Carvalho et al., 1992; Elmayan and Vaucheret, 1996). Silencing can affect homologous sequences in both transgenes and endogenous genes in the plant genome. Recent research has shown that post-transcriptional gene silencing in RNA-mediated plant virus resistance is sequence-specific and dependent upon transgene transcription (Mueller et al., 1995; Goodwin et al., 1996; English et al., 1996; English ef al., 1997).

In a series of elaborate experiments involving modified potato virus X (PVX) derivatives and transgenic plants with gene silencing activity, English et al. (1996) found that the presence of the homologous non-viral sequences in both the PVX derivative and in the post-transcriptionally silenced transgene could inhibit viral RNA accumulation. This form of resistance occurred with three different non-viral sequences: the uidA gene, the tomato polygalacturonase gene and the bacterial neomycin phosphotransferase gene (English et al., 1996). This data suggested that the 3' region of the non-viral sequence may be the target of the gene silencing mechanism since its absence permitted virus RNA accumulation (English et al., 1996). Furthermore, they found that the 3' region of the non-viral sequence was highly methylated (English et al., 1996).

The potential importance of the 3' region of the transgene was confirmed by Sijen et al. (1996) in transgenic plants expressing the CPMV MP gene. Sijen et al. (1996) detected strong DNA methylation in the 3' region of the CPMV MP coding sequence Sijen etal. (1996) also demonstrated that a 60 bp sense fragment situated at the extreme 3' end of the coding sequence was sufficient to induce resistance.

The findings of English et al. (1996) and Sijen et al. (1996) indicate that (i) methylation at 3' region of the transcribed sequence strongly correlates with post- transcriptional silencing and virus resistance, (ii) the complete coding sequence is not required to induce resistance and (iii) the target of the post-transcriptional degradation process may be localised to the 3' region of the coding sequence.

The precise mechanism of post-transcriptional gene silencing-derived resistance to plant viruses is not known. There is an increasing body of evidence to suggest that the resistance mechanism might involve (i) active transcription of the transgene (Smith et al., 1994; Mueller et al., 1995; English et al., 1997), (ii) sequence- specific RNA degradation in the cytoplasm (Smith et al., 1994; Mueller et al., 1995; Goodwin et al., 1996), (iii) degradation of any RNA containing homologous sequences to the silenced transgene (English et al., 1996), (iv) DNA methylation (Smith et al., 1994; English et al., 1996; Sijen et al., 1996) and (v) dosage-dependent

198

activation (Smith et al., 1994; Goodwin et al., 1996). However, there are several important aspects of the resistance mechanism which remain unresolved including (i) the trigger for post-transcriptional gene silencing, (ii) the role of DNA methylation, (iii) the process by which targeted RNA is degraded and (iv) the components involved. At least three models have been proposed to explain the post-transcriptional gene silencing of transgenes and homology-dependent resistance. These models are not necessarily mutually exclusive.

In the antisense RNA model, it has been hypothesised that the production of a transgene-derived antisense RNA fragment might lead to suppression of viral RNA expression by hybridising with viral RNA and blocking translation, thereby affecting RNA stability (Green, 1993). Alternatively, pairing of antisense RNA with viral sequence might make the duplexed RNA molecule a potential target for degradation by a double-strand specific RNase. Lindbo et al. (1993) suggested that the antisense RNA could be produced by an RNA-dependent RNA-polymerase (RdRp). A plant-encoded RdRp has been isolated (Schiebel et al., 1993a, 1993b cited from Baulcombe, 1996), and it is possible that this particular enzyme is using the transgene RNA as template for the synthesis of antisense RNA. Since the replication of the antisense RNA is based upon the transgene sequence, the antisense RNA should only hybridise to the transgene RNA or sequences with high homology to the transgene RNA. This might explain why the post-transcriptional gene silencing-mediated resistance mechanism exhibits such a high degree of sequence specificity (Mueller et al., 1995; English et al.,1996). However, at present no transgene-derived antisense RNA fragments have been detected or identified, and this in part could be due to their size and abundance.

In the threshold level model, the resistance mechanism is triggered by transgene overexpression exceeding a tolerated level, and functions to reduce expression levels by specifically degrading the transgene RNA. There are two resistance phenotypes, 'immune' and 'recovery', associated with the threshold model (Lindbo et al., 1993; Goodwin et al., 1996). Analysis of nuclear transgene transcription rates and transgene transcript levels in transgenic lines exhibiting these phenotypes, indicate that this resistance is likely to be based on post-transcriptional RNA degradation (Smith et al., 1994; Goodwin etal., 1996). This data suggests that transgenic plants with high transgene transcription rates are capable of generating transgene RNA levels that exceed a critical RNA threshold level, which leads to the activation of a cytoplasmic-based sequence-specific RNA degradation mechanism that targets the transgene RNA, thereby resulting in low steady-state levels of the transgene mRNA. Consequently, if the transgene contained virus-specific sequences, the activated resistance system would not only act against the transgene RNA but also against homologous viral RNA sequences (Lindbo et al., 1993; Smith et al., 1994;

199

Goodwin et al., 1996). Transgenic plants exhibiting this phenotype are highly resistant to the infecting virus, and are considered as 'immune'. Where transgenic plants have low transgene transcription rates, the threshold level is not exceeded and the degradation process remains inactive. These plants are susceptible to virus infection. However, Goodwin et al. (1996) observed that some susceptible transgenic lines developed resistance one or more weeks post-inoculation, and this was referred to as the 'recovery' phenotype. They have proposed that the additive level of transgene RNA (where it was sufficiently high) and the viral RNA containing homologous sequences, exceed the threshold level and activate the degradation mechanism, thereby conferring a form of inducible resistance. In addition, transgene-dosage and transgene transcription rates have been implicated in the threshold model. In transgenic plants transformed with the CPMV MP gene (Sijen et al., 1996), PVY CP ORF (Lindbo et al., 1993) or TEV CP ORF ( Goodwin et al., 1996), resistance was correlated with high transcription rates and/or high transgene copy number. Elmayan and Vaucheret (1996) demonstrated that post-transcriptional gene silencing could be activated in haploid and hemizygous plants derived from transgenic plants carrying a single, very highly expressed transgene. Potentially, the use of a single strongly expressed transgene containing viral sequences would make generating threshold-mediated virus resistant transgenic plants much simpler.

In the qualitative model, homology-dependent resistance operates independently of transgene expression. Although there are a number of examples of virus resistance which support the threshold model, there are also examples which are inconsistent with it. According to the threshold model, the resistance mechanism is activated by high transgene transcription rates exceeding a tolerated level. This was contradicted by data from English et al., (1996) and Mueller et al. (1996). In their studies they found significant variations in PVX resistance (susceptible to highly resistant) among transgenic lines which exhibited similarly high transgene transcriptional rates. This result indicated that there is another factor affecting post- transcriptional gene silencing, a qualitative rather than a quantitative one (English et al., 1996; Sijen et al., 1996). The formation of an aberrant RNA (aRNA) has been proposed as a possible activator of post-transcriptional degradation mechanism (English et al., 1996; Sijen et a l, 1996). The origin of aRNA remains unclear. However, since the methylation of transgene coding region has been found to be associated with a number of different virus resistant transgenic plants, this process might be involved in the generation of aRNA (English etal., 1996; Sijen et al., 1996). Methylation of transgene coding region could prevent transcription of full-length transcripts, thereby resulting in the formation of truncated mRNA or aRNA (English et al., 1996; Sijen et al., 1996). Since aRNA, transgene mRNA and viral RNA are

2 0 0

sense-oriented (most plant viruses are composed of positive-sense single-stranded RNA; Matthews, 1991), it is unlikely that they would directly interact to trigger a duplexed RNA degradation mechanism. Instead, it has been envisaged that the aRNA serves as a template for the production of antisense RNA by plant RdRp (English et al., 1996; Sijen et al., 1996). The antisense RNA and/or aRNA could then induce post-transcriptional gene silencing and virus resistance as described previously.

Future work may eventually show that one of these models is responsible for both post-transcriptional gene silencing and resistance. However, it more likely that either a combination of factors from all three models are involved, or that separate models are required to describe each different transgenic plant/virus response.

6.3.3 Alternative approaches for plant virus resistanceThe use of virus derived sequences for generating resistance in transgenic

plants is not without potential risk. For example, transgenic expression of a functional MP can cause problems, including increased susceptibility to virus infection (Ziegler- Graff et al., 1991; Cooper et al., 1995) and abnormal development and morphology of the transgenic plant (Prins et al., 1997). Consequently, dysfunctional virus MPs are used to produce vims resistance since they exhibit little or no deleterious side-effects in transgenic plants (reviewed in Carrington et al., 1996). However, mutations in the dysfunctional vims MP gene could potentially result in the formation native vims MP, and cause problems similar to those described above.

In another example, the small parasitic RNAs, known as satellite RNAs, which are associated with some plant viruses, have been exploited as source of resistance. Satellite RNAs have been used as biochemical agents, or expressed in transgenic plants to reduce disease symptoms and accumulation of the helper vims (Palukaitis and Roossinck, 1996). However, it has been demonstrated that the satellite RNA can rapidly mutate to a pathogenic form which exacerbates disease symptoms (Palukaitis and Roossinck, 1996).

A number of novel non-plant vims based resistance systems have been developed. These include transgenic plants expressing the mammalian 2 ',5 ' oligoadenylate system (Ogawa et al., 1996), the use of antisense technology to induce resistance to a wide variety of plant vimses (Masuta et al., 1995) and the application of analogs of melittin to inhibit vims assembly (Marcos et al., 1995). The development of these approaches may lead to production of transgenic plants resistant to a wide variety of plant vimses.

Alternatively, vims resistant plants could be generated using the plant's own defence-related proteins, such as pathogenesis-related (PR) proteins and the R genes (reviewed in Bowles, 1990; de Wit et al., 1997; Gebhardt, 1997). The advantages of

2 0 1

this approach would be that (i) virus resistance could be induced by simply increasing the expression levels of existing host defence-related genes, (ii) the source of resistance is derived from a plant- and/or host- origin and (iii) increasing the expression of general non-specific defence-related genes could induce resistance to a broad range of plant pathogens.

Another possible plant host-based approach is the generation of disease- resistant mutants. By treating groundnut seeds from the Valencia 1 cultivar with a chemical mutagen, Motagi et al. (1996) were able to recover a large number of foliar disease-resistant mutants. Moreover, three mutants, besides exhibiting foliar disease- resistance, possessed high yield potential, early maturity, desirable pod and kernel features. This mutagenesis approach towards generating somaclonal and gametoclonal variation has been applied to a wide-range of plant species, and has resulted in many new phenotypes including disease resistance, herbicide tolerance and antibiotic resistance (reviewed in Evans et al., 1983; Sharp et al., 1984). Although this method might initially generate mutants with both desirable and undesirable traits, a breeding program using these mutants could eventually lead to the recovery of many genetically stable hybrids with several beneficial traits.

2 0 2

Appendix A

Preparation of general solutions, reagents and culture medium

A l Antibiotics

Antibiotic Solvent Stockconcentration

Storagetemperature

Ampicillin SDW 100 mg/ml -20°CAugmentin SDW 200 mg/ml Prepared freshCarbenicillin SDW 100 mg/ml 0-5°CCefataxime SDW 250 mg/ml -20°CChloramphenicol Ethanol 50 mg/ml 0-5°CGentamycin SDW 10 mg/ml -20°CKanamycin SDW 50 mg/ml -20°CNalidixic acid SDW 100 mg/ml -20°CRifampicin Methanol 50 mg/ml -20°CSpectinomycin SDW 150 mg/ml -20°CStreptomycin SDW 100 mg/ml -20°CTetracycline Ethanol 10 mg/ml -20°C

All antibiotics were filter sterilised before storage or use.

A2 Bacterial growth mediums

LB (Luria-Bertani) medium 1% (w/v) tryptone, 0.5% (w/v) yeast extract and 1%(w/v) NaCl in DW. pH was adjusted to 7.0 with 5 M NaOH, then autoclaved. To prepare solid LB medium, agar was to concentration of 1.5% (w/v)before autoclaving.

Medium A LB medium supplemented with 10 mM MgS04.7H20 and

0.2% w/v) glucose. Filter sterilised.

Storage solution B LB medium supplemented with 36% (w/v) glycerin, 12 mMMgS04.7H20 and 12% (w/v) PEG (MW 7500). Filter sterilised stored at RT.

204

YEB 0.5% (w/v) beef extract, 0.5% (w/v) peptone, 0.5% (w/v) sucrose, 0.1% w/v) yeast extract and 0.05% MgS0 4 .7H2 0 in DW. pH was adjusted 7.0 with 5 M NaOH, then autoclaved.

2YT 1.6% (w/v) tryptone, 1.6% (w/v) yeast extract and 0.5% (w/v) NaCl inDW. pH was adjusted to 7.0 with 5 M NaOH, then autoclaved.

A3 Buffers and reagents

Church wash I 40 mM Na2HP04 (pH 7.2) and 5% (w/v) SDS.

Church wash II 40 mM Na2HPC>4 (pH 7.2) and 1% (w/v) SDS.

