The EMBO Joumal vol.3 no.4 pp.829-834, 1984

Processing of yeast mitochondrial messenger RNAs at

a conserved dodecamer sequence

Klaas A.Osinga, Erik De Vries, Gerda Van der Horst andHenk F.Tabak*Section for Molecular Biology, Laboratory of Biochemistry, University ofAmsterdam, Kruislaan 318, 1098 SM Amsterdam, The Netherlands

*To whom reprint requests should be sentCommunicated by L.A.Grivell

The yeast mitochondrial genes coding for cytochrome c oxid-ase subunit I (COX1) and the ATPase subunits 8 and 6 areorganized in one transcription unit. Precise mapping of RNAtermini with Si nuclease and primer extension analysis showsthat the 3' end of the COX1 mRNA and the 5' end of theATPase precursor RNA are juxtaposed within a conserveddodecamer sequence (5' -AAUAAUAUUCUU-3'). Sequencecomparison reveals that this motif is present downstream ofnearly all protein-encoding genes, including extragenic un-assigned reading frames (URFs) and two URFs located withinintrons. Also the 3' terminus of an RNA species derived fromthe URF-containing intron of the large rRNA gene mapswithin such a dodecamer sequence. It is likely, therefore, thatthis motif serves as a processing point in the generation ofmature mRNA. From a comparison of the various transcrip-tion units, we infer that RNAs that originate from an endo-nucleolytic cleavage at this sequence have stable 3' termini,while further processing of the 5' ends occurs. The efficiencyof the initial cleavage varies between the different positions atwhich the motif is present.Key words: yeast mitochondria/transcription-initiation/trans-cription units/mRNA processing

IntroductionThe mitochondrial genome of Saccharomyces cerevisiae en-

codes a number of genes whose products are components ofthe respiratory chain (subunits of the ATPase complex, theubiquinol-cytochrome c reductase complex and cytochrome c

oxidase complex), function in protein synthesis [a ribosomalprotein (varl), rRNAs and tRNAs] or are involved in RNAprocessing (maturases and an RNA component of the tRNAsynthesis locus). The genes coding for the large rRNA, apo-

cytochrome b and subunit I of cytochrome c oxidase (COXI)are split (see for review Dujon, 1982). The genome contains a

number of sites at which transcription is initiated. This occurs

without exception at the last nucleotide of a conservednonanucleotide sequence (Levens et al., 1981; Osinga et al.,1982; Christianson and Rabinowitz, 1983; Osinga et al., in

preparation). A series of overlapping transcripts has beenassigned to several genes, indicating the occurrence of RNAprocessing (Van Ommen et al., 1979). This is supported bypulse-chase experiments with isolated mitochondria (Groot etal., 1981) and by studies of mutants in which there is an ac-

cumulation of precursors at the cost of mature RNA (Churchet al., 1979; Van Ommen et al., 1980; Hensgens et al., 1983a).

Knowledge about the nature of sequences involved in pro-cessing is confined to several homologous elements present in

IRL Press Limited, Oxford, England.

introns (De la Salle et al., 1982; Anziano et al., 1982; Netter etal., 1982; Schmelzer et al., 1982; Weiss-Brummer et al.,1983). These sequences presumably have a function in intronremoval by mediating the proper folding of precursor RNA(thereby bringing the exons together) (Davies et al., 1982;Michel et al., 1982) and/or by serving as recognition se-quences for proteins involved in RNA splicing (Anziano etal., 1982; Lazowska et al., 1980; Dujardin et al., 1982; Weiss-Brummer et al., 1982).

Here we report on the identification of a conserved dodeca-mer sequence downstream of protein-encoding genes at aposition where 3' ends of mature mRNAs are mapped.

ResultsMapping ofRNA termini in the region between the genesforCOX] and A TPase subunit 8The mature mRNA (18S) of the COXI gene is - 2100 nucleo-tides long (Hensgens et al., 1983a). Transcription of this geneis initiated 540 bp upstream of the AUG start codon (Osingaet al., in preparation). The COXI mRNA has a 3' -untrans-lated tail of - 100 nucleotides as determined by electronmicroscopy of RNA/DNA heteroduplexes (Hensgens et al.,1983a). Downstream of the COXI gene, the genes coding forsubunit 8 (Macreadie et al., 1983) and subunit 6 (Macino andTzagoloff, 1980) of the ATPase complex are located (FigureIC). A set of overlapping transcripts (24S, 22S, etc.) has beenassigned to this region (Van Ommen et al., 1980). Cobon etal. (1982) have shown that the length variation occurs mainlyat the 5' end and they have positioned the 5' end of thelongest RNA (24S) within a few hundred nucleotides from the3' end of the COXI gene. We have determined the positionof these RNA termini more exactly.EcoRI fragment RR7 spans the region between COXI and

