2012 Hofstra Men's Lacrosse Guide

2012 LACROSSE MEDIA GUIDE

COLE KOESTERER

MICHAEL HAMILTON

ZACH PALL

DAN PEZZOLLA

20

12

H

OF

ST

RA

L

AC

RO

SS

E

ME

DI

A

GU

ID

E

MIKE DENAPOLI

STEVE SERLING

BRAD LOIZEAUX

ANDREW GVOZDEN

2012 HOFSTRA MEN’S LACROSSE — 1

2012

LACROSS


2012 HOFSTRA LACROSSE QUICK FACTS2012 HOFSTRA LACROSSE QUICK FACTSLocation: Hempstead, New York 11549Founded: 1935Enrollment: 12,000Affi liation: NCAA Division IConference: Colonial Athletic AssociationNickname: Pride Colors: Gold, White and BlueHome Stadium (Capacity): James M. Shuart Stadium (13,000)

President: Stuart RabinowitzFaculty Athletics Representative: Dr. Michael BarnesDirector of Athletics: Jack HayesSenior Executive Associate Director of Athletics: Danny McCabeSenior Associate Director of Athletics: Cindy LewisSenior Associate Director of Athletics for Facilities: Jay ArtinianAssociate Director of Athletics for Communications: Stephen GorchovAssociate Director of Athletics for External Affairs: Tim McMahonAssociate Director of Athletics for Compliance: John HeckAssistant Director of Athletics for Development: Daniel SolowAssistant Director of Athletics for Corporate Relations: Ellen JohnsonAssistant Director of Athletics for Student-Athlete Development: Samantha SweeneyAssistant Director of Athletic Administration: Rachel AugustAssistant Director of Athletics for Marketing and Promotions: Chrissy ArnoneDirector of Ticket Sales: Michael NeelyDirector of Student-Athlete Services: James LallyAthletic Department Phone: (516) 463-3800/6750

Associate Director of Athletics for Communications: Stephen Gorchov Offi ce Phone: (516) 463-4933Senior Sports Information Director/Lacrosse Contact: Jim Sheehan Offi ce Phone: (516) 463-6764 Cell Phone: (516) 523-6692 Fax: (516) 463-5033 Email Address: [email protected] Assistant Director of Athletic Communications: Brian Bohl Offi ce Phone: (516) 463-6759Director of Athletic Publications: Len Skoros Offi ce Phone: (516) 463-4602Hofstra Lacrosse on the Web: www.GoHofstra.com

Head Athletic Trainer: Evan MalingsAthletic Trainer-Men’s Lacrosse: Rob SullivanEquipment Managers: Anthony Battaglia (MLAX) and Kathy TheilingAssistant Equipment Managers: Dave Walsh, John ConsidinePhotography: Brian Ballweg, Jim Sheehan, Charles Roy, Darl Zehr, Larry Cowder

Head Lacrosse Coach: Seth Tierney (Johns Hopkins, 1991) Record at Hofstra: 49-26/Five seasons Overall Record: Same Email: [email protected] Coach’s Phone: (516) 463-6484Lacrosse Offi ce Fax: (516) 463-3818Assistant Coach: Kevin Unterstein (Hofstra, 2008) Offi ce Phone: (516) 463-6629 Email: [email protected] Coach: J.P. Brazel (Hofstra, 2000) Offi ce Phone: (516) 463-6617 Email: [email protected] Coach: Sean Smith (Roanoke, 1983) Offi ce Phone: (516) 463-6484

Senior Assistant to the Men’s Lacrosse Coach: Cathy AullE-mail Address: [email protected] ce Phone: (516) 463-6484Fax: (516) 463-3818

2012 LACROSSE INFORMATIONPlayers Returning/Lost: 26/18Starters Returning: 5 (M-Brad Loizeaux, M-Ian Braddish, D-Cody Solaja, D- Corey Caputo, G-Andrew Gvozden)Starters Lost: 5 (A-Jay Card, A-Jamie Lincoln, A- Stephen Bentz, M-Kevin Ford, D-Mike Skudin)2012 Team Captains: Andrew Gvozden, Steve Serling2011 Record: 13-32011 CAA Record: 5-1 (First place, regular season)

2011 StatsKey Returnees Pos. Cl. G - A - Pts. GBIan Braddish M Jr. 16-17-33 9Adrian Sorichetti M Jr. 12-1-13 5Brad Loizeaux M Sr. 6-4-10 10Mike DeNapoli M Sr. 5-5-10 2Andrew Gvozden G Sr. 16 GP, 6.00 GAA

Table of ContentsQuick Facts ....................................................................................1Director of Athletics Welcome ......................................................2Cascade ..........................................................................................3Hofstra Highlights ..........................................................................4Game Day ......................................................................................6Hofstra in the Community .............................................................7HEADstrong ..................................................................................8Nick Colleluori Tribute ..................................................................9Alumni Refl ections ......................................................................10Head Coach Seth Tierney ............................................................12Assistant Coach Kevin Unterstein ...............................................14Assistant Coach J. P. Brazel ........................................................15Assistant Coach Sean Smith ........................................................16Assistant Strength and Conditioning Coach Jimmy Prendergast 17The Hofstra Hundred Club ...........................................................172012 Numerical Roster ................................................................182012 Alphabetical Roster .............................................................192012 Outlook ...............................................................................20Player Profi les ..............................................................................242012 Opponents ...........................................................................442012 Composite Schedule ............................................................46NCAA Lacrosse ...........................................................................48NCAA Quarterfi nals at Hofstra ...................................................49This is Hofstra University ............................................................50Hofstra President ..........................................................................52University Senior Administration ................................................53Hofstra Director of Athletics .......................................................54Hofstra Athletics ..........................................................................55Athletics Administrative Staff and Head Coaches .......................56Hofstra Heritage ...........................................................................58Hofstra Lacrosse Academic Plan .................................................60A Day in the Life of a Hofstra Lacrosse Player ...........................61Margiotta Hall ..............................................................................62James M. Shuart Stadium/Hofstra Indoor Practice Facility .........64Howdy Myers Pavilion ................................................................65Academic Support ........................................................................66Athletic Training ..........................................................................67Long Island and New York City ..................................................68The Program .................................................................................69The Colonial Athletic Association ...............................................702011 Statistics and Results...........................................................712011 Game Summaries ................................................................722011 Colonial Athletic Association Review ................................84All-Time Letterwinners ...............................................................86Hofstra Record Book ...................................................................90Hofstra Annual Leaders ...............................................................94Hofstra Lacrosse Award Winners ................................................96Hofstra Players in the Pro’s .......................................................100National Team Alumni ..............................................................102Coaching Alumni .......................................................................103Series Records ............................................................................104Yearly Records/Coaches Records ..............................................105All-Time Hofstra Lacrosse Results ............................................106Media Information .....................................................................114Warrior Lacrosse ........................................................................116

2 — 2012 HOFSTRA MEN’S LACROSSE

012

LACROSSE

It is my pleasure to welcome you to Hofstra University and the 2012 NCAA Division I Lacrosse season. We look forward to another exciting season under Head Lacrosse Coach Seth Tierney. Hofstra remains committed to achieving success at the highest levels, both in the classroom and on the fi eld.

Hofstra Lacrosse enters the 2012 season after a 13-win 2011 campaign that saw the Pride earn a fourth consecutive NCAA Tournament berth, marking the fi rst time in program history that the team went to the NCAA Tournament four years in a row. The 2011 season also saw the Pride play in the Warrior Classic at Rentschler Field, defeating Massachusetts in a nationally televised contest on ESPNU. The Pride boasted four All-Americans in seniors Jay Card and Mike Skudin, junior Andrew Gvozden and sophomore John Antoniades, while Skudin was also named the CAA Defensive Player of the Year and a USILA Scholar-All-American.

In 2012 Hofstra will once again face a challenging schedule that includes home contests against Notre Dame and Delaware, and games at Princeton, North Carolina and Massachusetts. The North Carolina game will be held at the 21,000-seast American Legion Memorial Stadium in Charlotte, which serves as the home of the Charlotte Hounds of Major League Lacrosse. The Massachusetts game will take place at Gillette Stadium, home of the New England Patriots of the NFL and the site of the 2012 NCAA Tournament Semifi nals and Championship game.

Off the fi eld, the lacrosse program was the recipient of a generous gift from alumnus and former All-American James C. Metzger ’83, who made a $1.5 million dollar commitment to establish an endowment for the program as well as support capital improvements for the entire Hofstra Athletics Department. It is the largest gift in the history of Hofstra Athletics. Over the past decade, Hofstra University and the Athletics Department have committed its resources to provide a fi rst-class experience for our student-athletes and the entire University community. The primary mission at Hofstra University is to educate our students and prepare them for their careers after college. In recent years the Athletics program has added an enhanced academic advisement program that includes the Fried Center for Student-Athlete Development and an upgraded tutorial program. In addition, we have initiated “Career Nights” where successful alumni, including many former student-athletes, return to campus to speak, both in group

and one-on-one formats, about how to embark on a professional career.

On the athletic side, our constant upgrade of athletic facilities, locker rooms, training areas and offi ces provide our student-athletes and our staff with the very best environment in which to prepare and perform. The men’s lacrosse program, which salutes past student-athletes with the Pride Victory Walk at the entrance of Shuart Stadium, recently completed a multi-phase project that will keep their Shuart

Stadium/Margiotta Hall facility among the best in the country. In 2007 FieldTurf was installed in Shuart Stadium allowing the Pride to compete and practice on the best and safest playing surface. New scoreboards in the north and south end zones further enhance the game day experience. Recently, the Pride locker room and lacrosse offi ces were completely renovated to provide a fi rst-class dressing room as well as welcome, meeting and working areas for both of our lacrosse programs. The athletic training area of Margiotta Hall was also refurbished to create a state-of-the-art facility for Hofstra’s sports medicine staff to treat student-athletes. In 2010 a Traditions Project, which pays tribute to the history of the lacrosse program, was completed.

As Hofstra enters its 64th season of lacrosse, we look back fondly on all of our previous achievements; 517 victories (one of only 17 programs in the nation with 500 or more wins); 17 conference championships; 17 trips to the NCAA Tournament, including four quarterfi nal appearances; 45 times ranked in the Top 20 nationally in the fi nal poll; and the many All-Americans, scholar-athletes, all-conference selections and North-South All-Star Game participants.

The beginning of a new season excites us all and I would like to thank all our alumni, parents and friends for their support of Hofstra Lacrosse. Our mission and goals remain the same - to provide our student-athletes with the resources to be successful on and off the fi eld. My best wishes to Coach Tierney, his staff and the 2012 Pride team for a successful season.

Enjoy the season,

Jack HayesDirector of Athletics

Enjoy the season,

Jack HayesDirector of Athletics

MESSAGE FROM THEMESSAGE FROM THEDIRECTOR OF ATHLETICSDIRECTOR OF ATHLETICS

4 — 2012 HOFSTRA MEN’S LACROSSE 4 — 2012 HOFSTRA MEN’S LACROSSE

Comedian Louis C.K. headlined the Out Loud portion of Hofstra’s 2011 Fall Festival

Rapper Rick Ross performs at the Vibe Live concert during Fall Festival

Salt-n-Pepa were also featured performers at Fall Festival

Legendary rappers Public Enemy performed at Hofstra in 2010

The Hofstra-North Shore LIJ School of Medicine welcomed its fi rst class this past July

A large crowd of students enjoyed the Vibe Live Concert at Hofstra

Rock and Roll Hall of Fame nominee Joan Jett and the Blackhearts were part of the Vibe Live Concert

2012 HOFSTRA MEN’S LACROSSE — 52012 HOFSTRA MEN’S LACROSSE — 5

HIGHLIGHTS

WRHU, Hofstra’s radio station, was recently rated the fi fth best college radio station in the nation by The Princeton Review

The Princeton Review recently named the Zarb School of Business one of its “Great Schools for Marketing and Sales Majors”

Taking Back Sunday rocked the crowd during 2011 Fall Festival

Hofstra is just 25 miles from New York City


GAME GAME DAYDAY


HOFSTRA IN THE COMMUNITYHOFSTRA IN THE COMMUNITYThe Hofstra Men’s Lacrosse team lends a great deal of time to the Long Island community. The team frequently conducts lacrosse clinics for special needs children, as well as participating in events to aid the homeless, including the Have a Heart for the Homeless Candlelight Vigil sponsored by the Long Island Coalition for the Homeless (LICH). The Pride was helped set-up, sort and pack clothes and goods for both individuals and homeless shelters. Each holiday season, the Pride participates in Holiday Magic, a program that Coach Tierney initiated while he was at Johns Hopkins and brought with him to Hofstra. The team helps collect, wrap and distribute toys to underprivileged children, providing a bit of joy to those in need.

Hofstra is also actively involved in the fi ght against blood cancer

through the HEADstrong Foundation, which was founded by Nick Colleluori before his passing as a result of Non-Hodgkin’s Lymphoma. The team has raised awareness and a great deal of funds through the sales of “Relentless” t-shirts and lime green shoelaces. Each year the team participates in the Nick Colleluori Classic at Ridley High School in Pennsylvania, which serves as the organization’s biggest fundraiser.

Junior Jordan Fried also helped raise money for cancer research as part of Fred’s Team at the New York City Marathon. Fried, who is a leukemia survivor, completed the marathon in both 2010 and 2011.

The team also raises money for the Stephen Siller Children’s Foundation by competing in the Tunnel to Towers Run/Walk in honor of Firefi ghter Stephen Siller, who lost his life September 11, 2001.

The team is also involved with a variety of initiatives with Hofstra’s Student-

Athlete Advisory Committee (SAAC), including reading programs at local schools, a gift

card donation program during the holidays, the Special Olympics and Long Island Cares Holiday food drives.

The team has also joined with the Friends of Jaclyn Foundation and has “adopted” Dylan Beach. Team members and coaches spend time with Dylan and welcome him to home games.

2012

LACROSS


Nick Colleluori, who would have been part of the class of 2008, fought a “relentless” battle against Non-Hodgkin’s Lymphoma, and while Nick lost his battle on November 28, 2006, his vision has just begun.

The HEADstrong Foundation is dedicated to Nick’s life. During his 14-month battle, which included chemotherapy, a stem-cell transplant and extensive radiation treatment, it was Nick’s vision to establish this foundation to raise awareness and help others affected by this disease. He drew the logo as he was waiting to go into the operating room for a procedure. Because lacrosse was his passion and he can no longer carry the ball, his family and friends will carry the ball for him.

NICK COLLELUORI HEADSTRONG NICK COLLELUORI HEADSTRONG FOUNDATIONFOUNDATION

HEADSTRONG FOUNDATION HEADSTRONG FOUNDATION NICK COLLELUORI MEMO-NICK COLLELUORI MEMO-RIAL CLASSICRIAL CLASSIC

The Pride compete in the annual HEADstrong Foundation Nick Colleluori Memorial Classic at Ridley High School in Folsom, Pennsylvania. The underlying thread of the tournament is lacrosse, but the real theme is helping those in need. Since the Classic started in 2007, more than $700,000 has been raised for the Foundation, including $165,000 at the 2011 event.

For more information on Nick Colleluori and the HEADstrong Foundation, please visit www.HEADstrongfoundation.org

“Make use of the time you have & don’t stress the little things. Have a smile and enjoy what you can get out of life.”

- Nick Colleluori

NICK COLLELUORI TRIBUTENICK COLLELUORI TRIBUTE

Rather than retire the jersey of Nick Colleluori, the men’s lacrosse program decided to honor Nick by assigning the number to a deserving senior each year. Hofstra is determined to keep Nick’s memory and his mission alive by educating new players on his life and the inspiration he provide to the team.

“Wearing number 27 is both an opportunity and a responsibility. It has given me an opportunity to pay tribute

not only to Nick Colleluori and his family, but also the players who honored Nick before me, and all of those who continue to honor him today. The number has also given

me the responsibility to follow the lessons Nick has taught on and off the fi eld. Wearing the number 27 is the highest honor I will ever receive as a Hofstra Lacrosse player.”

Cole Koesterer


Previous #27 Jersey Recipients2010 Adam Swarsen2011 Steven DeNapoli 2

012

LACROSS


ALUMNI REFLECTIONSALUMNI REFLECTIONS

Like many kids growing up on Long Island I was introduced to the game of lacrosse at an early age. There were many people in my hometown of Bethpage who infl uenced my decision to work hard toward the goal of playing lacrosse at the college level. My high school coach, the late Fran McCall, took special interest in me and for that I am forever grateful. With his direction throughout middle school and high school he encouraged me to work hard, study the game and attend as many college games as possible. Many of the games I attended were at Hofstra. He helped me recognize that I had the athletic ability to play at the Division I level. By my senior year in high school I wanted nothing more than to play college lacrosse. Coach McCall coordinated the recruitment process, introduced me to Hofstra Coach Harry Royle and before I knew it I was on my way. Thirty-plus years later, I still enjoy the game as much as ever and I am proud to have worn the Hofstra blue and gold.

Although the years playing college lacrosse went by too fast, the friends and relationships I’ve made and the experiences I’ve shared will last a lifetime. My coaches,

teammates and alumni friends have infl uenced my life in so many ways. There is a unique and special bond within the Hofstra lacrosse family. In the years since my playing days I have remained close to Hofstra lacrosse and active within the Long Island lacrosse community. Attending Hofstra games and events over the years keeps me connected with former teammates and other alums. Socially and professionally these are the people I share my life with. I am able to hold onto the game I love and interact with the many friends I have made along the way.

There were many memorable times during my playing days as a Dutchmen. My senior year (1983) we were ranked 9th in the country at one point and fi nished the season with a respectable 9-5 record. Joe Fowler and I were selected as All American’s that year and I represented Hofstra in the North-South All Star game. One unforgettable game goes back to my freshman year (1980). That season I was fortunate to have played with great players like Vinny Sombrotto, Kevin Smith, Ed Wallace, Gary Arnold, and some guy named Jim Metzger. It was the last game of the season for both teams and Washington & Lee, highly ranked at the time, came up to Hempstead to play a hot Hofstra team who had just knocked off North Carolina State. W&L led most of the way but we somehow found a way to tie the game and force sudden death overtime. We won 7-6. I threw in 3 goals, including the winner in OT… all assisted by that guy Metzger. It’s funny how things happen in life. The game and the season end and then 28 years fl y by. Then somehow you reconnect with a teammate who throws you another assist as I’ve been working with Jim Metzger for the last several years.

Hofstra Lacrosse has been and will continue to be part of who I am. I attribute my success in my personal life and business life to all that I learned as an athlete in college.

I look forward to each new Hofstra Lacrosse season as if I were playing again. Each spring when I walk into that stadium for the fi rst home opener I feel like I’m part of the team.

Thank you to all the former and current coaches and to the entire athletic department for bringing Hofstra Lacrosse to the level it is today. The best is yet to come. Good luck to this years team! Go Pride!

Bob Quinlan, 1983012

LACROSSE


ALUMNI REFLECTIONSALUMNI REFLECTIONS

In the fall of 2006 when I arrived at Hofstra University, I remember being nervous and anxious to begin a new chapter of my life. Being greeted outside of Margiotta Hall by 45 new teammates, who are now like my brothers, is something I will never forget. It took me only a few hours to realize that Hofstra was a very special place. I was fortunate enough to be a member of the Hofstra Men’s Lacrosse team from 2006-10. The work ethic that was immediately demanded of me was a bit overwhelming at fi rst but at the same time, it was only preparing me for the rest of my life. At Hofstra, having a relentless pursuit of excellence on and off the fi eld is certainly required. We won games on the fi eld because it was the little things we did off the fi eld and in the classroom. In my four years there, expectations were always high. As great as it was winning a CAA championship and always being ranked in the top 10, achieving a cumulative team GPA of a 3.0 or better was something that always stood out to us.

Having a relentless attitude to achieve above expectations both on and off the fi eld was imperative. Hofstra wins games because their athletes are taught from day one to out work their opponents. This type of attitude has had a tremendous impact on my life, especially after I graduated. I currently work in fi nance for a fi rm that demands perfection. I can’t emphasize enough how prepared I was on my fi rst day because of the values that were instilled in me while at Hofstra. Waking up at 5 a.m. to be the fi rst one in the offi ce is not tough when I think of my boys who are probably in Shuart Stadium at that time for their early morning workouts. Playing lacrosse for the Pride has certainly made life in the ‘real world’ a lot easier. Student-athletes live very different lives than regular students. Since 2006, my teammates and I had a full-time job playing for a top tier program while achieving in the classroom at the same time. When I started working in June of 2010, I felt that I was a step above everyone when it came to working hard and effi ciently. Doing things the right way, the fi rst time, was something we lived by at Hofstra and this mind-set has not failed me yet. I can honestly say my four years in Hempstead were the four most memorable years of my life. The people I met, the challenges I faced and obstacles that we as a team overcame, has propelled me into the real world with the utmost confi dence. The friendships I made at Hofstra University will most certainly last a lifetime, as we still talk everyday and refl ect back on our time spent together. I remember Coach Tierney telling me my freshman year that my time spent at Hofstra would be the fastest four years of my life. It was not that I didn’t believe him; it was that I did not want him to be right. He was right. My teammates and I grew up extremely fast. We all left Hofstra with a mind-set that has pushed us to be great at whatever the next chapter in our lives leads us to. A strong belief that we fi nd ourselves frequently reminding each other is ‘if it was easy then everyone would do it...’ something we all learned on our fi rst day at Hofstra University.

Tom Interlicchio, 2010

2012

LACROSS

e

t

t


HEAD MEN’S LACROSSE COACH

Seth Tierney became the fi fth head coach in the history of the Hofstra Men’s Lacrosse program when he was hired to the position in August 2006. Entering his sixth season in 2012, Tierney has led the Pride to 49 victories, the 2008 Colonial Athletic Association championship, the 2009 and 2011 CAA regular season titles and berths in four consecutive NCAA Championships from 2008 through 2011.

Tierney served as an assistant coach at Hofstra from 1995 through 2000 before leaving for a similar position at his alma

mater Johns Hopkins University. During his six-year tenure with the Pride, Hofstra recorded six consecutive winning seasons with a combined overall record of 61-28 and a conference mark of 29-2, captured fi ve league titles, received fi ve top 15 fi nal national rankings, and played in four NCAA Championship tournaments.

Tierney also coached seven All-Americans and nearly two-dozen all-conference players during his fi rst tenure at Hofstra. Among them was midfi elder Doug Shanahan, who would receive the inaugural Tewaaraton Trophy as College Lacrosse Player of the Year, the Lt. Ray Enners Award as the Division I Player of the Year, and the Lt. Donald McLaughlin Award as the Division I Midfi elder of the Year in 2001.

“During our search, we had the privilege of meeting many outstanding candidates including several former Pride assistants,” Hofstra Director of Athletics Jack Hayes said. “Although all of them had exceptional and unique plans for Hofstra Lacrosse, Seth Tierney’s presentation displayed the enthusiasm, intensity and passion that we were looking for. We are committed to assisting him move the program into the elite level of college lacrosse.”

Last season, the Pride enjoyed great success, both on the fi eld and in the classroom. Hofstra recorded a 13-3 record, captured the CAA regular season title and earned its school record-breaking fourth consecutive bid to the NCAA Championship. In addition, the Pride had four players – Jay Card, Mike Skudin, Andrew Gvozden and John Antoniades – earn USILA All-America honors. Card, Skudin, Antoniades, Ian Braddish and Adam Mojica were named to the All-CAA fi rst team while Gvozden, Steven DeNapoli and Jamie Lincoln were voted to the second team. Skudin, who was selected the CAA Defensive Player of the Year, also earned USILA Scholar All-American and CAA Men’s Lacrosse Scholar-Athlete of the Year honors. To close out the year, Skudin, DeNapoli and Card were named to the North-South Senior All-Star Game with DeNapoli leading all goal scorers in the

contest with three.

In 2010, the Pride made its third consecutive trip to the NCAA Championship and fi nished the year with a 9-5 record. Hofstra had two players named to the USILA All-America team, fi ve named to the All-CAA team and two more named to the CAA All-Rookie Team. In 2009, Tierney directed the Pride to an 11-4 overall, a 6-0 mark during the CAA regular season and his second NCAA Championship bid. Five Hofstra players were named to the All-CAA Teams, including fi rst team selection Jay Card, who was voted the CAA Player of the Year. In addition, four Pride players were named to the USILA All-America team and one was voted to the USILA Scholar-Athlete All-America Team. For his efforts, Tierney was named the CAA co-Coach of the Year.

SETH TIERNEY012

LACROSSE

SE

e r

th th 9-

s.

d ew Gvo de d Jo o des e USAmerica honors. Card, Skudin, Antoniades, Ian Braddish and Adam Mojica were named to the All-CAA fi rst team while Gvozden, Steven DeNapoli and Jamie Lincoln were voted to the second team. Skudin, who was selected the CAA Defensive Player of the Year, also earned USILA Scholar AlAll-l-l AmAmAmmmererericicicananan and CAA Men’s Lacrosse Scholar-Athlete of the Year honors. To close out the year, Skudin, DeNapoli and Card were named ttttooooothe North-South Senior All-Star Game wwwwiititiitittttttthhhh h hhhhhh h h DeNapoli leading all goal scorers in theee

contest with three.

In 2010, the Pride made its third consecutive trip to the NCAA Championship and fi nished the yeyeararar with a 9-5 record. Hofstra hadd tttwwwowwowowowooooo players named to the USILAAA AAAAAAAAAAllllllllllllllllll----America team, fi ve nameddd ttttoo oo o othe All-CAA team and twwwooo more named to the CAAAAAll-Rookie Team. In 20202000909099909909,,Tierney directed the Prririiiddddeeedede to an 11-4 overall, a 6--6-00 00 0 0mark during the CAAAA A regular season and his second NCAA Championship biddd.. Five Hofstra playyyeyeeerrrrrsssrrsrss were named to thhhheee ee All-CAA Teammssss,,,, including fi rst team selectionnn Jay Card, whhhoooooowas voted thththheeeeeeeCAA Playyeeeerrrr of the Yeaaarr...r IIIIInnnnnn n nn addition, fofofoouuurururrruuuuaddition, fofooouuuuurrrrrr Pride playeererrss s ssswere nameddd to the USILAAAAAA All-America team and one wwwasassssaa voted to the USILALAAA SSSSSSSSSSchhhchchhchchchcchch llolooololollararrrararrarar-Athlete All-America TeTeT ammam. FFoFooooFFooFF rrrr rrhis efforts, Tierney was nammmeeeeddddddddd the CAA co-Coach of the YYeYeeeeeaaaarrrrrrraa ..


The 2008 season saw Hofstra make a return to the NCAA Tournament after a one-year hiatus. The team posted a 10-6 record and won the CAA title in a thrilling overtime win over Drexel. Leading scorer Anthony Muscarella was named an honorable mention All-American, while Kevin Unterstein was the CAA Defensive Player of the Year and Jay Card earned CAA Rookie of the Year accolades. In addition, seven players received All-CAA honors and the Unterstein brothers, Kevin and Michael, were named North-South Game All-Stars and were both selected in the Major League Lacrosse Draft.

In his fi rst year at the helm of the Hofstra program, Tierney took over a team that returned one starter from 2006’s NCAA Quarterfi nal squad and led them to a 6-8 record that saw seven losses decided by one goal. The team qualifi ed for the CAA Championship, saw one of its star players - Kevin Unterstein - earn honorable mention All-America honors and had seven players named to All-CAA teams, including three All-Rookie selections.

Tierney returned to Hofstra after a six-year tenure at John Hopkins, with the fi nal two seasons as associate head coach. As the Blue Jays offensive coordinator, he was the architect of one of the most potent and explosive offenses in the nation in recent years. Tierney

directed the Blue Jays attack that fi nished second in the nation in scoring margin, sixth in scoring offense and 16th in man-up offense during Hopkins’ NCAA title run in 2005. The Blue Jays led the nation in scoring offense and man-up offense in 2003 and fi nished fi fth in both categories in 2004.

In Tierney’s fi nal season at Hopkins the Blue Jays posted a 9-5 record, advanced to the NCAA Championship quarterfi nals, and ranked in the top 15 in the country in four statistical categories. With an emphasis on a balanced attack that puts pressure on the opposition at every position, individual awards have been

plentiful at Hopkins. A total of 21 Blue Jay midfi elders and attackmen earned All-America honors during Tierney’s tenure in Homewood. Among them was Kyle Harrison, a two-time fi rst team All-America, who received the Tewaaraton Trophy and the Lt. Enners Award in 2005 and the McLaughlin Award in 2004 and 2005.

Tierney played for the Blue Jays from 1988 through 1991 and served as team captain as a senior. He helped lead Hopkins to the NCAA Tournament in each of his four seasons, including an appearance in the 1989 NCAA title game. He received Hopkins’ Turnbull-Reynolds Award as a senior as the player most exemplifying leadership and sportsmanship. Tierney was also selected to play in the North-South game as a senior.

After graduating from Johns Hopkins, Tierney continued his playing career by playing three seasons of indoor lacrosse for the New York Saints before serving as an assistant coach for the Saints for two seasons.

Tierney and his wife, Maureen, have two children - a son, Ryan (13), and a daughter, Erin (11). The Tierney family resides in Massapequa, New York.

2012

LACROSS

seven playerto All-CAA tincluding thrselections.

Tierney returHofstra aftertenure at Johwith the fi nalas associate hAs the Blue Jcoordinator, architect of omost potent aoffenses in thin recent yea


ASSISTANT COACHASSISTANT COACH

Kevin Unterstein, who served as an assistant coach under Bill Tierney at both Princeton in 2009 and Denver in 2010, is entering his second season on the Hofstra Pride men’s lacrosse staff in 2012.

A 2008 graduate of Hofstra with a degree in sociology, Unterstein enjoyed a stellar playing career as a short-stick defensive middie from 2005 through 2008. As a senior he recorded

a team-leading 70 ground balls while helping to guide the Pride to

the Colonial Athletic Association title and the NCAA Tournament. For his efforts, he was an All-CAA fi rst team selection, and was named the CAA Defensive Player of the Year, and the CAA Championship Tournament Most Valuable Player.