Denaturing solution 1.5 M NaCl and 0.5 M NaOH.

Depurinating solution 0.25 M HC1.

Kinase buffer 1 mM ATP, 0.005% (w/v) BSA, 5 mM DTT, 10 mM MgCl2,50 mM Tris-HCl (pH 7.5) and 20 U T4 kinase.

Na2HP04 (pH 7.2) (1 M solution) 268 g/1 of Na2HP04.7H20 dissolved inDW, then 8 ml/1 of 85% H3PO4 was added.

Neutralisation solution 1.5 M NaCl and 0.5 M Tris-HCl (pH 7.0-8.0).

Plant genomic DNA PCR extraction buffer 25 mM EDTA (pH 8.0), 200 mM NaCl,200 mM Tris-HCl (pH 7.5) and 0.5% (w/v) SDS.

Phenol/chloroform/isoamylalcohol Add one volume chloroform/isoamyalcohol(24:1) to an equal volume of TE saturated phenol, mix

and leave to equilibrate until the phases separated. Stored in dark bottles at 4°C.

Prehybridisation/ 0.5 M Na2HP04 (pH 7.2) and 7% (w/v) SDS.hybridisation solution

205

SSC (lOx) 1.5 M NaCl and 150 mM trisodium citrate.

STE buffer 100 mM NaCl, 10 mM Tris and 1 mM EDTA.2H2O. pH adjusted to7.5 with HC1, then autoclaved.

TE 10 mM Tris and 1 mM EDTA (pH 8.0). pH adjusted to the required with HC1, then autoclaved.

A4 Solutions for plasmid preparations

RNase A Dissolve lyophilised RNase A in SDW to a concentration of10 mg/ml. Incubated at 100°C for 5 min, then stored at -20°C.

Solution 1 50 mM Glucose, 10 mM EDTA and 25 mM Tris-HCl (pH 8.0).Autoclved.

Solution 2 0.2 M NaOH and 1% (w/v) SDS.

Solution 3 5 M Potassium acetate and 11.5% (v/v) glacial acetic acid. Autoclaved.

A5 Electrophoresis buffers and reagents

Bromophenol blue loading dye (X10) 0.23% (w/v) bromophenol blue loadingdye and 50% (v/v) glycerol.

DNA and RNA ladders and fragment sizes:

1 kb (bp) 12216, 11198, 10180, 9162, 8144, 7126, 6108, 5090, 4072, 3054,2036, 1636, 1018, 517, 506, 396, 344, 298, 220, 201, 154, 134 and 75.

Lambda/Hindi I I (kb) 23.13, 9.42, 6.56, 4.36, 2.32, 2.03, 0.56 and 0.13

§X114/HinfI (bp) 726, 713, 553, 500, 427, 417, 413, 311, 249, 200, 151, 140,100, 82, 66 , 48, 42, 40 and 24.

RNA ladder (kb) 9.5, 7.5, 4.4, 2.4, 1.4 and 0.24.

206

Ficoll dye EDTA (FDE) 0.1 M EDTA (pH 7.5-8.0), 30% (w/v) ficoll type 400,traces of bromophenol blue and xylene blue.

Formamide sample buffer (FSB) 2.4X MOPS, 22.4% (v/v) formamide and10.7% (v/v) formaldehyde. Stored at -20°C.

MOPS (10X) 10 mM EDTA, 50 mM sodium acetate and 0.2 M MOPS.pH adjusted to 7.0 with 5 M NaOH. Filter sterilised and stored at 4°C.

Orange G loading dye 0.25% (w/v) orange G loading dye and 50% (v/v)glycerol.

TAE (10X) 400 mM Tris, 200 mM sodium acetate and 10 mM EDTA. pH adjustedto .4 with glacial acetic acid.

TBE (5X) 0.5 M Boric acid, 0.5 M Tris and 10 mM EDTA (pH 8.0). Filtered andstored at RT.

Xylene blue loading dye 0.25% (w/v) xylene blue loading dye and 50% (v/v)glycerol.

A6 Sequencing gel mixes

Sequencing gel mix A 23% (w/v) Urea, 5% (v/v) acrylamide/bis-acrylamide(sequencing grade), IX TBE. To polymerise, 3.3 pi of TEMED and 3.3 pi of ammonium persulphate (250 mg/ml) prepared freshly) per ml of gel mix A was added.

Sequencing gel mix B 23% (w/v) Urea, 5% (v/v) acrylamide/bis-acrylamide(sequencing grade), IX TBE. To polymerise, 0.8 pi of TEMED and 0.8 pi of ammonium persulphate (250 mg/ml) (prepared freshly) per ml of gel mix B was added.

207

A7 Virus detection buffers and reagents

AP colour development buffer 0.1 M Tris and 0.5 mM MgCl2- pH adjusted to9.5 with HC1.

BCIP/NBT substrate solution Separately dissolve BCIP and NBT in 70% (v/v)dimethyl formamide (DMF) to a concentration of 50 mg/ml and 30 mg/ml, respectively. Stored at 20°C. 10 il of BCIP and 10 \x\ of NBT were added per ml of AP colour development buffer and used immediately.

Coating buffer 15 mM Na2CC>3 and 35 mM NaHCC>3.

Commassie Brilliant blue R250 Dissolve 100 mg of Commassie Brilliant blueR250 in 50 ml 95% ethanol then add 100 ml of 85% phosphoric acid and make to 1 1 with DW. Filter through Whatman No.l filter paper.

Conjugate buffer Extraction buffer with 0.2% (w/v) ovalbumin

Extraction buffer PBS-Tween with 2% (w/v) PVP

Phosphate buffer saline (PBS) (IX) 136.89 mM NaCl, 1.47 mM KH2P 0 4,8.1 mM Na2HP0 4.12H2 0 and 2.68 mM KC1. pH adjusted to 7.4, then autoclaved.

Protein molecular weight standards (kDa) 200.0 (myosin-H chain),97.4 (phosphorylase b),68.0 (bovine serum albumen),43.0 (ovalbumin),29.0 (carbonic anhydrase),18.4 (P-lactoglobulin),14.3 (lysozyme).

PBS-Marvel (PBS-M) IX PBS and 2% (w/v) Cadburys Marvel low fat milkpowder .

208

PBS-Tween (PBS-T) IX PBS and 0.05% (v/v) Tween-20

Ponceau S red 0.5% (w/v) ponceau S and 1% (v/v) glacial acetic acid.

Resolving gel Gel mix for one pair of Bio-Rad mini Protean II 12% gels. 3.3ml of SDW, 4 ml of acrylamide/bisacrylamide (28:1), 2.5 ml of1.5 M Tris (pH 8 .8), 100 pi of 10% (w/v) SDS, 100 pi of ammonium persulphate (250 mg/ml) (prepared fresh) and 4 piof TEMED.

SDS/electrophoresis running buffer 24.9 mM Tris, 192 mM glycine and0.1% (w/v) SDS.

SDS-reducing buffer 125 mM Tris (pH 8 .8), 10% (v/v) glycerol, 4% (w/v)SDS, 10% (v/v) p-mercaptoethanol and 0.0025% (w/v) bromophenol blue loading dye.

Stacking gel Gel mix for one pair of Bio-Rad mini Protean II 12% gels. 2.7ml of SDW, 0.67 ml of acrylamide/bisacrylamide (28:1), 0.5 ml of 1.5 M Tris (pH 6 .8), 40 pi of 10% (w/v) SDS, 40 pi of ammonium persulphate (250 mg/ml) (prepared fresh) and 4 pi of TEMED.

Substrate buffer 100 ml of diethanolamine and 900 ml SDW. pH adjusted to 9.8with HC1. Substrate, 4-nitrophenyl phosphate, was diluted to working concentration of 0.6 mg/ml with substrate buffer.

Tris buffer saline (TBS) (IX) 20 mM Tris-HCl and 500 mM NaCl. pHadjusted 7.5 with HC1. Autoclaved.

TBS-Marvel (TBS-M) IX TBS and 5% (w/v) Cadburys Marvel low fat milkpowder.

Transfer buffer 25 mM Tris, 150 mM glycine and 10% (v/v) methanol. pHadjusted to 8.3.

209

A8 Plant reporter gene buffers

ATP buffer 10 mM ATP, 50 mM HEPES (pH 7.8) and 20 mM MgCl2.

5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) 1 mM X-Gluc dissolved in DMF.

GUS extraction buffer (GEB) 50 mM sodium phosphate buffer (NaHP0 4 ) (pH 7.0), 10 mM Na2EDTA (pH 8.0), 0.1% (w/v) SDS, 0.1% (v/v) Triton X-100 and p-mercaptoethanol. After addition of p-mercaptoethanol use immediately.

LUC extraction buffer (LEB) 100 mM potassium phosphate buffer (KHPO4) (pH 7.5) and 1 mM dithiothreitol (DTT). After addition of DTT use immediately.

Luciferin 10 mM D-luciferin dissolved in 10 mM KHPO4 (pH 7.5).

4-methyl umbelliferyl glucuronide (MUG) solution 1 mM MUG dissolved in GEB.

Potassium phoshate buffer (100 mM KHPO4, pH 7.5) 16 ml of 0.2 M KH2P04

was mixed with 84 ml of 0.2 M KH2P0 4 to make 100 mM KHPO4, pH 7.5.

Sodium phoshate buffer (0.2 M NaHPC>4, pH 7.0) 9.75 ml of 0.2 MNaH2P0 4 was mixed with 15.25 ml of 0.2 M Na2HP0 4 to make 0.2 M NaHPQ4, pH 7.0.

2 1 0

A9 Plant medium

Plant hormone Solvent Stockconcentration

Storagetemperature

Benzyladenine (BA) 0.1 M KOH 44.38 mM -20°C2,4-dichlorophenoxy acetic acid (2,4-D)

70% ethanol 45.25 mM -20°C

Indoleacetic acid (LAA) 0.1 M KOH 28.54 mM -20°Ca-naphthaleneacetic acid (NAA)

0.1 M KOH 26.85 mM -20°C

All plant hormones were filter sterilised before storage or use.

McKently regeneration medium IX MS basal salts, 110.96 |iM (25 mg/1) BA,(McKently et al., 1990) 2 mg/1 glycine, 0.5 mg/1 nicotinic acid, 0.1 mg/1

pyridoxine HC1, and 3% (w/v) sucrose. pH adjusted to 5.8 with 5 M KOH. 0.8% (w/v) agar added, then autoclaved.

MS30 medium IX MS basal medium and 3% (w/v) sucrose. pH adjusted to5.8 with 5 M KOH. 0.8% (w/v) agar added, then autoclaved.

MS30A As MS30 but 1.0% (w/v) agar was added.

MS30 medium, liquid As MS30 medium but the agar was omitted.

MS medium, liquid As MS30 medium but both the sucrose and agar were omitted.

MS60 medium As MS30 medium but 6% (w/v) sucrose was added.

MS basal medium IX MS basal medium. pH adjusted to 5.8 with 5 M KOH.1.0 % (w/v) agar was added, then autoclaved.

MS basal medium, liquid As MS basal medium but the agar was omitted.

1/2 MS basal medium As MS basal medium but half the MS basal medium wasused.

2 1 1

OR medium

5.8.

IX MS major salts, 4X minor salts, IX B5 vitamins, 0.2 jiM NAA, 5.0 |iM thiamine and 12 mM proline. pH adjusted to 0 .6% (w/v) agar added, then autoclaved.

2 1 2

Appendix B

Construction of plant expression vectors

H.Sp.P.HcXh.RI

SBB.X

P.Sp.H

i

I Digested with UlindlUISnaBI

H.Sp.P.Hc Ll8atl°* Xh.RI

X.B.Sm.K.S.RI

pMKC3.1 4.0 Kb

Digested with NcoIISmal

tH.Sp.P.Hc

Xh.RIN

SB

Ligation

RI.S.K.Sm.B.Hc.P.Sp.H

pRT2 TEV GUS INT pUC195.8 Kb 2.7 Kb

B.XP.Sm.K.S.RI

i j -pMKC3 5.8 Kb

Digested with HindllHHinclI

P.Sm.B.Spe.X.No.SII.S NXh.RI

B.X SB I Hc.P.RI.RV.H.Sa.Xh.KI Hc.P.F

l U —NpMKC26 .1 Kb

*

Digested with NcoIISmal

P.Sm T N I B.X SB

HCaMV 35S promoter with a double enhancer

U TEV 5’ UTR2us-intron reporter gene

BJCaMV 35S terminator 0 Ampicillin resistance gene

Appendix B1 Construction of pMKC3. Abbreviations: B, BamHI; H, HindIII\He, HincII\ K, Kpnl\ N, Ncol\ P, Pstl\ RI, EcoRI\ SB, SnaBI; S, SacI; Sm, Smal\Sp, SphI] X, Xbal\ Xh, Xhol. Construction of pMKC2 are detailed in Appendix B2.