ATPase subunit 6 (Figure IC). To locate the 3' end of COXImRNA, DNA fragment RR7 was labelled at its 3' ends,hybridized with total mtRNA and treated with SI nuclease.The length of the SI nuclease-protected DNA (150 nucleo-tides; Figure IA) indicates that COXI mRNA has a3'-untranslated segment of 90 nucleotides (±1). The posi-tions of the 5' termini of the ATPase RNAs were determinedusing the same DNA fragment, now labelled at its 5' ends(Figure IB). The longest SI nuclease-resistant DNA is -2400nucleotides and most likely results from hybridization with24S RNA. Additional bands of shorter length are derivedfrom the remaining set of overlapping RNAs from thisregion. The most prominent DNA band is - 1850 nucleo-tides: this survives SI nuclease digestion by virtue of itshybridization with 22S RNA, which is the main transcript inthis region. The SI nuclease-resistant DNA with a length of2400 nucleotides is - 160 nucleotides shorter than RR7 itselfand, therefore, the 3' end of COXI mRNA and the 5' end of24S RNA are extremely close to each other (see Figure IC).The largest fragment, visible in Figure lB (lane b), co-

migrates with the input DNA. This DNA most probably829

K.A.Osinga et al.

Am a b c 71n

B-i

A -rr >-l Irll

2560

2400-0 1850

7- -

150- *

S q -1

C

(Co X 1 .; ,

E,,. - , R :t-,9

') 0 . ...._................

L~~~~~N

Fig. 1. SI nuclease mapping of RNAs in the COXl-ATPase subunit 8region. (A) The 3 '-end of COXI mRNA. EcoRI fragment RR7 (see alsopanel C) was 3' 32P-labelled, hybridized with total KLI4-4A mRNA andtreated with SI nuclease. The SI nuclease-protected DNA was analysed ona 6% denaturing polyacrylamide gel. Lanes a and b, SI nuclease analysiswith 25 or 75 U/ml, respectively; c, input fragment RR7; m, 32P-labelledDNA marker from pBR322-Hinfl. (B) The 5' end of 24S and 22S RNA.EcoRI fragment RR7 (see also panel C) was 5' 32P-labelled, hybridizedwith total mtRNA isolated from petite mutant LH26D7 and treated withSI nuclease. The SI nuclease-protected DNA was analysed on a 27oalkaline agarose gel. Lane a, input fragment RR7; b, S1 nuclease analysiswith 25 U/ml; m, 32P-labelled DNA marker from pBR322-HinJI. (C)Diagram of the region between COXI and ATPase subunit 6. EcoRIfragment RR7 extends from the last exon of COXI to the ATPase subunit6 gene. The SI nuclease-resistant DNA products obtained in panels A andB are depicted. *, 32P-labelled ends. The lengths are indicated innucleotides.

arises as a result of DNA-DNA renaturation, since the inten-sity of the band is too high to be the result of hybridizationwith precursor RNA, spanning the entire RR7 fragment.These SI nuclease analyses yielded the same results usingmtRNA isolated either from wild-type KL14-4A or petite mu-tant LH26D7 (not shown).To localize the 5' end of 24S more precisely, a primer ex-

tension experiment was carried out. A synthetic DNA oligo-nucleotide of 19 nucleotides, complementary to a region ofthe 24S RNA - 50 nucleotides away from the 5' end, was us-ed as primer. The length of the complementary DNAs(cDNAs) synthesized is 73-75 nucleotides, as shown inFigure 2. The end of the longest cDNA of this set abutsprecisely the 3' end of COXI mRNA. The shorter and muchfainter bands (30-40 nucleotides) may result either from830

..* r-j 41 t, .1- !'.4SA

i-X %;.;AAUAA 1S ,jjr:~ .6

-` HIrRNA

''. R' A

Fig. 2. Localization of the 5' end of the 24S RNA by primer extension.(A) Lane a, a synthetic 19-mer (see Materials and methods) complementaryto the region 56-75 bp downstream of the position at which the 3' end ofthe 18S COXI mRNA maps was used to prime the cDNA synthesis.Lane m, 32P-labelled DNA marker from pBR322-MspI. (B) The juxtaposedtermini of the 18S COXl mRNA (cf. Figure 1) and the 24S ATPase RNA(*) are diagrammed with respect to their precursor RNA. The conserveddodecamer sequence is underlined. The lengths are indicated in nucleotides.

pausing of reverse transcriptase at certain secondary struc-tures in this AT-rich DNA or reflect the presence of multiple5' ends of 24S RNA. We did not analyse this further.The juxtaposition of the 3' end of COXI mRNA and the