In 2007 as a junior, Unterstein earned USILA All-American honorable mention honors, and was named to the All-CAA second team as well as the All-CAA Tournament team. As a sophomore in 2006, Kevin, his twin brother Mike, and their older brother Chris combined to help lead Hofstra to a 17-2 record, a No. 2 national ranking and a No. 3 seed in the NCAA tournament. He was also named to the All-CAA Rookie Team as a freshman.

Following graduation in 2008, he became an assistant under Bill Tierney at Princeton, working with the defense and face-off specialists. He would follow Tierney to Denver to help coordinate the Pioneers’ man-down unit and work specifi cally with the defensive midfi elders and work with assistant coach Trevor Tierney with the defense and the overall face-off game.

A native of Shoreham, N.Y., he was a high school All-American at Shoreham-Wading River High, where he was part of four Suffolk County championships and one state championship.

Unterstein married the former Melissa Orlando last October. The Untersteins reside in North Babylon, New York.

KEVIN UNTERSTEIN012

LACROSSE


ASSISTANT COACHASSISTANT COACH

The Hofstra Athletics Department announced this past December that James C. Metzger ’83, had committed $1.5 million to support Hofstra Athletics. Metzger’s leadership support marks the largest gift in the history of Hofstra Athletics. Metzger, a men’s lacrosse All-American in 1980 and a current member of the Pride Club board of directors, has generously supported Hofstra Athletics since reconnecting with the University in 2007. His contribution will establish a men’s lacrosse program endowment as well as support the capital improvement fund, which benefi ts all 17 sports.

“Jim’s generosity to Hofstra Athletics in recent years has helped to elevate the men and women’s lacrosse programs to an elite level,” noted Director of

Athletics Jack Hayes. “This most recent and generous gift will provide long term support for the program he represented as a student-athlete as well as fund important facility projects and improvements that will directly impact all of our student-athletes.” Metzger’s seven-fi gure funding will not only provide signifi cant support for the athletics programs but also serve as yet another positive step forward in the University’s ongoing efforts to bolster major gift support from alumni, parents and friends in order to continue to provide a fi rst-class educational experience for its students.

J.P. BRAZEL

FORMER LACROSSE ALL-AMERICAN JAMES C. METZGER ‘83 MAKES FORMER LACROSSE ALL-AMERICAN JAMES C. METZGER ‘83 MAKES LARGEST COMMITMENT IN HOFSTRA ATHLETICS HISTORYLARGEST COMMITMENT IN HOFSTRA ATHLETICS HISTORY

Hofstra alumnus J.P. Brazel is in his fi rst season on the Pride coaching staff in 2011-12.

A former goalie at Hofstra during the 2001 and 2002 seasons, Brazel returns to Hofstra after serving as an assistant coach under head coach Bob Shillinglaw at Colonial Athletic Association-foe Delaware during the 2010-11 academic year. While with the Blue Hens, he served as an offensive assistant coach, and coached the Delaware goalies as

well as the team’s attack unit. He coached four All-CAA players and one USILA All-America selection as the Blue Hens won the CAA Championship and advanced to the NCAA Championship Tournament..

Prior to coaching at Delaware, Brazel spent three seasons (2007-10) at Sacred Heart University in Fairfi eld, Connecticut. While at Sacred Heart, Brazel’s duties included coaching goaltenders, coordinating the team’s defense and man-down unit, recruiting, monitoring academic progress and assisting head coach Tom Mariano with all other day-to-day lacrosse operations. During his tenure at Sacred Heart, Brazel coached three All-Colonial Athletic Association defenders in addition to coaching the programs

goaltenders to top 15 national rankings in save percentage and top two national rankings in saves per game in 2009 and 2010.

Brazel began his Division I coaching career during the 2006-07 year at Manhattan College in Riverdale, New York. He served as offensive coordinator and goalie coach at Manhattan under Head Lacrosse Coach Tim McIntee. Under his assistance, the Jaspers made a jump of more than three goals per game during the 2007 season.

Brazel began his college coaching career as an assistant coach under Rich Speckmann from 2003 to 2006 at Nassau Community College. While at Nassau, Brazel guided the development of the team’s goaltenders and defensive units as well as working with the team’s face-off specialists. He helped lead the school to the NJCAA semifi nals and regional championship in both 2003 and 2004. During his tenure at Nassau, Brazel coached seven NJCAA All-American defenders as well as a two-time All-American goalie.

Nassau was also the start of Brazel’s college academic and athletic career. In 1999, Brazel earned National Junior College Athletic Association All-American and NJCAA Goalie of the Year while helping the Lions to NJCAA national title. As a freshman in 1998, he was a member of Nassau’s NJCAA semifi nal team.

Brazel then moved on to Hofstra and was part of the Pride’s NCAA Tournament appearances in 2000 and 2001, and was a member of the second highest ranked team in Hofstra history in 2002.

An active speaker, Brazel has presented at both the U.S. Intercollegiate Men’s Lacrosse Coaches Association and Connecticut High School Coaches conventions during the last two years.

Brazel, who holds a degree in psychology from Hofstra, resides in Massapequa, New York, with his wife, Jenna.

2012

LACROSS


ASSISTANT COACH

SEAN SMITHSean Smith is entering his 14th season on the Hofstra Lacrosse coaching staff in 2012. Smith, who came to Hofstra from Division Avenue High School in Levittown, New York, served on John Danowski’s coaching staff from 1998 through 2006 and returned to Seth Tierney’s staff for the 2008 season.

During his Hofstra coaching career, Smith helped develop 2001 Tewaaraton Trophy

recipient Doug Shanahan, who also won National Player of the Year and National Midfi elder of the Year accolades as well. He has also coached 53 all-conference players, seven conference players and rookies of the year, 25 All-Americans and 25 North-South All-Stars. Two of those all-stars, Doug Shanahan and Brett Moyer, went on to win MVP honors at the North-South All-Star Game. In 2006 Smith directed Tewaaraton Trophy fi nalist Chris Unterstein and helped the Pride to a berth in the NCAA Quarterfi nals. In is 13 years with the program Smith has also seen eight players go on to earn USILA Scholar All-America honors.

Smith began his coaching career in 1985 when he served as an assistant coach at Ohio Wesleyan University. While at Ohio Wesleyan, Smith also served as a physical education instructor, intramural director and ticket manager. In 1987 he joined the lacrosse staff at Army as an assistant and coached the Cadets from 1987 through 1990. Smith also served as a physical education instructor while at Army. He served as the varsity head lacrosse coach and the junior varsity head football coach at Division Avenue from 1990 to 1997. In addition to his Hofstra coaching duties, Smith is currently a teacher and assistant football coach in the Levittown School District.

As a player at Roanoke College, Smith was named to the USILA Division III All-American team in 1982 and 1983. He tallied 50 goals in 1981 and 51 in 1982. Smith concluded his college career as Roanoke’s career leader and is currently second with 145 goals. He also ranks seventh in career scoring with 208 points and in the top 15 in career assists with 63. In 1996 Smith was inducted into the Roanoke College Athletic Hall of Fame.

Smith holds a bachelor’s degree in physical education from Roanoke College, a master’s degree from the State University of New York at Stony Brook and a postgraduate degree in educational administration from Hofstra. Smith and his wife, Carol, have three children - J.P. (19), Brendan (18) and Conor (14). The Smith family resides in West Islip, New York.


012

LACROSSE


2012

LACROSS


ASSISTANT STRENGTH AND ASSISTANT STRENGTH AND CONDITIONING COACHCONDITIONING COACH

James Prendergast is in his third season as an assistant strength and conditioning coach at Hofstra University. Prendergast began his career at Hofstra as an intern on the strength and conditioning staff and moved into his current role in January 2010 and works primarily with the Pride’s men and women’s lacrosse programs.

In his day-to-day work with the lacrosse teams, Prendergast administers

drills for speed, agility and fl exibility in addition to instructing the student-athletes on proper technique and form during weight training.

Prior to joining the Hofstra staff, Prendergast served as a student personal trainer through the Hofstra Recreation Center during the 2008-09 academic year. In 2007-08 he completed a 200-hour internship at Institute 3e, an elite sports performance facility, in Huntington, New York.

Prendergast has also been a private strength coach to numerous athletes on Long Island.

A certifi ed strength and conditioning specialist, Prendergast is also certifi ed by USA Weightlifting and is a member of the National Strength and Conditioning and Collegiate Strength and Conditioning Associations. He also holds American Red Cross CPR and AED certifi cation.

A 2009 graduate of Hofstra, Prendergast was an exercise specialist major and minored in community health and psychology. He resides in Syosset, New York.

JAMES PRENDERGAST

2011 HOFSTRA HUNDRED CLUBThe “Hofstra Hundred Club” is a fund-raising initiative for the men’s lacrosse program under the umbrella of the Hofstra Pride Club. Each member of this elite club is asked to donate $100 for each victory earned. All contributors to this program will be recognized as Hofstra Pride Club members and will receive all benefi ts afforded to them through the Hofstra Pride Club. Besides supporting the members of the Pride lacrosse team both on and off the fi eld, these generous donations will allow Hofstra Lacrosse the opportunity to continue to operate in a fi rst-class manner, while setting a new standard for a Division I lacrosse program.

The Hofstra Men’s Lacrosse program would like to thank the Hofstra Hundred Club members and our generous contributors. With your support we have the resources and ability to do the ‘little things’ that make a big difference for our lacrosse program.

A special thanks to the following 2010-11 Hofstra Hundred Club members:

If you are interested in joining the Hofstra Hundred Club, please call our offi ce at 516-463-6484, or send us an email at [email protected].

Gary & Rose BarthStephen & Christine BentzPJ BjornebyKevin & Basia BraddishCarl & Jeanne CaputoJoe CarrelloRobert DallPeter DanteLou DiBlasiDotson FamilyDoug EdmondsGerry FayTom & Diane Ferry

Ed FineganJoseph FowlerDr. Arno FriedDr. Mindy FriedJeff FroccaroJohn FroccaroMichael GrecoDavid GreenbergMartin GreenbergDoug HallChris HeinGreg HeinTom Holman

Bob LearyRenee LearyGeorge LorosTony & Carole MazzarellaJames C. MetzgerJohn MichieliniBill MillerWilliam MunckTom & Sue NunziataRobert ParrinelliAnthony and Catharine PerettineBob Quinlan

Michael RiciglianoSteve and Kristen RiellyRobert SerlingJohn & Diane SkudinAdam SnyderBill & Kathleen StanleyJay SullivanTom TierneyPat TierneyOwen WalshDave WoycikDr Allen Zagoren

012

LACROSSE


2012 HOFSTRA MEN’S LACROSSE 2012 HOFSTRA MEN’S LACROSSE NUMERICAL ROSTERNUMERICAL ROSTER

No First Last Pos. Ht. Wt. Cl. Hometown High School

1 Brad Loizeaux M 6-0 190 SR Mullica Hill, NJ The Tatnall School

2 Lance Yapor A 5-11 180 SO Glenview, IL Glenbrook (IL)/Salisbury (CT)

3 Tyler Johnston A 5-8 170 FR Morton, PA Ridley

4 Steve Romano M 6-1 190 FR Massapequa, NY Massapequa

5 Steve Serling M 6-0 180 GR Rockville Centre, NY South Side

6 Dan Pezzolla M 5-10 185 SR Endicott, NY Union Endicott

7 Jordan Fried A 5-9 155 JR Chappaqua, NY Horace Greeley

8 Mike Malave M 5-11 180 FR Wading River, NY Shoreham-Wading River

9 Mike DeNapoli M 6-1 220 SR Lynbrook, NY Lynbrook

11 Ryan Quinn M 6-0 190 JR Gansevoort, NY Saratoga Springs

12 Drew Coholan M 5-10 175 JR Rochester, NY Irondequoit

13 Aaron Jones M 5-10 190 JR Fairport, NY Fairport

14 Tyler Begley A 6-2 195 FR East Islip, NY East Islip

15 Kevin Leary D 5-11 185 SO Guilford, CT Guilford

16 Chris Howell LSM 6-0 190 FR Bethlehem, PA The Hill School

17 Torin Varn A 6-2 175 SO Ithaca, NY Ithaca

18 Andrew Gvozden G 6-1 180 SR Millersville, MD Severna Park

19 Zachary Pall M 5-11 170 SR Setauket, NY Ward Melville

20 Guiliano Bove D 6-2 180 FR Garden City, NY H. Frank Carey

21 Brian Hogan D 6-3 200 GR West Islip, NY West Islip

22 Stephen DiGiovanni M 6-0 205 SO Cranford, NJ Cranford

23 Corey Caputo D 5-11 165 SO Stamford, CT Darien

24 Cody Solaja D 5-11 200 JR Dallas, TX Episcopal School of Dallas

25 Mark Mullen D 6-3 195 JR Harleysville, PA Germantown Academy

27 Coleman Koesterer LSM 6-1 200 SR Manhattan Beach, CA Cazenovia

28 Ryan O’Leary A 6-0 171 JR East Meadow, NY St. Anthony’s

29 Jack Moorehead D 6-0 225 SO East Northport, NY John Glenn

30 Sal Tuttle A 6-0 180 FR Massapequa Park, NY Farmingdale

31 Rob Bellairs LSM 6-0 175 JR N. Massapequa, NY Plainedge

32 Michael Hamilton D 6-0 225 JR Brighton, MI Brother Rice

33 Chris Selva G 5-9 160 FR Parkland, FL St. Thomas Aquinas

34 A.J. Leary M 5-11 177 SO Guilford, CT Guilford

37 Thomas Passenant D 5-11 180 FR Charlotte, NC Charlotte Country Day

39 John Reicherter M 6-2 180 FR Wantagh, NY Wantagh

40 Graham Horvath A 5-10 175 SO Essex Fells, NJ Seton Hall Prep

41 Anthony Zappone M 5-9 160 SO Ballston Lake, NY Shenendehowa

42 John Antoniades M/FO 5-9 165 JR Hauppauge, NY St. Anthony’s

43 Ian Braddish M 6-2 185 JR West Islip, NY West Islip

44 Rob Moore M 6-1 210 SO West Islip, NY West Islip

45 Korey Hendrickson M 5-7 175 FR Farmingdale, NY Farmingdale

47 Jackson Meyers D 6-1 180 FR Annapolis, MD Arundel

49 Ryan Brant G 5-11 190 JR Edgewater, MD DeMatha Catholic

50 Ryan Rielly LSM 5-11 180 FR East Northport, NY John Glenn

77 Adrian Sorichetti M 6-0 200 JR Whitby, ON, Canada All Saints/Trinity-Pawling

Head Coach: Seth Tierney

Assistant Coaches: Kevin Unterstein, J.P. Brazel and Sean Smith


2012

LACROSS


2012 HOFSTRA MEN’S LACROSSE 2012 HOFSTRA MEN’S LACROSSE ALPHABETICAL ROSTERALPHABETICAL ROSTER

No First Last Pos. Ht. Wt. Cl. Hometown High School42 John Antoniades M/FO 5-9 165 JR Hauppauge, NY St. Anthony’s

14 Tyler Begley A 6-2 195 FR East Islip, NY East Islip

31 Rob Bellairs LSM 6-0 175 JR N. Massapequa, NY Plainedge

20 Guiliano Bove D 6-2 180 FR Garden City, NY H. Frank Carey

43 Ian Braddish M 6-2 185 JR West Islip, NY West Islip

49 Ryan Brant G 5-11 190 JR Edgewater, MD DeMatha Catholic

23 Corey Caputo D 5-11 165 SO Stamford, CT Darien

12 Drew Coholan M 5-10 175 JR Rochester, NY Irondequoit

9 Mike DeNapoli M 6-1 220 SR Lynbrook, NY Lynbrook

22 Stephen DiGiovanni M 6-0 205 SO Cranford, NJ Cranford

7 Jordan Fried A 5-9 155 JR Chappaqua, NY Horace Greeley

18 Andrew Gvozden G 6-1 180 SR Millersville, MD Severna Park

32 Michael Hamilton D 6-0 225 JR Brighton, MI Brother Rice

45 Korey Hendrickson M 5-7 175 FR Farmingdale, NY Farmingdale

21 Brian Hogan D 6-3 200 GR West Islip, NY West Islip

40 Graham Horvath A 5-10 175 SO Essex Fells, NJ Seton Hall Prep

16 Chris Howell LSM 6-0 190 FR Bethlehem, PA The Hill School

3 Tyler Johnston A 5-8 170 FR Morton, PA Ridley

13 Aaron Jones M 5-10 190 JR Fairport, NY Fairport

27 Coleman Koesterer LSM 6-1 200 SR Manhattan Beach, CA Cazenovia

34 A.J. Leary M 5-11 177 SO Guilford, CT Guilford

15 Kevin Leary D 5-11 185 SO Guilford, CT Guilford

1 Brad Loizeaux M 6-0 190 SR Mullica Hill, NJ The Tatnall School

8 Mike Malave M 5-11 180 FR Wading River, NY Shoreham-Wading River

44 Rob Moore M 6-1 210 SO West Islip, NY West Islip

29 Jack Moorehead D 6-0 225 SO East Northport, NY John Glenn

25 Mark Mullen D 6-3 195 JR Harleysville, PA Germantown Academy

47 Jackson Meyers D 6-1 180 FR Annapolis, MD Arundel

28 Ryan O’Leary A 6-0 171 JR East Meadow, NY St. Anthony’s

19 Zachary Pall M 5-11 170 SR Setauket, NY Ward Melville

37 Thomas Passenant D 5-11 180 FR Charlotte, NC Charlotte Country Day

6 Dan Pezzolla M 5-10 185 SR Endicott, NY Union Endicott

11 Ryan Quinn M 6-0 190 JR Gansevoort, NY Saratoga Springs

39 John Reicherter M 6-2 180 FR Wantagh, NY Wantagh

50 Ryan Rielly LSM 5-11 180 FR East Northport, NY John Glenn

4 Steve Romano M 6-1 190 FR Massapequa, NY Massapequa

33 Chris Selva G 5-9 160 FR Parkland, FL St. Thomas Aquinas

5 Steve Serling M 6-0 180 GR Rockville Centre, NY South Side

24 Cody Solaja D 5-11 200 JR Dallas, TX Episcopal School of Dallas

77 Adrian Sorichetti M 6-0 200 JR Whitby, ON, Canada All Saints/Trinity-Pawling

30 Sal Tuttle A 6-0 180 FR Massapequa Park, NY Farmingdale

17 Torin Varn A 6-2 175 SO Ithaca, NY Ithaca

2 Lance Yapor A 5-11 180 SO Glenview, IL Glenbrook (IL)/Salisbury (CT)

41 Anthony Zappone M 5-9 160 SO Ballston Lake, NY Shenendehowa

Head Coach: Seth Tierney

Assistant Coaches: Kevin Unterstein, J.P. Brazel and Sean Smith


012

LACROSSE

A year ago, Hofstra Men’s Lacrosse Coach Seth Tierney was fairly certain about the talent and experience levels that he had with his 2011 Pride. Much was expected from a talented senior-laden attack, a deep competitive midfi eld, a solid team-minded defense and an ever improving goalie in the cage. Tierney was right.

The Pride hit on all cylinders last year, ranking number one in the country in defense (6.56 GAA), in the top 25 in scoring (9.94 GPG), fourth in the nation in man-up offense and sixth in face-off percentage. With a potent attack trio that included two All-America honorable mentions in Jay Card and Jamie Lincoln, a deep midfi eld that included an All-America honorable mention face-off selection in John Antoniades and the national leader in goals against average and All-America honorable mention in Andrew Gvozden, the results were fairly predictable and extremely successful.

Hofstra posted a 13-3 overall record and captured the Colonial Athletic Association regular season title. While things didn’t go as planned in the conference tournament, the Pride did receive their school-record fourth consecutive NCAA Championship Tournament bid.

But the year following such an outstanding season sometimes yields misfortune. But with 26 players, including fi ve starters, returning from last year’s squad plus the addition of some talented transfers and freshmen, Tierney feels confi dent that his team will be able to reload in 2012.

Tierney and company will be faced with an upgraded schedule that adds Notre Dame and North Carolina, fi nding and replacing the trio on attack as well as the defensive midfi eld and developing the right chemistry for another winning campaign.

“My concern is not youth but, rather, inexperience,” Tierney said. “When you graduate your three starting attackmen, the entire defensive midfi eld and a close defenseman and captain, you lose a lot of game time minutes. While we may or may not necessarily be playing freshman, we do have to get more game experience, even for some of our returnees.”

GOALOne of the strengths of the Pride in 2012 will be in goal where senior captain Andrew Gvozden returns to start for a fourth year after a stellar season in 2011. The Millersville, Maryland, native turned in the best season of his career last year, posting a 13-3 record, leading the nation in goals against average with a 6.00 goals against average and placing third in save percentage with a .602 mark. For his efforts, Gvozden was voted to the All-CAA second team and was named a USILA All-America honorable mention. With a new starter on close defense and a new defensive midfi eld, his outstanding leadership talents may be his greatest strength this season. “Andrew has enjoyed a pretty good career so far and we are looking for Andrew to even better his game as a senior captain,” Tierney said. “. Andrew, along with face-off specialists John Antoniades, has had one of the biggest impacts on their team as their play can dictate time of possession and the fl ow of the game. We are looking for Andrew to be a team leader and fi nish his career on the highest note possible.”

Fighting to back-up Gvozden is junior Ryan Brant (Edgewater, MD), a transfer from Ohio State, and freshman Chris Selva (Parkland, FL). Brant, who is the brother of former Pride player Tyler Brant, saw action for the Buckeyes in only one game in 2011 after playing in fi ve as a freshman in 2010. Selva, who has shown some really

good fl ashes in the cage, was a two-time high school All-America selection from

St. Thomas Aquinas High School in Fort Lauderdale, Florida.

2012 OUTLOOK2012 OUTLOOK

20 — 2012 HOFSTRAA MEMEN’N’S LACROSSE

winning campaign. ass aaa ffrereshman in 2010. Selva, who has shown some really gogogogogogogogog ddododdodododod flflflflflflflflaaaaa hshshshshhshhesesesese iiin nn the cage, was a two-time high

sccscscsscscscchohohohohohhh olo All-America selection from SSStSttSSSSt. Thomas Aquinas High

ScScSccScScScScScScScSSS hhohhhh ol in Fort Lauderdale, FFFFlFlFllllFFlFlllFFF oooooroo ida.

JOHN ANTONIADES


LACROSS

DEFENSEThe Pride lost only one starter to graduation from last year’s squad but he was a good one in All-America honorable mention and CAA Defensive Player of the Year Michael Skudin. The four-year starter and captain last season started all 16 games, picked up 26 ground balls and was second in caused turnovers with 16. More than stats, he was a team leader who helped develop the defensemen who are now starting.

Returning to starting roles are junior Cody Solaja (Dallas, TX) and sophomore Corey Caputo (Stamford, CT). Each picked up 14 ground balls last season. Challenging for the third spot are juniors Mark Mullen (Harleysville, PA), who posted 17 ground balls and seven caused turnovers, and Michael Hamilton (Brighton, MI), who saw action in six games last season. “We will be utilizing a four-man group at close defense headed by Solaja, Caputo and Mullen with Hamilton as the fourth,” Tierney said. “All have played for us and Michael (Hamilton) has done a really nice job getting ready for the season.”

Freshmen Thomas Passenant (Charlotte, NC), an all-North Carolina selection from Charlotte Country Day, and Jackson Meyers (Annapolis, MD), a two-sport athlete from Arundel High School, and Brian Hogan, a graduate student transfer from Limestone College, will also be looking for playing time.

MIDFIELDWith many talented players to choose, the Pride coaching staff will have several options at the midfi eld are in 2012. “The midfi eld is our deepest position on the team this season,” Tierney says. “Some injuries stung us pretty good last year. But with our talent, we are having several different conversations about the midfi eld in 2012.”On the offensive side, the Pride return graduate student Steve Serling (Rockville Centre, NY), who started in just four game but tallied three goals and six assists before suffering a season-ending spleen injury. Junior Ian Braddish (West Islip, NY), an All-CAA fi rst team pick in 2011, played in all 16 games and tallied 16 goals and tied for the team-high with 17 assists. Junior Adrian Sorichetti (Whitby, Ontario), who tallied 12 goals in 12 games last

year, are the top three middies. “We don’t know if they will all be playing on the same line or if we will split them up over two or three lines,” Tierney said. “They can all initiate the offense, they can all fi nish the play and I think they have been waiting to play with each other and move forward.”

The next group includes returning starter and senior Brad Loizeaux (Mullica

Hill, NJ), sophomores Stephen DiGiovanni (Cranford,

NJ) and Rob Moore (West Islip, NY) and freshman Tyler

Johnston (Morton, PA). Loizeaux,

who is returning from a knee injury last summer,

2012 OUTLOOK

COREY CAPUTO

for the

l-ay, and te from student

ng for

aching 2012. is tyeveral

dent n just

oreBraddish 1,for etti s last

ThThThTT e next group includes returning starter anaa d senior Brad Loizeaux (Mullica

HiHiHilll, NJ), sophomores StephenDiDDD Giovanni (Cranford,

NNJNNNNNN ) and Rob Moore ((W(W( est Islip, NY) aaand freshman Tyler

JoJ hnston (Morton,PAPPP ). Loizeaux,

whw o is rer turning from a kneeiinjury last summer,

ANDREW GVOZDEN


012

LA

tallied six goals and four assists in 16 games last year. DiGiovanni, who played in just six games last year, has improved

tremendously, according to

Tierney. Moore, a sophomore transfer from Jacksonville, tallied 14 goals and fi ve assists for the Dolphins

last season. Johnston is a red-shirt freshman transfer from Georgetown who was a two-time All-American at Ridley High School.

Senior Dan Pezzolla (Endicott, NY),

junior Aaron Jones (Fairport, NY), who tallied three goals and

fi ve assists last season, and newcomers Korey Hendrickson (Farmingdale, NY), a two-time All-Nassau County selection from Farmingdale High School, Mike Malave (Wading River, NY), an All-Suffolk County pick from Shoreham-Wading River High School, John Reicherter (Wantagh, NY), an All-Nassau County pick from Wantagh High School and Steve Romano (Massapequa, NY), another all-county selection from Massapequa High School, will all be fi ghting for playing time.

The Pride lost the defensive midfi elder trio of Steve DeNapoli, Tim Holman and Adam Mojica to graduation, leaving the spots wide open. At the long-stick, senior Cole Koesterer (Manhattan Beach, CA), who is the 2012 Nick Colleluori Memorial Award recipient and will wear number 27 this season, is moving to his fourth position this season and is the front-runner for a long-stick spot. Junior Rob Bellairs (North Massapequa, NY), has been converted from goalie to a pole to utilize his athleticism. Bellairs, who played in nine games in goal last season, is also coming off a summer knee injury. Two freshmen, Ryan Rielly (East Northport, NY), an All-America honorable mention as a senior at John Glenn High School, and Guliano Bove (Garden City, NY), a two-time all-county selection from Carey High School, will also be looking for long-stick playing time, as will sophomore Kevin Leary (Guilford, CT) and red-shirt freshman Chris Howell (Bethlehem, PA).

The short-stick defensive midfi elder spot is also in transition with the graduation of Steven DeNapoli and Holman. “This is an area in which we have taken a beating due to graduation,” Tierney said. Sophomore Anthony Zappone (Ballston Lake, NY), who played in fi ve games last season, looks to be the early front-runner for the job. Senior Zach Pall (Setauket, NY), who played in 10 games for the Pride last year after transferring from Quinnipiac, will challenge Zappone and will also be taking some face-offs in 2012. Sophomore A.J. Leary (Guilford, CT), whose twin brother Kevin will be looking for time as a long-stick middie, has good athleticism and will also push Zappone. Reicherter and Romano will also be battling for time here as well.

At the face-off X, junior All-America honorable mention John Antoniades (Hauppauge, NY) gives the Pride one of the best face-off specialists in the country. Last year he ranked fi fth in the nation, winning 174 of 271 face-offs for a .642 winning percentage. He also ranked 20th in ground balls with a team-leading 84. Pall, who won eight of 16 face-offs last year, will back up Antoniades along with Malave. “We have been fortunate to have John

2012 OUTLOOK

E

o

r

m

.

Romano will also be battling for time here as wellllll..

AtAtAtAtAtAt the face oo-offffffff XXX, junior All-America honorable mention Johnnn Antoniades (Hauppauge, NY) gives the Pride one of the best face-off specialists in the country. Last year he rankeddd fifth in the nation winning 174fi fth in the nation, winning 174 of 271 face-offs for a .642 winning gpercentage. He also ranked 20th in ground balls with a team-leading 88844444.4.4.44.. Pall, who won eight of 16 face-offfffffffsssssslast year, will back up Antoniadeeesesssss along with Malave. “We havebeen fortunate to have John STEVE SERLING

tallied six goals anassists in 16 gameyear. DiGiovanni,pplplpppp ayed in just six glalalaaaalalalalalalallllll ststststssss yyyear, has impr

trtrtrrrtrtrrtrtrrtrtrtrttt ememememmmeemeeeee endously,acacacacccaaaaaa cocc rding to

TTiTiTiiTTTT eree ney. Maaa aaaa ssos phomttrtrrttrt aaansfer fJJJJJaaaaJ cksonvttataaatt llllied 14aaanannnaaa d fi vefffffofofoofoorr the D

llllalalaallalassst seasonJJJJJJooooJoJJohhhnston isssssshhhhhshshshiiirt freshmtttrtrrrrrrtraaaansfer fromGGGGGGGeeeGGG orgetownwwwwwwaaaww s a two-timAAAAAAmmmAAA erican at RHHHHHHHiHiiHHH gh School.