214

H.Sp.P.Hc Xh.RI

SjSB

B.XP.Sp.H

i i -

K.XhSa.H.RV.RI.P.Sm.B.X.No.SII.S

pRT2 TEV GUS INT5.8 Kb

pBSII KS+ 3.0 Kb

Digested with PstI

Digested with PstIXh.RI

B.XSB

Ligation

Ligation

S.SII.No.X.Spe.B.Sm.P.HcXh.RIN B.X

SB P.RI.RV.H.Sa.Xh.K

pMKCl6 .1 Kb

P.Sm.B.Spe.X.No.SII.S

Xh.RIX.B SB He. P. RI. R V. H. Sa. Xh.K

HCaMV 35S promoter with a double enhancer

^ T E V 5'-UTRW^QUs-intron reporter geneHCaMV 35S terminator^Ampicillin resistance gene

pMKC26 .1 Kb

Appendix B2 Construction of pMKCl and pMKC2. Abbreviations: B,BamHl\H, HindIII\ He, Hincll\ K, Kpnl; N, Ncol; P, PstI; RI, EcoRI; SB, SnaBl\ S, Sacl\Sm, Smal\ Sp, Sphl\ X, Xbal\ Xh, XhoL

215

pPCV3 12.3 Kb

K.Xh.Sa.H.RV.RI.P.Sm.B.X.No.SII.S

pBSII KS+ 3.0 Kb

Digested with HindMIEcoRI

B.K.SH B.S.K RI.B

Digested with HindMIEcoRI

Ligation

K.Xh.Hc.Sa.H]

B.S.KB.K.S1 RI.P.Sm.Spe.X.No.SII.S

I \pPCV3/pBS II KS+

5.2 Kb

^ CaMV 35S promoter fflH -IPC V C P gene H CaMV 35S terminator 0Ampicillin resistance gene BKanamycin resistancegene (nptll)

Appendix B3 Construction of pPCV3/pBSII KS+. Abbreviations: B, BamHI;

H, HindiIl\ He, H inclp K, Kpnl\ No, NotI\ P, Pstl\ Pv, Pvul\ RI, EcoRI; RV, EcoRV\

S, Sacl\ SII, Sacll; Sm, Smal\ Sp, Sphl\ Spe, Spel\ X, Xbal\ Xh, XhoI\ LB, left border; RB, right border. Construct pPCV3 was obtained courtsey of Dr. M. Mayo, SCRI.

216

S.SII.No.X.Spe.B.Sm.P.Hc Xh.RIN B.X

rm tSB I P.RI.RV.H.Sa.Xh.Kis A

S.SII.No.X.Spe.B.Sm.P.Hc Xh.RIN B.XI SB P.RI.RV

pMKCl6 .1 Kb

I

Digested with HindllllKpnl. Blunted with Klenow and re-ligated

pMKC1.26 .1 Kb

Digested with NcoUSpel.Blunted with Klenow and re-ligated

iS.SII.N0 .X

3.XSB P.RI.RV.H.Sa.Xh.K

IDigested with Xhol. Blunted with Klenow and re-ligated

IS.SII.No.X.Spe.B.Sm.P.Hc

Pv.RIN B.X

SB I P.RI.RV _

pMKCl.l 5.2 Kb

Digested with Pstl. Blunted with Klenowand re-ligated

S.SII.No.XB.X

SB RI.RV.H.Sa.Xh.K

pMKC1.216 .1 Kb

I1

Digested with SacI/SnaBI

S.SII.No.X.Spe.B.Sm.P.Hc Pv.RI

MSB

pMKC1.125.2 Kb

Digested with SacHSnaBI Ligation

S.SII.No.X.Spe.B.Sm.P.Hc Pv.RIN B.X

Sp.Hc.RI.RV.H.Sa.Xh.K

pMKC96 .1 Kb

HCaMV 35S promoter with a double enhancer

^T E V 5’ UTR W\2us-intron reporter gene HCaMV 35S terminator 0Ampicillin resistance gene

Appendix B4 Construction of pMKC9. Abbreviations: B, BamHI; H, Hindlll; He, Hindi; K, Kpnl\ N, Ncol\ No, Notl\ P, Pstl\ Pv, Pvul\ RI, EcoRI; RV, EcoRV\ Sa, Sail; SB, SnaBI; S, SacI; SII, Sadi; Sm, Smal; Sp, SphI; Spe, Spel; X, Xbal; Xh, Xhol.

217

K.Xh.Sa.Cl.NNo.Bg.Sm.P

RI.P.Sm.B.X.No.SII.S

H.Sp.P.HcXh.RI

3.XSp.P.HSB

blue-sGFP-TY G-nos KS 4.0 Kb pRTL2GUS

5.6 Kb

Digested with NcoIIXbal

K.Xh.Sa.Cl.N I No.Bg.Sm.P

I RI.P.Sm.B.X.No.SII.S Digested with NcoIIXbal

Ligation

H.Sp.P.HcNo.Bg.Sm.P

Xh.RI RI .P.Sm.B .Spe.XIn

X

pMKC18 4.9 Kb

Digested with NotUXbal, then blunted with Klenow and religated

H.Sp.P.Hc Xh.RI

Sp.P.H

pMKC19 4.6 Kb

B|CaMV 35S promoter with a duplicated enhancer

^ T E V 5' UTR W^sus-intron reporter gene [JjJsGFP reporter gene 0C aM V 35S terminator § N o s 3' terminator 0Ampicillin resistance gene

Appendix B5 Construction of pMKC19. Abbreviations: B, BamHl\ Bg, BglII\ Cl, Clal\H, Hindlll; He, Hincll; K, Kpnl\ N, NcoI\ No, NotI\ P, Pstl\ Pv, Pvul\ RI, EcoRJ\SB, SnaBl\ S, SacI;SII, SacII\ Sm, Smal; Sp, Sphl\ Spe, Spel\ X, Xbal; Xh, Xhol.

218

References

Adejare, G.O and Coutts, R .H .A . (1981) Eradication of cassava mosaic virus from Nigerian cassava clones by meristem-tip culture. Plant Cell, Tissue Organ Cult. 1: 25-32.Ahmed, R., Gupta, S.D. and De, D.N . (1996) Somatic embryogenesis and plant-regeneration from leaf derived callus of winged bean (Psophocarpus tetragonolobus (L.) DC). Plant Cell Rep. 15: 531-535.Alexopoulos, C.J., Mims, C.W. and Blackwell, M. (1996) Introductory Mycology. John Wiley & Sons, Inc., New York, USA.Allavena, A. (1984) Beans (Phaseolus). In "Handbook of plant cell culture, Volume 2. Crop species" (eds. Sharp, W.R., Evans, D.A., Ammirato, P.V. and Yamada, Y.), 137-168. Macmillan Publishing Co., A Division of Macmillan, Inc., New York. Ammirato, P.V. (1983) Embryogenesis. In "Handbook of plant cell culture, Volume 1. Techniques for propagation and breeding" (eds. Evans, D.A., Sharp, W.R., Ammirato, P.V. and Yamada, Y.), 82-123. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Anderson, E.J., Stark, D.M., Nelson, R.S., Powell, P.A., Turner, N.E. and Beachy, R .N . (1989) Transgenic plants that express the coat protein genes of tobacco mosaic virus or alfalfa mosaic virus interfere with disease development of some unrelated viruses. Phytopathology 79: 1284-1290.Anderson, W.F., Holbrook, C.C. and Wynne, J.C. (1991) Heritability and early-generation selection for resistance to early and late leafspot in peanut. Crop Sci. 31: 588-593.Atreya, C.D., Rao, J.P. and Subrahmanyam N .C . (1984) In vitro regeneration of peanut (Arachis hypogaea L.) plantlets from embryo axes and cotyledon segments. Plant Sci. Let. 34: 379-383.Bailey, N.T. (1981) Statistical methods in biology, second edition, 27-32. Hodder and Stoughton, London.Bajaj, Y.P.S., Kumar, P., Labana, K.S. and Singh, M.M. (1981) Regeneration of plants from seedling-explants and callus cultures of Arachis hypogaea L. Indian J. Exp. Biol. 19: 1026-1029.Bajaj, Y.P.S. (1984) Peanut. In "Handbook of plant cell culture, Volume 3. Crop species" (eds. Ammirato, P.V., Evans, D.A., Sharp, W.R. and Yamada, Y.), 193- 225. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Baker, C.M. and Wetzstein, H .Y. (1992) Somatic embryogenesis and plant regeneration from leaflets of peanut {Arachis hypogaea L.) Plant Cell Rep. 11: 71-75. Baker, C.M., Durham, R.E., Burus, J.A., Parrott, W.A. and Wetzstein, H.Y. (1995) High frequency somatic embryogenesis in peanut {Arachis hypogaea L.) using mature, dry seed. Plant Cell Rep. 15: 38-42.

2 2 0

Barna, K.S. and Wakhlu, K.S. (1993) Somatic embryogenesis and plant regeneration from callus cultures of chickpea (Cicer arietinum L.). Plant Cell Rep. 12: 521-524.Barton, K.A., Binns, A.N., Matzke, A.J.M. and Chilton, M-D. (1983) Regeneration of intact tobacco plants containing full length copies of genetically engineered T-DNA and transmission of T-DNA to RI progeny. Cell 32: 1033-1043. Barwale, U.B., Kerns, H.R. and Widholm, J.M. (1986) Plant regeneration from callus culture of several soybean genotypes via embryogenesis and organogenesis. Planta 167: 473-481.Bate, N., Spurr, C., Foster, G.D. and Twell, D. (1996) Maturation-specific translational enhancement mediated by the 5'-UTR of a late pollen transcript. Plant J . 10: 613-623.Baulcombe, D.C. (1996) Mechanisms of pathogen-derived resistance to viruses in transgenic plants. Plant Cell 8: 1833-1844.Beach, K.H. and Smith, R.R. (1979) Plant regeneration from callus of red and crimson clover. Plant Sci. Lett. 16: 231-237.Bechtold, N., Ellis, J. and Pelletier, G. (1993) In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. Life sciences. C. R. Acad. Sci. Paris 316: 1194-1199.Bencheikh, M. and Gallais, A. (1996a) Study of the variation in the somatic embryogenesis ability of some pea lines (Pisum sativum L. and Pisum arvense L.) Euphytica 90: 251-256.Bent, A.F., Kunkel, B.N., Dahlbeck, D., Brown, K.L., Schmidt, R ., Giraudat, J., Leung, J. and Staskwicz, B .J. (1994) RPS2 of Arabidopsis thaliana - A leucine-rich repeat class of plant disease resistance genes. Science 265: 1856-1860.Beckert, M. and Qing, C.M. (1990) Results of a diallel trial and a breeding experiment for in vitro aptitude in maize. Theor. Appl. Genet. 68: 247-251.Be van, M. (1984) Agrobacterium vectors for plant transformation. Nucl. Acid Res. 12: 8711-8721.Bhojwani, S.S., Mullins, K. and Cohen, D. (1984) Intra-varietal variation for in vitro plant regeneration in the genus Trifolium. Euphytica 33: 915-921. Bingham, E.T., Hurley, L.V., Kaatz, D.M. and Saunders, J.W . (1975) Breeding alfalfa which regenerates from callus tissue culture. Crop Sci. 15: 719-721. Binns, A.N. (1990) Agrobacterium-mediated gene delivery and the biology of host range limitations. Physiol. Plant. 79: 135-139.Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl. Acids Res. 7: 1513-1523.

2 2 1

Bittner, H., Schenk, G. and Schuster, G. (1987) Chemotherapeutical elimination of potato virus X from potato stem cuttings. J. Phytopathol. 120: 90-92. Borissenko, S., Schuster, G. and Schmygla, W. (1985) Obtaining a high percentage of explants with negative serological reactions against viruses by combining potato meristem culture with anti-phy to viral chemotherapy. Phytopathol. Z. 114: 185-188.Bowles, D.J. (1990) Defense-related proteins in higher plants. Ann. Rev. Biochem. 59: 873-907.Bradford, M. (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilising the principle of protein-dye binding. Anal. Bioch. 72: 248-254.Brar, G.S., Cohen, B.A., Vick, C.L. and Johnson, G.W . (1994) Recovery of transgenic peanut (Arachis hypogaea L.) plants from elite cultivars utilising ACCELL® technology. Plant J. 5 (5): 745-753.Broadbent, L. (1976) Epidemiology and control of tomato mosaic virus. Annu. Rev. Phytopathol. 14: 75-96.Brown, D.C.W. and Atanassov, A. (1985) Role of genetic background in somatic embryogenesis in Medicago. Plant Cell Tiss. Org. Cult. 4: 111-122.Buiel, A.A.M. and Parlevliet, J.E. (1996) Mature plant and tissue resistance in the groundnut-peanut bud necrosis vims system. Euphytica 91: 213-217.Bullock, W.P., Baenziger, P.S., Schaeffer, G.W. and Bottino, P .J . (1982) Anther culture of wheat (Triticum aestivum L.) F i's and their reciprocal crosses. Theor. Appl. Genet. 62: 155-159.Butler, D.R., Wadia, K.D.R. and Jadhav, D.R. (1994) Effects of leaf wetness and temperature on late leaf-spot infection of groundnut. Plant Path. 43: 112- 120.