5' end of 24S RNA indicates that these termini result fromendonucleolytic cleavage of a common precursor RNA ratherthan from termination and re-initiation of transcription. Twoobservations support this: (i) the 5' end of the ATPase RNAdoes not start within a conserved nonanucleotide sequence(ATATAAGTA) which has been found at all transcriptioninitiation sites analysed thus far (Osinga et al., 1982; Chris-tianson and Rabinowitz, 1983; Osinga et al., in preparation);(ii) DNA fragment RR7 is not transcribed into specific run-off RNAs when used as a template in in vitro transcriptionexperiments (Edwards et al., 1982).We conclude from these experiments that the genes coding

for COXI and ATPase subunits 8 and 6 are co-transcribed.Endonucleolytic cleavage must be a rapid event, because wehave not been able to obtain evidence for the existence of this

mRNA processing in yeast mitochondria

giant precursor RNA. Even in the petite mutant LH26D7, inwhich most of the splicing steps cannot occur [only intronaI5y can be excised in the absence of mitochondrial proteinsynthesis (Hensgens et al., 1983a)], the longest transcriptdetectable with an ATPase subunit 6 probe is 24S RNA (notshown).SI nuclease mapping of transcripts derived from the 21SrRNA intronProcessing of COX1-ATPase precursor RNA takes placewithin the sequence 5'-AAUAAUAUUCUU-3' (see Figure2). We have found this dodecamer motif more often in yeastmtDNA at analogous positions, i.e., downstream of protein-encoding genes (see Discussion). One of these is located im-mediately downstream of the URF in the 1143-bp intron ofthe 21S rRNA gene (Dujon, 1980) and we have examinedwhether processing also occurs at this position.When Northern blots are hybridized with a DNA fragment

derived from the intron as probe several RNA species arefound (Bos et al., 1980): an unspliced precursor RNA, trans-cripts containing the intron and either the 5' or the 3' exonand two major intron-sized RNAs differing slightly in length.We have mapped the 3' ends of these RNAs with a SInuclease protection experiment as outlined in Figure 3B. Toour surprise we found no protection of the 3' end-labelledHindIII-EcoRI fragment up to the 3' intron-exon border.The protected segment is 130 nucleotides shorter and ends atthe position of the conserved dodecamer sequence. This fin-ding supports our notion that RNA processing takes place inthis sequence motif and indicates that intron RNA is not awaste product of RNA splicing. The processed introntranscript could function as mRNA for the intron-encodedURF. The difference in migration behaviour between the twointron-derived RNAs noted earlier may be due to length dif-ferences at the 5' end, but this needs further investigation.

A 7.m a bm2

1631-

4,511 - 91,

* 0.- -- 400

344-

B

9*

DiscussionA distinctive feature of transcriptional initiation in yeastmitochondria is the presence of a conserved nonanucleotidesequence at the start of RNA synthesis. The genes that lackthis sequence are most likely co-transcribed with upstreamgenes that possess this motif (Tabak et al., 1983). Additionalevidence for the existence of multi-gene transcription unitscomes from the identification of polycistronic precursorRNAs (Cobon et al., 1982; Locker and Rabinowitz, 1981;Coruzzi et al., 1981; Thalenfeld et al., 1983; Christianson etal., 1983; Miller et al., 1983). This type of gene organizationimplies the existence of RNA processing events distinct fromthose of RNA splicing. Here we have studied two examples ofsuch events in more detail.

(i) We have localized the site of processing which yields the3' terminus of COXI mRNA and the 5' terminus of thelongest RNA coding for subunits 8 and 6 of the ATPase com-plex. This shows that the three genes coding for COXI andATPase subunits 8 and 6 are organized in one transcriptionunit as was already suggested by the identification of anonanucleotide box at the initiation site of transcription540 bp upstream of the COXI gene (Osinga et al., in prepara-tion) and its absence from the intergenic region of COXI andATPase subunit 6 (Novitski et al., 1984). In some strains an

optional URF has been identified downstream of the ATPasesubunit 6 gene (Cobon et al., 1982; Macino and Tzagoloff,1980) and it has been shown that the 3' end of ATPase RNA

Fig. 3. SI nuclease mapping of the 3' termini of intron RNAs in the 21SrRNA gene. (A) The right-hand side HindIII-EcoRI fragment (see alsopanel B) was 3' 32P-labelled, hybridized with total RNA from petitemutant F41 and treated with SI nuclease. The SI nuclease-protected DNAwas analysed on a 6% denaturing polyacrylamide gel. Lane a, inputfragment; b, SI nuclease analysis with 100 U/ml; ml and m2, 32P-labelledDNA markers from pBR322-HinfI and pBR322-MspI, respectively.(B) Diagram of the yeast insert in Mci2l and the positions of the twointron-sized RNAs. The SI nuclease-resistant DNA product shown in panelA is outlined. *, 32P-labelled end; E, EcoRI; H, HindII. The lengths areindicated in nucleotides.