SSSSSSeeeeSSS nior Dan Pez(((E(E(E(EEE((( ndicott, NY),

jjjjujuuujjujujunnnior Aaron Jon(((FFFF(F(((((( airport, NY), wtatttatataatataaataallllied three goals

fi ve aasasasasasa sists last season,newcomers Korey Hendrickson (Farmingdale, NY),two-time All-Nassau County selection from FarmingHigh School, Mike Malave (Wading River, NY), an S ff lk C t i k f Sh h W di Ri H

ADRIAN SORICHETTI

short-t--k nsiveeefi elderrr is alsoo iiiinnnnn nnnnnn

sition wwititittti hhh hhhhhhhgraduationnnn ooooof f ffven DeNapppoololollli i iiHolman.is is an areaa

which we have n a beating due raduation,” Tierney . Sophomore Anthonnnnnnyyyyyyyy yyy pone (Ballston Lakeee,,, ,), who played in fi veee

mes last season, looksss e the early front-runnnnneeeerererrrrere he job. Senior Zach PPPPalalalalalalalllaalla llllllllllllllauket, NY), who playyyyeeeededddedddeddd 0 games for the Pridddeee e e year after transferrrririririiinnnnngngngnggnggngggg

m Quinnipiac, wilililllll l l lenge Zappone e e aaanannnanannnnddd d d d d dalso be takinggg ge face-offs innn n 2. Sophomoororreeee e eLeary

ilford, CT), se twin brothhherererr KKKKKKKKKKevevevevevveveviiinininiininninin be looking for time as a long-stick middie, has good i i d ill l h i h d

IAN BRADDISH


the past couple of years,” Tierney said. “We look for him to improve even more this season and become the premier face-off man in the country.”

ATTACKThe graduation of All-America honorable mentions Jay Card and Jamie Lincoln, as well as Stephen Bentz leaves all three spots on the starting attack wide open. The three accounted for 81 goals and 42 assists last season. “The attack position is the one area that we have some uncertainty,” Tierney stated. “As a staff, we have discussed the personnel frequently and we enjoy the competition that is there. But we are going to be different on attack than we have been in the past.”

Based on the fall season, the starting attack, which may not be solidifi ed until near the season opener, has fi ve players jockeying for the jobs. Senior Mike DeNapoli (Lynbrook, NY), who played in 13 games last season and tallied fi ve goals and fi ve assists, had a solid fall and will be looking to retain that momentum in the spring. Sophomores Lance Yapor (Glenview, IL), who tallied two goals and three assists in six games, and Torin Varn (Ithaca, NY), who played in 13 games and posted three goals and one assist, could be battling for the same spot on the attack line. Junior Drew Coholan (Rochester, NY), who tallied two goals and two assists in fi ve games last year before suffering a season-ending shoulder injury, and freshman Tyler Begley (East Islip, NY), a three-time All-Suffolk County selection at East Islip, will battle for the spot on the other side.

Sophomore Graham Horvath (Essex Fells, NJ), who saw action in four games last year and had a solid fall and

January newcomers Ryan O’Leary (East Meadow, NY), a junior transfer from the U.S. Naval Academy who tallied nine goals and eight assists in 14 games in 2010, and freshman Sal Tuttle (Massapequa Park, NY), an All-

American at Farmingdale High School, will be looking to crack

the rotation and disrupt any early line-up decisions by the

coaching staff.

2012 OUTLOOK2012 OUTLOOK

d t

e

ot

or d n-

g g g ,and fressshmhmhmhmhmanananann SSSSSalalalalaalalll TTTTTTTTTutututu tle (Massapequa Park, NY), an All-

AmAmAmAA erican at Farmingdale High ScScScScSSSS hoh ol, will be looking to crack

thththhhhttthheee rotation and disrupt any eeeeaaaaee rlrr y line-up decisions by the

cocoooococococococcoococcccc acacacaaa hing staff.


East Islip, will battle for the spot on the other side.

Sophomore Graham Horvath (Essex Fells,NJ), who saw action ininin four games last year and had a solid fallllll and

CODY SOLAJA

BRAD LOIZEAUX


012

LACROSSE

STEVE STEVE SERLINGSERLINGMidfi eld6-0, 180, Graduate StudentRockville Centre, NY/South SideHigh School Coach: Joe Baccerela55

Second season on the Pride Lacrosse team…Co-Captain… Came to Hofstra

following graduation from Lafayette College in Easton, Pennsylvania, in 2010…2011: Took a medical red-shirt…Started in all four game that he played before suffering a season-ending injury…Tallied three goals and six assists and

picked up two ground balls…Picked up an assist in his fi rst game for Hofstra against Colgate…Added three goals and four assists at Sacred Heart and was named CAA co-Player of the Week…Added an assist in win over Princeton…CAA Commissioner’s Academic Award recipient…At Lafayette College: Tallied 72 goals and 24 assists in three seasons at Lafayette…Graduated with a degree in economics and business…2010: USILA

All-American honorable mention…USILA Scholar-

All-America Team selection…Patriot League Offensive Player of the Year…All-Patriot League fi rst team selection…Played and started in all 14 games for the Leopards…Tallied 37 goals and 12 assists for a team-high 49 points…Ranked fi rst in the Patriot League and ninth in the nation in goals (2.64) and second in the Patriot League

and 18th in the nation in points…Tallied fi ve goals and three assists in the season opener against Fairfi eld…Scored fi ve goals against Holy Cross…Scored three man-up goals and was credited with a game-winning goal…Picked up 14 ground balls and took 101 shots…2009: Did not play due to injury…2008: Played and started in all 13 games…Tallied 23 goals and nine assists for a team-high 32 points…Scored four goals against Holy Cross and three goals against Wagner…Picked up 15 ground balls…2007: Played in 13 games and started 11 as a freshman…Second on the team with 12 goals including a season-high three against Drexel…Dished out three assists…Picked up nine ground balls…High School: Was a captain and three-year letterman in lacrosse at South Side High School in Rockville Centre, New York…Named to All-Nassau County teams as a senior in lacrosse and soccer…Captained the soccer team as well…National Honor Society member…Personal: Born May 9, 1988…Has two brothers and one sister…Pursuing a master’s degree in fi nance at Hofstra.

Year GP Sht. G A Pts. GB2007* 13 39 12 3 15 92008* 13 74 23 9 32 152010* 14 101 37 12 49 142011 4 13 3 6 9 2Career 44 227 75 30 105 40* - at Lafayette

MIKEMIKEDENAPOLIDENAPOLIMidfi eld6-1, 220, SeniorLynbrook, NY/LynbrookHigh School Coach: Larry Glenz99

Fourth year on the Pride lacrosse

roster…2011: Played in 13 games as a junior…Tied for

seventh on the team with 10 points on fi ve goals and

fi ve assists…Tallied goals against Harvard, Air Force,

Manhattan, Fairfi eld and Penn State…Posted a season-

best two assists at Delaware and single assists against

Manhattan, St. Joseph’s and Massachusetts…Notched

two points versus Delaware and Manhattan…Was

tied for third with three man-up goals…Picked up two

ground balls…Took 14 shots with nine going on goal…

Fired three shots against Air Force and Fairfi eld…2010:

Played in 14 games and started 11…Eighth on the team

in scoring with 12 points.. Tallied nine goals and three

assists…Scored a season-high three goals and four points

in the season opener at Princeton…Notched two goals

team…C…C…CCoo-oo CCCaCaCaCaptptptpptptaiaiaiaiaiain…n…n………n…n…n… CCCamama e to Hofstra following graduation fffrroroommmm m m Lafayette College in Easton, Pennsylvania,,, iinininnnn 2010…2011: Took a medical red-shirt…Started in all four game that he playeyeyeyeeeddd ddd d dd d d d before suffering aaa season-ending injury…Tallied three goals annnddd siisixx asasasasaasaas iisisisisisttststsss s ananana ddd d

picked up two groundndndd balls…Picked up an assist in his fi rst game ffooorrr Hofstra against Colgate…………Added three goals and foooururrruur assists at Sacred Heart annddd was named CAA co-Playyyeerrr r of the Week…Added annn assist in win over Princeton…CAA Commissioner’s Academimiicc cAward recipient At Lafayettttt e CoColllllllegege:: TTaTallied 72 goals

groundlettermRockviCountyCaptainSocietybrotherfi nance

Year 2007* 2008* 2010* 2011Career** - at Laf

roster…

seventh

fi ve ass

Manha

best tw

MEET THE PRIDEMEET THE PRIDE

hnhhnhnhnhhnhnhnhhnssss

ddd d d ddddd

eeeeeeeeeeeeettttttttttttttttttttttttttt ssssssssssss

…………

nnss

eaeartrt

oo

…

ne

goal

…

…

nst

009:

bert

d

l

County M

to All-Long Island an

teams as well…All-c

a junior…All-confer

sophomore…Two tim

in lacrosse and footb

90 goals and 42 assis

two scholastic season

All-Long Island and

County performer in

as well…Personal: B

December 18, 1989…

two sisters…Lists Br

Urlacher as his favor

athlete…Also recruit

by Ohio State and

Navy…Marketing

major.

YYYYYYYeYYeaYeaYYeaYeYeaYeaYeaYeaY r rr r r r Gr GGr r rr r P P P P SSSShhhhhht.hhhh G GGGGGG A PA PA PA PA PA P P PP PA Pts.ts.ts.ts.ts. GBGBGBGBGBGBGGBGBGGBB20020020020200022022202 9 9 1 0000 0 00000 0 00 000000000 000 000 0 00000000220220122020022222 0 14 44444440 0 90 990 99990 99900 3 33 3 12 12 12 12 11010101010101001010101010122202012012022012022012011 11 11 3 133 13 1 3 13 113 14 54 54 54 54 54 4 54 5 5555 5555 10 1000 2222222222CarCarCCaCarCCCCCCC eeeeeeeeerererrrrererr 288 5454545545454545444455444 141414 8 222222 22 1212121212121212212

WWWEWDRANDREWERRDDNNAAAA WWWWAA DNDREWDREWDREWANANDDAA RRGVOZDENGVOZDENGoalkeeper6-1, 180, SeniorMillersville, MD/Severna ParkHigh School Coach: Larry Kramer18818

Fourth year on the Hofstra Lacrosse roster…Co-Captain…Lowe’s Senior

CLASS Award nominee…2011: USILA All-America

honorable mention…All-CAA second team selection…

Led the nation in goals against average with a 6.00 mark…Ranked third in the country in save percentage with a .602 mark…Recorded a 13-3 won lost record while starting all 16 games and playing 899:23 of action…Made seven or more saves in 12 games including a season-high 17 in win over Penn State… Stopped 15 shots against Harvard, 12 at Delaware and 11 against St. John’s…Allowed only one

ag iainsnn t BrBrBrB owowowowwn n anndd JoJoJoJoJoJoJoJoooooohhhhhhhhhhh

HoHoHoHoHoHoHoHoHoHoHoHoHoH pkkkpkpkpkpkpkpkpkpkpkpkpkpkppp inininnniiiniii s…s…s…s…s…………………s……AAlAlAlAlAlAllAA sososs sssscccccococococcccocc rererererererereeererredddddddddd

aagagagagagagagg iaiaiaiaiaiinsnsnsnn t tttttttt MMMMaMaMaMMaMMMMM ssssssssacacacccccccaaa huhuhuhuhuhuhuhuhuhuhuhuhhh sssssssssss

ananana dd ddd dddddd JaJaJaJJaJaaJaaaJaJaccckckckcccccc sonvnvvvvnvnvvvvvililiilililiiliiiiliii leleelleleeee……

PoPoPoPoPoPoPoooooooostststsststststtttstedededededededededd aaasssssssssssssisiisisisisissisisistststtstststtsttstss

aaaagagagggggaggaiaiaiaaiaiainsnsnsnsnsnsttt t HoHoHoHoHoHoHoHoHoHoHHoHoppkpkpkpppkpkpkppkiiin

aaanananana ddd d d d SaSaSaSacrcrcrredededed HHeee

inininnininininiiiiniiiiiniiiiinininiiinn aaaaaaadddddddddd ititititioioionn toto

PrPrPrPrPrPrPPPPPPPPPPPPPPPPPPPPP iniinincececetotot n…n

TaTTTTaTaTTTTTTT lllllllieieied d d ono

mamamammmm n-n-n-upupu g

(J(J(Jacacacksksk onville)…

CrCrredededititeded with

ththhhe e e gagagamme-winning

goog aalalal aagag inst Brown…

PiPiPiPickkeeded up 10 ground

bbbbbabababababallllllllsss iinininclc uding two again

AAArArrrmmmmyy……T…Took 40 shots…20

SSaSaSaaaawwww lilimmimited action in the Rob

MMMMMMoMoMoorrrisisi ggame…High School:

PPPPlllaaayededd ffour years of lacrosse and

ttthththhhrerrereee yyeyears of football at Lynbrook

HHHHiHiHiHiHiHiiggghghghgh Scchchool…Named to High School

AAlAlAAlAlAll-l-l-l-AmAmAmAmAA e

Midfi elder of the Year……NaNaNamemeeed d d d ddd

nd All-Nassau Counntytyy

county selection as s

rence pick as a

me team captaiain n n

ball…Recordededd d

sts over his fifinnnall

ns…Was an n

All-Nassauauu

n footballll

Born

…Has s

rian n

ritetee

tededed

gogogog alalalal iin n alaa momoststst 554 4 minutes of action n atat SSt.t.t. JJJosososepepph’h s…s…AlAlloloowewed d 9090 gggoaoaoalssll oonn ththhe e e

sesesseasasasonon aandndd

ll

auauuuu

ghgghghgh SScchchool…Named to High Schohoool

erricicca a tteam as a senior…20008 8 NaNasssaaa

MEET THE PRIDE MEET THE PRIDEMEET THE PRIDE



012

LACROSSE

made a total of 136 saves…Allowed seven or fewer goals in 12 of the 16 games…Named to Hofstra Dean’s List for a third time…CAA Commissioner’s Academic Award recipient…2010: Played in 10 games and started seven in goal as a sophomore…Saw 412:49 of action…Played entire games against Delaware, Penn State, Jacksonville and Towson…Faced 219 shots, making 70 saves and allowing 64 goals for a 9.30 goals against average, a .522 save percentage and a 4-2 won-lost mark…Posted a season-high 13 saves on 36 shots in the NCAA Tournament game at Maryland…Made 11 saves in a win over Delaware (33 shots) and 10 saves against St. John’s (21 shots) and Manhattan (18 shots)… 2009: Named to the All-CAA

Freshman team…Played and started 13 games as a freshman…Made his college debut in the third game of the year against Johns Hopkins and his brother, Mike, in goal…Posted an 8.38 goals against average which ranked third in the CAA and 18th in Division I…Held Villanova to three goals and Robert Morris and Sacred Heart to fi ve…Posted a .557 save percentage which was fourth in the CAA and 20th in Division I…Recorded double-digit saves in seven games…Tallied a season-high 17 saves and faced 35 shots against Army, 15 saves on 45 shots at Cornell and 12 saves on 39 shots against North Carolina…Faced 43 shots at Johns Hopkins…CAA Commissioner’s Academic Award recipient…High School: Played four years of lacrosse and four years of ice hockey at Severna Park High School in Severna Park, Maryland…Helped lead team to Maryland Public School championships in 2006 and 2007…Named to all-county fi rst teams by The Baltimore Sun and The Capital…Selected fi rst team All-Examiner…Posted a save percentage of .800 as a senior…Personal: Born June 14, 1990…Has one sister and two brothers…Brother, Michael, is a goalkeeper for the Johns Hopkins lacrosse team…Lists “Entourage” as his favorite television show…Also recruited by Johns Hopkins, Georgetown, Cornell, Brown, Dartmouth and Penn…Plans to attend culinary school after graduation…Entrepreneurship major.

Year GP Min. GA GAA Svs. Sv%2009 13 780:42 109 8.38 137 .5572010 10 412:49 64 9.30 70 .5222011 16 899:23 90 6.00 136 .602Career 23 1,193:31 173 8.70 207 .545

COLE COLE KOESTERERKOESTERERMidfi eld (LS)6-1, 200, SeniorManhattan Beach, CA/Cazenovia (NY)High School Coach: Eric Nieman27

Fourth year on the Hofstra lacrosse roster…2012 Nick Colleluori Memorial

Award recipient and will wear number 27…2011: Played in all 16 games at short-stick defensive middie as a junior…

Recorded fi ve ground balls on the season…Picked up two ground balls at Sacred Heart and one each against Harvard, Manhattan and St. Joseph’s…2010: Played in four games as a sophomore…Took three shots…Picked up three ground balls on the season, all

against Manhattan…Forced a turnover against the Jaspers of Manhattan…Was moved to the midfi eld…2009: Saw limited action in two games as a freshman…Played in the Robert

Morris and Cornell games…CAA Commissioner’s Academic Award recipient…High School: Lettered in lacrosse, ski racing and football at Cazenovia High School in Cazenovia,

New York…Three-time all-league fi rst team selection in lacrosse…Was an all-state and

two-time All-Central New York selection as a quarterback and led the Lakers to back-to-back sectional championships…New York State Skiing

champion in the slalom and a junior Olympic team selection in 2005…Personal: Born May 3, 1990…Has

two brothers and two sisters…Has served as a volunteer with the Cazenovia Pop Warner Football program...Began playing lacrosse at age 5…Film studies and production major.

Year GP Sht. G A Pts. GB2009 2 0 0 0 0 02010 4 3 0 0 0 32011 16 0 0 0 0 5Career 22 3 0 0 0 8

w 412:49 of action…Played entirePenn State, Jacksonville and ts, making 70 saves and allowing against average, a .522 save

n-lost mark…Posted a season-highl k P d hi hhe NCAA Tournament game at es in a win over Delaware (33st St. John’s (21 shots) and 009: Named to the All-CAA

d and started 13 games as a ege debut in the third ggammmmmeee eee e ofoffofofoofofofofof

opkins and his Posted an 8.38 ich ranked h in Division ee goals and d Heart to percentage

CAA and rded double-s…Tallied a faced 35 shots

n 45 shots at 39 shots against 3 shots at Johns sioner’s Academic

School: Played four r years of ice hockeyyy hool in Severna Parkk,, team to Maryland hips in 2006 and nty fi rst teams by Theapital…Selected fi rst ted a save percentage of al: Born June 14, 1990…Has one Brother, Michael, is a goalkeeper rosse team…Lists “Entourage” as

ow Also recruited by Johns

Midfi eld (LS)6-1, 200, SenManhattan BeCazenovia (NHigh School C272222272

Fourth year on troster…2012 Ni

Award recipient and will wear numalalall l 16 games at short-stick defensiv

ReReReReRRRRRRRRR coc rded fi ve ground balls on twtwtwtwwwtwtwtttwo ground balls at Sacred HHHHHHHaHaHaHaHHHHHHH rvard, Manhattan and St.iininininnninininininii four games as a sophomoPPPPiPiPiPPPPPPP cked up three ground ba

aagaa ainst Manhattan…Fothtt e Jaspers of Manhatmimimidfidfidfidfififififieeeeeeeeldldldll ………2009: Sawgagagaagaaagagagagaagagag memememememememmmem sssss ss asasasasaaasass aaaa ffreshman

MoMoMoMorrrrrrrrrrrisisisi aaaaanndnn CorneCoCoCoCoommmmmmmmm issionerrerereerecicciccippient…H

lalalalalalalalalalalll cccrcrc osse, ski rCCaCaCCCCCaaCCCCaCazzzenovia Hi

NNNNeNeNeNeNeNeNeeNeNeNNNN ww w w w YYork…Thrtteam s lllelecttion in lacrosse

ttttwtwtwtwt o-time All-Central New Yqqqquarterback and led the Lakersssectional championships…Ne

ccchampion in the slalom and a jussseselection in 2005…Personal: Bo

ttttwtwtwwwtwtwo brothers and two sisters…Haswiw th the Cazenovia Pop Warner Foplaying lacrosse at age 5…Film stumajor.

Year GP Sht. G 2009 2 0 0



2012

LA CROSS

BRADBRADLOIZEAUXLOIZEAUXMidfi eld6-0, 190, SeniorMullica Hill, NJ/The Tatnall SchoolHigh School Coach: Pete Duncan11

Fourth year on the Pride Lacrosse roster…2011: Started all 16 games at midfi eld…Finished seventh on the team with 10 points on six goals and four assists…Tallied single goals against Colgate, Princeton, Harvard, Air Force, St. Joseph’s and Johns Hopkins…Dished out a season-best two assists against Air Force and one against Sacred Heart and Fairfi eld…Posted three points versus Air Force…Picked up 10 grounds balls including three against Drexel…Took 42 shots with 19 on goal…Fired six shot against Princeton and fi ve versus Penn State…2010:

All-CAA fi rst team selection

as a sophomore…Played and started in 14 games at midfi eld…Fourth on the team in scoring with 30 points…Tallied 19 goals and 11 assists…Posted fi ve multi-goal contests including three against Jacksonville and two versus Brown, St. John’s, Massachusetts and Penn State…Notched a season-high three assists in win over Johns Hopkins…Also dished out two assists in wins over Army and Jacksonville…Posted fi ve points in the Jacksonville game, four against Hopkins and three versus Brown, Massachusetts, Army and Penn State…Picked up four ground balls including two at Maryland…Took 65 shots…2009: Played in 13 games as a freshman and tallied fi ve goals on the year…Scored goals against Princeton, Sacred Heart, Towson, North Carolina and Villanova in the CAA semifi nals…Picked up four ground balls on the season in games against Sacred Heart, Army, Towson and North Carolina…Took 14 shots on goal with eight on goals…High School: Attended The Tatnall School in Wilmington, Delaware for two years…Played lacrosse and ice hockey…Was an All-Delaware and all-conference selection as a junior and senior…Scored 33 goals as a junior at Tatnall and added 25 goals as a senior…Team captain as a senior…Began his scholastic career at Clearview Regional High School in Mullica Hill, New Jersey…Was an all-conference selection twice while at Clearview…Personal: Has one sister…Father, Stephen, played football at Cornell and then lacrosse at Fairleigh Dickinson…Hobbies include movies and snowboarding…Also recruited by Towson, Maryland, Drexel, Army and Hobart…Entrepreneurship major.


90, Seniora Hill, NJ/The Tatnall

chool Coach: Pete Duncan

ear on the Pride Lacrosse6 games at midfi eld…Finished 0 points on six goals and four s against Colgate, Princeton,

eph’s and Johns Hopkins…wo assists against Air Force

rt and Fairfi eld…Posted ce…Picked up 10 grounds t Drexel…Tooooookkk 424242 ssshohohohotstststs shot againstststt PPPPPPPririririririncccncncnn etettonononnnno

…2010101000::

onn

nd d d elelldd…d…d………………………dd…

ng g g

d fi veeee ng three o versusus Brown, St. John’s, ate…Notched a season-high hns Hopkins…Also dished out my and Jacksonville…Posted lle game, four against Hopkins assachusetts, Army and Penn nd balls including two at

…2009: Played in 13 games ve goals on the year…Scored cred Heart, Towson, North he CAA semifi nals…Picked season in games against

on and North Carolina…Tookk on goals…High School:

ol in Wilmington, Delawaree osse and ice hockey…Was aaan nrence selection as a junior annndd d a junior at Tatnall and added

m captain as a senior…Began



012

LACROSSE

ZACHARYZACHARYPALLPALLMidfi eld/Face-Off Specialist5-11, 170, SeniorSetauket, NY/Ward MelvilleHigh School Coach: Mike Hoppie1919

Second year on the Hofstra Lacrosse roster…2011: Played in 10 games at midfi eld and as a face-off specialist…Took 16 face-offs, winning eight…Won

two of three face-offs against Manhattan and three of seven at Delaware…Picked

up four ground balls including two at Delaware…Took just one shot on the season at St. Joseph’s…Came to Hofstra after two years at Quinnipiac University in Hamden,

Connecticut…At Quinnipiac: 2010: Played in 13

games…Tallied six goals and three assists for nine points…Scored

a season-high two goals against Sacred Heart…Posted

a goal and an assist in games against Detroit and Bellarmine…Led the team and ranked ninth in the country in face-off percentage (.577)…Won 101 of 175 face-offs…Captured 12 of 18 face-offs at Detroit and 11 of 19 at Sacred

Heart…Led the team and ranked ninth in the nation (6.08) in ground balls with 79…Picked up 13 ground balls at Detroit…Took 20 shots…2009: Saw action in 10 games as a freshman…Scored two goals…Captured eight of 13 face-offs (.615)…Picked up nine ground balls…Took 17 shots…High School: Was a member of the lacrosse and swimming teams at Ward Melville High School in Setauket, New York…All-American as a senior for the Patriots…Led the Northeast in face-off winning percentage in 2008…All-Suffolk County selection as a junior…All-league swimmer and helped lead the team to the county fi nals…Personal: Born April 12, 1990…Has one brother and one sister…Mass media major.

Year GP Sht. G A Pts. GB FOW-L Pct2009* 10 17 2 0 2 9 8-5 .6152010* 13 20 6 3 9 13 101-74 .5772011 10 1 0 0 0 4 8-8 .500Career 33 38 9 3 11 26 117-87 .574

* - at Quinnipiac

DANNYDANNYPEZZOLLAPEZZOLLAMidfi eld5-10, 185, SeniorEndicott, NY/Union EndicottHigh School Coach: Jon Stank6

Fourth year on the Pride Lacrosse team…2011: Did not see any game action due to

injury…CAA Commissioner’s Academic Award recipient…2010: Played in four

games as a sophomore…Tallied one assist on the season…Assisted on a

goal against Manhattan…Picked up three ground balls including

two against Army…Took fi ve shots on the year including

three against Manhattan… CAA Commissioner’s

Academic Award recipient…Hofstra

Athletics Academic Honor Roll member…2009: Played in all 15 games as a freshman…

Recorded one assist on the season in the

Pride’s 6-5 victory over Sacred Heart…

Tallied two ground balls on the season in games

against Massachusetts and Robert Morris…Took eight shots with fi ve on goal…Fired two shots at Sacred Heart…CAA Commissioner’s Academic Award recipient…High

School: Played four years of lacrosse and soccer at Union Endicott High School…Graduated as the

highest scoring midfi elder in Union Endicott history and ranks

second in career points…Recorded 105 goals, 79 assists and 184 points in his career…US Lacrosse All-American as a senior…Three-time all-league selection…Named to Section IV All-Tournament team twice…Two-time team Most Valuable Player and Most Outstanding Offensive Player…Won a silver medal at the 2007 Empire State

, SeniorNY/Ward Melville

ool Coach: Mike Hoppie

r on the Hofstra Lacrosse mes at midfi eld and as a face-

ntan icked o t

s at den,

piac:

goooaalllsss s s r d als ostteedd d es

d thheheheeee yy iinnn nn00011 ooooooof f f fffaaacceeeee---eddd

nthhh p 113333ctiiioonnnnn n

cored two goals…Captureeedd icked up nine ground

School: Was a member oofff ms at Ward Melville Higiggghh h h…All-American as a sennniioooooorr r r rheast in face-off winninggg olk County selection as aaa nd helped lead the team ttoooo

Born April 12, 1990…Hasasss ass media major.

Pt GB FOW L P tPts. GB FOW-L Pct2 9 8-5 .6159 13 101-74 .5770 4 8-8 .50011 26 117-87 .574

5-10, 185, SeniorEndicott, NY/Union EndicottHigh School Coach: Jon Stank66

Fourth year on the Pride Lacrosse tteteteeeamamamamamamammmammmm……………202020202020202020201111111111111111111::::: DDDDDDDDDDDididddidid nnnot see any game action due to

iinnnnjujujuuuuuujj ryryyyrr …CAA Commissioner’s Academic AAAwAwAwwwwwAAwA ararrra d dd recipient…2010: Played in four

gagagaaagagagg mmmememeeemmmmmmm s ss s as a sophomore…Tallied one aaasasasaassasssssisisiissttt on the season…Assisted on a

ggggogogoooog alalalalalaaaa aaaagagg inst Manhattan…Picked uupupuppppupuu tttttthrhrrhh eeeee ground balls including

twwwwwtwtwtwwtwtt oooooo oo agaggagagaga aiaa nst Army…Took fi ve sshshhhhs oootttotoo s s ooon the year including

thhhhthththththththththttt rerereeeeereeerrrr eeeeeee eee agagagaagaaa ainst Manhattan… CACACACACACACACAAAAAAACAAACACAACCCC AAAAAAAAAAA CCoCoC mmissioner’s

AAAcAcAcAcAcAcAcAcAAcAcAAAA adadadddddadaaaaa eememmic Award rrrrrrrerereeeeeeeeereeeer cccicciciccicipppipipiippppppp eene t…Hofstra

AtAtAtAtAtAtAtAtAtAtAtAtAAAA hlhlhlhlhllllhh eetteee icii s Academic HHHHHHoHoHoHoHooooHoHHHHH nnnnnonooonnnnnnnn r Roll mmmmmmmmmmeeeeeeemm mmmmmmmmbmmm er…2009:

PPPPPPPPlPlPlPlPlPPlPlPlllaaaaayayayayayyayayayaayyeeede in all 11111115555551555 gggggggaaames asaaaa a fffffrfrfrrrfrfreeesssee hman…

RRRRRRReReReeeReeecccococooococccc rrrded one assist ooooooononnnnonn ttttthhhheheheh season in the

PPPPPPPrPrPrPrPrrPrrridididididdididideeee’s 6-5 victory ooovvvovvveeeerreer SSacred Heart…

TTTaTaTaTaaaT lllllllllliieieied two ground balls onononnno ttttttthhhehehhh season in games

aaagaaa aaiaiiia nnnnssst Massachusetts aanananannnanananaaanaanddd d d dd RRRRoRobert Morris…TTTTToToToToToToToooooooookokkook eight shots with fi ve ooonnnnnnon ggoooal…Fired two shots aatataatatattt SSSSSSSaaacacred Heart…CAA CCCCCoCoCCoooCommmmmissioner’s Academic AAAwAwAwwwwAwA aararard recipient…High

ScScScSccccScScSccSSSchohooohhhhhhh olo : Played four years ofoofofffffoo llaacaccrosse and soccer atatatatatatatatatatatatatt UUUUUUUUUUUnninion Endicott High ScScScScScScSScScchhohoohhh ol…Graduated as the

hhhihihihhhihihh hhhhhh i idfi ld ihhhhihihihihhihiiihighghghghghghgghgheese t scoring midfi elder inUnUnUUUnUnUUUnUnUnioiioioioioioi nn n nn EEnEndicott history and ranks

sesesesesesecococoooco dndndnddndndnd iiiiiiin n n cacacaccarererererereerereerer ppppoiioioiointtntnttsss…RRecorded 105 goals, 79 assists and d 184 points in his career…US Lacrosse All-Americanas a senior…Three-time all-league selection…Named to Section IV All-Tournament team twice…Two-time team Most Valuable Player and Most Outstanding Offensive Player…Won a silver medal at the 2007 Empire State

roster…2011: Played in 10 gamoff specialist…Took 16 face-of

two of three faand three of

up four grat Delawon the seCame toQuinnip

Co

aa go

aga ainst Detrotett am and ranfaff ce-off per175 face-ofoffs at Detr

Heart…Led tin the nation (6.08) in ground bground balls at Detroit…Took

mes at midfi eld and as a ffs, winning eight…Wonace-offs against Manhattf seven at Delaware…Piround balls including tw

ware…Took just one shoteason at St. Joseph’s…o Hofstra after two yearspiac University in Hamd

onnecticut…At Quinnip

2010: Played in 13 gag mes…Tallied six and three assists for nine points…Scored

a season-high two goaagainst Sacred Heart…Poal and an assist in gameoit and Bellarmine…Lednked ninth in the countryrcentage (.577)…Won 1ffs…Captured 12 of 18 froit and 11 of 19 at Sacrethe team and ranked nin

balls with 79…Picked up20 shots…2009: Saw ac



OSS

Games…2007 STX Shootout champion as a member of the Central New York Roadhawks…Four-time Scholar-Athlete Award recipient…Member of the National Honor Society…Personal: Born June 19, 1989…Has one sister…Lists “Green Street Hooligans” as his favorite movie…Also recruited by Cornell, Loyola, North Carolina and Navy…Boys and Girls Club youth lacrosse coach and youth lacrosse camp coach…Plans to pursue a career in marketing…Information technology major.