Byrne, M.C., McDonnel, R.E., Wright, M.S. and Carnes, G.M. (1987) Strain and cultivar specificity in the Agrobacterium-soybem interaction. Plant Cell Tiss. Org. Cult. 8: 3-15.Carr, J.P., Marsh, L.E., Lomonossoff, G.P., Sekiya, M.E. and Zaitlin, M. (1992) Resistance to tobacco mosaic vims induced by the 54-kDa gene sequence requires expression of the 54-kDa protein. Mol. Plant-Microbe Interact. 4: 397-404.Carr, J.P. and Zaitlin, M. (1993) Replicase-mediated resistance. Semin. Virol. 4: 339-347.Carrington, J.C. and Freed, D.D. (1990) Cap-independent enhancement of translation by a plant potyvirus 5' nontranslated region. J. Virol. 64: 1590-1597.

2 2 2

Carrington, J.C., Kasschau, K.D., Mahajan, S.K. and Schaad, M .C.(1996) Cell-to-cell and long-distance transport of viruses in plants. Plant Cell 8: 1669- 1681.Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W. and Prasher, D .C .(1994) Green fluorescent protein as a marker for gene expression. Science 263: 802- 805.Cheng, M., Jarret, R.L., Li, Z., Xing, A. and Demski, J.W . (1996) Production of fertile transgenic peanut (Arachis hypogaea L.) plants using Agrobacterium tumefaciens. Plant Cell Rep. 15: 653-657.Chengalrayan, K., Sathaye, S.S. and Hazra, S. (1994) Somatic embryogenesis from mature embryo derived leaflets of peanut (Arachis hypogaea L.). Plant Cell Rep. 13: 578-581.Chengalrayan, K., Mhaske, R.B. and Hazra, S. (1998) Genotypic control of peanut somatic embryogenesis. Plant Cell Rep. 17: 522-525.Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H. and Sheen, J. (1996) Engineered GFP as a vital reporter in plants. Curr. Biol. 6: 325-330. Christou, P., McCabe, D.E., Martinell, B.J. and Swain, W .F. (1990) Soybean genetic engineering-Commercial production of transgenic plants. Trends Biotech. 8: 145-151.Christou, P., Ford, T. and Kofron, M. (1991) Production of transgenic rice (Oryza sativa L.) plants from agronomically important indica, and japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos. Bio/Technology. 9: 957-962.Christou, P. (1995) Strategies for variety-independent genetic transformation of important cereals, legumes and woody species utilizing particle bombardment. Euphytica 85: 13-27.Clark, M.F. and Adams, A .N . (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Vir. 33: 475-483.Cone, K., Burr, F. and Burr, B. (1986) Molecular analysis of the maize anthocyanin regulatory locus Cl. Proc. Natl. Acad. Sci. USA. 83: 9631-9635. Cooper, B., Lapidot, M., Heick, J.A., Dodds, J.A. and Beachy, R .N .(1995) A defective movement protein of TMV in transgenic plants confers resistance to multiple viruses whereas the functional analogue increases susceptibility. Virology 206: 307-313.Cubitt, A.B., Heims, R., Adams, S.R., Boyd, A.E., Gross, L.A. and Tsien, R.Y. (1995) Understanding, improving and using green fluorescent proteins. Trends Biochem. Sci. 20: 448-455.

223

Cuozzo, M., O’Connell, K.M., Kaniewski, W., Fang, R-X., Chua, N - H. and Turner, N.E. (1988) Viral protection in transgenic tobacco plants expressing the cucumber mosaic virus coat protein or its antisense RNA. Bio/Technology 6: 549-557.Da Rocha, P.S.C.F. and Bertrand, H. (1995) Structure and comparative analysis of the rDNA intergenic spacer of Brassica rapa. Implications for the function and evolution of the Cruciferae spacer. Eur. J. Biochem 229: 550-557.Datla, R.S.S., Bekkaoui, F., Hammerlindl, J.K., Pilate, G., Dunstan, D.I. and Crosby, W.L. (1993) Improved high-level constitutive foreign gene expression in plants using an AMV RNA4 untranslated leader sequence. Plant Sci. 94: 139-149.Davies, D.R., Hamilton, J. and Mullineaux, P. (1993) Transformation of peas. Plant Cell Rep. 12: 180-183.Davis, D.P., Jacobi, J.C. and Backman,' P.A. (1993) 24-hour rainfall, a simple environmental variable for predicting peanut leaf-spot epidemics. Plant Dis. 77: 722-725.de Carvalho, F., Gheysen, G., Kushnir, S., Van Montagu, M., Inze, D. and Castresana, C. (1992) Suppression of p-l,3-glucanase transgene expression in homozygous plants. EMBO J. 11: 2595-2602.De Framond, Barton, K.A. and Chilton, M-D. (1983) Mini-Ti A new vector strategy for plant genetic-engineering. Bio/Technology 1: 262-269.De Loose, M., Danthinine, X., Van Bockstaele, E., Van Montagu, M. and Depicker, A. (1995) Different 5' leader sequences modulate p-glucuronidase accumulation levels in transgenic Nicotiana tabacum plants. Euphytica 85: 209-216.De Wit, P.J.G.M. (1997) Pathogen avirulence and plant resistance: a key role for recognition. Trends Plant Sci. 2: 452-458.Deblaere, R., Bytebier, B., Degreve, H., Deboeck, F., Schell, J. and Van Montagu, M. (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene-transfer to plants. Nucl. Acid Res. 13: 4777-4788. Delfosse, P., Devi, P.S., Reddy, A.S., Risopoulos, J., Doucet, D ., Legreve, A., Maraite, H. and Reddy, D.V.R. (1996) Epidemiology of Indian peanut clump virus (IPCV) transmitted by Polymyxa spp. In "The Third Symposium of the International Working Group on Plant Viruses with Fungal Vectors".Depicker, A., Stacbel, S., Dhaese, P., Zambryski, P. and Goodman, H.M . (1982) Nopaline synthase transcript mapping and DNA sequence. J. Mol. Appl. Gen. 1: 561-568.

224

Dineshkumar, V., Kirti, P.B., Sachan, J.K.S. and Chopra, V.L. (1995) Picloram induced somatic embryogenesis in chickpea (Cicer arietinum L.). Plant Sci. 109: 207-213.Dowson Day, M.J., Ashhurst, J.L., Mathias, S.F., Watts, J .W ., Wilson, T.M.A. and Dixon, R.A. (1993) Plant viral leaders influence expression of a reporter gene in tobacco. Plant Mol. Biol. 23: 97-109.Dos Santos, A.V.P., Outka, D.E., Cocking, E.C. and Davey, M .R. (1980) Organogenesis and somatic embryogenesis in tissues derived from leaf protoplasts and leaf explants of Medicago sativa. Z. Pflanzenphysiol. 99: 261-270. Draper, J., Scott, R., Armitage, P. and Walden, R. (1988) In "Plant genetic transformation and gene expression: A laboratory manual". Blackwell Scientific Publishers, Oxford.Drews, G.N. and Goldberg, R.B. (1989) Genetic control of flower development. Trends Genet. 5: 256-261.Dunbar, K.B. and Pittman, R .N . (1992) Adventitious shoot formation from mature leaf explants of Arachis species. Crop Sci. 32: 1353-1356.Durham, R.E. and Parrott, W.A. (1992) Repetitive somatic embryogenesis from peanut cultures in liquid medium. Plant Cell Rep. 11: 122-125.Eapen, S. and George, L. (1993a) Plant regeneration from leaf discs of peanut and pigeonpea: Influence of benzyladenine, indoleacetic acid and indoleacetic acid- amino acid conjugates. Plant Cell Tiss. Org. Cult. 35: 223-227.Eapen, S. and George, L. (1993b) Somatic embryogenesis in peanut: Influence of growth regulators and sugars. Plant Cell Tiss. Org. Cult. 35: 151-156.Eapen, S. and George, L. (1994) Agrobacterium tumefaciens mediated gene transfer in peanut {Arachis hypogaea L.) Plant Cell Rep. 13: 582-586.Edwards, K., Johnstone, C. and Thompson, C. (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucl. Acid Res. 19: 1349.Ellis, D.D., McCabe, D.E., Mclnnis, S., Ramachandran, R., R ussell,D.R., Wallace, K.M., Martinell, B.J., Roberts, D.R., Raffa, K.F. and McCown, B.H. (1993) Stable transformation of Picea glauca by particle acceleration-A model system for conifer transformation. Bio/Technology 11: 84-89. Elmayan, T. and Vaucheret, H. (1996) Expression of single copies of a strongly expressed 35S transgene can be silenced post-transcriptionally. Plant J. 9: 787-797. English, J.E., Mueller, E. and Baulcombe, D.C. (1996) Suppression of virus accumulation in transgenic plants exhibiting silencing of nuclear genes. Plant Cell 8: 179-188.

225

English, J.E., Davenport, G.F., Elmayan, T., Vaucheret, H. and Baulcombe, D.C. (1997) Requirement of sense transcription for homology- dependent virus resistance and trans-inactivation. Plant J. 12: 597-603.Evans, D.A., Sharp, W.R., Ammirato, P.V. and Yamada, Y. (eds.) (1983) Handbook of Plant Cell Culture. Volume 1. Techniques for Propagation and Breeding. Macmillan Publishing Co., A Division of Macmillan, Inc., New York. Feldmann, K.A. and Marks, M.D. (1987) Agrobacterium-medialed transformation of germinating Arabidopsis thaliana'. A non-tissue culture approach. Mol. Gen. Genet. 208: 1-9.Fernow, K .H . (1967) Tomato as a test plant for detecting mild strains of potato spindle tuber virus. Phytopathology 57: 1347-1352.Finnegan, J. and McElroy, D. (1994) Transgene inactivation: Plants fight back! Bio/Technology 12: 883-888.Flavell, R.B. (1994) Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proc. Natl. Acad. Sci. USA. 91: 3490-3496.Fitchen, J.H. and Beachy, R .N . (1993) Genetically engineered protection against viruses in transgenic plants. Annu. Rev. Microbiol. 47: 739-763.Flick, C.E. (1983) Isolation of mutants in cell culture. In "Handbook of plant cell culture, Volume 1. Techniques for propagation and breeding" (eds. Evans, D.A., Sharp, W.R., Ammirato, P.V. and Yamada, Y.), 393-441. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Flowerdew, B. (1993) Pests and diseases in an organic garden. In "Bob Flowerdew's Organic Garden" (ed. Stace, A.), 43-56. Hamlyn, Reed International Books Ltd., London, U.K.Fourney, R.M., Miyakoshi, J., Day, R.S. and Paterson, M.C. (1988) Northern blotting: efficient RNA staining and transfer. Focus 10: 5-7.Freytag, A.H., Anand, S.C., Rao-Ardelli, A.P. and Owens, L .D .(1988) An improved method for adventitious shoot formation and callus induction in Beta vulgaris L. in vitro. Plant Cell Rep. 7: 30-34.Flick, C.E., Evans, D.A. and Sharp, W .R. (1983) Organogenesis. In "Handbook of plant cell culture, Volume 1. Techniques for Propagation and Breeding" (eds. Evans, D.A., Sharp, W.R., Ammirato, P.V. and Yamada, Y.), 13-81. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Frison, E.A. and Ng, S.Y . (1981) Elimination of sweet potato virus disease agents by meristem tip culture. Trop. Pest Manage. 27: 452-454.Fromm, M.E., Morrish, F., Armstrong, C., Williams, R., Thomas, J. and Klein, T.M. (1990) Inheritance and expression of chimeric genes in the progeny of transgenic maize plants. Bio/Technology 8: 833-844.