maps beyond this gene (Cobon et al., 1982). It may, there-fore, be considered as the fourth gene on this unit. The pro-cessing event occurs within the conserved dodecamer se-

quence 5'-AAUAAUAUUCUU-3'. The giant precursorRNA, which should be at least 18 000 nucleotides long inKL14-4A, could not be detected. We attribute this to themany splicing steps occurring in the COXI part of the precur-sor (in KL144A this gene contains seven introns) and to effi-cient processing. Recently, however, a mRNA specieshybridizing with probes from both the COXI and ATPasesubunit 6 gene was detected in a nuclear mutant disturbed inmtRNA processing (Faye and Simon, 1983).

(ii) The presence of the 12-mer sequence behind the intron-encoded URF of the large rRNA gene (rI-URF) prompted us

to examine possible processing events in this region. The S1nuclease mapping shows that both intron-sized RNAs, which

831

K.A.Osinga et al.

COX 2

a 53-URF 1 6 n

CoX I

ATPase f9

r -URF

URF

U RF -'

URF 2

Cy t. b

Va r I

6 7 i

. n 8 1_

7 D X06 r'i r.

I ci 9 nti.

9 2 r -.

C O Fg9 r

UAAUAAUUAU AAUAAUAUUCUU AAAUAUAAUAAAGAUAUAGAuU GUCUAAUUA AAUhAAUAUUCUU UUUUUUUUAUGACUUACUACAUAAUAUAAU AAUAAUAUUCUU AUAAAAAAAAAUAUAUAAAAuGALiUAAAUU AAUAACAUUCUU AUAAUUAUAUAAUULAUUAUAACUUUUUUAA AAUIAAUAUUCUU AUUUUUAUUUUAUGAUAUAU

CAUAA GUUUU AAUAAUAUUCUU UUAUUCUUUAUUAUUAUAUAUACLJAAUUUA AAUAAUAUUCUU AAUCUUUAIJUCUUUAUUAAACUUU |JUUUUUU AAUAAUAUUCUU UCAUAAAUAUAU_CUAUUUAUA UAAUA tUUU AAUAAUAUUCUU AAAAAUAAUAUAUCUCUAAUAAAU.A4AAUAA AAUAAUAUUCUiUAAUUUUUAUUCUUAUTCUUCd

Flg. 4. A conserved dodecamer sequence downstream of protein-encoding genes. Numbers refer to the distance between the diagrammed sequence and the lastcodon of the respective gene. The UAA stop codon of the rI-URF lies in the 12-mer sequence. Additional sequence homologies have been indicated (see textfor explanation). The sequences are taken from the following sources: COX2 and URFI (Coruzzi et al., 1981), a1513-URF (Hensgens et al., 1983b), COXI(Novitski et al., 1984), ATPase subunit 9 and varl (Tzagoloff et al., 1980), rI-URF (Dujon, 1980), URF3 (Thalenfeld and Tzagoloff, 1980), URF2 (Macinoand Tzagoloff, 1980) and cytochrome b (Nobrega and Tzagoloff, 1980).

can be detected in Northern blot hybridizations, have 3' ter-mini that end within this motif. Conservation of this 12-mersequence at the same position (downstream of rI-URF) in themtDNA of the distantly-related yeast Kluyveromyces thermo-tolerans (Jacquier and Dujon, 1983) indicates that itspresence is not coincidental. Finally, the fact that non-processed rRNA is still detectable in Northern blot hybridiza-tion may point to a less efficient processing event at this posi-tion compared with the analogous cleavage of the COXI-ATPase precursor RNA.

Additional support in favour of a role in RNA processingof the dodecamer motif comes from a tabulation of the loca-tions at which they are found in the available DNA sequencefiles. Figure 4 shows that they all occur at a short distancedownstream of a protein-encoding gene. They have beenclassified into two categories: those present between genes ina transcription unit (Figure 4A) and those present beyond thelast identified gene of a transcription unit (Figure 4B). Notethat the 12-mer motif downstream of the ATPase subunit 9gene has one difference with the consensus sequence. Someother small stretches of sequence homology are present: theyhave been indicated in Figure 4A (a U-rich stretch down-stream of the two intronic URFs) and Figure 4B (UCU-containing sequences). Their relevance is at present unclear.The 3' termini of the mRNAs for COX2, COXI, ATPase