JOHNANTONIADESMidfi eld/Face-off Specialist5-9, 165, JuniorHauppauge, NY/St. Anthony’s/Chaffee PrepHigh School Coach: Keith Wieczorek42

Third year on the Hofstra Lacrosse roster…2011: USILA All-America honorable mention…All-CAA fi rst team selection…Played in all 16 games…Ranked fi fth in the nation in face-off percentage with a .642 mark…Ranked 20th in the country in ground balls per game with a 5.25 average…Won174 of 271 face-offs…Won 16 of 22 face-offs with nine ground balls against Princeton…Captured 15 of 19 face-offs against Air Force…Won 15 of 20 face-offs with eight ground balls against Massachusetts and 15 of 21 with eight ground balls against Drexel…Also picked up nine ground balls against Delaware and Manhattan…Picked up 84 ground balls on the year…Tallied two goals and four assists …Posted a goal and an assist at Towson…Also scored against Johns Hopkins…Picked up assists against Princeton, Drexel and Delaware…Took just four shots on the year…CAA Commissioner’s Academic Award recipient…2010: CAA All-Rookie Team

selection…Played in all 14 games as the primary face-off specialist after the injury to Mike Vaccaro in the season opener…Tallied one goal and two assists for three points…Scored his lone goal of the year at St. John’s and assisted on goals against Manhattan and Delaware…Second on the team with 47 ground balls…Picked up eight ground balls against Jacksonville, six against Towson and fi ve versus Princeton and Army…Took eight shots…Won 180 face-offs and lost 149 for a .549 winning percentage, ranking 25th in Division 1…Also ranked fi fth in the CAA in face-off winning percentage… Won 21 of 30 face-off at Princeton…Captured 19 of 27 face-off against Jacksonville…Won 17 of 25 face-offs against Towson…Captured 16 of 28 face-off against Brown and 12 of 17 at St. John’s…Grabbed 10 of 13

face-offs against Manhattan…Prep

School: Came to Hofstra after one year at Loomis Chaffee Prep School in Windsor, Connecticut…Named to the All-New England team after recording 30 goals, 20 assists, 162 ground balls and winning 85% of his face-offs…Selected to the East-West All-Star Game…High School: Played scholastically at St. Anthony’s High School in South Huntington, New York…Voted CHSAA Face-Off Midfi elder of the Year as a senior…Named team Most Valuable Player and received the Army Reserve Award for the Friars, who were ranked fourth nationally with a 15-3 record, in 2008…Recorded 15 goals, 15 assists, 157 ground balls and won 83% of his face-offs…Personal: Born June 8, 1990…Has one sister…Enjoys weight-lifting and ice hockey in his free time…Also recruited by Army, Navy and Virginia…Aspires to a career in criminal justice or teaching…History major.

Year GP Sht. G A Pts. GB FOW-L Pct.2010 14 8 1 2 3 47 180-149 .5472011 16 4 2 4 6 84 174-97 .642Career 30 12 3 6 9 131 354-246 .590

ffs against Manhattataannn…n………PPrPrPrrPrPrPrrepepepeppepepp

: Came to Hofstrraraa aaaaafftftfftftftteeererererr oooooneneneneee Loomis Chaffeeee PPPPrrrerereeepppp pp in Windsor,

cticut…Named ttoo tthhhheeehh w England teammm aaaftftfttfteeeeeerrrr ng 30 goals, 202000 162 ground bbbabaaallllllllllssss

nning 85% oooofff hhhhhhiss nning 85% oooffff hhhhhhhhiiisssisffs…Selecteeedddd ttttttooo ot-West Alllll--SSSSSttttS aaarrrra

…High Scchchhoooooooooolll::::l

scholastiiccaaac llllllll yyy aaaaatatatt hony’s HiHiigghhhhhhhin Southgton, Neeewww w

…Voted A Face---OOOOOfffffffff lder of thhhhhhheee e e es a seniorrr……………………………………………

team MMMMMMMMMMMMMosososossssosssssttttttttt t tle Plalalaayyyeyeyeeeyyy r rrrrreiveddd ttttttthehehehehehehehehehehehhe

Reserrvevevevee for thhheeewho wwweererereeee fourth

ally withh h a aacord, in Recordeddd 15555551

15 assists, 15557777 balls anddd % of hiss

ffs…nal: Borrnn n

1990………e

…Enjoyss s -liftinghockey

reeAlso recruiteddd bybbyby AAAAArmrmrmrmr y,yyy,y, NNNNNavavavyyy and Virgini ia A…AAspspspiririreseses

youth lacrosse camp coach…Plans tomarketing…Information technology mmarketing Information technology m

Year GP Sht. G A2009 15 8 0 0 2010 4 5 0 12011 0 0 0 0Career 19 13 0 1

JOHNJOHN

Midfi eld/Face-of5-9, 165, JuniorHauppauge, NY/Chaffee PrepHigh School Coa422242

Third year on the roster…2011: USILA All-America h

All-CAA fi rst team selection…PlayeRanked fifth in the nation in face-off pmark…Ranked 20th in the country inwith a 5.25 average…Won174 of 27122 face-offs with nine ground balls agCaptured 15 of 19 face-offs against A20 face-offs with eight ground balls agand 15 of 21 with eight ground balls appicked up nine ground balls against DManhattan…Picked up 84 ground baltwo goals and four assists …Posted aTowson…Also scored against Johns Hassists against Princeton, Drexel and Dfour shots on the year…CAA CommiAward recipient…2010: CAA All-Ro

selection…Played in all 14 games as tspecialist after the injury to Mike Vacopener…Tallied one goal and two assScored his lone goal of the year at St. goals against Manhattan and Delawarteam with 47 ground balls…Picked upagainst Jacksonville six against Towsagainst Jacksonville, six against TowsPrinceton and Army…Took eight shoand lost 149 for a .549 winning percenDivision 1…Also ranked fi fth in the Cwinning percentage… Won 21 of 30 fCaptured 19 of 27 face-off against Jac25 face-offs against Towson…Capturagainst Brown and 12 of 17 at St. John



012

LACROSSE

ROB ROB BELLAIRSBELLAIRSLong Stick Midfi elder6-0, 175, JuniorNorth Massapequa, NY/PlainedgeHigh School Coach: Gary Levitan3131

Third season on the Pride Lacrosse roster…Will move to the long stick midfi eld position in 2012…2011: Played in nine games and 60:37 of action in goal as a sophomore...Allowed 15 goals and made six saves…Posted a season-best three saves against Air Force in 8:42 of action…Faced 40 shots…CAA Commissioner’s Academic Award recipient…2010: Played in 10 games and started seven in goal as a freshman…Saw 422:09 of action…Faced 180 shots, made 41 saves, allowed 62 goals for a 8.81 goals against average, a .398 save percentage and a 5-3 record…Played entire games against Brown, Johns Hopkins, Massachusetts and Drexel…Tallied a season-high eight saves on 28 shots against Drexel…Posted seven saves against Brown (30 shots) and Johns Hopkins (19 shots)...Made fi ve saves and allowed just two goals in 52 minutes against Army…Posted six saves in win over Sacred Heart…Picked up 12 ground balls including three against Johns Hopkins…High

School: Played four years of lacrosse and three years of football at Plainedge High School in North Massapequa, New York…Lacrosse All-American as a senior…Four-time All-Nassau County selection…Voted Nassau County Goalie of the Year as a junior and senior…Posted a 65.3 save percentage during high school and holds the Plainedge record with 872 career saves…Four-time lacrosse academic all-conference selection…Honor Roll student…Played on the Empire State Games gold medal-winning team in 2008…All-Nassau County selection in football as a senior…Also received the Nassau County Dragon Award in football…Personal: Born August 18, 1991…Has three sisters…Enjoys surfi ng in his free time…Also recruited by Cornell, Loyola, Massachusetts and Army…Serves as a volunteer youth lacrosse coach…Exercise science major.

Year GP Min. GA GAA Svs. Sv%2010 10 422:09 62 8.81 41 .3982011 9 60:37 15 14.85 6 .286Career 19 482:46 77 9.57 47 .379

IAN IAN BRADDISHBRADDISHMidfi eld6-2, 185, JuniorWest Islip, NY/West IslipHigh School Coach: Scott Craig43

Second season on the Hofstra Lacrosse team…2011: All-CAA fi rst team

selection…Played in all 16 games and started 10…Ranked fourth on the team with 33 points on 16 goals and tying for team honors with 17 assists…Posted fi ve multi-goal games including a season-high three against Penn State and two against Harvard, Air Force, Manhattan and Fairfi eld…Led the CAA with fi ve game-winning goals…Tallied a season-best four assists at St. Joseph’s and two against Drexel, Towson, Massachusetts and Delaware…Ranked ninth in the CAA in assists…Recorded four points against Penn State and St. Joseph’s and three points in fi ve other games…Picked up nine ground balls including three against Fairfi eld…Took just 53 shots with 31 on the goals…Took nine shots against Massachusetts…Came to Hofstra after one year at the University of North Carolina in Chapel Hill…At UNC: 2010: Played in fi ve games for the Tar Heels as a freshman…Recorded one goal against Johns Hopkins…Picked up one ground ball…Took eight shots including four against Virginia and three against Hopkins…High School: Played three years of lacrosse and basketball and two years of football at West Islip (NY) High School…Under Armour All-American in 2009…Selected to play in the Under Armour North-South All-Star Game…Played on two New York State High School Championship teams at West Islip in 2007 and 2009, three Suffolk County championship teams and two Long Island championships…The Lions were also declared national high school champions in 2007 as well…Played on two gold-medal winning teams at the Empire State Games…Personal: Born April 21, 1991…Has two brothers…Enjoys fi shing and snowboarding in his free time…Public relations major.

Second season on the Hofofofofffffstststststststttttrrrararararararaaa osse team…2011: All-CAA fi rst teamammmmmmm

tion…Played in all 16 games and d 10…Ranked fourth on the teamammm 33 points on 16 goals and tyiinnngnggggg am honors with 17 assists…………d fi ve multi-goal gamesess ding a season-high against Penn State

wo against Harvardd,, orce, Manhattan andndndd eld…d………LeLeLeLeeeeddd dd ththththe eeee CACACAA A A fivvveee ee eeeee -nnnnnngg gggg…………ed dson--four assistttsss atatat SSSStttt. JJJoseph’swo against Drexel, Towson,achusetts and Delaware…Ranked dddin the CAA in assists…Recorded

points against Penn State and St. Josepph’h’h’h sssssshree points in fi ve other games…Picked ne ground balls including three against eld…Took just 53 shots with 31 on the …Took nine shots against Massachusetts…e to Hofstra after one year at the University of NoNoN rtrtrthhhh ina in Chapel Hill…At UNC: 2010: Played in



2012

LA CROSS

Year GP Sht. G A Pts. GB2010* 5 8 1 0 1 12011 16 53 16 17 33 9Career 21 61 17 17 34 10* - at UNC

DREW DREW COHOLAN COHOLAN Attack5-10, 175, JuniorRochester, NY/IrondequoitHigh School Coach: Craig Whipple1212

Third year on the Hofstra Lacrosse team…Is expected to move to the attack from midfi eld in 2012…2011: Played in fi ve games and started two before suffering a season-ending injury…Started against Harvard and Air Force…Tallied two goals and two assists…Recorded two points against Princeton…Scored goals against Princeton and Air Force and assists against Harvard in addition to the Tigers…Credited with one game-winning goal…Picked up three ground balls on the year all in the Harvard contest…Took fi ve shots with three on

cage…

Fired two shots in games against Princeton and Air Force…CAA Commissioner’s Academic Award recipient…2010: Played in all 14 games and started one at midfi eld as a freshman…Tallied three goals and three assists for six points…Scored goals against Army, Manhattan and Jacksonville…Posted two assists against Manhattan and one against Jacksonville…Notched three points in win over Manhattan

and two against Jacksonville…Picked up two ground balls, both against Army…Took 17 shots including fi ve against Jacksonville and two against Manhattan, St. John’s, Delaware and Maryland…High School: Played four years of lacrosse at Irondequoit High School in Rochester, New York…U.S. Lacrosse All-America selection as a junior and a senior…Three-time All-Greater Rochester and Section V all-tournament selection…Scored 56 goals and 23 assists as a senior in 2009…Team Most Valuable Player as a senior…Tallied 62 goals and 28 assists as a junior, and 54 goals and 27 assists in 2007 as a sophomore…A member of Irondequoit’s Section V championship team in 2007…Personal: Born July 26, 1991…Has three brothers…Enjoys boating and golfi ng in his free time…Also recruited by Maryland, Towson, Penn State, UMBC and Loyola…Aspires to a career in fi nance…Management major.

Year GP Sht. G A Pts. GB2010 14 17 3 3 6 22011 5 5 2 2 4 3Career 19 22 5 5 10 5

JORDAN JORDAN FRIED FRIED Attack5-9, 155, JuniorChappaqua, NY/Horace GreeleyHigh School Coach: Roy Colsey7

Third season on the Pride Lacrosse roster…2011: Saw limited action in just one game as a sophomore…Played in the Pride’s 13-8 win over Manhattan…CAA Commissioner’s Academic Award recipient…2010: Played in two games as a freshman…Saw action in games against Sacred Heart and Manhattan…High School: Four-year member of the lacrosse and cross country teams at Horace Greeley High School in Chappaqua, New York…All-section pick as a senior after scoring 26 goals and eight assists in 2009…Tallied 24 goals and six assists as a junior, and 20 goals and fi ve assists as a sophomore…Played on Greeley teams that twice advanced to the sectional semifi nals and once to the sectional quarterfi nal…Two-time all-league cross country selection and was named all-county as a senior…Personal: Born July 25, 1990…Has one brother…Completed both the 2010 and 2011 New York City Marathons in under 3:17 as part of Fred’s (Lebow) Team…Has served as a volunteer for the Make-A-Wish Foundation of Hudson Valley…Also recruited by Hartford, Siena, Manhattan and Fairfi eld… Liberal arts major.

202012 H

goals against Princeton and Air Force and assists against Harvard in addition to the TTiggererererrrs…sss…s…CrCrCrCrCrededededititi ede with one game-winning goal…Piiickckckkedededddd uuuuuuuuuuppppppthree ground balls on thththhheee ee ee year all in the Harvardd d d contest…Tookk fififivvve e shshhhhottotts ss s iwiwiwithththt ttthrhrhrh eeeeeeeeeeeeeee oooooonn nnn

ccacaaaaaaacaccc geggegegegegeg ………

FiFiFiFiFiFiFiFirrerereredddd twtwtwwoo ooshshshotots in ggamammeseses against Princetonn nand Air Force…CAA Commissioneerr’s’s Academic Award recipient…2010:

Played in all 14 games and started d done at midfi eld aasas a freshman…Talliieededd three goals and thththreerer e eeeeassists for six pointsts…………S d l iScored goals againststst Army, Manhattan ananannnnnndddd d ddddJacksonville…Posteeeddd ddtwo assists against Manhattan and one against Jacksonvilleee………………Notched three pointststs in win over Manhatttatataaannn n n n n

77

ror ster…a a a sophomManhattrecipienSaw actiManhattlacrosseSchool isenior afTallied 2and fi veteams thand oncelelelelleague casasssaasasasaaasaaa aaaa senibbbrbrrrbrooottoototo hheher…CCCiiiiiCiCCC tytytyytytytytt MMMaTTTeeeeeTeTTT aamammmaaam…FFFFFFFFoFoooFoooouuuununnnuu dddHHHHHHaaaaHaaaarrrtrttffofmmmmaaamammmam jjojooj r



SE


MICHAEL MICHAEL HAMILTONHAMILTONDefense6-0, 225, Junior (RS)Brighton, MI/Brother RiceHigh School Coach: Rob Ambrose32

Fourth year on the Pride Lacrosse roster…2011: Played in six games on

defense as a sophomore…Played against Air Force, St. John’s, Towson, Manhattan, St, Joseph’s and Massachusetts, all wins…Picked up ground balls against

Towson and Air Force…Forced turnovers against

the Falcons, Tigers and Minutemen...CAA

Commissioner’s Academic Award recipient…2010: Played in seven games as a red-

shirt freshman…Tallied two goals

and one assist for three points…Scored

in wins over St. John’s and Manhattan…Posted

an assist in victory over Brown...Picked up a ground

ball against Brown and Army…Took fi ve shots including two against Army…Hofstra Athletics

Academic Honor Roll…2009: Did not

play as a freshman…CAA Commissioner’s Academic

Award recipient…High School: Played four years of lacrosse and ice hockey, and three years of football at Brother Rice High School in Birmingham, Michigan…Member of the 2008 Inside Lacrosse national Championship team…Won four state titles from 2005 to 2008 and Midwest Championships in 2005 and 2008…Two-time All-America selection…Twice named to All-Midwest and All-Michigan teams…Michigan

and Midwest Player of the Year…Recorded 39 goals, 42 assists and 114 ground balls as a senior…Personal: Born July 31, 1989…Has two brothers…Brother, Mark, played lacrosse at Cabrini College while other brother Matthew plays at Adrian College in Michigan…Lists Tom Brady as his favorite athlete and Adam Sandler as his favorite actor…Recruited by Ohio State, Georgetown and Loyola…History major.


AARON JONESMidfi eld5-10, 190, JuniorFairport, NY/FairportHigh School Coach: Mike Torrelli13

Third year on the Hofstra Lacrosse roster…2011: Played in all 16 games and started one as a sophomore…Tallied eight points on three goals and fi ve assists…Notched two goals against Drexel and one against Sacred Heart…Credited with the game-winning goal

against Sacred Heart…Dished out two assists against Air Force and one against Colgate, Harvard and Massachusetts…Picked up ground balls at Sacred Heart, Delaware and Towson…Took 24 shots including

11 on goal…Fired four shots against Drexel…2010:

Played in all 14 games at midfi eld as a freshman…Recorded six goals and three

assists for nine points…Posted a

season-high three goals and four points in the Pride’s win

over Manhattan…Notched two goals against Jacksonville

and one against Army…Tallied assists against Army, Drexel and

High School Coach: Rob Ambrose3232FoFoFoFoFFF uruu th year on the Pride Lacrosse

rororooooroststttststsss eererre ………2011: Played in six games ondedededeededddd fefefeefefff nnnsn e as a sophomore…Played

agagaagggggggaaiinnst Air Force, St. John’s, TTToToToooTTTTowwwwson, Manhattan, St, Joseph’s aananannnananaaaa dd dd Massachusetts, all wins…PPPPPiPiiiP cckckckc ed up ground balls against

ToToToToToToToTTT wswswsswww onoo and Air Force…FoFFoFoFoooFoFFoF rcrcrcrcr ededdede ttururnovers against

thththhthththhhththhthe e e ee eeeee eeeeee FaFaFaFaFFFFFFaF lclclcll onMiMiMiMiMiMMM nununutett

CCoCoCoCCCCC mmAcAcAcAAAAAAAAAAAA aarererererererererrereererrrr cccccccccccPlPlllPlPlPlPlPlPlPPPPPlPlaaaaaaaaaaagagaggagagagagggggg mmmmm

shshshshhhsssssshhiririririrtttttTaTaTTaTaTTTTalllllllie

aanananananaanannddddddd d dd oneththhree poin

iiiiiniiii wins oveaaaananannnnaanannnnd Manhatta

aaaaaanannnnaanannnn assist in vicBrBrBrBrBrBBrBrBBBB ooooowoo n...Picked

bbbbababababababababballllllllllll against BrowAAAAArArArArArAAAAArArArmymmm …Took fi veiinininininininiiiii ccclcllccclc uuuding two agaiAArAArArAArmmmmy…Hofstra At

AAAAAcAcAcAAAAcccA aaademic Honor RRRRRoRoRooRR llll…2009: Did no

ppplplplplpplaayayay as a freshman…CCCCoCoCoCCoCoCoCommmmmissioner’s Academ

AwAwAwAwAwAwAwwaararararrdddddd d rrererecccipient…High School

AARAAR

Midfi el5-10, 1FairporHigh S13313

S LALAAACRCRCRCRCRRRRCRCRRRRRRRRRRCRRRRCRROSOOOSOSOSOSOSOSOSOSOSOSOSOOSOSSSOSOSOSOSOSOOOOSOSOSOOSOSOSOSSESESESESESESESS

yhree ol in

008 Insiiiddddededeeeeeee on west me l-an

ear on the Hofstra Lacrosse 16 games and started one as

ht points on three goals and fi ve s against Drexel and one against th the game-winning goal inst Sacred Heart…Dished out assists against Air Force and against Colgate, Harvard and

ssachusetts…Picked up ground s at Sacred Heart, Delaware and

wson…Took 24 shots including 111111111 oooon nn goal…Fired four shots

agaggagagagaaagaiaiaia nst Drexel…2010:

PPlPlllPPPPPPPP ayaa ed in all 14 games atataaa mmmidfi eld as a ffrfrfrffrf eesese hman…Recorded sisiisisisisssss x xxx gog als and three

aaaassaaaaa sisisis sts for nine popopoopopopopopoop iininininintttststsss PP…P…PP…P… osososo ted a

sssseseesseaason-high h hthree gogoo lalalalssss ananananddddddd ffffofofofooffof uur points in the Pride’s win

ooooovovvvoo er Manhattan…Notched ttttwwwwwwtt o goals against Jacksonville

aaaaanannnaandd one against Army…Tallied aaaaasassassssists against Army, Drexel and

vers against ns, Tigers and emen...CAA

mmmmissioner’s adadadada emic Award ciiicipient…2010:

ayaa ed in seven memm s as a red-tttt freshman…ed two goals e assist for nts…Scored er St. John’s an…Posted ctory over

up a grouuuunnndndndndndndddd wn and e shots inst thletiiiccccssssss

t CAAA mic l: Playeddddd d

Third yeroster…2011: Played in alla sophomore…Tallied eighassists…Notched two goalsSacrededd HHHHeaeaeaeartrtrtrt…C…C…C… redited wit

agaitwt ooooono e MMMMMMasbbbballToToToToTToTTTT www

11111111111111



2012

LA CROSS

Manhattan…Picked up ground balls against Sacred Heart and Manhattan…Took one face-off against Penn State…Took 18 shots including four against Manhattan and three against Sacred Heart…High School: Played fi ve years of lacrosse and football at Fairport (NY) High School…Two-time all-county selection including a fi rst team pick as a senior…Also named to the All-Greater Rochester team…Tallied 53 points as a senior…Personal: August 16, 1990…Has two brothers and one sister…Enjoys golf in his free time…Aspires to a career in telecommunications…Also recruited by Ohio State, UMBC, Bucknell and Delaware…Linguistics major.


MARKMARKMULLENMULLENDefense6-3, 195, Junior (RS)Harleysville, PA/Germantown AcademyHigh School Coach: Dave Martin

2525

Fourth year on the Pride Lacrosse roster…2011: Played in all 16 games on defense as a sophomore…Started against Colgate, Sacred Heart and Johns Hopkins…Picked up 11 ground balls including a season-high three against Colgate…Also recorded two against St. John’s, Drexel and Johns Hopkins…Tallied seven forced turnovers including two against Hopkins and Colgate…CAA Commissioner’s Academic Award recipient…2010: Played in 13 games and started one on defense as a red-shirt freshman…Picked up 10 ground balls on the year…Scooped up four ground balls against Army and two against Manhattan and Drexel…Forced seven turnovers including three against Manhattan and two at Drexel…CAA Commissioner’s

Academic Award recipient…Hofstra Athletics Academic Honor Roll…2009: Red-shirted as a freshman and did not compete…CAA Commissioner’s Academic Award recipient…High School: Lettered in lacrosse, ice hockey and cross country at Germantown Academy…Earned US Lacrosse All-America honors as a senior…2008 George Cruz Award recipient from the Inter-AC League for sportsmanship…Team Most Valuable Player as a junior…Tallied four goals and four assists as a senior…Personal: Born September 11, 1989…Has one brother…Hobbies include fl y-fi shing…Lists Mark Messier as his favorite athlete and “The Hatchet” as his favorite book…Began playing lacrosse at age 8…Also recruited by Towson, Bucknell and Drexel…Received the Hofstra general chemistry excellence award…Aspires to attend medical school…Health science major.


CODY CODY SOLAJASOLAJADefense5-11, 200, JuniorDallas, TX/Episcopal School of DallasHigh School Coach: Kevin Barnicle24

Third year on the Hofstra Lacrosse roster…2011: Played and started in 15 games on defense as a sophomore…Picked up 14 ground balls…Scooped up

a season-high three against Manhattan and two against Colgate and Air Force…Forced two turnovers in win

at Sacred Heart…CAA Commissioner’s Academic Award recipient…2010: CAA All-Rookie Team

selection…Played in 13 games and started 12 on defense as a freshman…Picked up 11 ground

balls on the season…Scooped up three ground balls against both Drexel and Jacksonville…Recorded eight forced turnovers including two at Drexel…High

School: Played lacrosse and football at the Episcopal School

of Dallas (TX)…Named to the Under Armour

All-America team as a senior…

Two-time All-America selection…Three-time all-state selection…Picked up 85 ground balls and recorded two goals and two assists as a senior…

2220202020020001111121212222 HOHOFSTRA MEN’S LACROSSE

Fourth year on the er…2011: Played d defense as a d against art and Johns p 11 ground ason-high te…Also st St. John’sss,s, opkins…

d turnoverrrsss st te…CAA AAademic 010:

and nse asn…d balllllllsssssseded s wo and dven threeee

and A Commis isioner’s’s

Dallas, TX/Episcopal SchoDallasHigh School Coach: Kevin2444242444

Third year on the Hofstra Lacrooororr ststs er…2011: Played and started in 15 games onasassssaaa aaaaaa ssssopoo homore…Picked up 14 ground balls…Sc

a a aaa aa seseeess asaa on-high three against Manhattan and twCCCoCooCCoCCCC lglglgl ate and Air Force…Forced two turnov

aatattatataaa SSSSaca red Heart…CAA Commissioner’s AAAAAwAwAwwwAAAAA aara d recipient…2010: CAA All-Rook

sssseeeeeeess leleelllll cctc ion…Played in 13 games and starooooonnnnnnono dddddeefe ense as a freshman…Picked up 1

balls on the season…Scooped upground balls against both DrexelJacksonville…Recorded eight foturnovers inclludu ing two at Drexe

ScScScScSSSSSSS hohhhoh lololololol::: PPPPPPlalalalallalayeeyeyeeyeyeyeyy d d dd lalalaacrrcrcrcrcrrcrososososossoo sesese aandndn footballEpEpEpEpEpEpEpEpEpEpEppppisisisissiii cococ pa

oofofofofofofofofoffffoooo DDDDDDDDDDDDDDDalalaaa lNaNaNaNaNaNNaNaNaNaNNNNNNN mmmmemeeemmedddUUUUUnUnUnnnUnUnnnddddedederrr

AAAlAlAlAlAAlAlA ll-l-l-AAAAmtetetteamamam as a se

TTTTwwwT o-time All-America selection…Three-tiaaalllaaaa ll--sts ate selection…Picked up 85 ground balrrrreeeeeeccooorded two goals and two assists as a senio



012

LACR Named 2009 team Most Valuable Player…Named All-

SPC and team MVP as a running back and linebacker as a senior…Earned All-SPC honorable mentions in football as a sophomore and junior… Earned the 2009 Strength and Conditioning Award…Personal: Born August 1, 1990…Has one brother…His brother, Steve, was a national champion boxer at West Point…Enjoys music, traveling and spending time with friends in his free time…Aspires to a career in marketing for a professional football team…Marketing major.


ADRIAN ADRIAN SORICHETTISORICHETTIMidfi eld6-0, 200, JuniorWhitby, Ontario, Canada/All-Saints/Trinity-Pawling Prep School Coach: Joe Tweed

7777

Third season on the Pride Lacrosse team…2011: Played in

12 games as a sophomore…Sixth on the team in scoring

with 13 points on 12 goals and one assist…Tallied a

season-high three goals against Massachusetts and two

goals against Fairfi eld and Penn State…Tallied lone assist

at Massachusetts for a four-point day…Credited with

the game-winning goal at Towson…Recorded a one ma-

up goal against Johns Hopkins…Picked up fi ve ground

balls including two against Manhattan…Took 23 shots

and placed 16 on goal…Notched fi ve shots against Penn

State…2010: CAA All-Rookie Team selection…Played

in all 14 games at midfi eld as a freshman…Recorded nine

goals and six assists for 15 points…Tallied a season-high

three goals at Drexel and two goals against Brown…

Posted a season-high two assists against both Princeton

and Jacksonville…Notched three points in games against

Princeton, Drexel and Jacksonville…Tied for third on the

team with four man-up goals…Picked up three ground

balls including two against St. John’s…Took 24 shots

including four against Brown and Jacksonville…Prep

School: Comes to Hofstra from Trinity-Pawling School

in Pawling, New York…Played lacrosse and hockey

at Trinity-Pawling…Named to the

All-Founder’s League fi rst team in

2009…Team captain of T-P’s state

championship team…Received

the school’s Coaches Award

and held the position of

Dean’s Assistant…Earned

three varsity letters…

High School: Attended

All-Saints High School

in Whitby, Ontario,

Canada…Played for

Team Canada at the

Under-19 World

Championships…

Was a member

of Canada’s

silver-medal

winning team...