226

Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C. and W ilson, T.M.A. (1987) A comparison of eukaryotic viral 5'-leader sequences as enhancers of mRNA expression in vivo. Nucl. Acid. Res. 15: 8693-8711.Gardner, R., Howarth, A., Hahn, P., Brown-Luedi, M., Shepherd, R. and Messing, J. (1981) The complete nucleotide sequence of an infectious clone of Cauliflower mosaic virus by M13mp7 shotgun cloning. Nucl. Acids. Res. 9: 2871 - 2882.Gasser, C.S. and Fraley, R.T. (1989) Genetically engineering plants for crop improvement. Science 244: 1293-1299.Gebhardt, C. (1997) Plant genes for pathogen resistance-variation on a theme. Trends Plant Sci. 2: 243-244.Gharyal, P.K. and Maheshwari, S.C . (1983) Genetic and physiological influences on differentiation in tissue cultures of legumes, Lathyrus sativus. Theor. Appl. Genet. 66: 123-126.Gill, R. and Saxena, P.K. (1992) Direct somatic embryogenesis and regeneration of plants from seedling explants of peanut (Arachis hypogaea): promotive role of thidiazuron. Can. J. Bot. 70:1186-1192.Godoy, R., Smith, O.D., Taber, R.A. and Pettit, R.E. (1985) Anatomical traits associated with pod rot resistance in peanut. Peanut Sci. 12: 77-82.Goff, S.A., Klein, T.M., Roth, B.A., Fromm, M.E., Cone, K .C ., Radicella, J.P. and Chandler, V.L. (1990) Transactivation of anthocyanin biosynthesis genes following transfer of B regulatory genes into maize tissues. EMBO J. 9: 2517-2522.Goldberg, R.B., Beals, T.P. and Sanders, P.M . (1993) Anther development: Basic principles and practical applications. Plant Cell 5: 1217-1229. Golemboski, D.B., Lomonossoff, G.P. and Zaitlin, M. (1990) Plants transformed with a tobacco mosaic virus nonstructural gene sequence are resistant to the virus. Proc. Natl. Acad. Sci. USA. 87: 6311-6315.Gonsalves, D. and Slightom, J.L. (1993) Coat protein-mediated protection: Analysis of transgenic plants for resistance in a variety of crops. Semin. Virol. 4: 397- 405.Goodwin, J., Chapman, K., Swaney, S., Parks, T.D., Wernsman,E.A. and Dougherty, W.G. (1996) Genetic and biochemical dissection of transgenic RNA-mediated virus resistance. Plant Cell 8: 95-105.Gordon-Kamm, W.J., Spencer, T.M., Mangano, M.L., Adams, T .R ., Daines, R.J., Start, W.G., O'Brian, J.V., Chambers, S.A., Adams, W.R., Willets, N.G., Rice, T.B., Mackey, C.J., Krueger, R .W .,

227

Kausch, A.P. and Lemaux, P.G . (1990) Transformation of maize cells and regeneration of fertile transgenic plants. Plant Cell 2: 603-618.Gould, J.H. and Smith, R.H. (1989) A non-destructive assay for GUS in the media of plant tissue cultures. Plant Mol. Biol. Rep. 7: 209-216.Green, P.J. (1993) Control of mRNA stability in higher plants. Plant Physio. 102: 1065-1070.Gregory, W.C., Gregory, M.P., Krapovickas, A., Smith, B.W. and Yarbrough, J.A. (1974) Structure and genetic resources of peanuts. In "Peanuts- culture and uses". Stillwater, OK: Am. Peanut Res. Educ. Assoc. Inc.Gupta, S.D., Ahmed, R. and De, D.N. (1997) Direct somatic embryogenesis and plantlet regeneration from seedling leaves of winged bean, Psophocarpus tetragonolobus (L.) DC. Plant Cell Rep. 16: 628-631.Hansen, G., Das, A. and Chilton, M-D. (1994) Constitutive expression of the virulence genes improves the efficiency of plant transformation by Agrobacterium. 91: 7603-7607.Haseloff, J., (1997) Removal of a cryptic intron and subcellular localization ofgreen fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA. 94: 2122-2127.Haseloff, J. and Siemering, K.R. (1998) The uses of GFP in plants. In "Green fluorescent protein: Strategies, applications and protocols" (eds. Chalfie, M. and Kain, S.) 191-220. John Wiley & Sons, Inc., New York, USA.Hazra, S., Sathaye, S. and Mascarenhas, A .F. (1989) Direct somatic embryogenesis in peanut (Arachis hypogaea L.). Bio/Technology 7: 949-951.Heim, R. and Tsien, R.Y. (1996) Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr. Biol. 6: 178-182.Hemenway, C., Fang, R-X., Kaniewski, W., Chua, N-H., and Turner, N.E. (1988) Analysis of the mechanism of protection in transgenic plants expressing the potato virus X coat protein or its antisense RNA. EMBO J. 7: 1273-1280.Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6: 271-282.Hinchee, M.A.W., Connor-Ward, D.V., Newell, C.A., McDonnel, R.E., Sato, J., Gasser, C.S., Fischhoff, D.A., Re, D.B., Fraley, R .T. and Horsch, R.B. (1988) Production of transgenic soybean plants using Agrobacterium-mediated DNA transfer. Bio/Technology 6: 915-921.

228

Hobbs, S.L.A., Jackson, J.A. and Mahon, J.D . (1989) Specificity of strain and genotype in susceptibility of pea to Agrobacterium tumefaciens. Plant Cell Rep. 8: 274-277.Hobbs, S.L.A., Warkentin, T.D. and Delong, C.M .O. (1993) Transgene copy number can be positively or negatively associated with transgene expression. Plant Mol. Biol. 21: 17-26.Hodges, T.K., Kamo, K.K., Imbrie, C.W. and Becwar, M.R. (1986) Genotype specificity of somatic embryogenesis and regeneration in maize. Bio/Technology 4: 219-223.Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J. and Schilperoort, R .A .(1983) A binary plant vector strategy based on separation of the vir and T-DNA regions of the Agrobacterium tumefaciens Ti plasmid. Nature 303: 179-180.Hofgen, R. and Willmitzer, L. (1988) Storage of competent cells for Agrobacterium transformation. Nucl. Acid Res. 16 (20): 9877.Hohn, B., a-Nicola, Z.K., Bakkeren, G. and Grimsley, N. (1989) Agrobacterium-mediated gene transfer to monocots and dicots. Genome 31: 987-993. Hood, E.E., Jen, G., Kayes, L., Kramer, J., Fraley, R.T. and Chiltern, M-D. (1984) Restriction endonuclease map of pTiBo542, a potential Ti plasmid vector for genetic engineering of plants. Bio/Technology 2: 702-708.Hood, E.E., Helmer, G.L., Fraley, R.T. and Chiltern, M-D. (1987) The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J. Bact. 168: 1291-1301.Hooykaas, P.J.J. and Schilperoort, R.A. (1992) Agrobacterium and plant genetic engineering. Plant Mol. Biol. 19: 15-38.Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers, S.G. and Fraley, R.T. (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231.Hu, W. and Cheng, C.L. (1995) Expression of Aequorea green fluorescent protein in plant-cells. FEBS letters 369 (2-3): 331-334.Huala, E. and Sussex, I.M . (1993) Determination and cell interactions in reproductive meristems. Plant Cell 5: 1157-1165.Iglesias, V.A., Moscone, E.A., Papp, I., Neuhuber, F., M ichalowski, S., Phelan, T., Spiker, S., Matzke, M. and Matzke, A.J.M. (1997) Molecular and cytogenetic analyses of stably and unstably expressed transgene loci in tobacco. Plant Cell 9: 1251-1264.Illingworth, J.E. (1968) Peanut plants from single deembryonated cotyledons. HortScience 3: 238.

229

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) (1984) Annual report 1983. Patancheru, India: ICRISAT: 186. International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) (1986) Annual report 1985. Patancheru, India: ICRISAT: 250.Isleib, T.G., Wynne, J.C. and Nigam, S .N . (1994) Groundnut breeding. In "The groundnut crop; A scientific basis for improvement" (eds. Smartt, J.): 552-563. Chapman Hall, London.Jacobsen, H-J. and Kysely, W. (1984) Induction of somatic embryogenesis in pea, Pisum sativum L. Plant Cell Tiss. Org. Cult. 3: 319-324.Jaiwal, P.K. and Gulati, A. (1991) In vitro high-frequency plant regeneration of a tree legume Tamarindus indica (L.). Plant Cell Rep. 10: 569-573.Jefferson, J.G., Kavanagh, K.Y. and Bevan, M.W. (1987) GUS fusions: (3-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901-3907.Jobling, S.A. and Gerkhe, L. (1987) Enhanced translation of chimeric messenger RNAs containing a plant viral untranslated leader sequence. Nature 325: 622-625.Johnston, S.A., den Nijs, T.P.M., Peloquin, S.J. and Hanneman Jr., R .E . (1980) The significance of genic balance to endosperm development in interspecific crosses. Theoret. Appl. Genet. 57: 5-9.Jorgensen, R.A. (1995) Cosuppression, flower color patterns, and metastable gene expression states. Science 268: 686-691.Kanyard, M, Dessai, A.P. and Prakesh, C .S. (1994) Thidiazuron promotes high frequency regeneration of peanut (Arachis hypogaea) plants in vitro. Plant Cell Rep. 14: 1-5.Kartha, K .K. (1986) Production and indexing of disease-free plants. In "Plant tissue culture and its agricultural application" (eds. Withers, L.A. and Alderson, P.G.), Butterworth Press, London.Kawchuk, L.M., Martin, R.R. and McPherson, J. (1990) Resistance in transgenic plants expressing the potato leafroll virus coat protein gene. Mol. Plant- Microbe Interact. 3: 301-307.Kawchuk, L.M., Martin, R.R. and McPherson, J. (1991) Sense and antisense RNA-mediated resistance to potato leafroll in Russet Burbank potato plants. Mol. Plant-Microbe Interact. 4: 247-253.Kay, R., Chan, A., Daly, M. and McPhearson, J. (1987) Duplication of the CaMV 35S promoter sequences create a strong enhancer for plant genes. Science 236: 1299-1302.

230

Kerns, H.R., Barwale, U.B., Meyer, M.M. Jr. and Wildholm, J.M .(1986) Correlation of cotyledonary node shoot proliferation and somatic embryoid development in suspension cultures of soybean (Glycine max (L) Merr.). Plant Cell Rep. 5: 140-143.Kerstetter, R.A. and Hake, S. (1997) Shoot meristem formation in vegetative development. Plant Cell 9: 1001-1010.Keyes, G.J., Collins, G.B. and Taylor, N.L. (1980) Genetic variation in tissue cultures of red clover. Theor. Appl. Genet. 58: 265-271.Kimble, K.A., Grogan, R.G., Greathead, A.S., Paulus, A.O. and House, J.K. (1975) Development, application, and comparison of methods for indexing lettuce seed for mosaic virus in California. Plant Dis. Rep. 59: 461-464. Klein, T.M., Wolf, E.D., Wu, R. and Sanford, J.C. (1987) High-velocity microprojectiles for delivering nucleic acids into living cells. Nature 327: 70-73. Knauft, D.A., Gorbet, D.W. and Norden, A.J. (1988) Yield and market quality of seven peanut genotypes grown without leafspot control. Peanut Sci. 15: 9- 13.Knauft, D.A. and Wynne, J.C. (1995) Peanut breeding and genetics. Adv. Agronomy 55: 393-445.Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44: 283-292.Kozak, M. (1991) Structural features in eukaryotic mRNAs that moderate the initiation of translation. J. Biol. Chem. 266: 19867-19870.Koziel., M.G., Beland., G.L., Bowman, C., Carozzi, N .B ., Crenshaw, R., Crossland, L., Dawson, J., Desai, N., Hill, M ., Kadwell, S., Launis, K., Lewis, K., Maddox, D., McPherson, K ., Meghji, M.R., Merlin, E., Rhodes, R., Warren, G.W., Wright, M. and Evola, S.V. (1993) Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Bio/Technology 11: 194-200. Kudirka, D.T., Schaeffer, G.W. and Baenziger, P .S . (1986) Wheat: Genetic variability through anther culture. In "Biotechnology in agriculture and forestry, Vol. 2, Crops 1" (ed. Bajaj, Y.P.S.), 39-54. Springer-Verlag, Berlin, Germany.Kulothungan, S., Ganapathi, A., Shajahan, A. and Kathiravan, K .(1995) Somatic embryogenesis in cell-suspension culture of cowpea (Vigna unguiculata (L.) Walp). Israel J. Plant Sci. 43: 385-390.Kumar, V. and Davey, M.R. (1991) Genetic improvement of legumes using somatic cell and molecular techniques. Euphytica 55: 157-169.