subunit 9, cytochrome b and rI-URF have been preciselylocalized by SI nuclease analysis. The endonucleolyticcleavage occurs close to the end of the dodecamer sequence(see also Figure 2B). This remains to be established for theother termini since their mapping is based on Northern blothybridization. The results of such studies are compiled inFigure 5, which shows the location of the dodecamer motifsin the transcription units. This figure also outlines the posi-tion of two kinds of transcripts, those mapping over thismotif and those mapping at this motif, either with the 3' orthe 5' end. The overall picture emerging is that after endo-nucleolytic cleavage of precursor RNA at the dodecamer se-quence the newly-generated ends of the two resulting RNAsegments have different fates. The 3' end of the upstreamsegment is stable, whereas the 5' end of the downstream seg-ment is processed further. For instance, processing in the 5'part of the 24S RNA derived from the region with the genes832

for ATPase subunits 8 and 6, gives rise to the set of sevenoverlapping transcripts, which all appear to have the same 3'end (Cobon et al., 1982). An extreme case is found at thedodecamer sequence present at the 3' end of the gene codingfor cytochrome b. This is the last gene of transcription unit D(see Figure 5) as is apparent from DNA sequence analysis bet-ween this gene and unit E (Nobrega and Tzagoloff, 1980). Noevidence for transcription beyond the dodecamer sequence isavailable (Bonitz et al., 1982) and from this one could arguethat at this position of the 12-mer motif RNA synthesis is ter-minated. The controlled use of a termination signal wouldthen resemble the situation at the 3' end of the large rRNAgene in animal mitochondria. Here sequences signalling bothattenuation of transcription and processing may even besuper-imposed, resulting in the differential level of transcrip-tion of rRNA genes versus the downstream encoded genes(Van Etten et al., 1983; Montoya et al., 1983). However, foryeast mitochondria, we consider it unlikely that the 12-merserves a double function in both processing and termination,the choice being determined by its location on the genome.We prefer a model in which the 3' end of the cytochrome bmRNA is generated by processing. The absence of detectabletranscripts downstream of this motif can be explained by ahighly efficient processing event (as noticed in the case of theCOXI-ATPase precursor RNA) and a fast turnover of theresulting 3' segment of the precursor. We therefore proposethat the 3' ends of mRNAs of genes which are located at theend of a transcription unit (see also Figure 4B) are generatedby endonucleolytic cleavage and not by termination of trans-cription. This resembles the situation found in someeukaryotic systems [cf. mouse f-globin gene (Hofer et al.,1982)] in which short-living transcripts have been detectedfrom regions beyond the polyadenylation site.The RNA processing occurring at the 12-mer sequence

within the intron for the 21S rRNA gene has important im-plications for the expression of the interlaced genes coding forrRNA and the rI-URF protein. How are RNA splicing andprocessing steps coordinated? Several possibilities can be con-sidered. (i) Splicing precedes processing and the excised intronRNA is processed further. The 3' half of the precursor RNAis unstable and cannot easily be picked up. This is in line withresults discussed above. (ii) Processing precedes RNA splic-

mRNA processing in yeast mitochondna

A

B

C

D

E

F

5 COX a158-URF 3ATPase

r - 6// 1 l *

URF 2

-4 2_ _--.* 3

COX 2 URF1i l >

unit C

_ ~~~~~2

Phe Val COX 3 URF 3

l 1

Glu Cy' b

> ATPase 9 Ser-2 Var 1

1-102

--4 3

large rRNA rl-URF Thr-2

-~~~~~~~~mmE _ -

-4 1

2-...,........... 3

Fig. 5. Multi-gene transcription units and the positions of the dodecamersequences. Positions of the nonanucleotide sequence (start of RNAsynthesis) are indicated by a triangle. Filled in circles represent the 12-mersequence. Open circles refer to a 12-mer sequence at which no 3' terminiof RNA maps (URF3) or for which no clear transcript mapping data areavailable (aIS,B-URF). Recent DNA sequence analysis (F.Michel, inpreparation) has revealed the presence of a dodecamer sequence in theregion where the 3' end of transcript Cl may map. For simplicity, allintrons in the mosaic genes coding for cytochrome b and COXI have beenomitted except one relevant intron in the COXI gene (al5o3). Each unit isdrawn to a separate scale. Broken lines indicate gaps in the known DNAsequence, uncertainties in the exact position of the AUG start codon(URF2, URF3) or in the exact limits of transcripts. The transcripts aredepicted as wavy lines and numbered by each transcription unit (Al, A2,etc.). The positions of the transcripts are taken from the followingreferences: Al, Osinga et al. (in preparation) and this study; A2, this studyand Cobon et al. (1982); A3, Cobon et al. (1982); BI, Coruzzi et al.(1981); B2, Coruzzi et al. (1981) and Fox and Boerner (1980); Cl,Thalenfeld et aL (1983); Dl, Christianson et al. (1983) and Bonitz et al.(1982); D2, Grivell et al. (1982); El, Edwards et al. (1983) and Miller et al.(1983); E2, R.Van der Veen (unpublished); E3, Farrelly et al. (1982); Fl,Levens et al. (1981), Osinga and Tabak (1982) and Locker and Rabinowitz(1981); F2, Bos et al. (1980) and Merten et al. (1980); F3, Bos et al. (1980)and this study.