Named Team

Canada Player of the

Game in the World

Championships…

Was a member of gold

medal-winning teams

in the Under-19 Canadian

Field Lacrosse Championships,

Provincial Under-19 Field Lacrosse

Championships, the Canadian Provincial

High School Field Lacrosse Championships and the

Canadian Provincial Box Lacrosse Championships…

Personal: Born October 8, 1990… Has one brother and

one sister…Enjoys fi shing and golfi ng in his free time…

eam captain of T-P’s statee

nship team…Receiveddd

l’s Coaches Awardddd

the position of

ssistant…Earneddd

ity letters…

ool: Attended

s High School

y, Ontario,

Played for

nada at thehehee

World

nships…………

ember

a’s

dal

eam...

eam

layer of thehee

the World

nships…

ember of goldd

nning teams

der-19 Canadian



2012

LA CROSS

Also recruited by Georgetown, Loyola, Massachusetts and

Cornell…Exercise science major.


COREY COREY CAPUTOCAPUTODefense5-11, 165, Sophomore (RS)Darien, CT/DarienHigh School Coach: Jeff Bramier2323

Third year on the Hofstra Lacrosse roster…2011: Played in 16 games and started 14 on defense…Picked up 14 ground balls on the year…Recorded three ground balls at Towson and two against St. Joseph’s, Penn State and Johns Hopkins…Third on the team in caused turnovers with 10 including three at Towson and two at St. Joseph’s… 2010: Red-shirted as a true freshman and did not see any action…High School: Played four years of lacrosse and three years of football, and ran one year of track at Darien (CT) High School…Two-time All-Connecticut and all-conference selection in lacrosse as a defender and long-stick middie…Played on four Connecticut Class M state championship teams, and two FCIAC championship teams…A member of two Connecticut Marines Team of the Year…2008 team was

ranked fourth in the nation by Inside Lacrosse…Two-time all-conference football selection at cornerback…Personal: Born June 28, 1990…Has one brother and three sisters…His father, Carl, played baseball at Miami and West Virginia…Coached Under-11 Chargers lacrosse team last summer…Also recruited by Hobart, Bryant and St. John’s…Aspires to a career in fi nance…Marketing major.

Year GP Sht. G A Pts. GB2011 16 0 0 0 0 14

STEPHEN STEPHEN DIGIOVANNIDIGIOVANNIMidfi eld6-0, 205, SophomoreCranford, NJ/CranfordHigh School Coach: Al Reinoso2222

Second year on the Hofstra Lacrosse roster…2011: Saw action in six games as a freshman…Played against Air Force, St. John’s, Towson, Manhattan, St. Joseph’s and Massachusetts…Took just three shots with one on goal…Picked up a ground ball against Air Force… High School: Played four years of lacrosse at Cranford (NJ) High School…Four-year offensive leader who tallied 193 goals, 81 assists and 274 points during his career…Two-time selection (2008-08) to the Adidas All-American National Lacrosse Classic…Two-time All-New Jersey fi rst team selection…Four-time all-conference fi rst team pick…Selected conference Offensive Most Valuable Player as a senior…Tallied 49 goals and 15 assists as a senior…Chosen to the Gil Gibbs High School Seniors All-Star Game…Ranked 18th in New Jersey in scoring with 65 goals and 25 assists as a junior and was named to the Under Armour Underclass All-Star Team…Posted 45 goals and 19 assists as a sophomore and 43 goals and 22 assists as a freshman…Played on two (2008-09) Kimber Conference championship teams…Served as senior captain…Personal: Born March 19, 1992…Has two brothers…Enjoys weight-lifting and swimming…Recruited by Cornell, Navy, Massachusetts and Towson…Aspires to a career in business or fi nance…Undecided major.


2020202020202020121212111 HO

and two FCIAC championship teams…A member of two CoCoConnnnnecectiticuucuttt MaMM rines Team of the Year…2008 team was

New Jersefi rst teamValuable assists asSeniors Ascoring wnamed toPosted 45gogg als and009090 ) Kimbsseeenin or capttwwwo brothRReReR cruiteTToToT wsonUUUnU deci

YYYear 2202011



012

LACROSSE

GRAHAMGRAHAMHORVATHHORVATHAttack5-10, 175, SophomoreEssex Fells, NJ/Seton Hall PrepHigh School Coach: Dave Giarrusso

4040 Second season on the Pride Lacrosse team…2011: Saw action in six games as

a freshman…Took just three shots with one on goal…Fired two shots against Manhattan…Had one shot against St. Joseph’s…Junior College: Attended Morris Community College in Morristown, New Jersey but did not compete…High School: Played four years of lacrosse at Seton Hall Prep High School in West Orange, New Jersey…Recorded 128 career goals…Three-time All Fitch-Pitt Conference pick and two-time All-Essex County and All Iron Hills Conference selection…Named to All -New Jersey as a senior after recording 50 goals and 3.8 points per game…Led the team in scoring for three consecutive years…Tallied 41 goals and a 3.5 points per game average as a junior and 37 goals and a 2.6 points per game average as a sophomore…Personal: Born January 21, 1992…Has one sister…Enjoys surfi ng and snowboarding in his free time…Recruited by Navy, Bucknell, Fairfi eld and Towson…Public relations major.


A.J. A.J. LEARYLEARYMidfi eld (SS)5-11, 177, SophomoreGuilford, CT/GuilfordHigh School Coach: Brian White3434

Second year on the Hofstra Lacrosse

roster…2011: Saw action in fi ve games

as a freshman…Played against Air Force, St. John’s,

Towson, Manhattan and St. Joseph’s…Recorded one

ground ball at Towson…Dean’s List student…CAA

Commissioner’s Academic Award recipient…Prep

School: Came to Hofstra from Loomis Chaffee Prep

School in Windsor, Connecticut...Selected to the New

England Prep All-Star Game after scoring 42 goals and fi ve

assists in 2010...High School: Played four years of lacrosse

and three years of football at Guilford (CT) High School...

Two-time (2008-09) All-Connecticut Class M selection..

Two-time All-Area selection by the New Haven Register

and two-time All-SSC league pick...Holds the school

records for most career goals (167) and most points (268)...

Captain and team most valuable player after scoring 61

goals and 31 assists as a senior in 2009...Posted 40 goals

and 16 assists in 12 games as a junior and was named the

Indians’ offensive most valuable player...Scored 44 goals

and 31 assists as a sophomore and 22 goals and 23 assists

as a freshman...Also named to All SCC and All-Area teams

in football in 2009...Personal: Born September 21, 1990...

Has two brothers and one sister...His twin brother, Kevin,

is also a member of the Pride lacrosse team...Undecided

major.

Year GP Sht. G A Pts. GB

2011 5 0 0 0 0 1

KEVIN KEVIN LEARYLEARYDefense/Long Stick Midfi elder5-11, 185, SophomoreGuilford, CT/GuilfordHigh School Coach: Brian White1515

Second season on the Pride Lacrosse team…2011: Played in two games as a freshman…Saw action against Air Force and Manhattan…CAA Commissioner’s Academic Award recipient…Prep

School: Came to Hofstra from Loomis Chaffee Prep School in Windsor, Connecticut...Selected to the New England Prep All-Star Game...High School: Played four years of lacrosse and three years of football at Guilford (CT) High School...Two-time (2008-09) All-Connecticut Class M selection...Named to the 2009 All-Area team by the New Haven Register...Two-time All-SCC league pick...Captain and team offensive most valuable player after recording 56 goals and 34 assists as a senior...Led the team with 43 goals and 27 assists as a junior...Personal: Born September 21, 1990...Has two brothers and one sister...His twin brother A.J. is also a member of the Pride lacrosse team...Undecided major.




2012

JACK JACK MOOREHEAD MOOREHEAD Defense6-0, 225, SophomoreEast Northport, NY/John GlennHigh School Coach: Kevin Lavey2929

Second year on the Hofstra Lacrosse roster…2011: Played in fi ve games as a freshman…Saw game time against Air Force, St. John’s, Towson, Manhattan and St. Joseph’s…Recorded ground balls against Air Force and St. John’s…High School: Played lacrosse and football and was a member of the wrestling team at John Glenn High School in East Northport, New York…Three-time team captain for the Knights…Named to all-division team as a sophomore…Standout in football being named to All-New York, All-Long Island and All-Suffolk County teams as a senior when the Knights posted a 10-1 mark…Two-time Blue Helmet Award, defensive most valuable player and Leadership Award recipient in football…Three-time all-league gridiron pick…Personal: Born February 10, 1992…Has three sisters…Enjoys movies and swimming…Recruited by Virginia, Colgate and Delaware…Undecided major.


2011 5 0 0 0 0 2

TORIN VARNAttack6-2, 175, SophomoreIthaca, NY/IthacaHigh School Coach: Frank Welch1717

Second season on the Pride Lacrosse team…2011: Played in 13 games as a freshman…Recorded four points on three goals and one assist…Tallied two goals in win over Drexel...Named CAA Rookie of the Week after the Drexel game…Also scored against Harvard…Posted his lone assist against Manhattan…Picked up eight ground balls including two against both Drexel and Massachusetts…Took just 11 shots but 10 were on goal…Fired three shots on goal against

Harvard…High School: Played four years of lacrosse and two years of hockey at Ithaca (NY) High School…U.S. Lacrosse All-American as a senior in 2010…Was ranked the 25th best young guns rising in the country by Inside Lacrosse as a senior…Tallied 191 goals and 94 assists during his career…Under Armour All-American as a junior…Three-time all-section selection…Voted Best Offensive Player on the Team all four years and was the team most valuable player as a senior…His Ithaca teams ranked 14th in the Under Armour national poll as a senior and 17th as a junior…Played on the Little Red’s Section IV championship teams and New York State Championship semifi nalists in 2009 and 2010…Played in the Adidas All-American Classic…Personal: Born September 24, 1991…Enjoys listening to music, playing ping pong, hockey and the guitar, and watching football…Aspires to a career as a teacher…History major.


2011 13 11 3 1 4 8

2220202020202020202020202002000111121222222 HOHOHOHOOOOOOOOHOOHOHOOOOHOOHOHOOHOHOOFSFSFSSSSSSSSSSSSSSSSSSSTTTTTRTRTRRRTT AAAAA A A MMMMMMEMEMEMEM N’N’N’N’SSSS LALALALACRCRCRCRCRCRCCCCCCRCRCRCRCRCCRCRROOOOOSOSOSOSOSSSSSSSSSSESESESESEESSESS ———— 337

yer and Leadership Award recipient in me all-league gridiron pick…Personal:

1992…Has three sisters…Enjoys ming…Recruited by Virginia, Colgate ndecided major.

Sht. G A Pts. GB

0 0 0 0 2

TORINTORIN

Attack6-2, 175, SophomoreIthaca, NY/IthacaHigh School Coach: Frank Welch

Second season on the Pride 011: Played in 13 games as a ded four points on three goals andd d l i i D ld two goals in win over Drexel.....kie of the Week after the Drexeeellld against Harvard…P…Posososteteteddd hhihihih ss ss s Manhattan……PiPiPickckckkeded uup p p eieieieighghghghghhttt tding two aagagagagainiininnnstststsststs bbbbbbbbbbotototototthhhhhh DDDDrDrDrD exexexexexelelelelelel aaaannndnndndnddd ook jusst t t 1111111 sssshhhohohohoootstststtstss al…Fiiirrreredd d d dl agaiaiainnsnsstt t t



012

LACROSSE

LANCE LANCE YAPORYAPORAttack5-11, 180, SophomoreGlenview, IL/Glenbrook South (IL)/Salisbury (CT)High School Coach: Bobby Wynne (Salisbury)22

Second year on the Hofstra Lacrosse roster…2011: Played in six games as a freshman…Saw action against Air Force, Manhattan, Massachusetts, Penn State, Delaware and Johns Hopkins…Was slowed by a preseason injury…Recorded fi ve points on two goals and three assists on the season, all against Massachusetts…Picked up ground balls against Massachusetts and Penn State…Took four shots with two on goal…Fired three shots against Massachusetts…High School: Played lacrosse and basketball at Glenbrook South High School in Glenview, Illinois and at Salisbury (CT) High School…Recorded 147 goals and 123 assists for 270 points during his high school career…Helped lead

Salisbury to its fi rst perfect 13-0 record and the New England title in 2010…Scored 45 goals and 52 assists as a senior…Named to All-American, All-Illinois and all-conference teams as a junior after posting 27 goals and 40 assists at Glenbrook South…Tallied 41 goals and 25 assists and was voted the team most valuable player as a sophomore…Personal: Born September 14, 1990…Has two brothers and one sister…Undecided major.


ANTHONYANTHONYZAPPONEZAPPONEMidfi eld (SS)5-9, 160, SophomoreBallston Lake, NY/ShenendehowaHigh School Coach: Chuck Holohan41

Second season on the Pride Lacrosse team…2011: Played in fi ve games at midfi eld as a freshman…Did not record any stats…High School:

Played four years of lacrosse and soccer at Shenendehowa High School in Clifton Park, New York…All-section selection as a senior in 2009…Four-time team most valuable player in lacrosse…Tallied 23 goals and 21 assists as a senior…Recorded 16 goals and 21 assists as a junior in 2008…Posted 16 goals and 15 assists as a sophomore in 2007…Two-time Coaches Award winner in soccer…All-section pick in soccer as a senior…Scholar-Athlete in both lacrosse and soccer…Personal: Born April 19, 1991…Has two sisters…Recruited by Army, Le Moyne and Albany…Lists his hobby as cars…Accounting major.


Recorded 147 goals aaandndndnd 11111122323232323323 aaaaaassssssssssssssssisisisisisiisisistststststststst fffffffforoorororororor 2222222707007070707077 pppppoioioiointntntsss dud ring his high schoolllcareer…Helped llleeaeaeadd d d ddd

4141Second season on th

teteteamaa …2011: Played in fi ve games at mfrfrfrfrfff esesesee hmhmmhman…Did not record any stats…

PlPlPllPlPllPlPP ayayayyyaa eede four years of lacrosse and soSShShShhhSSSSSS eennnendehowa High School in ClYYYYYoYoooYYYYoY rrkrk…All-section selection as aFFFFFooooFF uuur-time team most valuable pTTTTTTaaTT llllied 23 goals and 21 assistsRRRReReeeR corded 16 goals and 21 assiiinnnnn 22008…Posted 16 goals andsssooophp omore in 2007…Two-timwwwwiwiiwwwiiinnnn er in soccer…All-sectioa aaaa a aaaa sssseees nior…Scholar-Athlete in sosooooososocccccc er…Personal: Born Aprtwtwwwwwwwtwtwwwtttt oo ooo sisters…Recruited by ArAAAlAAlAlAlAllbbbbababab ny…Lists his hobby as cmmmmmmamaam jjoor.

YYYYYeYeeeaaYeYeYY r r r GP Sht. G A 222020200012 120 111 5 0 0 0



2012

LA CROSS

PRIDE NEWCOMERSPRIDE NEWCOMERS

TYLER TYLER BEGLEY BEGLEY Attack6-2, 195, FreshmanEast Islip, NY/East IslipHigh School Coach: Joe Ancona1414

High School: Played fi ve years of lacrosse, four years of basketball and one year of football at East Islip (NY) High School…Three-time All-Suffolk County selection in lacrosse…Named to the Suffolk County Rising junior and senior all-star teams…Earned Scholar-Athlete accolades in all three sports…Named to the Academic All-Suffolk County team in basketball…Matt Howard Award recipient by the Suffolk Basketball Coaches as a senior…Also earned East Islip Coaches Award for basketball…Member of the National Honor Society and Boys Leaders…2011 East Islip Athletic Booster Club and HIA-LI Scholarship recipient…Played on the New York State Empire Games lacrosse team in 2010…Member of the Long island Express Club team for fi ve years that was ranked #1 by Inside Lacrosse Magazine…Personal: Born May 10, 1993…Has one brother…Lists O.A.R. as his favorite band and Tim Tebow as his favorite athlete…Undecided major.

GUILIANOGUILIANOBOVEBOVEDefense6-2, 180, FreshmanGarden City, NY/H. Frank CareyHigh School Coach: Tom Aiello2020

High School: Lettered in lacrosse and football at H. Frank Carey High School in Franklin Square, New York…Was an All-America fi nalist as a senior…Two time All-Nassau County selection in both lacrosse and football…Named to all-academic teams in both sports as well…Team captain in both sports…Personal: Born March 19, 1993 in Naples, Italy…Has two sisters…Started playing lacrosse at age 14…Lists the Red Hot Chili Peppers as his favorite band and “Scar Tissue” as his favorite book…Also recruited by Army and St. John’s…Plans to pursue a career in the criminal justice fi eld…Undecided major.

RYAN RYAN BRANTBRANTGoalie5-11, 190, JuniorEdgewater, MD/DeMatha CatholicHigh School Coach: Scott Morrison4949

First year on the Pride Lacrosse team…Comes to Hofstra after two years at Ohio State University…At Ohio State: 2011: Played in just one game, seeing 30 minutes of action, allowing two goals, making two saves and getting the victory…OSU Scholar-Athlete…2010: Played in fi ve games and started one, seeing 126:17 of action as a freshman…Tallied a 7.60 goals against average and a .619 save percentage…Allowed 16 goals and made 26 saves…Faced 71 shots…Made fi rst career start at Notre Dame and made 10 saves on 17 shots in an overtime loss…OSU Scholar-Athlete…High School: Played four years of lacrosse at DeMatha Catholic High School in Hyattsville, Maryland…All-Maryland fi rst team honors…All-Metropolitan second team by the Washington Post as a senior in 2009 and a honorable mention as a junior in 2008…Selected most valuable player of the 2009 WCAC Championship Game…Three-time all-conference selection…Member of three WCAC championship teams…Team most valuable player as a senior…Three-time team defensive most valuable player…Posted a .710 save percentage during his scholastic career…Rated the number 49 recruit and the fi fth-best goalie for the class of 2013 by Inside Lacrosse…Personal: Born September 16, 1991…Has two brothers and one sister…His father played football and baseball at Eastern Kentucky while brother Tyler played lacrosse at Hofstra…Enjoys boating and relaxing in his free time…Economics major.

Year GP Min. GA GAA Svs. Sv%2010* 5 126:17 16 7.60 26 .6192011* 1 30:00 2 4.00 2 .500Career 6 156:17 18 6.91 28 .609

* - at Ohio State



012

LACROSSE

KOREY KOREY HENDRICKSON HENDRICKSON Midfi eld5-7, 175, FreshmanFarmingdale, NY/FarmingdaleHigh School Coach: Bob Hartranft4545

High School: Played lacrosse for four years at Farmingdale (NY) High School…Part of New York State and Long Island championship team as a senior and a Nassau County championship team as a junior…Named to All-Nassau County team as a junior and senior…All-conference selection as a sophomore…Personal: Born November 10, 1992…has one brother, Zach, who plays ice hockey at Nichols College…Hobbies include playing hockey and surfi ng…Names Theo Fleury as his favorite athlete…Also recruited by Maryland, Georgetown and Stony Brook…Plans to pursue a career in business, as well as coach college lacrosse and youth hockey…Undecided major.

BRIAN BRIAN HOGANHOGANDefense6-3, 200, GraduateWest Islip, NY/West IslipHigh School Coach: Scott CraigPrevious College: Limestone (SC)2121

Joins the Pride after four years at Limestone College in South Carolina…Played in 35 games and made 29 starts in his three seasons after red-shirting as a freshman…Posted 14 ground balls and seven caused turnovers in 2010…Had 34 ground balls and 17 caused turnovers in 2011 and was named to the all-conference team…Graduated with a degree in physical education…High

School: Played football and lacrosse at West Islip (NY) High School…Is a 2007 graduate…All-Suffolk County selection…Member of state championship teams in 2006 and 2007…Personal: Born April 21, 1989…Has two brothers…Hobbies include fi shing…Is pursuing a master’s in health education at Hofstra…Aspires to teach physical education and coach.

Year GP Sht. G A Pts. GB2008* Red-shirt2009* 5 3 0 0 0 42010* 13 0 0 0 0 142011* 17 2 1 0 1 34Career 35 5 1 0 1 52

*at Limestone

CHRIS CHRIS HOWELL HOWELL Long-Stick Midfi elder6-0, 190, Freshman (RS) Bethlehem, PA/The Hill SchoolHigh School Coach: Ned Ide1616

High School: Played lacrosse for two years and ice hockey for three years at The Hill School in Pottstown, Pennsylvania…Lacrosse team was MAPL champions as a senior in 2010…Served as team captain of both teams as a senior…Was a member of the Lehigh Valley All-Star team and the all-academic team in hockey…Personal: Born November 1, 1991…Has one brother and one sister…Mother, Karen, was a swimmer at Ithaca College…Father, Tom, played basketball at Rider University…Plans to attend law school and become a trial litigation lawyer…Philosophy major.

TYLER TYLER JOHNSTONJOHNSTONAttack5-8, 170, Freshman (RS)Morton, PA/RidleyHigh School Coach: Kevin EllersPrevious College: Georgetown 33

Joins the Pride after spending the 2010-11 season at Georgetown University in Washington, DC…Red-shirted as a freshman…High School: Played lacrosse for four years at Ridley High School in Folsom, Pennsylvania…Earned All-America accolades as a junior and senior…All-Pennsylvania selection as a sophomore…Personal: Born November 1, 1991…Has two sisters and one brother…Is active in the HEADStrong Foundation…Plans to pursue a career in fi nance…Management major.



2012

LA CROSS

MIKE MIKE MALAVE MALAVE Midfi eld5-11, 180, FreshmanWading River, NY/Shoreham-Wading RiverHigh School Coach: Tom Rotanz88

High School: Lettered in lacrosse, basketball, winter track and golf at Shoreham-Wading River High School…Member of Suffolk County championship team as a senior…All-Suffolk County selection as a senior after scoring 27 goals and adding 17 assists despite missing fi ve games due to injury…Totaled 58 goals and 38 assists in his scholastic career…Two-time all-division selection…All-county selection in the long jump as a junior and senior…Personal: Born June 3, 1993…Has one sister…Cousin, David Malave, played lacrosse at Alfred University…Hobbies include surfi ng, snowboarding and listening to music…Lists Mikey Powell, Alexander Ovechkin and John Wall as his favorite athletes…Also recruited by Maryland, Albany, Bucknell and Fairfi eld…Mathematics major.

JACKSON JACKSON MEYERS MEYERS Defense6-1, 180, FreshmanAnnapolis, MD/ArundelHigh School Coach: Kevin Necessary4747

High School: Played lacrosse for four years and football for three years at Arundel High School in Gambrills, Maryland…Selected to play in the Warrior 40 All-Star game…Honorable mention All-Met selection by The Washington Post…Attended Nike Blue Chip Camp…Personal: Born October 27, 1992…Hobbies include fi shing…Lists the Zach Brown Band as his favorite musicians…Started playing lacrosse at age 7…Plans to pursue a teaching career…Undecided major.

ROB ROB MOOREMOOREMidfi eld6-1, 210, SophomoreWest Islip, NY/West IslipHigh School Coach: Scott Craig4444

First year on the Hofstra Lacrosse roster…At Jacksonville: Comes to Hofstra after one season at Jacksonville University…2011: Played in 15 games and started nine as a freshman…Was fi fth on the team with 19 points on 14 goals and fi ve assists…Posted a season-high four points on three goals and one assist against Marist…Also posted two goals against both Rutgers and Siena…Notched two assists in collegiate debut against Georgetown…Recorded two points in games against Rutgers, Canisius (1-1), Siena and Georgetown…Picked up 20 ground balls including fi ve against Detroit and four against Duke…Took 69 shots including 36 on goal…Fired nine shots against Marist…High School: Played lacrosse and football at West Islip (NY) High School…Earned All-Suffolk County honors as a senior after recording 42 goals…Member of New York State Championship teams as a junior and a senior…Earned three varsity letters at West Islip in lacrosse and football…Personal: Born March 10, 1992…Has two brothers…Finance major.

Year GP Sht. G A Pts. GB2011* 15 69 14 5 19 20

* - at Jacksonville

RYAN RYAN O’LEARYO’LEARYAttack6-0, 171, JuniorEast Meadow, NY/St. Anthony’sHigh School Coach: Keith Weiczorek2828

First season on the Hofstra Lacrosse roster…Comes to Hofstra after three years at the United States Naval Academy…At Navy: 2011: Red-shirted and did not play…2010: Played in 14 games and started 13 as a sophomore…Was fi fth on the team with nine goals and eight assists for 17 points…Tallied two goals and one



012

LACROSSE

assist against both Towson and Lafayette…Recorded two assists in regular season game against Lafayette…Picked up 12 ground balls and took 31 shots including 23 on goal… 2009: Played in 14 games as a freshman in 2009…Recorded one goal and one assist…Took 17 shots including six on goal…Picked up fi ve ground balls…High School: Played four years of lacrosse and one year of football at St. Anthony’s High School in South Huntington, New York…Named CHSAA Attackman of the Year as a senior in 2007…All-league selection as a junior…Was quarterback on the Friars’ undefeated conference championship team in 2006…Personal: Born November 28…Has three sisters…Enjoys fi shing, hunting and snowboarding in his free time…Economics major.

Year GP Sht. G A Pts. GB2009* 14 17 1 1 2 5 2010* 14 31 9 8 17 122011* Red-shirt Career 28 48 10 9 19 17

* - at Navy

THOMAS THOMAS PASSENANT PASSENANT Defense5-11, 180, FreshmanCharlotte, NC/Charlotte Country DayHigh School Coach: Brad Touma3737

High School: Lettered in lacrosse and football at Charlotte (NC) Country Day School…Earned All-America honors in lacrosse as a senior…Part of four North Carolina Independent School Athletic Association state championship teams…Two-time All-NCISAA selection…Member of Team Carolina Elite…Was an All-North Carolina selection in football as a senior at running back and defensive back…Helped lead football team to NCISAA state championship in 2010…Served as class president as a sophomore…Personal: Born June 9, 1992…Has one sister and two brothers, including a twin (Derek)…Hobbies include deep sea fi shing…Lists Jordy Nelson as his favorite athlete and the Zack Brown Band as his favorite musicians…Started playing lacrosse at age 10…Undecided major.

RYAN RYAN QUINNQUINNMidfi eld6-0, 190, JuniorGansevoor, NY/Saratoga SpringsHigh School Coach: Jon Coons1111

First year on the Pride Lacrosse team…Will not play in 2012…Junior College: Comes to Hofstra after one year at Nassau Community College in Garden City, New York…Named to 2011 NJCAA All-America second team…Also named to all-district/region team…At Bryant: Played the 2009 season at Bryant College in Smithfi eld, Rhode Island…Saw action in one game, taking one shot and picking up one ground ball…High

School: A 2008 graduate of Saratoga Springs (NY) High School where he was a four-year letterman in lacrosse and football…Named to all-star fi rst team as a senior by both the Albany Times-Union and the Saratogian in 2008…Tallied 30 points, 130 ground balls and won 70 percent of his face-offs as a senior…All-Big 10 fi rst team in 2007…Personal: Born February 10, 1990…Has one brother…Nephew of Johns Hopkins great and three-time U.S. World Team member, Larry Quinn…Enjoys skiing and wakeboarding…Economics major.

JOHN JOHN REICHERTER REICHERTER Midfi eld6-2, 180, FreshmanWantagh, NY/WantaghHigh School Coach: Gary Reh3939

High School: Lettered in lacrosse, football and basketball at Wantagh (NY) High School…Earned All-Nassau County honors as a senior in all three sports…Member of the National Honor Society, the Foreign Language Honor Society and the Business Honor Society…Personal: Born January 21, 1993…Has two sisters…Lists snowboarding, going to the beach and sports among his hobbies…Names O.A.R. as his favorite band and pizza as his favorite food…Also recruited by Lafayette and Connecticut College…Undecided major.



2012

LA CROSS

RYAN RYAN RIELLYRIELLYLong Stick Midfi elder5-11, 180, FreshmanEast Northport, NY/John GlennHigh School Coach: Kevin Lavey5050

High School: Played four years of lacrosse and football at John Glenn High School in East Northport, New York…Member of Suffolk County championship lacrosse team in 2010…Earned honorable mention All-America honors as a senior…All-Suffolk County selection as a junior and senior…Named team Most Valuable Player…Recorded more than 200 ground balls in his career…Team captain as a senior…Member of the Rutgers Trophy winning football team in 2010…Football team was also Long Island and Suffolk County champions…Second team All-New York state selection at quarterback as a senior…Finalist for the Hansen Award (Suffolk Player of the Year) and Esiason Award (top QB)…MVP of the Suffolk County and Long Island championship games…Football team and Division IV Most Valuable Player…Set Long Island record for all-purpose yards with more than 3,400 while passing for 21 touchdowns and rushing for 20…Personal: Born August 5, 1993…Has one sister…Father, Jim, was an Academic All-American football player at Bucknell University in 1985 and also played baseball…Nicknamed “Riles”…Undecided major.

STEVE STEVE ROMANO ROMANO Midfi eld6-1, 190, FreshmanMassapequa, NY/MassapequaHigh School Coach: Tim Radomski4444

High School: Played lacrosse and football for three years at Massapequa (NY) High School…Part of two Nassau County runner-up teams as a junior and senior…Named to All-Nassau County team as a senior…Honorable mention all-county as a junior…Tallied 15 goals and 23 assists as a senior and 12 goals and 15 assists as a junior…Two-time all-county pick in football…Personal: Born December 8, 1992…Has one sister…Names Michael Jordan as his favorite athlete…Lists “Gangs of New York” as his favorite movie…Also

recruited by Johns Hopkins, North Carolina and Ohio State…Plans to pursue a career in television or fi lm…Undecided major.