231

Kumar, V.D., Kirti, P.B., Sachan, J.K.S. and Chopra, V.L. (1994) Plant regeneration via somatic embryogenesis in chickpea (Cicer arietinum L.). Plant Cell Rep. 13: 468-472.Kyhse-Anderson, J.E. (1984) Electroblotting of multiple gels: A simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J. Biochem. Biophys. Methods 10: 203-209.Kysely, W. and Jacobsen, H.J. (1990) Somatic embryogenesis from pea embryos and shoot apices. Plant Cell Tiss. Org. Cult. 20: 7-14.Lacorte, C., Mansur, E.A., Timmerman, B. and Cordeiro, A.R. (1991) Gene transfer into peanut (Arachis hypogaea L.) by Agrobacterium tumefaciens. Plant Cell Rep. 10: 354-357.Lansden, J.A. (1982) Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Sci. 9: 17-20.Lapidot, M., Gafny, R., Ding, B., Wolf, S., Lucas, W.J. and Beachy,R.N. (1993) A dysfunctional movement protein of tobacco mosaic virus that partially modifies the plasmodesmata and limits virus spread in transgenic plants. Plant J. 4: 959-970.Larkin, P.J. and Scowcroft, W.R. (1981) Somaclonal variation-A novel source of variability from cell cultures for plant improvement. Theor. Appl. Genet. 60: 197- 214.Lawson, C., Kaniewski, W., Haley, L., Rozman, R., Newell, C ., Sanders, P. and Turner, N.E. (1990). Engineering resistance to mixed virus infection in a commercial potato cultivar resistance to potato virus X and potato virus Y in transgenic russet burbank. Bio/Technology 8: 127- 134.Lazar, M.D., Baenziger, P.S. and Schaeffer, G.W . (1984) Combining abilities and heretibility of callus formation and plantlet regeneration in wheat (Triticum aestivum L.) anther cultures. Theor. Appl. Genet. 68: 131-134.Lazerri, P.A., Hildebrand, D.F. and Collins, G.B. (1987) Soybean somatic embryogenesis: Effects of hormones and culture manipulations. Plant Cell Tiss. Org. Cult. 10: 197-208.Leduc, N., Iglesias, V.A., Bilang, R., Gisel, A., Potrykus, I. and Sautter, C. (1994) Gene transfer to inflorescence and flower meristems using micro­targeting. Sex. Plant Reprod. 7: 135-143.Lindbo, J.A., and Dougherty, W.G. (1992) Untranslatable transcripts of the tobacco etch virus coat protein gene sequence can interfere with tobacco etch virus replication in transgenic plants and protoplasts. Virology 189: 725-733.Lindbo, J.A., Silva-Rosales, L., Proebsting, W.M. and Dougherty, W .G. (1993) Induction of a highly specific antiviral state in transgenic plants:

232

Implications for regulation of gene expression and virus resistance. Plant Cell 5: 1749- 1759.Linn, F., Heidmann, I., Saedler, H. and Meyer, P. (1990) Epigenetic changes in the expression of the maize A1 gene in Petunia hybrida: Role of numbers of integrated gene copies and state of methylation. Mol. Gen. Genet. 222: 329-336.Litz, R.E. and Conover, R.A. (1980) Somatic embryogenesis in cell cultures of Carica stipulata (Report). Hortic. Sci. 15: 733-734.Loesch-Fries, L.S., Merlo, D., Zinnen, T., Burhop, L., Hill, K ., Krahn, K., Jarvis, N., Nelson, S. and Halk, E. (1987) Expression of alfalfa mosaic virus RNA4 in transgenic plants confers virus resistance. EMBO J. 6: 1845- 1851.Lomonossoff, G .P. (1995) Pathogen-derived resistance to plant viruses. Annu. Rev. Phytopathol. 33: 323-343.Long, R.D. and Cassells, A.C. (1986) Elimination of viruses from tissue culture in the presence of antiviral chemicals. In "Plant tissue culture and its agricultural application" (eds. Withers, L.A. and Alderson, P.G.), Butterworth Press, London.Loo, S-W. and Xu, Z-H. (1986) Rice: Anther culture for rice improvement in China. In "Biotechnology in agriculture and forestry, Vol. 2, Crops 1" (ed. Bajaj, Y.P.S.), 139-156. Springer-Verlag, Berlin, Germany.Lu, D.Y., Ma, X.Y., Wang, C. and Chen, Y. (1991) Plant-regeneration from seedling protoplasts and explants of Lotus comiculatus (forage legume). Tropical Agriculture. 68: 344-348.Liihrs, R. and Lorz, H. (1988) Initiation of morphogenic cell-suspension and protoplast cultures of barley. Planta 175: 71-81.Lui, C-N., Li, X-Q. and Gelvin, S.B. (1992) Multiple copies of virG enhance the transient transformation of celery, carrot and rise tissues by Agrobacterium tumefaciens. Plant Mol. Biol. 20: 1071-1087.McCabe, D.E. and Christou, P. (1993) Direct DNA transfer using electric discharge particle acceleration (ACCELL™ technology). Plant Cell Tiss. Org. Cult. 33: 227-236.McCabe, D.E. and Martinell, B .J. (1993) Transformation of elite cotton cultivars via particle bombardment of meristems. Bio/Technology 11: 596-598. McCormick, S., Neidermeyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986) Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens. Plant Cell Rep. 5: 81-84.McKently, A.H., Moore, G.A. and Gardner, F .P . (1990) In vitro plant regeneration of peanut from seed explants. Crop Sci. 30: 192-196.

233

McKently, A.H., Moore, G.A. and Gardner, F .P . (1991a) Regeneration of peanut and perennial peanut from cultured leaf tissue. Crop Sci. 31: 833-837. McKently, A.H. (1991b) Direct somatic embryogenesis from axes of mature peanut embryos. In vitro Cell. Dev. Biol. 27P: 197-200.McKently, A.H. (1995) Effect of genotype on somatic embryogenesis from axes of mature peanut embryos. Plant Cell Tiss. Org. Cult. 42: 251-254.McKently, A.H., Moore, G.A., Doostdar, H. and Neidz, R .P. (1995) Agrobacterium-mediated transformation of peanut (Arachis hypogaea L.) embryo axes and the development of transgenic plants. Plant Cell Rep. 14: 699-703.McLean, M. (1994) The phytotoxic effects of aflatoxin B-l - A review (1984-1994). S. Afr. J. Sci. 90: 385-390.Maheswaran, G. and Williams, E.G. (1984) Direct somatic embryoid formation on immature embryos of Trifolium repens, T. pratense and Medicago sativa and rapid clonal propagation of T. repens. Ann. Bot. 54: 201-211.Mansur, E.A., Lacorte, C., de Freitas, V.G., de Oliveira, D .E ., Timmerman, B. and Cordeiro, A.R. (1993) Regulation of transformation efficiency of peanut (Arachis hypogaea L.) explants by Agrobacterium tumefaciens. Plant Sci. 89:93-99.Mante, S., Scorza, R. and Cordts, J. (1989) A simple, rapid protocol for adventitious shoot development from mature cotyledons of Glycine max cv. Bragg. In vitro. Cell. Dev. Biol. 25: 385-388.Maraite, H. (1991) Transmission of viruses by soil fungi. In "Biotic interactions and soil-borne diseases: proceedings of the First Conference of the European Foundation for Plant Pathology" (eds. Beemster, A.B.R., Bollen, G.J., Gerlach, M., Ruissen, M.A., Schippers, B. and Tempel, A.), 67-82. Elsevier, Amsterdam, Netherlands.Maraite, H., Legreve, A. and Delfosse, P. (1994) Ecology of Polymyxa graminis. In "Working together on groundnut virus disease" (eds. Reddy, D.V.R., McDonald, D. and Moss, J.P.), 51. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Andhra Pradesh, India.Marcos, J.F., Beachy, R.N., Houghten, R.A., Blondelle, S.E. and Perez-Paya, E. (1995) Inhibition of a plant virus infection by analogs of melittin. Proc. Natl. Acad. Sci. USA. 92: 12466-12469.Martin, G. B. (1994) Analysis of the molecular basis of Pseudomonas syringae pv. tomato resistance in tomato. Euphytica 79: 187-193.Masuta, C., Tanaka, H., Uehara, K., Kuwata, S., Koiwai, A. and Noma, M. (1995) Broad resistance to plant viruses in transgenic plants conferred by

234

antisense inhibition of a host gene essential in S-adenosylmethionine-dependent transmethylation reactions. Proc. Natl. Acad. Sci. USA. 92: 6117-6121.Matand, K., Dessai, A.P. and Prakesh, C.S. (1994) Thidiazuron promotes high frequency regeneration of peanut {Arachis hypogaea) plants in vitro. Plant Cell Rep. 14: 1-5.Matthews, R.E.F. (1991) Disease symptoms and effects on metabolism. In " Plant Virology". Academic Press, Inc., San Diego, California, U.S.A.Matzke, M.A. and Matzke, A.J.M. (1995) Homology-dependent gene silencing in transgenic plants: What does it really tell us? Trends Genet. 11: 1-3.Mayo, M.A., Miller, J.S., Wesley, S.V., Naidu, R.A. and Reddy,D .V .R . (1994) Screening for resistance to groundnut rosette virus disease. In "Working together on groundnut virus disease" (eds. Reddy, D.V.R., McDonald, D. and Moss, J.P.), 46. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Andhra Pradesh, India.Mayo, M.A., Wesley, S.V. and Miller, J .S . (1994) Nucleotide sequence studies with Indian peanut clump virus. In "Compendium of Current research in plant sciences 1993" (eds. Witcombe J.R. and Wright, D.), 55-57. ODA and CAZS, Bangor.Meijer, E.G.M. and Broughton, W.J. (1981) Regeneration of whole plants from hypocotyl-, root-, and leaf-derived tissue cultures of the pasture legume Stylosanthes guyanensis. Physiol. Plant. 52: 280-284.Meyer, P. and Saedler, H. (1996) Homology-dependent gene silencing in plants. Ann. Rev. Plant physiol. Plant Mol. Biol. 47: 23-48.Miller , J.S., Wesley, S.V., Naidu, R.A., Reddy, D.V.R. and Mayo, M.A. (1996) The nucleotide sequence of RNA-1 of Indian peanut clump furovirus. Arch. Virol. 141: 2301-2312.Moses, P.B. and Chua, N-H. (1988) Light switches for plant gene. Sci. Amer. 1988: 88-118.Motagi, B.N., Gowda, M.V.C. and Sheshagiri, R. (1996) Mutants resistant to foliar diseases in groundnut {Arachis hypogaea L.). Curr. Sci. 71: 582-584. Mroginski, L.A. and Fernandez, A. (1980) Obtainment of plantlets by in vitro culture of anthers of wild species of Arachis (Leguminosae). Oleagineux 35: 89-92. Mroginski, L.A., Kartha, K.K. and Shyluk, J.P . (1981) Regeneration of peanut plantlets by in vitro culture of immature leaves. Can. J. Bot. 59: 473-497. Mroginski, L.A. and Kartha, K.K. (1984) Tissue culture of legumes for crop improvement. Plant Breed. 2: 215-264.

235

Mueller, E., Gilbert, J.E., Davenport, G., Brigneti, G. and Baulcombe, D. (1995) Homology-dependent resistance: Transgenic virus resistance in plants related in homology-dependent gene silencing. Plant J. 7: 1001-1013. Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant. 15: 473-497.Naidu, R.A., Miller, J.S., Mayo, M.A. and Reddy, A .S. (1996) The nucleotide sequence of Indian peanut clump virus RNA 2. In "Proceedings at the third symposium of the international working group on plant viruses with fungal vectors" (eds., Sherwood, J. L. and Rush, C. M.), 77-80.Namba, S., Ling, K., Gonsalves, C., Gonsalves, D. and Slightom ,J.L. (1991) Expression of a gene encoding the CP of cucumber mosaic virus (CMV) strain WL appears to provide protection to tobacco plants against infection by different CMV strains. Gene 107: 181-188.Nejidat, A. and Beachy, R .N . (1989) Decreased levels of TMV coat protein in transgenic tobacco plants at elevated temperatures reduces resistance to TMV infection. Virology 173: 531-538.Nejidat, A. and Beachy, R .N. (1990) Transgenic tobacco plants expressing a tobacco mosaic virus coat protein gene are resistant to some tobamoviruses. Mol. Plant-Microbe Interact. 3: 247-251.Niedz, R.P., Sussman, M.R. and Satterlee, J .S . (1995) Green fluorescent protein: an in vivo reporter of plant gene expression. Plant Cell Rep. 14: 403-406. Nigam, S .N . (1987) A review of the present status of genetic resources of the ICRISAT Regional Groundnut Improvement Program, of the Southern African Cooperative regional Yield Trials, and of rosette virus resistance breeding. In 'Proc. Reg. Groundnut Workshop S. Afr., 2nd, 10-14 Feb. 1986', Harare, Zimbabwe, 15- 30. Patancheru, A. P., India: ICRISAT.Nigam, S.N. and Bock, K.R. (1990) Inheritance of resistance to groundnut rosette virus in groundnut. Ann. App. Biol. 117: 553-560.Nigam, S.N., Dwivedi, S.L. and Gibbons, R.W . (1991) Groundnut breeding: constraints, achievements, and future possibilities. Plant Breed. Abstr. 61: 127-1136.Nishimura, A., Morita, M., Nishimura, Y. and Sugino, Y. (1990) A rapid and highly efficient method for preparation of competent Escherichia coli cells. Nucl. Acid Res. 18: 6169.Nolt, B.L., Rajeshwari, R., Reddy, D.V.R., Bharathan, N. and Manohar, S .K . (1988) Indian peanut clump virus isolates: Host range, symptomatology, serological relationships, and some physical properties. Phytopathology 78: 310-313.

236

Oelck, M.M. and Schieder, O. (1983) Genotypic differences in some legume species affecting the redifferentiation ability from callus to plants. Z. Pflanzenziichtg 91: 312-321.Ogawa, T., Hori, T. and Ishida, I. (1996) Virus-induced cell death in plants expressing the mammalian 2',5' oligoadenylate system. Nature Biotechnology 14: 1566-1569.Olorunju, P.E., Kuhn, C.W., Demski, J.W., Misari, S.M. and Ansa, O.A. (1992) Inheritance of resistance in peanut to mixed infections of groundnut rosette virus (GRV) and groundnut rosette assistor virus and a single infection of GRV. Plant Dis. 76: 95-100.Omirulleh, S., Abrahams, M., Golovkin, M., Stefanov, I., Karabaev, M.K., Mustardy, L., Morocz, S. and Dudits, D. (1993) Activity of a chimeric promoter with doubled CaMV 35S enhancer element in protoplast-derived cells and transgenic plants in maize. Plant Mol. Biol. 21: 415-428.Ooms, G., Burrell, M.M., Karp, A., Bevan, M. and Hille, J. (1987) Genetic transformation in two potato cultivars with T-DNA from disarmed Agrobacterium. Theor. Appl. Genet. 73: 744-750.Ow, D.W., Wood, K.V. DeLuca, M., DeWet, J.R. Helinski, D.R. and Howell, S .H . (1986) Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science 234: 856-859.Ozcan, S., Barghchi, M., Firek, S. and Draper, J. (1992) High frequency adventitious shoot regeneration from immature cotyledons of pea {Pisum sativum L.). Plant Cell Rep. 11: 44-47.Ozcan, S., Barghchi, M., Firek, S. and Draper, J. (1993) Efficient adventitious shoot regeneration and somatic embryogenesis in pea. Plant Cell Tiss. Org. Cult. 34: 271-277.Ozias-Akins, P., Anderson, W.F. and Holbrook, C.C. (1992) Somatic embryogenesis in Arachis hypogaea L.: genotype comparison. Plant Sci. 83: 103- 111 .