ing. This has the drawback that splicing becomes a bi-molecular reaction between separate half-molecules. How-ever, it could be envisaged that the halves are kept together bythe extensive folding which is proposed for the intron RNA(Davies et al., 1982; Michel et al., 1982) or the precursorRNA may be assembled first into a pre-ribosomal particlebefore processing or splicing occurs, as has been described forthe mitochondrial large rRNA precursor in Neurosporacrassa (LaPolla and Lambowitz, 1979). (iii) The precursorRNA may have different fates, one yielding rRNA, the other

URF mRNA.Determination of the position of the 5' ends of the intron-

derived RNA may help to distinguish between these variouspossibilities.

Materials and methodsYeast strains and growth conditionsS. cerevisiae KL 144A was grown at 28°C in a semi-synthetic lactate medium,supplemented with 0.307o (w/v) glucose (Ohnishi et al., 1966). The petitemutants LH26D7, described by Hensgens et al. (1983a), and F41, describedby Heyting et al. (1979), were grown in 207o (w/v) glucose, I 7o (w/v) yeast ex-tract and 10o (w/v) Bacto peptone at 23°C and 28°C, respectively.Recombinant phagesMci2l has been described previously (Osinga et al., 1983). It is a phageMl3mp7 recombinant containing the 21S rDNA intron flanked by exon se-quences (161 bp of the 5' exon and 59 bp of the 3' exon).RNA and DNA preparationsmtRNA was isolated as follows: cells (50 g) were collected by centrifugation at6000 g, washed with cold distilled water, resuspended in 200 ml 0.1 M Tris-HCI (pH 8.3), 2 mM dithiothreitol (DTT) and pre-incubated for 25 min at28°C. After centrifugation, cells were taken up in 100 ml 1 M sorbitol,33 mM Tris maleic acid (pH 5.7), 1 mM EDTA, containing 2 g Helicase(Reactifs IBF) and converted into protoplasts by incubation at 28°C for- 1 h. The protoplasts were then resuspended in 250 ml 0.5 M mannitol,0.5 mM EDTA (pH 7.0) and broken in a Sorvall omnimixer. After cen-trifugation of the homogenate at 2500 g in order to remove cell debris, mito-chondria were pelleted by centrifugation of the supernatant at 12 000 g. Themitochondrial pellet was further purified by repeating the low- and high-speedcentrifugation steps. mtRNA and mtDNA were then isolated as described(Van Ommen et al., 1980).The replicative form of phage M13 clones was isolated according to a

modified procedure (Maniatis et al., 1982) of the alkaline lysis method ofBirnboim and Doly (1979). The DNA was further purified by equilibrium cen-trifugation in a CsCI-ethidium bromide density gradient.Primer extension analysisA 5' end-labelled synthetic DNA oligonucleotide (AGTTCCCAAAAAGG-ATAAT, complementary to segment in the 5' part of the 24S RNA, see

Figure 2) was used to prime cDNA synthesis on total mtRNA (DNase1-treated) from petite mutant LH26D7. 1 ng of the 5' phosphorylated 19-merprimer was mixed with 2 /Lg RNA and the reaction mixture was adjusted to50 mM Tris-HCl (pH 8.0), 50 mM KCI, 8 mM MgCl2, 10 mM DTT, 50 sMeach of dATP, dCTP and dGTP, 100 WM dTTP and 400 U reverse transcrip-tase per ml. The reaction (final volume 5 Al) was carried out at 42°C for15 min. Before loading onto the gel, RNA was digested with RNase I(140 Ag/ml) at 42°C for 15 min. The primer-extended products were analysedon a 607o denaturing polyacrylamide gel.MiscellaneousEnd-labelling of DNA fragments and SI nuclease analysis were carried out as

described (Osinga et al., 1982).

AcknowledgementsWe are indebted to Drs. A.W. Linnane and P.Nagley (Department of Bio-chemistry, Monash University, Clayton, Victoria, Australia) and to Drs. A.Jacquier, B.Dujon and F.Michel (Centre de Genetique Moleculaire du CNRS,91-Gif-sur-Yvette, France) for providing DNA sequence data prior to publica-tion. We thank Mrs.R.Van der Veen for communication of unpublishedresults and Professor J.H.Van Boom (Organic Chemistry Laboratory, StateUniversity Leiden, The Netherlands) for performing the synthesis of the oligo-nucleotide used for primer extension analysis. We thank Dr. R. Benne andProfessor L.A.Grivell and Professor P.Borst for their comments on themanuscript. This work was supported in part by a grant to L.A.Grivell fromThe Netherlands Foundation for Chemical Research (SON) with financial aidfrom The Netherlands Organization for the Advancement of Pure Research(ZWO).