CHRIS CHRIS SELVA SELVA Goalie5-9, 160, FreshmanParkland, FL/St. Thomas AquinasHigh School Coach: Terry Crowely3333

High School: Played four years of lacrosse at St. Thomas Aquinas High School in Fort Lauderdale, Florida…Named to high school All-America team as a junior and senior…Three-time all-district, all-county and all-league selection…2011 Sun Sentinel Player of the Year…Named fi rst team All-Sun Sentinel and All-Miami Herald as a junior and senior…Personal: Born November 4, 1992…Has one brother and one sister…Lists Ed Reed as his favorite athlete and mahi-mahi as his favorite food…Nicknamed “Piglet”…Started playing lacrosse at age 6…Undecided major.

SAL SAL TUTTLETUTTLEAttack6-0, 180, FreshmanMassapequa Park, NY/FarmingdaleHigh School Coach: Bob Hartranft3030

Joins the Pride after spending the fall 2011 semester at Nassau Community College…High

School: Lettered in lacrosse, football and basketball at Farmingdale (NY) High School… Part of New York State and Long Island championship team as a senior and a Nassau County championship team as a junior…Named to high school All-America team as a senior…All-Long Island team selection…Named Nassau County Attackman of the Year…Two-time All-Nassau County selection…All-conference selection as a sophomore…Recorded 37 goals and 57 assists as a senior…Ranks ninth all-time in points at Farmingdale with 208 (100 goals and 108 assists)…Team captain as a senior…Named to all-county team in football as a senior…Also was football team MVP and captain…Personal: Born July 4, 1993…Has one sister…Hobbies include video games and golf…Started playing lacrosse at age 7…Physical education major.


44 — 2012 HOFSTRA MEN’S LACROSSE 44 — 2012 HOFSTRA MEN’S LACROSSE

012

LACROSSE

DREXELUNIVERSITYUNIVERSITY

Saturday, March 24 at Drexel

Location: Philadelphia, PANickname: DragonsDirector of Athletics: Dr. Eric ZillmerLacrosse Stadium: Vidas FieldHead Lacrosse Coach: Brian VoelkerRecord at School/Years: 18-11/2 yearsOverall Record: 60-62/9 yearsCoach’s Office Phone: (215) 895-1859Men’s Lacrosse SID: Mike TuberosaOffice Phone: (215) 895-1591Fax: (215) 895-2038E-mail: [email protected] Record: 8-6/3-3(CAA)Returning Lettermen: 25Returning Starters: 8Series Record: Hofstra leads, 21-3Last Meeting: 2011-Hofstra won, 11-6Athletic Web Site: DrexelDragons.com

ST. JOHN’S ST. JOHN’S UNIVERSITYUNIVERSITY

Tuesday, March 20 at Hofstra

Location: Queens, NYNickname: Red StormDirector of Athletics: Chris Monasch Lacrosse Stadium: DaSilva Memorial

(1,200)Press Box Phone: (718) 990-6057Head Lacrosse Coach: Jason MillerRecord at School/Years: 21-47/5 yearsOverall Record: sameCoach’s Office Phone: (718) 990-6305Men’s Lacrosse SID: Brad ZakOffice Phone: (718) 990-1523Fax: (718) 969-8468E-mail: [email protected] Record: 4-10, 2-4 (Big East)Returning Lettermen: 20Returning Starters: 7Series Record: Hofstra leads, 11-2Last Meeting: 2011-Hofstra won, 8-5Athletic Web Site: RedStormSports.com

UNIVERSITY OF UNIVERSITY OF DELAWAREDELAWARE

Saturday, March 17 at Hofstra

Location: Newark, DENickname: Fightin’ Blue HensDirector of Athletics: Bernard MuirLacrosse Stadium: Rullo Stadium

(2,000)Press Box Phone: (302) 831-3526Head Lacrosse Coach: Bob

ShillinglawRecord at School/Years: 275-246/33

yearsOverall Record: 299-262/35 yearsCoach’s Office Phone: (302) 831-8661Men’s Lacrosse SID: Scott SelheimerOffice Phone: (302) 831-2186Fax: (302) 831-8653E-mail: [email protected] Record: 11-7/4-2 (CAA)Returning Lettermen: 26Returning Starters: 5Series Record: Hofstra leads, 23-12Last Meeting: 2011-Delaware won,

10-9Athletic Web Site: BlueHens.com

UNIVERSITY OF UNIVERSITY OF NOTRE DAMENOTRE DAME

Saturday, March 10 at Hofstra

Location: Notre Dame, IN Nickname: Fighting IrishDirector of Athletics: Jack SwarbrickLacrosse Stadium: Arlotta Stadium

(2,500)Head Lacrosse Coach: Kevin CorriganRecord at School/Years: 217-106/23

yearsOverall Record: 227-121/25 yearsCoach’s Office Phone: (574) 631-5108Men’s Lacrosse SID: Sean CarrollOffice Phone: (574) 631-2664Fax: (574) 631-7941E-mail: [email protected] Record: 11-3/5-1 (Big East)Returning Lettermen: 18Returning Starters: 6Series Record: Hofstra leads, 7-6Last Meeting: 2006-Hofstra won, 13-5Athletic Web Site: UND.com

HARVARD HARVARD UNIVERSITYUNIVERSITY

Saturday, March 3 at Harvard

Location: Cambridge, MANickname: CrimsonDirector of Athletics: Robert L.

Scalise Lacrosse Stadium: Soldiers Field

Soccer Stadium (4,500)Press Box Phone: (617) 495-5902Head Lacrosse Coach: Chris WojcikRecord at School/Years: 10-6/1 yearOverall Record: SameCoach’s Office Phone: (617) 495-4890Men’s Lacrosse SID: Tim WilliamsonOffice Phone: (617) 495-2206Fax: (617) 495-1230E-mail: [email protected] Record: 10-6/3-3 (Ivy)Returning Lettermen: 30Returning Starters: 9Series Record: Hofstra leads, 9-8Last Meeting: 2001-Hofstra won, 15-9Athletic Web Site: GoCrimson.com

FAIRFIELD UNIVERSITYUNIVERSITY

Tuesday, February 28 at Hofstra

Location: Fairfield, CTNickname: StagsDirector of Athletics: Eugene P. DorisLacrosse Stadium: Lessing Field (600)Head Lacrosse Coach: Andrew

CopelanRecord at School/Years: 23-20/3 yearsOverall Record: 41-35/5 yearsCoach’s Office Phone: (203) 254-4000Men’s Lacrosse SID: Chris O’ConnorOffice Phone: (203) 254-4000 ext.

2878Fax: (203) 254-4117E-mail: [email protected] Record: 8-8/3-3 (ECAC)Returning Lettermen: 24Returning Starters: 8Series Record: Hofstra leads, 2-0Last Meeting: 2011-Hofstra won, 8-7Athletic Web Site: FairfieldStags.com

PRINCETON UNIVERSTIYUNIVERSTIY

Saturday, February 25 at Princeton

Location: Princeton, NJNickname: TigersDirector of Athletics: Gary D. WaltersLacrosse Stadium: Class of 1952

Stadium (6,000)Press Box Phone: (609) 258-

2401/2472Head Lacrosse Coach: Chris BatesRecord at School/Years: 15-13/2 yearsOverall Record: 85-84/12 yearsCoach’s Office Phone: (609) 258-4978Men’s Lacrosse SID: Jerry PriceOffice Phone: (609) 258-3569Fax: (609) 258-2399E-mail: [email protected] Record: 4-8/2-4 (Ivy)Returning Lettermen: 34Returning Starters: 8Series Record: Hofstra leads 13-11Last Meeting: 2011-Hofstra won, 11-9Athletic Web Site: GoPrincetonTigers.com

SACRED HEART UNIVERSITYUNIVERSITY

Saturday, February 18 at Hofstra

Location: Fairfield, CTNickname: PioneersDirector of Athletics: C. Donald Cook Lacrosse Stadium: Campus Field

(4,000)Press Box Phone: (203) 365-7532Head Lacrosse Coach: Tom MarianoRecord at School/Years: 86-125/15

yearsOverall Record: 100-137/17 yearsCoach’s Office Phone: (203) 365-7563Men’s Lacrosse SID: Katie SullivanOffice Phone: (203) 365-4813Fax: (203) 371-7889E-mail: [email protected] Record: 4-9/1-4 (NEC)Returning Lettermen: 42Returning Starters: 8Series Record: Hofstra leads10-0Last Meeting: 2011-Hofstra won, 10-6Athletic Web Site:

SacredHeartPioneers.com

2012 OPPONENTS2012 OPPONENTS


UNIVERSITY OF MASSACHUSETTSSaturday, February 23 at MassachusettsLocation: Amherst, MA

Nickname: Minutemen

Director of Athletics: John F.

McCutcheon

Lacrosse Stadium: Richard F. Garber

Field (5,000)

Press Box Phone: (413) 687-1756

Head Lacrosse Coach: Greg Cannella

Record at School/Years: 117-69/13

years

Overall Record: Same

Coach’s Offi ce Phone: (413) 545-3782

Men’s Lacrosse SID: Jason Yellin

Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556

E-mail: [email protected]

2007 Record: 7-7/4-3 (ECAC)

Returning Lettermen/Starters: 24/7

Series Record: Massachusetts leads

18-14

Last Meeting: 2007-Massachusetts

won, 11-10 (OT)

Athletic Web Site: www.

umassathletics.com


Nickname: Minutemen


McCutcheon


Field (5,000)




years




Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556


2007 Record: 7-7/4-3 (ECAC)



18-14


won, 11-10 (OT)


Nickname: Minutemen


McCutcheon


Field (5,000)




years




Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556


2007 Record: 7-7/4-3 (ECAC)



18-14


won, 11-10 (OT)


umassathletics.com


Nickname: Minutemen


McCutcheon


Field (5,000)




years




Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556


2007 Record: 7-7/4-3 (ECAC)



18-14


won, 11-10 (OT)


Nickname: Minutemen


McCutcheon


Field (5,000)




years




Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556


2007 Record: 7-7/4-3 (ECAC)



18-14


won, 11-10 (OT)


umassathletics.com


Nickname: Minutemen


McCutcheon


Field (5,000)




years




Offi ce Phone: (413) 577-3061

Fax: (413) 545-1556


2007 Record: 7-7/4-3 (ECAC)



18-14


won, 11-10 (OT)


umassathletics.com

2012

LACROSS

UNIVERSITY OF UNIVERSITY OF MASSACHUSETTSMASSACHUSETTS

Saturday, April 21 at Foxborough, MA

Location: Amherst, MANickname: MinutemenDirector of Athletics: John F.

McCutcheonLacrosse Stadium: Richard F. Garber

Field (5,000)Head Lacrosse Coach: Greg CannellaRecord at School/Years: 149-95/17

yearsOverall Record: SameCoach’s Office Phone: (413) 545-3782Men’s Lacrosse SID: John SinnettOffice Phone: (413) 577-3061Fax: (413) 545-1556E-mail: [email protected] Record: 10-5/4-2 (CAA)Returning Lettermen: 25Returning Starters: 10Series Record: Massachusetts leads,

19-17Last Meeting: 2011-Hofstra won, 14-5Athletic Web Site: UMassAthletics.com

DARTMOUTH DARTMOUTH COLLEGECOLLEGE

Tuesday, April 3 at Hofstra

Location: Hanover, NHNickname: Big GreenDirector of Athletics: Harry SheehyLacrosse Stadium: Scully-Fahey Field

(1,600)Head Lacrosse Coach: Andrew TowersRecord at School/Years: 10-17/2 yearsOverall Record: 10-31/3 yearsCoach’s Office Phone: (603) 646-8157Men’s Lacrosse SID: Chip WhippleOffice Phone: (603) 646-0424Fax: (603) 646-3348E-mail: [email protected] Record: 5-9/1-5 (Ivy)Returning Lettermen: 32Returning Starters: 10Series Record: Hofstra leads, 5-2Last Meeting: 1979-Hofstra won,

12-10Athletic Web Site: dartmouthsports.com

PENN STATE PENN STATE UNIVERSITYUNIVERSITY

Saturday, April 28 at Penn State

Location: State College, PANickname: Nittany LionsDirector of Athletics: Tim CurleyLacrosse Stadium: Jeffrey Field

(5,000)Head Lacrosse Coach: Jeff TambroniRecord at School/Years: 7-7/1 yearOverall Record: 116-47/11 yearsCoach’s Office Phone: (814) 863-7470Men’s Lacrosse SID: Matt CaracappaOffice Phone: (814) 865-1757Fax: (814) 863-3165E-mail: [email protected] Record: 7-7/5-1 (CAA)Returning Lettermen: 26Returning Starters: 8Series Record: Hofstra leads, 9-5Last Meeting: 2011-Hofstra won, 9-4Athletic Web Site: GoPSUSports.com

SAINT JOSEPH’S UNIVERSITYUNIVERSITY

Saturday, April 7 at Hofstra

Location: Philadelphia, PANickname: HawksDirector of Athletics: Don DiJuliaLacrosse Stadium: Finnesey Field

(600)Head Lacrosse Coach: Taylor WrayRecord at School/Years: First yearOverall Record: First yearCoach’s Office Phone: (610) 660-1733Men’s Lacrosse SID: Chris HumbrechtOffice Phone: (610) 660-2601Fax: (610) 660-1724E-mail: [email protected] Record: 0-12/0-6 (CAA)Returning Lettermen: 27Returning Starters: 7Series Record: Hofstra leads, 1-0Last Meeting: 2011-Hofstra won, 11-3Athletic Web Site: SJUHawks.com

UNIVERSITY OF UNIVERSITY OF NORTH NORTH

CAROLINACAROLINASaturday, April 14 at

Charlotte, NC

Location: Chapel Hill, NCNickname: Tar HeelsDirector of Athletics: Bubba

CunninghamLacrosse Stadium: Fetzer FieldHead Lacrosse Coach: Joe BreschiRecord at School/Years: 35-15/3 yearsOverall Record: 127-78/14 yearsCoach’s Office Phone: (919) 962-5216Men’s Lacrosse SID: Dave LohseOffice Phone: (919) 962-7257Fax: (919) 962-0612E-mail: [email protected] Record: 10-6/1-2 (ACC)Returning Lettermen: 32Returning Starters: 6Series Record: Hofstra leads, 6-3Last Meeting: 2009-North Carolina

won, 13-8Athletic Web Site: tarheelblue.com

TOWSON UNIVERSITYUNIVERSITY

Saturday, April 2 at Towson

Location: Towson, MDNickname: TigersDirector of Athletics: Mike WaddellLacrosse Stadium: Johnny Unitas

Stadium (11,198)Press Box Phone: (410) 704-3102Head Lacrosse Coach: Shawn NadelenRecord at School/Years: First yearOverall Record: First yearCoach’s Office Phone: (410) 704-4968Men’s Lacrosse SID: Eric RhewOffice Phone: (410) 704-6258Fax: (410) 704-3861E-mail: [email protected] Record: 3-10/1-5 (CAA)Returning Lettermen: 26Returning Starters: 6Series Record: Hofstra leads, 24-18Last Meeting: 2011-Hofstra won, 12-5Athletic Web Site: TowsonTigers.com

PRIDE TO PRIDE TO TRAVEL TO TRAVEL TO

JAPANJAPANThe Hofstra Men’s Lacrosse team will travel

to Japan to compete in a series of exhibition

contests from May 30-June 7, 2012. The

Pride will play a minimum of four contests

against the Japanese National team, U21

National team and various universities. The

International Friendship Game, versus the

Japanese National team has seen crowds in

upwards of 9,000 fans at Edogawa Stadium

along with Japanese politicians and royalty

in attendance.

2012 OPPONENTS2012 OPPONENTS


2012 NCAA DIVISION I COMPOSITE SCHEDULE 2012 NCAA DIVISION I FEBRUARY 4Detroit at Delaware 1 p.m.

FEBRUARY 9Detroit at Ohio State 7 p.m.

FEBRUARY 10Massachusetts at Army 3 p.m.

FEBRUARY 11Rutgers at Duke 12 p.m.VMI at Navy 12 p.m.Robert Morris at Bellarmine 1 p.m.Delaware at Bucknell 1 p.m.Bryant at Colgate 1 p.m.Towson at Jacksonville 1 p.m.Ohio State at Mercer 1 p.m.North Carolina vs. Penn State (Kennesaw, Ga.) 1 p.m.Lehigh at Saint Joseph’s 2 p.m.

FEBRUARY 12North Carolina vs. Mercer (Atlanta, Ga.) 1 p.m.Detroit vs. Michigan (Pontiac, Mich.) 1 p.m.

FEBRUARY 15Wagner at Army 3 p.m.

FEBRUARY 17Towson at Johns Hopkins 5 p.m.

FEBRUARY 18VMI at Army 12 p.m.Vermont at Colgate 12 p.m.Villanova at Lehigh 12 p.m.Detroit at North Carolina 12 p.m.Sacred Heart at Hofstra 12:30 p.m.Saint Joseph’s at Bryant 1 p.m.Delaware at Loyola 1 p.m.Hartford at Maryland 1 p.m.Robert Morris at UMBC 1 p.m.Bucknell at Massachusetts 1 p.m.Bellarmine at Mercer 1 p.m.Duke at Notre Dame 1 p.m.Michigan at Penn State 1 p.m.Holy Cross at St. John’s 1 p.m.Virginia at Drexel 2 p.m.Stony Brook at Fairfi eld 3 p.m.Providence at Lafayette 3:30 p.m.

FEBRUARY 19Air Force vs. Rutgers (Syracuse, N.Y.) 11 amDenver vs. Ohio State * 2 p.m.Albany at Syracuse 2 p.m.Navy at Jacksonville * 4 p.m.Hobart vs. Siena (Syracuse, N.Y.) 5 p.m.* Moe’s Southwest Grill Classic (EverBank Field, Jacksonville, Fla.)

FEBRUARY 21Rutgers at Wagner 2 p.m.Delaware at Johns Hopkins 5 p.m.VMI at Virginia 7 p.m.

FEBRUARY 24Penn at Duke 7 p.m.Maryland at Georgetown 7 p.m.

FEBRUARY 25Mount St. Mary’s at Delaware 12 p.m.Vermont at Harvard 12 p.m.North Carolina at Navy 12 p.m.Bucknell at Villanova 12 p.m.Stony Brook at Virginia 12 p.m.

Saint Joseph’s at VMI 12 p.m.Drexel at Albany 1 p.m.Lafayette at Binghamton 1 p.m.Dartmouth at Colgate 1 p.m.Bryant at Fairfi eld 1 p.m.Holy Cross at Hartford 1 p.m.Cornell at Hobart 1 p.m.Manhattan at Lehigh 2 p.m.Towson at Loyola 1 p.m.Detroit at Mercer 1 p.m.Hofstra at Princeton 1 p.m.Massachusetts at Ohio State 1 p.m.Air Force vs. Robert Morris (Denver, Colo.) 1 p.m.St. John’s at Yale 1:30 p.m.Wagner at Providence 2 p.m.Siena at Johns Hopkins 3 p.m.Michigan at Denver 3:30 p.m.

FEBRUARY 26Brown at Quinnipiac 12 p.m.UMBC at Rutgers 12 p.m.Jacksonville at Duke 1 p.m.Air Force vs. Michigan (Denver, Colo.) 1 p.m.Penn State at Notre Dame 1 p.m.Marist at Sacred Heart 1 p.m.Army at Syracuse 2 p.m.Robert Morris at Denver 3:30 p.m.

FEBRUARY 28Binghamton at Cornell 4 p.m.Harvard at Holy Cross 4 p.m.Virginia at Mount St. Mary’s 4 p.m.Manhattan at Princeton 4 p.m.Fairfi eld at Hofstra 7 p.m.Wagner at Lafayette 7 p.m.Lehigh at Penn 7 p.m.Drexel at Villanova 7 p.m.

MARCH 2Michigan at Jacksonville 3:30 p.m.Johns Hopkins at Princeton 5 p.m.Loyola at Bellarmine 7 p.m.

MARCH 3Villanova at Delaware 12 p.m.Bucknell at Navy 12 p.m.Colgate at Robert Morris 12 p.m.Quinnipiac at Air Force 1 p.m.Massachusetts at Brown 1 p.m.Army at Cornell 1 p.m.Detroit at Georgetown 1 p.m.Binghamton at Hobart 1 p.m.Duke at Maryland 1 p.m.Penn State at Ohio State 1 p.m.Lafayette at Rutgers 1 p.m.Siena at St. John’s 1 p.m.Marist at Stony Brook 1 p.m.Mount St. Mary’s at Towson 1 p.m.Albany at Yale 1 p.m.Notre Dame at Drexel 2 p.m.Providence at Manhattan 2 p.m.Saint Joseph’s at Wagner 2 p.m.Sacred Heart at Dartmouth 2:30 p.m.Hartford at Denver 3 p.m.Vermont at Bryant 3 p.m.Hofstra at Harvard 3 p.m.Fairfi eld at UMBC 3 p.m.Lehigh at North Carolina 7:30 p.m.

MARCH 4Mercer vs. Michigan 12 p.m.Holy Cross at Jacksonville 3:30 p.m.

Syracuse at Virginia 4:30 p.m.

MARCH 6Holy Cross vs. Mercer (Jacksonville, Fla.) 1 p.m.Bellarmine at Dartmouth 3 p.m.Albany at Massachusetts 3 p.m.Lehigh at VMI 3 p.m.Manhattan at Johns Hopkins 3:30 p.m.Hobart at Colgate 4 p.m.Canisius at Cornell 4 p.m.Drexel at Saint Joseph’s 4 p.m.Rutgers at Army 7 p.m.Maryland at UMBC 7 p.m.North Carolina at Penn 7 p.m.Sacred Heart at Yale 7 p.m.Vermont at Virginia 7 p.m.

MARCH 7Hartford at Brown 3 p.m.Fairfi eld at Quinnipiac 3 p.m.Loyola at Michigan 7 p.m.

MARCH 9Robert Morris at Ohio State 7 p.m.

MARCH 10North Carolina vs. Princeton * 11 amColgate at Holy Cross 12 p.m.Navy at Lafayette 12 p.m.Duke at Loyola 12 p.m.Canisius at Albany 1 p.m.Siena at Binghamton 1 p.m.Drexel at Bryant 1 p.m.Hobart at Bucknell 1 p.m.Harvard at Georgetown 1 p.m.Mercer at Jacksonville 1 p.m.Marist at Maryland 1 p.m.Hartford at Massachusetts 1 p.m.VMI at Mount St. Mary’s 1 p.m.Denver at Penn State 1 p.m.Detroit at Quinnipiac 1 p.m.Manhattan at Sacred Heart 1 p.m.Syracuse at St. John’s 1 p.m.Brown at Saint Joseph’s 1 p.m.Cornell vs. Virginia * 1:30 p.m.Army vs. Air Force (Houston, Texas) 2 p.m.Stony Brook at Delaware 3 p.m.Notre Dame at Hofstra 3 p.m.Villanova at Penn 3 p.m.Johns Hopkins vs. UMBC * 4 p.m.* Konica Minolta Face-Off Classic (M&T

Bank Stadium, Baltimore, Md.)

MARCH 11Yale at Lehigh 1 p.m.Fairfi eld at Vermont 1 p.m.

MARCH 12Harvard at Duke 7 p.m.

MARCH 13Colgate at Binghamton 3 p.m.Lafayette at Fairfi eld 3 p.m.Manhattan at Mercer 3 p.m.Wagner at VMI 3 p.m.Bucknell at Drexel 4 p.m.Quinnipiac at Saint Joseph’s 4 p.m.Mount St. Mary’s at Georgetown 7 p.m.Vermont at Holy Cross 7 p.m.Marist at Rutgers 7 p.m.St. John’s at Stony Brook 7 p.m.Princeton at Villanova 7 p.m.Navy at Towson 7:30 p.m.

MARCH 14Siena at Hartford 3:30 p.m.

MARCH 16Wagner at Mercer 1 p.m.North Carolina at Duke 5 p.m.

MARCH 17Delaware at Hofstra 1 p.m.Air Force at Loyola 12 p.m.Holy Cross at Navy 12 p.m.Massachusetts at Penn State 12 p.m.Bryant at Albany 1 p.m.Fairfi eld at Colgate 1 p.m.Yale at Cornell 1 p.m.Robert Morris at Hobart 1 p.m.Army at Lehigh 1 p.m.Binghamton at Manhattan 1 p.m.Jacksonville at Marist 1 p.m.Villanova at Maryland 1 p.m.Virginia at Ohio State 1 p.m.Georgetown at Providence 1 p.m.Towson at Stony Brook 1 p.m.Sacred Heart at Vermont 1 p.m.Siena at VMI 1 p.m.Quinnipiac at Hartford 2 p.m.Penn at Princeton 2 p.m.Lafayette at Bucknell 3 p.m.Bellarmine at Michigan 3 p.m.St. John’s at Rutgers 3 p.m.Syracuse at Johns Hopkins 4 p.m.Drexel at Mount St. Mary’s 4 p.m.Brown at Harvard 7 p.m.Detroit at Canisius TBA

MARCH 18Dartmouth at Duke 1 p.m.Denver at Notre Dame 1 p.m.

MARCH 20Stony Brook at Siena 3 p.m.Cornell vs. Denver (Hempstead, N.Y.) 4 p.m.Hobart at Canisius 7 p.m.St. John’s at Hofstra 7 p.m.Lehigh at Penn State 7 p.m.Robert Morris at Bucknell 7:30 p.m.

MARCH 21Hartford at Sacred Heart 3 p.m.Dartmouth at North Carolina 4 p.m.Notre Dame at Ohio State 4 p.m.Georgetown at Loyola 7 p.m.Providence at Syracuse 7 p.m.Mercer at Towson 7:30 p.m.

MARCH 24Manhattan at Canisius 11 amAlbany at Bucknell 12 p.m.Marist at Detroit 12 p.m.Hobart at Fairfi eld 12 p.m.Duke at Georgetown 12 p.m.Maryland at North Carolina 12 p.m.Princeton at Yale 12 p.m.Stony Brook at Bryant 1 p.m.VMI at Jacksonville 1 p.m.Army at Lafayette 1 p.m.Holy Cross at Lehigh 1 p.m.Cornell at Penn 1 p.m.Binghamton at Quinnipiac 1 p.m.Penn State at Saint Joseph’s 1 p.m.Brown at Vermont 1 p.m.Navy at Colgate 2 p.m.Wagner at Hartford 2 p.m.

012

LACROSSE


2012 NCAA DIVISION I COMPOSITE SCHEDULE COMPOSITE SCHEDULEDartmouth at Harvard 2 p.m.Providence at Siena 2 p.m.Johns Hopkins at Virginia 2 p.m.Denver at Air Force 3 p.m.Mount St. Mary’s at Michigan 3 p.m.Hofstra at Drexel 7 p.m.Loyola at UMBC 7 p.m.Bellarmine at Ohio State 7 p.m.St. John’s at Sacred Heart 7 p.m.Delaware at Towson 7:30 p.m.

MARCH 25Rutgers at Notre Dame 1 p.m.Villanova at Syracuse 2 p.m.

MARCH 27Brown at Duke 3 p.m.Air Force vs. Jacksonville (The Bolles School) 7 p.m.Harvard at Massachusetts 7 p.m.Bucknell at Penn State 7 p.m.Bryant at Providence 7 p.m.

MARCH 30Lehigh at Navy 7 p.m.

MARCH 31Colgate at Army 12 p.m.Virginia at Maryland 12 p.m.Binghamton at Albany 1 p.m.Fairfi eld at Bellarmine 1 p.m.Cornell at Dartmouth 1 p.m.Sacred Heart at Bryant 1 p.m.Michigan at Harvard 1 p.m.Bucknell at Holy Cross 1 p.m.Ohio State at Loyola 1 p.m.Detroit at Manhattan 1 p.m.Saint Joseph’s at Massachusetts 1 p.m.Quinnipiac at Mount St. Mary’s 1 p.m.Villanova at Penn State 1 p.m.Jacksonville at Siena 1 p.m.Vermont at Stony Brook 1 p.m.Marist at VMI 1 p.m.Robert Morris at Wagner 1 p.m.Penn at Yale 1 p.m.Mercer at Air Force 2 p.m.Princeton at Brown 3 p.m.Hobart at Denver 3 p.m.Georgetown at Lafayette 4 p.m.Drexel at Delaware 7 p.m.Towson at Hofstra 7 p.m.Hartford at UMBC 7 p.m.Rutgers at Providence 7 p.m.

APRIL 1Notre Dame vs. St. John’s * 1 p.m.Duke vs. Syracuse * 4 p.m.North Carolina vs. Johns Hopkins * 6:30 p.m.* Konica Minolta Big City Classic (MetLife

Stadium, East Rutherford, N.J.)

APRIL 3Canisius at Binghamton 7 p.m.Bryant at Brown 7 p.m.Dartmouth at Hofstra 7 p.m.Wagner at Manhattan 7 p.m.Lafayette at Marist 7 p.m.Yale at Providence 7 p.m.

APRIL 4Georgetown at Villanova 7 p.m.UMBC at Towson 7:30 p.m.

APRIL 5Albany at Johns Hopkins 7 p.m.

APRIL 6Navy at Maryland 7 p.m.Bellarmine at Denver 9 p.m.

APRIL 7Siena at Detroit 11 amArmy at Bucknell 12 p.m.Marist at Duke 12 p.m.Ohio State at Hobart 12 p.m.Virginia at North Carolina 12 p.m.Robert Morris at Sacred Heart 12 p.m.Mount St. Mary’s at Bryant 1 p.m.Harvard at Cornell 1 p.m.Yale at Dartmouth 1 p.m.Loyola at Fairfi eld 1 p.m.St. John’s at Georgetown 1 p.m.Saint Joseph’s at Hofstra 1 p.m.Canisius at Jacksonville 1 p.m.VMI at Manhattan 1 p.m.Towson at Massachusetts 1 p.m.Delaware at Michigan 1 p.m.Wagner at Quinnipiac 1 p.m.Villanova at Rutgers 1 p.m.UMBC at Vermont 1 p.m.Providence at Notre Dame 1:30 p.m.Lehigh at Colgate 2 p.m.Penn State at Drexel 2 p.m.Lafayette at Holy Cross 4 p.m.Princeton at Syracuse 4 p.m.Stony Brook at Binghamton 7 p.m.Albany at Hartford 7 p.m.Brown at Penn 7:30 p.m.