Ozias-Akins, P., Schnall, J.A., Anderson, W.F., Singsit, C ., Clemente, T.E., Adang, M.J. and Weissinger, A.K. (1993) Regeneration of transgenic peanut plants from stably transformed embryonic callus. Plant Sci. 93: 185-194.Palukaitis, P. and Roossinck, M.J. (1996) Spontaneous change of a benign satellite RNA of cucumber mosaic virus to a pathogenic variant. Nature Biotech. 14: 1264-1268.Park, Y-D., Papp, I., Moscone, E.A., Iglesias, V.A., Vaucheret, H ., Matzke, M.A. and Matzke, A .J.M . (1996) Gene silencing mediated by

237

promoter homology occurs at the level of transcription and results in meiotically heritable alterations in methylation and gene activity. Plant J. 9: 183-194.Parrott, W.A., Williams, E.G., Hildebrand, D.F. and Collins, G .B .(1989) Effect of genotype on somatic embryogenesis from immature cotyledons of soybean. Plant Cell Tiss. Org. Cult. 16: 15-21.Pazour, G.J., Ta, C.N. and Das, A. (1992) J. Bacteriol. 174: 4169-4174. Peach, C. and Velten, J. (1991) Transgene expression variability (position effect) of CAT and GUS reporter genes driven by linked divergent T-DNA promoters. Plant Mol. Biol. 17: 49-60.Pereira, L.F. and Erickson, L. (1995) Stable transformation of alfalfa (Medicago sativa L.) by particle bombardment. Plant Cell Rep. 14: 290-293.Pharis, R.P. and King, R.W. (1985) Gibberellins and reproductive development in seed plants. Annu. Rev. Plant Physiol. 36: 517-568.Phillips, G.C. and Collins, G.B. (1979) In vitro tissue culture of selected legumes and plant regeneration from callus cultures of red clover. Crop Sci. 19: 59- 64.Phillips, G.C. and Collins, G .B. (1980) Somatic embryogenesis from cell suspension cultures of red clover. Crop Sci. 20: 323-326.Phillips, G.C. and Collins, G.B. (1984) Red clover and other forage legumes. In "Handbook of plant cell culture, Volume 2. Crop species" (eds. Sharp, W.R., Evans, D.A., Ammirato, P.V. and Yamada, Y.), 169-210. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Pittman, R., Banks, D.J., Kirby, J.S. and Richardson, P.E. (1983) In vitro culture of immature peanut {Arachis spp.) leaves: Morphogenesis and plantlet regeneration. Peanut Sci. 10: 21-25.Potrykus, I. (1989) Gene transfer to cereals: An assessment. Trends Biotechnol. 7: 269-273.Powell Abel, P., Nelson, R.S., De, B., Hoffman, N., Rogers, S .G ., Fraley, R.T. and Beachy, R .N . (1986) Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232: 738-743.Powell Abel, P., Sanders, P.R., Turner, N., Fraley, R.T. and Beachy,R.N . (1990) Protection against tobacco mosaic virus protection in transgenic plants require accumulation of coat protein rather than coat protein RNA sequences. Virology 175: 124-130.Prins, M., de Oliveira Resende, R., Anker, C., van Schepen, A., de Haan, R. and Goldbach, R. (1996) Engineered RNA-mediated resistance to

238

tomato spotted wilt virus is sequence specific. Mol. Plant-Microbe Interact. 9: 416- 418.Prins, M., Storms, Kormelink, R., De Haan, P. andGoldbach, R. (1997) Transgenic tobacco plants expressing the putative movement protein of tomato spotted wilt tospovirus exhibit aberrations in growth and appearance. Transgenic Res. 6: 245-251.Pua, E-C., Mehra-Palta, A., Nagy, F. and Chua, N-H. (1987) Transgenic plants of Brassica napus L. Bio/Technology 5: 815-817.Puonti-Kaerlas, J., Eriksson, T. and Engstronm, P. (1990) Production of transgenic pea {Pisum sativum L.) plants by Agrobacterium tumefaciens-mediated gene-transfer. Theor. Appl. Genet. 80: 246-252.Quak, F. (1977) Meristem culture and virus-free plants. In "Applied and fundamental aspects of plant cell, tissue and organ culture" (eds. Reinert, J. and Bajaj, Y.P.S.), Springer-Verlag, Berlin.Quimio, C.A. and Zapata, F .J. (1990) Diallel analysis of callus production and green plant regeneration in rice anther culture. Crop Sci. 30: 188-192.Rainer, H .K. (1998) GFP for in vivo imaging of subcellular structures in plant cells. Trends Plant Sci. 3: 317- 320.Rao, P.V.S., Renard, J.L., Waliyar, F., McDonald, D. and Schilling,R. (1993) Variations in symptoms of Cerospora arachidicola isolates on some groundnut genotypes. Oleagineux 48: 243-250.Ray, I.M. and Bingham, E.T. (1989) Breeding diploid alfalfa for regeneration from tissue culture. Crop Sci. 29: 1545-1548.Reddy, D.V.R., Rajeshwari, R., Ilizuka, N., Leseman, D.E., N olt, B.L. and Goto, T. (1983) The occurrence of Indian peanut clump, a soil-borne virus disease of groundnuts {Arachis hypogaea L.) in India. Ann. Applied Biol. 102: 305-310.Reddy, D.V.R., Nolt, B.L., Hobbs, H.A., Reddy, A.S., Rajeshwari, R., Rao, A.S., Reddy, D.D.R. and McDonald, D. (1988) Clump virus in India: isolates, host range, transmission and management. In "Developments in applied biology II. Viruses with fungal vectors" (eds. Cooper, J.I. and Asher,E.D.C.), 239-246. Association of Applied Biologists, Wellesbourne, UK.Reichel, C. (1996) Enhanced green fluorescence by expression of an Aequorea victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells. Proc. Natl. Acad. Sci. 93: 5888-5893.Reimann-Philipp, U. and Beachy, R.N. (1993) The mechanism(s) of coat protein-protein mediated resistance against tobacco mosaic virus. Semin. Virol. 4: 349-356.

239

Reisch, B. (1983) Genetic variability in regenerated plants. In "Handbook of plant cell culture, Volume 1. Techniques for propagation and breeding" (eds. Evans, D.A., Sharp, W.R., Ammirato, P.V. and Yamada, Y.), 748-769. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Reza, M.A., Mamun, A.N.K., Islam, R. and Joarder, O.I. (1995) In vitro regeneration of plantlets from hypocotyl explants of Albizzia lebbeck. Bangladesh J . Bot. 24: 109-113.Rossi, L., Escudero, J., Hohn, B. and Tinland, B. (1993) Efficient and sensitive assay for T-DNA-dependent gene expression. Plant Cell Rep. 11: 220-229. Rout, G.R., Samantaray, S. and Das, P. (1995) Somatic embryogenesis and plant regeneration from callus culture of Acacia catechu - A multipurpose leguminous tree. Plant Cell Tiss. Org. Cult. 42: 283-285.Roy, P.K., Barat, G.K. and Mehta, S.L . (1992) In vitro plant regeneration from callus derived from root explants of Lathyrus sativus. Plant Cell Tiss. Org. Cult. 29: 135-138.Rush, C.M. and Heidel, G .B. (1995) Furovirus disease of sugar beets in the United States. Plant Dis. 79: 868-875.Russell, J.A., Roy, M.K. and Sanford, J.C . (1992) Physical trauma and tungsten toxicity reduce the efficiency of biolistic transformation. Plant Physio. 98: 1050-1056.Russell, D.R., Wallace, K., Bathe, J., Martinell., B.J. and McCabe,D.E. (1993) Stable transformation of Phaseolus vulgaris via electric-discharge mediated particle acceleration. Plant Cell Rep. 12: 165-169.Russel-Kikkert, J. (1993) The Biolistic™ PDS-1000/He device. Plant Cell Org. Cult. 33: 221-226.Sahi, S.V., Chilton, M-D. and Chilton, W.S. (1990) Proc. Natl. Acad. Sci. USA. 87: 3879-3883.Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning. A laboratory manual. Second edition (eds. Nolan, C.), Cold Spring Harbour Laboratory Press.Sanders, P., Sammons, B., Kaniewski, W., Haley, L., Layton, J ., Lavallee, B.J., Delannay, X. and Turner, N .E. (1992) Field resistance of transgenic tomatoes expressing the tobacco mosaic virus or tomato mosaic virus coat protein genes. Phytopathology 82: 683-690.Sanford, J.C., Klein, T.M., Wolf, E.D. and Allen, N .J. (1987) Delivery of substances into cells and tissue using a particle bombardment process. J. Part. Sci. Technol. 6: 559-563.

240

Sanford, J.C., Devit, M.J., Russell, J.A., Smith, F.D., Harpending, P.R., Roy, M.K. and Johnston, S.A . (1991) An improved, helium driven biolistic device. Technique. 3: 3-16.Sanford, J.C. and Johnson, S.A . (1985) The concept of parasite-derived resistance: deriving resistance genes from the parasites own genome. J. Theor. Biol. 115: 395-405.Sastri, D.C., Nalini, M.S. and Moss, J.P. (1982) Tissue culture and prospects for improvement of Arachis hypogaea and other oil seed crops. In "Tissue culture of economically important plants" (ed. Rao, A.N.), 42-57. Proc. COSTED Symp., Singapore, 28-30 April, 1981. ICRISAT, Patancheru, India.Satina, S., Blakeslee, A.F. and Avery, A .G . (1940) Demonstrations of the three germ layers in the shoot apex of Datura by means of induced polyploidy in periclinal chimeras. Am. J. Bot. 27: 895-905.Sauger, L. and Catharinet, M. (1954) La rosette chlorotique de l'arachide et les lignees selectionnees. L'Agronomie Tropicale 9: 28-36.Sautter, C., Waldner, H., Neuhaus-Uri, G., Galli, A., Neuhaus, G. and Potrykus, I. (1991) Micro-targeting: High efficiency gene transfer using a novel approach for the acceleration of micro-projectiles. Bio/Technology 9: 1080- 1085.Sautter, C., Leduc, N., Bilang, R., Iglesias, V.A., Gisel, A., Wen, X . and Potrykus, I. (1995) Shoot apical meristems as a target for gene transfer by microballistics. Euphytica 85: 45-51.Sawadogo, M., and Von Dyle, M.W. (1991) A rapid method of the purification of deprotected oligodeoxynucleotides. Nucl. Acids Res. 19: 674.Schiebel, W., Haas, B., Marinkovic, S., Klanner, A. and Sanger, H.L. (1993a) RNA-directed RNA polymerase from tomato leaves. I. Purification and physical properties. J. Biol. Chem. 268: 11851-11857.Schiebel, W., Haas, B., Marinkovic, S., Klanner, A. and Sanger, H.L.(1993b) RNA-directed RNA polymerase from tomato leaves. II. Catalytic in vitro properties. J. Biol. Chem. 268: 11858-11867.Schnall, J.A. and Weissinger, A.K. (1993) Culturing peanut (Arachis hypogaea L.) zygotic embryos for transformation via microprojectile bombardment. Plant Cell Rep. 12: 316-319.Seitz, M.H., Stalker, H.T. and Green C.C. (1987) Genetic variation for regenerative response in immature leaflet cultures of cultivated peanut, Arachis hypogaea. Plant Breed. 98:104-110.