ReferencesAnziano,P.Q., Hanson,D.K., Mahler,H.R. and Perlman,P.S. (1982) Cell,

30, 925-932.Birnboim,H.C. and Doly,J. (1979) Nucleic Acids Res., 7, 1513-1523.Bonitz,S.G., Homison,G., Thalenfeld,B.E., Tzagoloff,A. and Nobrega,F.G.

(1982) J. Biol. Chem., 257, 6268-6274.Bos,J.L., Osinga,K.A., Van der Horst,G., Hecht,N.B., Tabak,H.F., VanOmmen,G.J.B. and Borst,P. (1980) Cell, 20, 207-214.

833

K.A.Osinga et al.

Christianson,T. and Rabinowitz,M. (1983) J. Bio. Chem., 258, 14025-14033.Christianson,T., Edwards,J.C., Mueller,D.M. and Rabinowitz,M. (1983)

Proc. Natl. Acad. Sci. USA, 80, 5564-5568.Church,G.M., Slonimski,P.P. and Gilbert,W. (1979) Cell, 18, 1209-1215.Cobon,G.S., Beilharz,M.W., Linnane,A.W. and Nagley,P. (1982) Curr.

Genet., 5, 97-107.Coruzzi,G., Bonitz,S.G., Thalenfeld,B.E. and Tzagoloff,A. (1981) J. Biol.

Chem., 256, 12780-12787.Davies,R.W., Waring,R.B., Ray,J.A., Brown,G.A. and Scazzocchio,C.

(1982) Nature, 300, 719-724.De La Salle,J., Jacq,C. and Slonimski,P.P. (1982) Cell, 28, 721-732.Dujardin,G., Jacq,C. and Slonimski,P.P. (1982) Nature, 298, 628-632.Dujon,B. (1980) Cell, 20, 185-197.Dujon,B. (1982) in Strathern,J.N., Jones,E.W. and Broach,J.R. (eds.),

Molecular Biology of the Yeast Saccharomyces: Lfe Cycle and Inheritance,Cold Spring Harbor Laboratory Press, NY, pp. 505-635.

Edwards,J.C., Levens,D. and Rabinowitz,M. (1982) Cell, 31, 337-346.Edwards,J.C., Osinga,K.A., Christianson,T., Hensgens,L.A.M., Janssens,

P.M., Rabinowitz,M. and Tabak,H.F. (1983) NucleicAcids Res., 11, 8269-8282.

Farrelly,F., Zassenhaus,H.P. and Butow,R.A. (1982) J. Biol. Chem., 257,6581-6587.

Faye,G. and Simon,M. (1983) in Schweyen,R.J., Wolf,K. and Kaudewitz,F.(eds.), Mitochondria 1983: Nucleo-Mitochondrial Interactions, De Gruyter,Berlin, pp. 433-439.

Fox,T.D. and Boerner,P. (1980) in Kroon,A.M. and Saccone,C. (eds.), TheOrganization and Expression of the Mitochondrial Genome, Elsevier,Amsterdam, pp. 191-194.

Grivell,L.A., Hensgens,L.A.M., Osinga,K.A., Tabak,H.F., Boer,P.H.,Crusius,J.B.A., Van der Laan,J.C., De Haan,M., Van der Horst,G.,Evers,R.F. and Arnberg,A.C. (1982) in Slonimski,P., Borst,P. and AttardiG. (eds.), Mitochondrial Genes, Cold Spring Harbor Laboratory, NY, pp.225-239.

Groot,G.S.P., Van Harten-Loosbroek,N., Van Ommen,G.J.B. and Pijst,H.L.A. (1981) Nucleic Acids Res., 9, 6369-6377.

Hensgens,L.A.M., Arnberg,A.C., Roosendaal,E., Van der Horst,G., Vander Veen,R., Van Ommen,G.J.B. and Grivell,L.A. (1983a) J. Mol. Biol.,164, 35-58.

Hensgens,L.A.M., Bonen,L., De Haan,M., Van der Horst,G. and Grivell,L.A. (1983b) Cell, 32, 379-389.

Heyting,C., Meijlink,F.C.P.W., Verbeet,M.Ph., Sanders,J.P.M., Bos,J.L.and Borst,P. (1979) Mol. Gen. Genet., 169, 231-250.

Hofer,E., Hofer-Warbinek,R. and Darnell,J.E.,Jr. (1982) Cell, 29, 887-893.Jacquier,A. and Dujon,B. (1983) Mol. Gen. Genet., 192, 487499.LaPolla,R.J. and Lambowitz,A.M. (1979) J. Biol. Chem., 254, 11746-11750.Lazowska,J., Jacq,C. and Slonimski,P.P. (1980) Cell, 22, 333-348.Levens,D., Ticho,B., Ackerman,E. and Rabinowitz,M. (1981) J. Biol.