APRIL 8Bellarmine at Air Force 2 p.m.

APRIL 9Mercer at Delaware 3 p.m.

APRIL 10Penn at Bucknell 7 p.m.Syracuse at Cornell 7 p.m.Quinnipiac at Harvard 7 p.m.Bryant at Holy Cross 7 p.m.Rutgers at Princeton 7 p.m.

APRIL 13Duke at Virginia 6 p.m.Yale at Brown 7 p.m.

APRIL 14Ohio State at Michigan 11 amRutgers vs. Syracuse* (Charlotte, N.C.) 11 amNavy at Army 12 p.m.Jacksonville at Detroit 12 p.m.Harvard at Penn 12 p.m.Hobart at Bellarmine 1 p.m.Lafayette at Colgate 1 p.m.Saint Joseph’s at Delaware 1 p.m.Dartmouth at Princeton 1 p.m.Bryant at Quinnipiac 1 p.m.Sacred Heart at Wagner 1 p.m.North Carolina vs. Hofstra* (Charlotte, N.C.) 1:30 p.m.Fairfi eld at Air Force 2 p.m.Drexel vs. Massachusetts ( Bethpage, N.Y.) 2 p.m.Mercer at VMI 2 p.m.Canisius at Siena 3 p.m.Mount St. Mary’s at Robert Morris 4 p.m.Maryland at Johns Hopkins 6 p.m.Vermont at Albany 7 p.m.

Binghamton at Hartford 7 p.m.Bucknell at Lehigh 7 p.m.Manhattan at Marist 7 p.m.Stony Brook at UMBC 7 p.m.Holy Cross at Providence 7 p.m.St. John’s at Villanova 7 p.m.Penn State at Towson 7:30 p.m.Loyola at Denver 9 p.m.* - ESPNU Warrior Classic at American

Legion Stadium

APRIL 15Notre Dame at Georgetown 1 p.m.

APRIL 16Yale at Stony Brook 7 p.m.

APRIL 17Providence at Brown 7 p.m.Syracuse at Hobart 7 p.m.Penn at Saint Joseph’s 7 p.m.

APRIL 20Colgate at Bucknell 7 p.m.Bryant at Yale 7 p.m.ACC Semifi nals (Charlottesville, Va.) 5/7:30

p.m.

APRIL 21Air Force at Ohio State 11 amHoly Cross at Army 12 p.m.Bellarmine at Detroit 12 p.m.Loyola at Hobart 12 p.m.Johns Hopkins at Navy 12 p.m.VMI at Canisius 1 p.m.Penn at Dartmouth 1 p.m.Denver at Fairfi eld 1 p.m.Princeton at Harvard 1 p.m.Manhattan at Jacksonville 1 p.m.Albany at UMBC 1 p.m.Saint Joseph’s at Mercer 1 p.m.Sacred Heart at Mount St. Mary’s 1 p.m.Providence at St. John’s 1 p.m.Marist at Siena 1 p.m.Lehigh at Lafayette 2 p.m.Quinnipiac at Robert Morris 2 p.m.Brown at Cornell 3 p.m.Georgetown at Syracuse 3 p.m.Binghamton at Vermont 3 p.m.Hofstra vs. Massachusetts (Foxborough, Mass.) 4 p.m.Notre Dame at Villanova 5:30 p.m.Delaware at Penn State 7 p.m.Michigan at Rutgers 7 p.m.Hartford at Stony Brook 7 p.m.Drexel at Towson 7:30 p.m.

APRIL 22Wagner at Bryant 1 p.m.ACC Championship (Charlottesville, Va.) 3:30 p.m.

APRIL 24Dartmouth at Vermont 4 p.m.Siena at Albany 7 p.m.Saint Joseph’s at Marist 7 p.m.

APRIL 25Maryland at Mount St. Mary’s 7 p.m.

APRIL 27Patriot League Semifi nals (Site TBA) 5/7:45 p.m.Massachusetts at Delaware 7 p.m.

Rutgers at Georgetown 7 p.m.Virginia vs. Penn * 7:30 p.m.Denver vs. Duke * 10 p.m.* Mile High Classic (Sports Authority Field,

Denver, Colo.)

APRIL 28Hofstra at Penn State 12 p.m.Ohio State at Fairfi eld 1 p.m.Johns Hopkins at Loyola 1 p.m.Canisius at Marist 1 p.m.Bellarmine at Maryland 1 p.m.Bryant at Robert Morris 1 p.m.Quinnipiac at Sacred Heart 1 p.m.Towson at Saint Joseph’s 1 p.m.Mount St. Mary’s at Wagner 1 p.m.Harvard at Yale 1 p.m.Villanova at Providence 2 p.m.Detroit at VMI 2 p.m.Dartmouth at Brown 3 p.m.St. John’s at Drexel 4 p.m.Syracuse at Notre Dame 5 p.m.Stony Brook at Albany 7 p.m.UMBC at Binghamton 7 p.m.Vermont at Hartford 7 p.m.Air Force at Hobart 7 p.m.Siena at Manhattan 7 p.m.Cornell at Princeton 7 p.m.

APRIL 29Patriot League Championship (Site TBA) 3 p.m.

MAY 1Holy Cross at Dartmouth 4 p.m.

MAY 2America East Semifi nals (Site TBA)

TBACAA Semifi nals (Site TBA) TBA

MAY 3BIG EAST Championship (Villanova, Pa.) 4:30 /7

p.m.ECAC Championship (Denver, Colo.) TBA

MAY 4Ivy League Championship (Site TBA) TBAMAAC Semifi nals (Poughkeepsie, N.Y.) TBANEC Semifi nals (Site TBA) TBA

MAY 5BIG EAST Championship (Villanova, Pa.) 12 p.m.Maryland at Colgate 1 p.m.Army at Johns Hopkins 2 p.m.America East Championship (Site TBA) 3 p.m.Michigan at North Carolina 7 p.m.CAA Championship (Site TBA) TBAECAC Championship (Denver, Colo.) TBA

MAY 6Ivy League Championship (Site TBA) TBAMAAC Championship ( Poughkeepsie, N.Y.) TBANEC Championship (Site TBA) TBAAll Times Eastern

2012

LACROSS

012

LACROSSE


2011 NCAA Tournament

Recap: First Round (May 14-15)Home Team Visitor#1 Syracuse 10 Siena 4#2 Cornell 12 Hartford 5#3 Johns Hopkins 12 Hofstra 5#4 Notre Dame 13 Penn 6#5 Duke 15 Delaware 14#6 Denver 13 Villanova 10#7 Virginia 13 Bucknell 12#8 North Carolina 6 Maryland 13

Quarterfi nalsat Hempstead, NewYork, May 21:#6 Denver 14 #3 Johns Hopkins 9#7 Virginia 13 #2 Cornell 9

at Foxborough, Massachusetts, May 22:Maryland 6 #1 Syracuse 5#5 Duke 7 #4 Notre Dame 5

Semifi nals at Baltimore, Maryland May 28:#7 Virginia 14 #6 Denver 8Maryland 6 #5 Duke 3

Championship at Baltimore, Maryland May 30:#7 Virginia 9 Maryland 7

NCAA TOURNAMENT APPEARANCESTeam Yrs. Won Lost LastÅJohns Hopkins 40 65 31 2011Maryland 34 44 32 2011Virginia 34 47 29 2011Syracuse 30 59 20 2011Navy 26 16 26 2009North Carolina 26 27 22 2011Cornell 24 30 21 2011Princeton 19 30 13 2010Massachusetts 18 9 18 2009Loyola 17 9 17 2010Hofstra 17 4 17 2011Army 16 4 16 2010Notre Dame 16 9 16 2011Duke 15 22 14 2011Brown 12 5 12 2009Georgetown 11 10 11 2007Pennsylvania 11 2 11 2011Towson 10 7 10 2007Rutgers 9 2 9 2004Wash. & Lee 8 3 8 1980Delaware 6 3 6 2011Harvard 5 2 5 2006UMBC 5 1 5 2009Adelphi 4 2 4 1989Denver 4 2 4 2011Albany 4 1 4 2007Yale 3 2 3 1992Ohio State 3 1 3 2008Michigan State 3 0 3 1991Hobart 3 0 3 2004Providence 3 0 3 2007Air Force 2 0 2 1988Fairfi eld 2 0 2 2005Penn State 2 0 2 2005Siena 2 0 2 2011Villanova 2 0 2 2011Stony Brook 2 1 2 2010Mt. St. Mary’s 2 0 2 2010Bucknell 2 0 2 2011Cortland State 1 1 1 1972LIU-C.W. Post 1 0 1 1986New Hampshire 1 0 1 1986No. Carolina St. 1 0 1 1979Butler 1 0 1 1998Manhattan 1 0 1 2002Dartmouth 1 0 1 2003Marist 1 0 1 2005Canisius 1 0 1 2008Colgate 1 0 1 2008Hartford 1 0 1 2011

NCAA DIVISION I MEN’S LACROSSE CHAMPIONS 1971 - Cornell1972 - Virginia1973 - Maryland1974 - Johns Hopkins1975 - Maryland1976 - Cornell1977 - Cornell1978 - Johns Hopkins1979 - Johns Hopkins1980 - Johns Hopkins1981 - North Carolina1982 - North Carolina1983 - Syracuse1984 - Johns Hopkins1985 - Johns Hopkins1986 - North Carolina1987 - Johns Hopkins1988 - Syracuse1989 - Syracuse1990 - Title vacated (by Syracuse)1991 - North Carolina1992 - Princeton1993 - Syracuse1994 - Princeton1995 - Syracuse1996 - Princeton1997 - Princeton1998 - Princeton1999 - Virginia2000 - Syracuse2001 - Princeton2002 - Syracuse2003 - Virginia2004 - Syracuse2005 - Johns Hopkins2006 - Virginia2007 - Johns Hopkins2008 - Syracuse2009 - Syracuse2010 - Duke2011 - Virginia

The Pride equaled their best NCAA Championship seeding with a number three placement in 2006. Hofstra defeated Providence at Shuart Stadium, 14-8, in the fi rst round before losing a heart-breaking 11-10 overtime decision to Massachusetts in the quarterfi nal at Stony Brook. In 1973, the Flying Dutchmen were ranked third in the eight-team tournament fi eld and lost to Virginia, 12-5 in the fi rst round. In 1971 Hofstra was seeded fi fth and lost to Army, 19-3, in the fi rst round. In 1975, 1993 and 1996, the Dutchmen were seeded sixth. In 1975 Hofstra lost to Mary-land, 19-7. In 1993 Hofstra dumped Massachusetts, 9-8, in the fi rst round of the fi eld of 12 before losing to eventual national champion Syracuse, 20-8, in the quarterfi nals. In 1996 Hofstra dropped a 15-12 decision to Harvard. In both 1974 and 1978, the Dutchmen were ranked seventh and dropped fi rst round games to Johns Hopkins each year. In 1999 Hofstra earned the seventh seed and defeated Navy, 15-7, in the opening round before falling to Johns Hopkins in the quarterfi nals. Hofstra was not seeded in 1997, 2000, 2001, 2003, 2008, 2009, 2010 or 2011.

1971 - Army 19, #5 Hofstra 31973 - Virginia 12, #3 Hofstra 51974 - Johns Hopkins 18, #7 Hofstra 101975 - Maryland 19, #6 Hofstra 71978 - Johns Hopkins 20, #7 Hofstra 81993 - #6 Hofstra 9, Massachusetts 8 Syracuse 20, #6 Hofstra 81996 - Harvard 15, #6 Hofstra 121997 - Massachusetts 6, Hofstra 4 1999 - Hofstra 15, Navy 7 Johns Hopkins 11, Hofstra 7

2000 - Maryland 14, Hofstra 122001 - Hofstra 15, Virginia 14 (OT) Syracuse 18, Hofstra 132003 - Massachusetts 9, Hofstra 6 2006 - #3 Hofstra 14, Providence 8 Massachusetts 11, #3 Hofstra 10 (OT)2008 - Johns Hopkins 10, Hofstra 42009 - Cornell 11, Hofstra 82010 - Maryland 11, Hofstra 82011 - Johns Hopkins 12, Hofstra 5

HOFSTRA IN THE NCAA TOURNAMENT

Hofstra’s Tournament Seeding

NCAA LACROSSE TOURNAMENTNCAA LACROSSE TOURNAMENT

2012

LACROSS


Hofstra hosted the NCAA Division I Quarterfi nals for the seventh time in program history on May 21, 2011 at James M. Shuart Stadium.

James M. Shuart Stadium is the largest outdoor sports complex on Long Island. Opened in 1963, Shuart Stadium has served as the site for NCAA Championships, New York State High School Championships, world cham-pionships, and professional contests.

James M. Shuart Stadium has been an important venue in NCAA Lacrosse history as it served as the site of the fi rst-ever NCAA Lacrosse Championship game in 1971, which saw Cornell post a 12-6 victory over Maryland. Since then the stadium has hosted fi rst round NCAA Tournament games in 1973, 1993 and 2006, and NCAA Quarterfi nals in 1997, 1998, 1999, 2001, 2002, 2009 and 2011.

The largest crowds in James M. Shuart Stadium history occurred during the hosting of the NCAA Lacrosse Quarterfi nals. A stadium record 13,447 people, the largest-ever lacrosse crowd on Long Island, were in attendance for the 2011 NCAA Quarterfi nals, while a crowd of 12,292, a then-NCAA Men’s Lacrosse Championship Quarterfi nal, witnessed the 1999 NCAA Quarterfi nals. In 2001 10,510 fans attended quarterfi nals.

PREVIOUS NCAA CHAMPIONSHIP QUARTERFINALS AT HOFSTRA

1997Princeton*-11, Massachusetts-9Syracuse-13 vs. Loyola-12

1998Princeton*-11, Duke-9Syracuse-17, Virginia-14

1999Johns Hopkins-11, Hofstra-7Georgetown-17, Duke-14

2001Syracuse-18, Hofstra-13Princeton*-8, Loyola-7

2002Syracuse*-10, Duke-9Princeton-14, Georgetown-13

2009Cornell 6, Princeton 4Syracuse* 11, Maryland 6

2011Virginia*-13, Cornell-9Denver-14, Johns Hopkins-9

* National Champion

NCAA DIVISION I NCAA DIVISION I LACROSSE QUARTERFINALSLACROSSE QUARTERFINALS


Hofstra University provides a dynamic college experience tailored for engaged and ambitious individuals. Students fi nd pride and purpose at Hofstra, through small classes, a faculty whose primary concern is teaching, cutting edge technology, extensive library resources, internships, and active and compelling educational programs that appeal to their interests and abilities. The Hofstra community is driven, dynamic and energetic, helping students fi nd and focus their strengths to prepare them for a successful future.

In its relatively short 76-year history, Hofstra has established itself as a world-class institution of higher education and cultural enterprise. Each academic year, the Hofstra campus and the programs offered grow and change to meet the demands of our students and our community.

Hofstra opened in 1935 as a commuter school with all classes and offi ces housed in one building. Since those early days, Hofstra has evolved into an international institution with a student body hailing from 50 states and territories, and 72 countries around the world. The beautiful campus is an accredited arboretum with 115 buildings on 240 acres. There are approximately 4,000 students living on campus, and Hofstra offers them and all students an extensive array of academic and social activities. Additionally, Hofstra’s close proximity to Manhattan means that students have easy access to the wondrous cultural, social and career offerings of the city.

While the campus and its offerings have changed, what has remained consistent throughout the years is the sense of community on campus, the eagerness of our students to learn and the commitment of the Hofstra faculty and administration to provide a challenging education that encourages the pursuit of lifelong learning.

The Colleges and Schools of the University are: Hofstra College of Liberal Arts and Sciences, Frank G. Zarb School of Business, School of Communication, School of Education, Health and Human Services, Maurice A. Deane School of Law, School for University Studies, Honors College, Hofstra University Continuing Education and Hofstra North Shore-LIJ School of Medicine at Hofstra University. Bachelor’s degrees are offered in about 150 areas of study. Graduate degrees are offered, including Ph.D., Ed.D., Psy.D., Au.D., J.D., and M.D. degrees, advanced certifi cates and professional diplomas, in more approximately 160 programs of study.

In October 2011 the Commission on Presidential Debates announced that it had chosen Hofstra University for the site of its October 16, 2012 Presidential Debate, which will be in the “town meeting” format. The Commission on Presidential Debates, a nonprofi t, nonpartisan corporation, has sponsored and produced every presidential and vice-presidential debate since 1988. Hofstra University hosted the third and fi nal presidential debate of the 2008 election cycle, between then Senator Barack Obama and Senator John McCain, on October 15, 2008.

Hofstra joined with North Shore-LIJ Health System in announcing plans to establish a medical school on the University campus in October 2007. The new school, which welcomed its fi rst class in July 2011, is the fi rst allopathic (MD) medical school in Nassau County and the fi rst in New York State since 1963.

In 2011 Hofstra announced that it would launch a School of Engineering and Applied Science with a co-op education program that will partner with a network of industry leaders to offer students substantial work experience before they graduate.

The new school, set to open in September 2012, will combine and expand the University’s existing Engineering and Computer Science departments to develop a curriculum that emphasizes high-tech research, practical work experience and inter-disciplinary study, integrating resources and faculty from other parts of the institution, including the Hofstra North Shore-LIJ School of Medicine and the Frank G. Zarb School of Business.

Hofstra’s School of Communication is one of the largest, most

advanced non-commercial television facilities in the East. Students take classes and work in Dempster Hall, a sophisticated television production/post-production facility with two broadcast-quality studios and control rooms; two advanced online video edit suites; two Avid non-linear digital editing systems and several cuts-only video work stations. Two satellite dishes are available with one dish providing special news feeds for the broadcast journalism room, which also has access to Associated Press, Lexis-Nexis and Dow Jones services. In addition, the facility is capable of broadcasting student-produced programming to the entire campus on our own cable channels. Also located here is the University’s radio station (WRHU/88.7-FM), audio production studios, a fi lm/video screening room, fi lm editing rooms, a computer laboratory, a speech performance studio and a large dance studio.

Hofstra’s C.V. Starr Hall offers academic facilities that are among the most technologically advanced in the nation. Every seat in every classroom allows students direct access to the Internet and Hofstra network, including the resources of Hofstra’s Axinn Library.

Hofstra’s growing computer facilities offer extensive high-tech training opportunities. There are computer terminals throughout the campus for student and faculty use, with more than 750 PC, Macintosh and UNIX workstations available in labs and classrooms.

012

LACROSSE

THIS IS HOFSTRA THIS IS HOFSTRA


Hofstra hosts more than 500 cultural events annually, bringing thousands of scholars, dignitaries and other participants to campus. More than 200 musical and dramatic performances take place on campus each year. The University recently completed a year-long celebration of its 75th anniversary, complete with a concert, academic convocation and cake, several conferences and signature events which brought together students, faculty, alumni and community. In October 2008 the eyes of the world were on Hofstra for the fi nal presidential debate between Barack Obama and John McCain. The debate was a transformational moment for the University, highlighting the achievements of our students and faculty and their engagement in the political process. Leading up to the

debate, students and the entire community were engaged by the year-long Educate ’08 program, almost 150 lectures, conferences, and events focused on the issues, history and politics of the presidency, followed by Defi ne ’09, which looked at the fi rst year of his presidency. The University continues to host important political events, such as the New York State Gubernatorial Debate in 2010.

The Hofstra Museum, which houses one of the largest art collections in the metropolitan area, coordinates approximately eight exhibitions annually and offers exhibition areas and an extensive outdoor sculpture collection, with 75 pieces. The Hofstra Museum is accredited by the American Association of Museums – one of only 94 universities in the nation and one of six in New York to hold that distinction.

Hofstra also has six theaters, a student newspaper, a lively student center, a recently renovated recreation center and numerous athletic facilities, including the 13,000-seat James M. Shuart Stadium and the 5,054-seat David S. Mack Sports and Exhibition Complex.

Hofstra also has an indoor, Olympic-sized (eight lane, 50-meter) swimming pool, one of the largest such facilities in the New York metropolitan area.

The Hofstra athletic program competes on the NCAA Division I level and is a member of the Colonial Athletic Association. The University sponsors 17 intercollegiate programs – eight men’s sports and nine women’s sports. Hofstra has men’s teams in basketball, baseball, lacrosse, golf, tennis, wrestling, soccer and cross country. Women’s

sports include basketball, volleyball, softball, tennis, soccer, fi eld hockey, lacrosse, cross country and golf.

Hofstra’s academic programs are accredited by numerous national agencies and the University is one of only 280 schools, out of more than 3,600 colleges and universities nationwide,

with a chapter of the national honor society Phi Beta Kappa. Of Hofstra’s 1,165 faculty members, 533 are full time and 93 percent hold the highest degree in their fi elds. The average undergraduate class size is 21 students, while student-faculty ratio is 14-to-1.

Hofstra University is 100-percent program accessible to persons with disabilities, and has been cited as a national model for this achievement.

HOFSTRA BY THE NUMBERS 17 Varsity sports

20 Eateries on campus

20 Local and national fraternities and sororities

21 Average undergraduate class size

22 Academic accreditations

37 Residence halls

100 Percent program accessibility to persons with disabilities

175 Student clubs and organizations

500 Cultural events per year

1,165 Faculty members

1935 Founding date

6,804 Full-time undergraduate enrollment

12,000 Total University enrollment, including part-time undergraduate, graduate and School of Law

119,000+ Hofstra alumni

1.2 MILLION Volumes available at Hofstra University Libraries

THIS IS HOFSTRATHIS IS HOFSTRA


012

LACROSSE

Stuart Rabinowitz was chosen by the Hofstra University Board of Trustees to serve as the eighth president of the University on December 20, 2000. Prior to his appointment, he served as dean of Hofstra University School of Law from September 1989 through June 2001. He joined the faculty of the Law School in 1972. President Rabinowitz currently holds the Andrew M. Boas and Mark L. Claster Distinguished Professor of Law.

President Rabinowitz has held positions with a number of important government and community organizations, including the Judicial Advisory Council of the State of New York Unifi ed Court System, County of Nassau. He currently serves as a member of the board of directors for the Long Island Association, and as co-vice chair of the Long Island Regional Economic Development Committee. He has also served as a trustee of the Commission on Independent Colleges and Universities and on the board of directors the Long Island Technology Network. President Rabinowitz is a former member of the Nassau County Blue Ribbon Financial Review Panel and a former chair of the Nassau County Local Advisory Board. Additionally, President Rabinowitz served as a member of the Nassau County Commission on Government Revision, which was charged with drafting a new charter and a new form of government for the County. He is the recipient of the Martin Luther King Living the Dream Award, EOC; Distinguished Service in the Cause of Justice, Legal Aid Society; UJA Federation Leadership Award; the Bar Association of Nassau County Proclamation for Outstanding Service to both the legal profession and the community; the Community Service Award from the Conference of Jewish Organizations of Nassau

County; and the Alumni Association of the City College of New York 2005 Townsend Harris Medal. President Rabinowitz has also been honored by the Long Island Software and Technology Network (LISTnet) and was the recipient of Networking magazine’s David Award. In 2009, he received the Chief Executive Leadership Award from the Council for Advancement and Support of Education (CASE), District II. Clafl in University presented President Rabinowitz with the degree of Doctor of Laws, honoris causa in November 2009.

President Rabinowitz received a juris doctor, magna cum laude, from Columbia University School of Law, where he was a member of the board of editors of the Columbia Law Review and a Harlan Fiske Stone Scholar. He graduated from the City College of New York with honors, and is a member of Phi Beta Kappa and the American Law Institute.

STUART RABINOWITZ

Hofstra President Stuart Rabinowitz (left), Pride Club Board Member James C. Metzger (center) and Pride Club President E. David Woycik, Jr. (right)

HOFSTRA UNIVERSITY PRESIDENTHOFSTRA UNIVERSITY PRESIDENT


2012

LACROSS

SENIOR ADMINISTRATION SENIOR ADMINISTRATION

OFFICERS

Janis M. Meyer,* ChairJames E. Quinn,* Vice ChairPeter G. Schiff, Vice ChairDavid S. Mack,* Secretary

MEMBERS

TRUSTEES OF HOFSTRA UNIVERSITY (AS OF OCTOBER 2011 )

Alan J. Bernon*

George W. Bilicic, Jr.

Tejinder Bindra

Robert F. Dall*

Helene Fortunoff

Steven J. Freiberg*

Joseph M. Gregory*

Martin B. Greenberg*

Leo A. Guthart

Peter S. Kalikow*

Abby Kenigsberg

Arthur J. Kremer

Karen L. Lutz

Donna M. Mendes*

John D. Miller*

Marilyn B. Monter*

Martha S. Pope

Edwin C. Reed

Robert D. Rosenthal*

Debra A. Sandler*

Thomas J. Sanzone*

Joseph Sparacio*

Frank G. Zarb*

DELEGATES TRUSTEES EMERITI

M. Patricia Adamski

Senior Vice President for Planning and Administration

Joseph M. BarkwillVice President for

Facilities and Operations

Dr. Herman Berliner

Provost and Senior Vice President for Academic

Affairs

Stephanie BusheyVice President for

Institutional Research and Assessment

Melissa ConnollyVice President for

University Relations

Jessica EadsVice President for

Enrollment Services

Dolores Fredrich, Esq.

Vice President for Legal Affairs and General

Counsel

Richard V. Guardino, Jr., Esq.

Vice President for Business Development

Catherine HennessyVice President for

Financial Affairs and Treasurer

Sandra S. JohnsonVice President for Student

Affairs

Robert W. Juckiewicz

Vice President for Information Technology

Alan J. KellyVice President for

Development

William F. Nirode, Speaker of the FacultyStuart L. Bass,* Chair, University Senate Executive CommitteeElizabeth K. Venuti, Chair, University Senate Planning and Budget CommitteeDavid Zuniga, President, Student Government AssociationAlexander Zelinski, Vice President, Student Government AssociationFrederick E. Davis, Jr.,* President, Alumni Organization

James M. Shuart,* President EmeritusWilbur Breslin, Trustee EmeritusEmil V. Cianciulli,* Chair EmeritusJohn J. Conefry, Jr., Chair EmeritusMaurice A. Deane,* Chair EmeritusGeorge G. Dempster,* Chair EmeritusJoseph L. Dionne,* Trustee EmeritusBernard Fixler,* Trustee EmeritusFlorence Kaufman, Trustee EmeritaWalter B. Kissinger, Trustee EmeritusAnn M. Mallouk,* Chair EmeritaThomas H. O’Brien, Trustee EmeritusArnold A. Saltzman, Trustee EmeritusNorman R. Tengstrom,* Trustee Emeritus

* Hofstra Alumni

HOFSTRA UNIVERSITYHOFSTRA UNIVERSITY


DIRECTOR OF ATHLETICSDIRECTOR OF ATHLETICS

Jack Hayes is in his eighth year as director of athletics at Hofstra University in 2011-12. Hayes was appointed by Hofstra President Stuart Rabinowitz as the University’s director of athletics on October 4, 2004. Hayes came to Hofstra after serving as an associate director of athletics at the University of Connecticut for three years. Hayes, the eighth director of athletics at Hofstra, leads a department that includes 17 Division I teams, 90 coaches and administrative staff members and 350 student-athletes.

Hayes’ proven expertise in enhancing academic and athletic success of student-athletes, strategic planning, fund-raising, marketing, university relations, facility enhancement, budgetary management, and NCAA compliance complements Hofstra University’s athletic department in its quest to further enhance its athletic program, and assist Hofstra’s student-athletes both on and off the fi eld.

The Hofstra Athletic program has fl ourished under Hayes’ leadership, winning 20 CAA Championships and making 33 postseason appearances, including 25 NCAA Tournaments, since the 2004-05 academic year. In 2010-11 four Pride teams advanced to postseason play with women’s soccer and men’s lacrosse reaching the NCAA Tournament as at-large selections. In addition, Hofstra hosted the NCAA Men’s Lacrosse Quarterfi nals in 2009 and 2011, setting a James M. Shuart Stadium attendance record in 2011.

Hayes has placed a signifi cant emphasis on fund-raising during his tenure. Pride Club membership reached all-time highs, both in terms of the number of contributors and funds raised as the organization topped the $1 million mark for the three consecutive years. In addition, Hofstra Athletics signed its largest corporate sponsorship deal in department history when it partnered with W.B. Mason in 2010. In 2011 Hofstra announced a 1.5 million dollar commitment from lacrosse alumnus James C. Metzger ’83, the largest gift in Hofstra Athletics history.

Resources generated through fund-raising efforts have been used to enhance programs and facilities available to student-athletes. Recent initiatives include the construction of the W.B. Mason Pride Lounge on the lower level of the Mack Sports Complex, baseball’s Quinn Family Grandstand and the Fried Family Student-Athlete Development Center on the second fl oor of the James M. Shuart Stadium Building. Other recent renovations

include locker rooms, the wrestling room, athletic training rooms in Margiotta Hall and the Physical Education Center, the basketball media room in the Mack Sports Complex, a press box at the Hofstra Soccer Stadium, replacement of the turf at James M. Shuart Stadium and the construction of the Hofstra Field Hockey Stadium.

In 2006 Hayes reintroduced the Hofstra Athletics Hall of Fame after more than a 50-year absence, inducting fi ve classes since that time. He also led an effort to retire the uniform numbers of prominent Hofstra student-athletes with 20 jersey retirement ceremonies held during the 2008-09 academic year.

Active on a national level, Hayes served on the NCAA Division I Lacrosse Committee from September 2006 to September 2008. In September 2010 he was appointed to the NCAA Leadership

Council, which is an advisory body to the Division I Board of Directors.

Hayes came to Hofstra with more than 14 years of athletic administration experience, including management positions at four Division I institutions – Connecticut, Fordham, St. John’s and Fairfi eld. Hayes received a master’s degree in education in 1992 with a concentration in sport management from the University of Connecticut. He holds a bachelor’s degree (1989) from

Providence College, where he was a member of Providence’s lacrosse team. He was also awarded a certifi cate of completion in 2001 from the Sports Management Institute, Consortium of the Universities of Michigan and Texas. A native of Providence, Rhode Island, Hayes graduated from the Providence Country Day School where he lettered in football, basketball and lacrosse. He was inducted, as a member of his high school basketball team, into the Providence Country Day Athletic Hall of Fame in October 2004. In October 2010 Hayes became a two-time member of Providence Country Day’s Athletic Hall of Fame when he was inducted along with the rest of his high school lacrosse team.