241

Sellars, R.M., Southward, G.M. and Phillips, G.C. (1990) Adventitious somatic embryogenesis from cultured immature zygotic embryos of peanut and soybean. Crop Sci. 30: 408-414.Sequeira, L. (1984) Cross protection and induced resistance: Their potential for plant disease control. Trends Biotech. 2: 25-29.Sharp, W.R., Evans, D.A., Ammirato, P.V. and Yamada, Y. (eds.)(1984) Handbook of Plant Cell Culture. Volume 1. Crop Species. Macmillan Publishing Co., A Division of Macmillan, Inc., New York.Sheen, J., Hwang, S.B., Niwa, Y ., Kobayashi, H. and Galbraith,D.W. (1995) Green-fluorescent protein as a new vital marker in plant-cells. Plant J. 8 (5): 777-784.Shillito, R.D., Carswell, G.K., Johnson, C.M., DiMaio, J.J. and Harms, C.T. (1989) Regeneration of fertile plants from protoplasts of elite inbred maize. Bio/Technology 7: 581-587.Shimamoto, K., Terada, R., Izawa, T. and Fujimoto, H. (1988) Fertile transgenic rice plants regenerated from transformed protoplasts. Nature 338: 274-276. Sijen, T., Wellink, J., Hiriart, J-B. and van Kammen, A. (1996) RNA- mediated virus resistance: Role of repeated transgenes and delineation of targeted regions. Plant Cell 8: 2277-2294.Singer, S.R. and McDaniel, C .N. (1986) Floral determination in the terminal and axillary buds of Nicotiana tabacum L. Dev. Biol. 118: 587-592.Smith, H.A., Swaney, S.L., Dawn Parks, T., Wernsman, E.A. and Dougherty, W .G. (1994) Transgenic plant virus resistance mediated by untranslatable sense RNAs: Expression, regulation, and fate of nonessential RNAs. Plant Cell 6: 1441-1453.Smith, O.D., Boswell, T.E., Grichar, W.J. and Simpson, C.E. (1989) Reaction of select peanut {Arachis hypogaea L.) lines to southern stem rot and Pythium pod rot under varied disease pressure. Peanut Sci. 16: 9-13.Somers, D.A., Rines, H.W., Gu, W., Kaeppler, H.F. and Bushnell, W.R. (1992) Fertile, transgenic oat plants. Bio/Technology 10: 1589-1594.Song, W-Y., Wang, G-L., Chen, L-L., Kim, H-S., Pi, L-Y., H olsten, T. Gardner, J., Wang, B., Zhai, W-X., Zhu, L-H., Fauquet, C.and Ronald, P.C. (1995) A receptor kinase-like protein encoded by the rice disease gene Xa21. Science 270: 1804-1806.Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by electrophoresis. J. Mol. Biol. 98: 503.

242

Sreenivasu, K., Malik, S.K., Kumar, P.A and Sharma, R.P. (1998) Plant regeneration via somatic embryogenesis in pigeonpea (Cajanus cajan L. Millsp). Plant Cell Rep. 17: 294-297.Stachel, M.E., Nester, E.W. and Zambryski, P. (1986) A plant cell factor induces Agrobacterium tumefaciens Vir gene expression. Proc. Natl. Acad. Sci. USA. 83: 379-383.Stachel, M.E. and Zambryski, P. (1986) vir A and virG control the plant- induced activation of the T-DNA transfer process of A. tumefaciens. Cell 46: 325- 333.Steward, F.C ., Mapes, M.O. and Mears, K. (1958) Growth and organized development of cultured cells. II. Organization in cultures grown from freely suspended cells. Am. J. Bot. 45: 705-708.Subrahmanyam, P., McDonald, D., Gibbons, R.W., Nigam, S.N. and Nevill, D.J. (1982) Resistance to rust and late leafspot diseases in some genotypes of Arachis hypogaea. Peanut Sci. 9: 6-10.Subrahmanyam, P., Moss, J.P., McDonald, D., Subba Rao, P.V. and Rao, V.R. (1982) Resistance to leafspot caused by Cercosporidium personatum in wild Arachis species. Plant Dis. 69: 951-954.Subrahmanyam, P. and McDonald, D. (1983) Rust disease of groundnut. International Crops Research Institute for Semi-Arid Tropics (ICRISAT) Info. Bull. No. 13. Patancheru, India.Subrahmanyam, P., Williams, W.H., McDonald, D. and Gibbons,R.W. (1984) The influence of foliar diseases and their control by selective fungicides on a range of groundnut (Arachis hypogaea L.) genotypes. Ann. Appl. Biol. 104: 476-476.Subrahmanyam, P., Hildebrand G.L. and Singh, A .K . (1994) Screening for resistance to groundnut rosette virus disease. In "Working together on groundnut virus disease" (eds. Reddy, D.V.R., McDonald, D. and Moss, J.P.), 32. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Andhra Pradesh, India.Suhasini, K., Sagare, A.P. and Krishnamurthy, K .V. (1994) Direct somatic embryogenesis from mature embryo axes in chickpea (Cicer arietinum L.). Plant Sci. 102: 189-194.Swain, S.M., Reid, J.B. and Ross, J.J. (1993) Seed development in Pisum- The lhl allele reduces gibberellins levels in developing seed, and increases seed abortion. Planta 191: 482-488.

243

Swanson, E.B. and Tomes, D.T. (1980) Plant regeneration from cell cultures of Lotus comiculatus and the selection and characterisation of 2,4-D tolerant cell lines. Can. J. Bot. 58: 1205-1209.Tabe, L.M., Higgins, C.M., McNabb, W.C. and Higgins, T.J.V. (1993) Genetic engineering of grain and pasture legumes for improved nutritive value. Genetica 90: 181-200.Tacke, E., Salamini, F. and Rohde, W. (1996) Genetic engineering of potato for broad-spectrum protection against virus infection. Nature Biotechnology 14: 1597- 1601.Taylor, G.R. (1994) Polymerase chain reaction: basic principles and automation. In "PCR. A practical approach. Vol. 1" (eds. McPherson, Quirke, P. and Taylor G.R.), The practical approach series, IRL Press.Thouvenal, J.C., Germani, G. and Pfeiffer, P. (1974) Preuvre de l'origine virale de rabougrissement ou "clump" de l'arachide en Haute-Volta et au Senegal. Comptes rendus hebdomadaires des seances de l'Academie des sciences, serie D. 278: 2847-2849.Tian, L.N., Brown, D.C.W., Voldeng, H. and Webb, J. (1994) In vitro response and pedigree analysis for somatic embryogenesis of long-day photoperiod adapted soybean. Plant Cell Tiss. Org. Cult. 36: 269-273.Tisserat, B. and De Mason, D.A. (1980) A histological study of development of adventive embryos in organ cultures of Phoenix dactylifera L. Ann. Bot. 46: 465-472. Todd, J.W., Culbreath, A.K. and Demski, J.W. (1994) Insect vectors of groundnut viruses. In "Working together on groundnut virus disease" (eds. Reddy, D.V.R., McDonald, D. and Moss, J.P.), 23. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Andhra Pradesh, India.Tomes, D.T., Weissinger, A.K., Ross, M., Higgins, R., Drummond, B.J., Schaaf, S., Malone-Schoneberg, J., Staebell, M., Flynn, P ., Anderson, J. and Howard, J. (1990) Transgenic tobacco plants and their progeny derived from microprojectile bombardment of tobacco leaves. Plant Mol. Biol. 14: 261-268.Tomlinson, J.A. (1982) Chemotherapy of plant viruses and viruses diseases. In "Pathogens, vectors and plant diseases" (eds. Harris, K.F. and Maramorosch, K.), 23-44, Academic Press, London.Topfer, R., Matzeit, V., Gronenborn, B., Schell, J. and Steinbiss, H .(1987) A set of plant expression vectors for transcriptional and translational fusions. Nucl. Acid Res. 15: 5890.

244

Torisky, R., Fellers, J.P. and Collins, G .B. (1996) A focusing device for tissue transformation with the DuPont/BioRad PDS1000 helium microprojectile system. Plant Mol. Cell Rep. 14: 124-133.Towbin, J., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications, Proc. Natl. Acad. Sci. USA. 76: 4350-4354.Trigiano, R.N., Beaty, R.M. and Graham, E.T. (1988) Somatic embryogenesis from immature embryos of redbud (Cercis canadensis). Plant Cell Rep. 7: 148-150.Turner, R., Bate, N., Twell, D. and Foster, G.D. (1994) In vivo characterisation of a translational enhancer upstream from the coat protein open reading frame of potato virus S. Arch. Virol. 137: 123-132.Turner, R. and Foster, G.D. (1995) The potential exploitation of plant viral translational enhancers in Bio/Technology for increased gene expression. Mol. Biotech. 3: 225-236.Turner, R.B., Lindsey, D.L., Davis, D.D. and Bishop, R.D. (1975) Isolation and identification of 5,7-dimethoxyisoflavone, an inhibitor of Aspergillus flavus from peanut. Mycopathologia 57: 39-40.Twell, D., Klein, T.M., Fromm, M.E. and McCormick, S. (1989) Transient expression of chimeric genes delivered into pollen by microprojectile bombardment. Plant Physio. 91: 1270-1274.Twell, D., Yamaguchi, J., Wing, R.A., Ushiba, J. and McCormick, S .(1991) Promoter analysis of three genes that are coordinately expressed during pollen development reveals pollen-specific enhancer sequences and shared regulatory elements. Genes Devel. 5: 496-507.Umbeck, P., Johnson, G., Barton, K. and Swain, W. (1987) Genetically transformed cotton (Gossypium hirsutum L). Bio/Technology 5: 263-266.USD A. (1994) Peanut area, yield, and production. Production estimates and crop assessment division, FAS, USDA.Vain, P., McMullen, M.D. and Finer, J.J. (1993) Osmotic treatment enhances particle bombardment-mediated transient and stable transformation of maize. Plant Cell Rep. 12: 84-88.Vancanneyt, G., Schmidt, R., O'Connor-Sanchez, A., Willmitzer, L. and Rocha-Sosa, M. (1990) Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in Monitoring early events in Agrobacterium-mediated plant transformation. Mol. Gen. Genet. 220: 245-250.

245

Vasil, V., Castillo, A.M., Fromm, M.E. and Vasil, I. (1992) Herbicide resistant fertile transgenic wheat plants obtained by microprojectile bombardment of regenerable embryogenic callus. Bio/Technology 10: 667-674.Velazhahan, R. and Vidhyasekaran, P. (1994) Role of phenolic-compounds, peroxidase and polyphenol oxidase. Acta Phytopathologica et Entomologica Hungaria 29: 23-29.Waliyar, F., Shew, B.B, Stalker, H.T., Isleib, T.G., Sidahmed, R. and Beute, M.K. (1994) Effect of temperature on stability of components of resistance. Phytopathology 84: 1037-1043.Walkey, D .G .A . (1991) Virus symptoms. In "Applied Plant Virology". Chapman and Hall, London.Wan, Y and Lemaux, P.G. (1994) Generation of large numbers of independently-transformed fertile barley plants. Plant Physiol. 104: 37-48.Weeks, T.J., Anderson, O.D. and Blechl, A.E. (1993) Rapid production of multiple independent lines of fertile transgenic wheat (Triticum aestivum). Plant Physiol. 102: 1077-1084.Wells, M.A., Grichar, W.J., Smith, O.D. and Smith, D.H. (1994) Response of selected peanut germplasm lines to leafspot and southern stem rot. Oleagineux 49: 21-26.Wesley, S.V., Mayo, M.A., Jolly, C.A., Naidu, R.A., Reddy, D.V.R., Jana, M.K. and Parnaik, V.K. (1994) The coat protein of Indian peanut clump vims: relationships with other fiiroviruses and with barley stripe mosaic vims. Arch. Virology 134: 271-278.Wetzstein, H.Y. and Baker, C.M. (1993) The relationship between somatic embryo morphology and conversion in peanut {Arachis hypogaea L.). Plant Sci. 92: 81-89.Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R., Corr, C. and Baker, B. (1994) The product of the tobacco mosaic vims resistance gene N : Similarity to Toll and the interleukin-1 receptor. Cell 78: 1011-1015.Whitham, S., McCormick, S. and Baker, B. (1996) The N gene of tobacco confers resistance to tobacco mosaic vims in transgenic tomato. Proc. Natl. Acad. Sci. U.S.A. 93: 8776-8781.Williams, E.G. and Maheswaran, G. (1986) Somatic embryogenesis: Factors influencing coordinated behaviour of cells as a embryogenic group. Ann. Bot. 57: 443-462.Wynne, J.C., Beute, M.K. and Nigam, S .N . (1991) Breeding for disease resistance in peanut (Arachis hypogaea L.). Ann. Rev. Phytopathol. 29:279-303.

246

Yu, Y.G., Buss, G.R. and Maroof, M.A.S. (1996) Isolation of a superfamily of candidate disease-resistance genes in soybean based on a conserved nucleotide- binding site. Proc. Natl. Acad. Sci. USA. 93: 11751-11756.Zambryski, P.O. (1989) Agrobacterium-plant cell DNA transfer. In "Mobile DNA", 309-333 (ed. Howe, D.B.a.M), Am. Soc. Microbiol., Washington DC. Zambryski, P.C. (1992) Chronicles from the Agrobacterium-plant cell DNA transfer story. Annu. Rev. Plant. Physio. Plant Mol. Biol. 43: 465-490.Zettler, F.W. and Hartman, R.D. (1987) Dasheen mosaic virus as a pathogen of cultivated aroids and control of virus by tissue culture. Plant Dis. 71: 958-963. Ziegler-Graff, V., Guilford, P.J. and Baulcombe, D.C. (1991) Tobacco rattle virus RNA-1 29K gene product potentiates viral movement and also affects symptom induction in tobacco. Virology 182: 145-155.Zimmerman, J.L. (1993) Somatic embryogenesis: A model for early development in higher plants. Plant Cell 5: 1411-1423.

247