Chem., 256, 5226-5232.Locker,J. and Rabinowitz,M. (1981) Plasmid, 6, 302-314.Macino,G. and Tzagoloff,A. (1980) Cell, 20, 507-517.Macreadie,I.G., Novitski,C.E., Maxwell,R.J., Ulrik,J., Ooi,B.G., McMul-

len,G.L., Lukins,H.B., Linnane,A.W. and Nagley,P. (1983) NucleicAcidsRes., 11, 4435-4451.

Maniatis,T., Fritsch,E.F. and Sambrook,J. eds. (1982) Molecular Cloning:A Laboratory Manual, published by Cold Spring Harbor Laboratory Press,NY, pp. 90-91.

Merten,S., Synenki,R.M., Locker,J., Christianson,T. and Rabinowitz,M.(1980) Proc. NatI. Acad. Sci. USA, 77, 1417-1421.

Michel,F., Jacquier,A. and Dujon,B. (1982) Biochemie, 64, 867-881.Miller,D.C., Underbrink-Lyon,K., Najarian,D.R., Krupp,J. and Martin,

N.C. (1983) in Schweyen,R.J., Wolf,K. and Kaudewitz,F. (eds.), Mito-chondria 1983: Nucleo-Mitochondrial Interactions, De Gruyter, Berlin,pp. 151-164.

Montoya,J., Gaines,G.L. and Attardi,G. (1983) Cell, 34, 151-159.Netter,P., Jacq,C., Carignani,G. and Slonimski,P.P. (1982) Cell, 28, 733-

738.Nobrega,F.G. and Tzagoloff,A. (1980) J. Biol. Chem., 255, 9828-9837.Novitski,C.E., Macreadie,I.C., Maxwell,R.J., Lukins,H.B., Linnane,A.W.

and Nagley,P. (1984) Curr. Gent., 8, 135-146.Ohnishi,T., Kawaguchi,K. and Hagihara,B. (1966) J. Biol. Chem., 241,

1797-1806.Osinga,K.A. and Tabak,H.F. (1982) Nucleic Acids Res., 10, 3617-3626.Osinga,K.A., De Haan,M., Christianson,T. and Tabak,H.F. (1982) Nucleic

Acids Res., 10, 7993-8006.Osinga,K.A., Van der Bliek,A.M., Van der Horst,G., Groot Koerkamp,

M.J.A., Tabak,H.F., Veeneman,G.H. and Van Boom,J.H. (1983) NucleicAcids Res., 11, 8595-8608.

Schmelzer,C., Schmidt,C. and Schweyen,R.J. (1982) Nucleic Acids Res., 10,6797-6808.

Tabak,H.F., Osinga,K.A., De Vries,E., Van der Bliek,A.M., Van der Horst,G.T.J., Groot Koerkamp,M.J.A., Van der Horst,G., Zwarthoff,E.C. andMacDonald,M.E. (1983) in Schweyen,R.J., Wolf,K. and Kaudewitz,F.(eds.), Mitochondria 1983: Nucleo-Mitochondrial Interactions, De Gruyter,Berlin, pp. 79-93.

Thalenfeld,B.E. and Tzagoloff,A. (1980) J. Biol. Chem., 255, 6173-6180.Thalenfeld,B.E., Hill,J. and Tzagoloff,A. (1983) J. Biol. Chem., 258, 610-

615.Tzagoloff,A., Nobrega,M., Akai,A. and Macino,G. (1980) Curr. Genet., 2,

149-157.Van Etten,R.A., Bird,J.W. and Clayton,D.A. (1983) J. Biol. Chem., 258,

10104-10110.Van Omrnmen,G.J.B., Groot,G.S.P. and Grivell,L.A. (1979) Cell, 18, 511-523.Van Ommen,G.J.B., Boer,P.H., Groot,G.S.P., De Haan,M., Roosendaal,

E., Grivell,L.A., Haid,A. and Schweyen,R.J. (1980) Cell, 20, 173-183.Weiss-Brummer,B., Rodel,G., Schweyen,R.J. and Kaudewitz,F. (1982) Cell,

29, 527-536.Weiss-Brummer,B., Holl,J., Schweyen,R.J., Rodel,G. and Kaudewitz,F.

(1983) Cell, 33, 195-202.

Received on 29 December 1983

Note added in proof

Recent experiments show that the 5' end of the RNAs of -1100 nucleotides,which are derived from the intron of the 21S rRNA gene, do not extend intothe 5' exon. The work referred to throughout the text as Osinga et al., inpreparation has been published in Nucleic Acids Research, 12, 1889-1900,1984.

834