Hayes resides in East Northport, New York, with his wife Bridget, daughter Katie (9), and sons Matt (6), Tommy (3) and Michael, who was born in April 2011.

JACK HAYES

PateoMU

AHCfoinbCObChh

HOFSTRA UNIVERSITY

DIRECTORS OF ATHLETICS

1937-42 John Bartlett MacDonald1942-45 John Archer Smith (Interim)1945-48 John Bartlett MacDonald1948-51 John Archer Smith1951-74 Howard “Howdy” Myers1974-75 Dick Thiebert1975-87 Bob Getchell1987-97 Jim Garvey1997-04 Harry Royle

012

LACROSSE


HOFSTRA ATHLETICSHOFSTRA ATHLETICSCharles Jenkins, Hofstra’s all-time

leading scorer, was a three-time Haggerty Award winner and two-time CAA Player of the Year who was selected by the Golden State Warriors in the 2011 NBA Draft

Tiffany Yovino helped lead the

Pride to the second round of the NCAA

Tournament in 2007 and 2010

and was an All-American last

season

Shante Evans was an All-American in 2010-11 after averaging a team-high 18.4 points and 11 rebounds per game

Lou Ruggirello earned All-America and Academic All-America accolades in 2010-11 and was a four-time NCAA qualifi er

Genna Kovar, a two-time fi eld hockey All-American, led the nation in goals and points per game in 2011 and is Hofstra’s all-time leader in

goals (57), assists (34) and points (148).

Olivia Galati set the school single season victory, strikeout and shutout records with 29 wins, 348 strikeouts and 17 shutouts in 2011

Shaun Foster was the CAA

Defensive Player of the Year in 2010

and 2011

2012

LACROSS

2012

L


Alison AdamskiWomen’s Tennis Coach

Pete AlfanoCross Country Coach

Rob AnspachWrestling Coach

Chrissy ArnoneAssistant Director of

Athletics for Marketing and Promotions

Jay ArtinianSenior Associate Director of Athletics for Facilities

Rachel AugustAssistant Director of

Athletic Administration

Cathy AullAthletic Department

Secretary

Ann BallerAssociate Director of

Athletic Facilities

Dr. Michael Barnes

Faculty Athletics Representative

Anthony BattagliaEquipment Manager

Susan BauerAssistant Dean of

University Advisement

Marisa BigginsAssistant Director of

Compliance

Maria CorvinoAssistant Director of Athletics for Ticket

Operations

Maren CrowleyWomen’s Golf Coach

Kathy De AngelisField Hockey Coach

Steven DeNapoliAthletic Facilities

Coordinator

Bill EdwardsSoftball Coach

Joe ElliottMen’s Golf Coach

Allison BradshawAssistant Strength and Conditioning Coach

Brittany ButtsAthletic Facilities

Coordinator

Mo CassaraMen’s Basketball Coach

Neil CollinsAssistant Director of

Athletic Facilities

John ConsidineAssistant Equipment

Manager

Tara CoppolaAssistant Director of

Athletic Facilities

David FernandezAthletic Facilities

Coordinator

Stephen GorchovAssociate Director

of Athletics for Communications

John HeckAssociate Director of

Athletics for Compliance

Kristina Hernandez

Volleyball Coach

Tim HolmanAthletic Facilities

Coordinator

Ellen JohnsonAssistant Director of

Athletics for Corporate Relations

ATHLETICS ADMINISTRATIVE STAFF AND HEAD COACHESATHLETICS ADMINISTRATIVE 012

LACROSSE


ATHLETICS ADMINISTRATIVE STAFF AND HEAD COACHES STAFF AND HEAD COACHES

Colm KennedyAssistant Director of

Athletic Facilities

Krista Kilburn-Steveskey

Women’s Basketball Coach

James LallyDirector of Student-

Athlete Services

Frantzer Le BlancAssistant Director of

Athletic Facilities

Cindy LewisSenior Associate Director

of Athletics

Evan MalingsHead Athletic Trainer

Danny McCabeExecutive Associate Director of Athletics

Tim McMahonAssociate Director of Athletics for External

Affairs

Abby MorganWomen’s Lacrosse Coach

Kevin MurgaAthletic Facilities

Coordinator

Isaac NealTicket Offi ce Graduate

Assistant

Michael NeelyDirector of Ticket Sales

Diane SchuerleinAthletic Department

Secretary

Jim SheehanSenior Sports Information

Director

Daniel SolowAssistant Director

of Athletics for Development

Samantha Sweeney

Assistant Director of Athletics for Student-Athlete Development

Kathy TheilingEquipment Manager

Seth TierneyMen’s Lacrosse Coach

Richard NuttallMen’s Soccer Coach

Jeanne O’KeefeAthletic Department

Secretary

Rachel PeelAssociate Dean of

University Advisement

James Prendergast

Assistant Strength and Conditioning Coach

Simon RiddioughWomen’s Soccer Coach

John RussoBaseball Coach

Michael Unterstein

Assistant Director of Athletic Development

Dave WalshAssistant Equipment

Manager

Ryan WatsonAssistant Director of

Athletic Facilities

Philip WayneMen’s Tennis Coach

Winnie WymesAthletic Department

Secretary

Dr. Michael YorioTeam Physician

2012

LACROSS


012

LACROSSE

HOFSTRA HERITAGEHOFSTRA HERITAGE

THE SYMBOLS OF HOFSTRA UNIVERSITYTHE SHIELD LOGOIn 2005 Hofstra introduced a new logo as part of a University-wide re-imaging. Both the University’s logo as well as the Pride logo were designed by Powell New York, a full-service branding and marketing agency, noted as one of the ten fi rms to watch in 2005 in Advertising Age.

The new University logo features an “H” within a shield design. Hofstra University has always been known for both a tradition of academic excellence and a willingness to evolve to meet the needs of students and the greater society. This shield represents the University’s commitment to our heritage and a tradition of academic excellence, while the dynamic representation of the H within the shield embodies the evolutionary, changing nature of the University. Hofstra University has both honored its traditions and heritage while embracing changing disciplines, using new technology and remaining relevant to scholarly pursuits and the demands of industry.

THE SEALThe Hofstra seal was designed from the royal Dutch emblem by art instructor Constant Van de Wall. The seal is modeled on the coat of arms of the House of Orange-Nassau. The round seal includes the coat of arms, fl anked by lions on either side. A lion also stands in the center of the coat of arms, holding a sword in its right claw and a bundle of seven arrows, which represent the seven provinces of Holland, in its left. The seal also carries the motto of the House of Orange-Nassau in Old French: “Je maintiendray” (I stand steadfast). In 1988 one of the two lions on the seal was offi cially replaced with a lioness. The Hofstra seal is still in use today, though not as a logo. The seal will be affi xed to formal documents, and used for offi cial purposes such as commencement, convocations, and offi cial University functions.

THE PRIDEHofstra’s athletic teams are offi cially known as the Pride, providing our teams with a strong, consistent image that resonates with the Hofstra community. The new Hofstra Athletics logo consists of a graphic mark of a male and female

lion in powerful, synchronized motion with the word mark of the Hofstra Pride or the specifi c sports team. This logo will be the only one used by Hofstra Athletics.

The Hofstra Pride refers to a pack of lions, male and female, which work together towards a common goal and symbolize determination and strength. The Pride conveys both the teamwork and togetherness that is a trait of lions living in prides, who have a close bond and work together for the good of the entire group. The teamwork evident in prides is a trait of Hofstra’s student-athletes, who support each other in furtherance of a common goal, while working tirelessly to represent their

teams and, in turn, the University. Lions also possess speed, tenacity, and agility, and are relentless in their pursuit of a goal, which are traits our

student-athletes demonstrate both on and off the fi eld.

The fi rst consistent use of the word “Pride” relating to athletics was in 1989

when the University’s athletic booster club was founded and called itself The Pride Club, which at the time simply referred to the pride that alumni and fans had for our teams. The Pride identity has progressed over the past decade in a more specifi c fashion than just the

expression of a feeling. After one lion on the Hofstra seal was changed into a lioness to

symbolize gender equity, the University mascots -- Kate and Willie Pride, a lioness and lion – were introduced.

HOFSTRA’S DUTCH HERITAGETies to Dutch heritage and the Netherlands began with William S. Hofstra, after whom the school is named and on whose property the University was started. William Hofstra died in 1932 and when his wife, Kate, died 16 months later, her will provided that their house, 15-acre estate, and bulk of her inheritance were to be used for a “public, charitable, benevolent, or scientifi c purpose” as a memorial to her husband.

The idea for a college came from Truesdel Peck Calkins, former Hempstead superintendent of schools, who was then with New York University. He suggested that NYU might offer extension courses on the Hofstra property. Hofstra opened in September 1935, as a two-year extension branch of NYU; its offi cial name was “Nassau College – Hofstra Memorial of New York University at Hempstead, Long Island.” When the doors opened, the sole

building on campus was Hofstra’s mansion, which he had affectionately named

the Netherlands after his homeland, and all classes were held there. The

mansion, which houses administrative offi ces, is now the center of Hofstra’s 240-acre

campus, and has been renamed Hofstra Hall.

e maintiendray” (I stand f the two lions on the seal ith a lioness. The Hofstra hough not as a logo. o formal documents, and such as commencement, l University functions.

s

schools, who was then witsuggested that NYU mighthe Hofstra property. Hof1935, as a two-year extenits offi cial name was “NaMemorial of New York ULong Island.” When the

building on campus was Hhe

thh

ren

nd marketing agency, noted as one of the ten fi rms to watch n 2005 in Advertising Age.

The new University logo features an H” within a shield design. Hofstra

University has always been known or both a tradition of academic xcellence and a willingness to volve to meet the needs of students nd the greater society. This hield represents the University’s ommitment to our heritage and a radition of academic excellence,

while the dynamic representation of the H within the shield mbodies the evolutionary, changing

nature of the University. Hofstra University has both honored its traditions nd heritage while embracing changing

disciplines using new technology and remaining relevant to

of a common goal, while working tirelessly to representeams and, in turn, the University. Lions also p

speed, tenacity, and agility, and are relin their pursuit of a goal, which are tra

student-athletes demonstrate bothoff the fi eld.

The fi rst consistent use of the wo“Pride” relating to athletics was

when the University’s athletic bclub was founded and called itsPride Club, which at the time sireferred to the pride that alumnhad for our teams. The Pride idhas progressed over the past decin a more specifi c fashion than j

expression of a feeling. After onethe Hofstra seal was changed into a lio

symbolize gender equity, the University mKate and Willie Pride, a lioness and lion – were introdu


2012

LA CROSS

HOFSTRA HERITAGEHOFSTRA HERITAGE


HOFSTRA MEN’S LACROSSE ACADEMIC PLANHOFSTRA MEN’S LACROSSE ACADEMIC PLAN

The Hofstra Men’s Lacrosse program fi rmly believes that

academic success is as important as success on the fi eld of play.

To reinforce the Hofstra Athletics academic program, the men’s

lacrosse team has implemented an academic plan of their own to

insure that each men’s lacrosse player reaches his full potential in

the classroom.

Mission: Create an environment where players and coaches

know and understand each other on a very strong interpersonal

level, allowing coaches the opportunity to provide student-athletes

with support and mentoring, and to help them recognize and

master the intellectual tools necessary for success. Also, create

a standard and set level of accountability with expectations and

support systems that, when utilized, will provide our student-

athletes the tools necessary to be successful. By working and

living in this environment throughout their careers, our goal is to

have a sustained positive infl uence on how our student-athletes

think, act and feel.

Our Responsibility: Set a high standard for our student-

athletes and be more accountable for academic success. Teach

them what is right, and provide the guidance needed to bring to

light their strengths and improve on their weaknesses so they can

attain their full potential.

The Program: This is a counseling based program that will

focus on developing relationships fi rst and then provide mentoring

and guidance in various ways. While academic success is at the

core of this program, this is not strictly an academic initiative. We

will focus on life skills, study skills, career planning and other

intellectual tools that all individuals should be profi cient in.

Our team will be divided into different groups based on the

intensity of the integration determined. We will focus heavily on

the fi rst-year student experience, as they are the most vulnerable

group and will make up the foundation for future successes.

Listed below (section I) are the different levels of integration

with characteristics of each. The primary technique utilized

throughout this program will be individual meetings with

members of the coaching staff based on the level of integration

necessary. It is during these meetings where relationships will

be further developed and skills will be discussed. Understanding

that time management is one of the most important tools needed,

all of our student-athletes will utilize a daily planner that will be

discussed in our scheduled meetings. Working closely with the

offi ce of Academic Advisement and utilizing Assistant Dean of

Advisement Rachel Peel as a supplement to our meeting schedule,

we will offer all the resources provided by the University to each

of our student-athletes. The Career Center will be both a group

and individual activity for our entire team, as career planning

and networking will be topics discussed throughout our meeting

schedule.

A large component of the program is the rules that are in place for

each student’s daily academic life. These rules, which are listed

after section I, must be adhered to by each member of the team.

Section I - Levels of Integration These levels will be determined by the coaching staff at the end

of each semester or prior to a student’s matriculation at Hofstra

University.

Transition Phase - All first-year student-athletes: Meet once per week with assigned coach and have an additional

meeting with Rachel Peel

Develop rapport

Help develop intellectual and academic competence

Encourage student-athletes to set a high standard for themselves

in: academic achievement, interpersonal relationships, self-image,

athletic achievement and life long goals

Familiarize student-athletes with campus community, academic

resources and social threats

Level I Integration - Continuing student-athletes who need extra support:Meet bi-weekly with assigned coach and once per week with

Rachel Peel

Further enhance academic and intellectual competence

Proactively approach academic shortcomings

Focus student’s goals in terms of major

Level II Integration - Continuing students who need moderate support: Meet bi-weekly with Rachel Peel and once per month with

assigned coach.

Safeguard against academic risks

Begin career search process

Start networking for career placement

Level III Integration - Students who have taken ownership of their learning and who have learned the necessary intellectual skills needed for success:Meet at beginning and end of semester with Coaching Staff.

Certify graduation progress with Rachel Peel

Finalize career goals and make necessary interview appointments

for internships or employment

Rules for the Classroom: Attend every class that is scheduled

Be fi ve minutes early. Lateness to class qualifi es as an absence

Sit in one of the fi rst three rows of the classroom.

Do not sit next to a teammate.

No hats are to be worn in any building.

Academic Resources for Student-AthletesAdvising - Advisement Dean and Faculty Advisor

Tutoring Services - Three courses per semester at no charge

Study Hall - Eight hours per week professionally monitored

Mid-semester academic progress reports

Academic Labs

Writing Center

Tracking progress towards graduation against both University and

NCAA standards

Student-Athlete Advisory Committee (SAAC)

Guest speakers regarding personal and professional development

Professional mentoring program through the Hofstra Career

Assistance Network and Corporate Development Council

Career counseling, resume building, interview workshops, on-

campus recruiting and job fairs through the Career Center

012

LACROSSE


A DAY IN THE LIFE OF A HOFSTRA LACROSSE PLAYERA DAY IN THE LIFE OF A HOFSTRA LACROSSE PLAYER

7:45 a.m. Wake up

8:15 a.m. Breakfast, Student Center Cafeteria 8:45-9:45 a.m. Study Hall – Reilly Theater in Margiotta Hall10-11:20 a.m. “Legal Studies” class with

Professor Bass, Roosevelt Hall11:45 a.m.-12:15 p.m. Defensive fi lm session with

Coach Brazel, coaches offi ce

12:30 p.m. Lunch

1-2:20 p.m. “Art History” class with

Professor Cohen, Breslin Hall2:30-5 p.m. Practice, Shuart Stadium

5-5:30 p.m. Team Meeting

– Opponent Scouting Report, Locker Room6 p.m. Dinner, Student Center Cafeteria7 p.m. Free time/Study time

STUDENT CENTER CAFETERIA

CLASS IN MONROE LECTURE HALL

MEN’S LACROSSE STUDY HALL

SCIENCE CLASS

♦ Students typically take 15-17 credits per semester, which equates to roughly 15-17 hours of class time per week. This student’s day included about 3 hours of class time.

♦ All Hofstra Lacrosse freshmen and any student-athlete who carries a cumulative GPA of less than 3.0 is required to complete 8 hours of study hall per week by the coaching staff.

♦ This schedule refl ects the daily planner of a Hofstra Lacrosse student-athlete for a Monday in April as the team prepared for a game that Saturday.

2012

LACROSS

012

LACROSSE


MARGIOTTA HALLMARGIOTTA HALLOpened in 1992, Margiotta Hall, a magnifi cent three-story, 22,500-square-foot building, is a centerpiece of the Hofstra University Athletics program. The state-of-the-art fi eld house, combined with Hofstra’s 13,000-seat stadium, has created one of the fi nest facilities in the nation. The facility was named after Joseph M. Margiotta ’50, a former Pride student-athlete and long-time supporter. Margiotta, who founded and served as President of the Hofstra Pride Club for more than 20 years, passed away in November 2008

Margiotta Hall features a 3,500-square-foot weight room on the fi rst fl oor. The building also contains locker rooms for men’s lacrosse and women’s lacrosse, all of which have undergone major renovations since 2008.

The state-of-the-art athletic training room, also located on the fi rst fl oor, has hydrotherapy and electrotherapy areas, cardiovascular and isokinetic equipment, as well as taping areas, a rehabilitation area, an aerobics room, and athletic trainer and physician offi ces. On the second fl oor, an attractive multi-purpose room, enclosed by a glass wall, provides a panoramic view of James M. Shuart Stadium. Meetings and receptions for alumni, parents and friends of the Hofstra Athletic program are held in this area.

Located on this level are the offi ces for the men and women’s lacrosse coaching staffs.

The lacrosse offi ce was the benefi t of a major renovation project in 2008. The offi ces are equipped with video equipment, a 12-seat theater with stadium seating for group fi lm and meeting sessions, as well as a viewing room with hardwood fl ooring and a 50-inch fl at screen television that overlooks the fi eld.

In 2010 Margiotta Hall was the recipient of a “Traditions Project” that provides a sense of history of the lacrosse programs. The walls of the second fl oor of Margiotta Hall contain pictures and brief text descriptions of the key moments and people in Hofstra Lacrosse history. The project was made possible through the generosity of former lacrosse All-American James C. Metzger ’83. The lower level of Margiotta Hall contains a 178-seat theater, additional meeting rooms and an indoor golf training facility.


2012

LACROSS

MARGIOTTA HALLMARGIOTTA HALL


JAMES M. SHUART STADIUMJAMES M. SHUART STADIUM012

LACROSSE


Originally opened in 1963 as Hofstra Stadium and renamed James M. Shuart Stadium in August 2002, the facility serves as the home to Hofstra’s lacrosse teams.

Named after the former Hofstra President, who played football and lacrosse during his undergraduate days at Hofstra, James M. Shuart Stadium has served as the host for the NCAA Division I Men’s Lacrosse Championship Quarterfi nals and fi rst round games in the NCAA Men’s and Women’s Lacrosse Championships, numerous conference championship contests, the Long Island All-Star Football Game, the Fun City Bowl featuring the New York City Police and Fire Department teams, the Long Island Lizards of Major League Lacrosse, and various Long Island high school and New York state championship games. The stadium also served as a home for the Long Island Rough Riders of professional soccer’s A-League.

In 1968 the stadium became the third college facility in the nation to install an artifi cial playing surface. James M. Shuart Stadium underwent a major renovation and expansion that was completed in the fall of 1996, making the facility into one of the premier complexes in the Northeast. The project included

the expansion of the seating capacity from 7,000 to 13,000; the creation of the Howdy Myers Pavilion in the southeast corner of the stadium; and the installation of scoreboards in both end zones. The renovation transformed James M. Shuart Stadium

into the largest outdoor sports and entertainment complex on Long Island. In 2007 the artifi cial turf at James M. Shuart Stadium was replaced with FieldTurf, then in 2009 new scoreboards were installed in the north and south end zones.

The largest crowds in James M. Shuart Stadium history occurred during the hosting of the NCAA Lacrosse Quarterfi nals.

A stadium record 13,447 people, the largest-ever lacrosse crowd on Long Island, were in attendance for the 2011 NCAA Quarterfi nals, while a crowd of 12,292, a then-NCAA Men’s Lacrosse Championship Quarterfi nal record, witnessed the 1999 NCAA Quarterfi nals featuring Hofstra versus Johns Hopkins. In 2009 11,292 fans were present and 10,510 fans attended the 2001 quarterfi nals that featured Hofstra against Syracuse.

HOFSTRA INDOOR PRACTICE FACILITYThe Pride has use of the Hofstra Indoor Practice Facility, that formerly was the property of the New York Jets of the National Football League. The 50-yard turf fi eld gives Hofstra a unique environment that many teams in the Northeast do not have. The practice bubble is located on the North Campus, behind the Mack Sports Complex.

HOFSTRA LACROSSE VICTORY WALKIn 2004 Hofstra Athletics and the Pride men’s lacrosse program created a Victory Walk to commemorate the more than 400 victories achieved since the programs’ inception in 1949. The Victory Walk, spearheaded by then-Hofstra Head Lacrosse Coach John Danowski, is located near the main entrance of James M. Shuart Stadium and consists of a walkway made from individual bricks showcasing all the victories of the Hofstra Men’s Lacrosse program. Each brick is inscribed with the year, the opponent and the score of the contest. Included in the project are several memorial gardens and benches. The project generated more than $70,000 in donations and had more than 220 contributors, of which more than half were former players.


THE HOWDY MYERS PAVILIONTHE HOWDY MYERS PAVILION2012

LACROSS

In October 1998 Hofstra University President Emeritus Dr. James M. Shuart presided over the dedication ceremony for the Howdy Myers Pavilion in the south end zone of James M. Shuart Stadium. Howdy Myers served as Hofstra University’s director of athletics, head men’s lacrosse coach and head football coach for a quarter of a century. His extraordinary coaching talents in both lacrosse and football from 1950 to 1975 made Howdy Myers a legend in both sports.

Myers was personally credited with the tremendous growth of lacrosse on Long Island, through the creation of scholastic clinics and demonstrations in the 1950s, and leading the Hofstra Lacrosse program to national prominence. He was years ahead of the intercollegiate athletic world with his use of many coaching innovations in both lacrosse and football.

As Hofstra lacrosse coach, Howdy Myers coached 26 seasons (1950-75) and recorded a 216-138-4 record. He coached Flying Dutchmen teams that captured eight divisional championships and made four NCAA Division I Championship Tournament appearances. In 1970 he received the F. Morris Touchstone Award as the United States Intercollegiate Lacrosse Association (USILA) Division I Coach of the Year. In 1971 Howdy Myers received the Governor’s Trophy for providing continuous and meaningful contributions to lacrosse. That same year he received lacrosse’s highest honor when he was inducted into the United States Lacrosse Hall of Fame.

As Hofstra’s football coach for 25 years (1950-74), Coach Myers recorded 15 winning seasons and a 141-98-4 record. In 1959 he led the Flying Dutchmen to the fi rst undefeated (9-0-0) season in Hofstra Football history.

Dr. Shuart, who served as a team captain under Coach Myers in both football and lacrosse in the early 1950s, praised the coaching

legend. “Howdy Myers had a huge impact on intercollegiate and scholastic sports,” Shuart said. “Renowned for his coaching abilities throughout collegiate sports, Coach Myers will always be a Hofstra legend.”

Howard “Howdy” Myers passed away in 1980. In 2006 he was among the inaugural class inducted into the Hofstra University Athletics Hall of Fame. Hofstra’s connection to the Myers family

includes his son, Howard Myers III, his daughter, Dorsey Donnelly, and his son-in-law, William Donnelly, who are all Hofstra alumni.

A portrait sculpture of Howdy Myers, created by artist Peter Homestead, stands in front of the Pavilion facing the Shuart Stadium fi eld. In creating the sculpture, Mr. Homestead worked from photographs and consultations with Coach Myers’

family and friends. The completed sculpture captures the spirit and strength of Howdy Myers. Alumni and friends of Coach Myers have joined together to establish the Howard M. Myers Jr. Endowed Athletic Scholarship in his honor. In 2002 Hofstra created the Howard “Howdy” Myers Award, which is presented to a male student-athlete in recognition of outstanding leadership and athletic performance.

HOFSTRA MEN’S LACROSSE — 65

in recognition of outstanding leadership and athletic performance.

HOWARD “HOWDY” MYERS AWARD RECIPIENTS2002 Kahmal Roy-Football

2003 Arni Gunnarsson-Soccer

2004 Noel Thompson-Wrestling

2005 Jon Masa-Wrestling and Loren Stokes-Basketball

2006 Chris Unterstein-Lacrosse

2007 Loren Stokes-Basketball

2008 Antoine Agudio-Basketball and

Charles Griffi n-Wrestling

2009 Jay Card-Lacrosse and Charles Jenkins-Basketball

2010 Charles Jenkins-Basketball

2011 Charles Jenkins, Men’s Basketball


HOFSTRA ACADEMIC SUPPORTHOFSTRA ACADEMIC SUPPORTHofstra University is committed to the pursuit of academic and athletic excellence. The University views participation in intercollegiate athletics as benefi ting the student-athlete in an educationally enhancing experience beyond any other opportunity available. Hofstra also realizes the time commitment made by student-athletes and has committed the facilities and resources to support all students.

The University Tutorial Program (UTP) provides free tutoring in every subject area to any Hofstra student. Students are able to obtain up to 1 1/2 hours of individual tutorial assistance per week for up to three courses. They are also able to utilize the various help labs on campus, which specialize in providing assistance in writing, business and QM, and biology and chemistry. In addition to this service, student-athletes are assigned an academic advisor, through the Center for University Advisement, who helps address the various needs of student-athletes. The academic advisor emphasizes four areas in their efforts to ensure the academic success of Hofstra’s student-athletes.

Area one is academic counseling. Services are provided in the areas of academic planning, career planning, personal counseling, and campus and community referrals. The advisor also meets with prospective student-athletes, at the coach’s request, to share the many benefi ts of a Hofstra University education.

Area two is academic advising. The academic advisor serves as the primary advisor for fi rst-year and undecided student-athletes, and also assists upperclassmen who have declared a major.

Area three is academic monitoring. The advisor monitors the academic progress of student-athletes to ensure compliance with Hofstra University, NCAA and conference regulations. The advisor’s regular communication with the faculty and coaches provide opportunities for early intervention should academic diffi culties arise.

Area four is study halls. The University Tutorial Program supports athletic study halls by providing tutors in various subjects as necessary. The academic advisors also assess the needs of individual student-athletes to provide the most effective study environment. The assessment tool administered by the

Center for University Advisement is also used to provide various enrichment seminars for the student-athletes such as time management, writing skills, campus resources, and surviving the college transition.

In 2010 The Fried Center for Student-Athlete Development was opened on the second level of the James M. Shuart Stadium Building. The center houses the

offi ces of the Student-Athlete Services Staff, as well as a large computer lab with printer access for use by Hofstra

student-athletes, a quiet study area with wireless internet access and two group study/tutor rooms with power point access and white boards.


SPORTS MEDICINESPORTS MEDICINEThrough a comprehensive athletic training program, Hofstra University student-athletes are provided excellent health care during their attendance at the University. A coordinated effort between the University Health and Wellness Center, the Athletic Department and outside health care providers ensures every student-athlete the best medical attention possible. University student-athletes have direct access to a myriad of health care services. Managing the coverage of every practice and competition event is Hofstra University’s athletic training staff, which is led by seventh-year Head Athletic Trainer Evan Malings and features eight full-time athletic trainers and numerous student athletic trainers. The athletic trainers provide injury management, rehabilitation and treatment to the entire Athletic program. Utilizing three state-of-the-art athletic training rooms, these professionals work tirelessly to ensure the safe participation of Hofstra’s student-athletes and to return injured athletes to play quickly and safely.

Supporting the athletic trainers is team physician Dr. Michael Yorio. Dr. Yorio, a physician with Pro Health Care, Inc. in Lake Success, New York, is in his fi rst year on Hofstra’s medical team. Yorio is an internist with specialized training in sports medicine. He earned his undergraduate degree at Villanova University, and received his medical degree from the SUNY Health Science Center in Syracuse. Yorio previously served as a sports medicine fellow with the University of Maryland Orthopedics. Prior to that, he was a resident physician in internal medicine at Carolinas Medical Center in Charlotte, North Carolina.

Yorio was named the Director of Player Medical Services for the 2008 U.S. Open Tennis Tournament in Flushing, New York, and is on the medical staff for the New York Islanders. He also worked as a team physician for the University of Maryland from 2003 to 2005.

Hofstra University sponsors a fully accredited, highly competitive undergraduate degree program for athletic training majors, in which Hofstra student athletic trainers participate in all aspects of

Evan MalingsHead Athletic Trainer

Dr. Michael YorioTeam Physician

Robert SullivanMen’s Lacrosse Athletic Trainer

2012

LACROSS


ABOUT NEW YORK CITY…Hofstra is located only 30 miles from New York City – the capital of culture and fi nance. You can visit

Carnegie Hall, South Street Seaport, Hard Rock Café, Grand Central Station, Central Park, NBC Studios in Rockefeller Center, Little Italy or Chinatown.

Study the world’s fi nest sculptures and paintings at the Metropolitan Museum of Art.

Go and cheer along with the crowd at a Yankees, Mets, Rangers or Knicks game.

Wave at the TV cameras in the street-level studios of FOX, CNN, NBC, CBS or ABC

Walk through the fi nancial capital of the world at the New York Stock Exchange on Wall Street.

Take the subway to Coney Island for a Nathan’s hot dog and a ride on the Cyclone, the last of the great wooden rollercoasters.

Get half-priced tickets to Broadway’s fi nest shows at the TKTS booth in a new, glittering Times Square.

ABOUT LONG ISLAND…Long Island has a rich history as an active, vibrant community, a summer playground, and home to some of New York’s most prominent families.

Five distinct regions make up Long Island:• North Shore, otherwise known as the Gold

Coast, with dozens of historic sites dating back to colonial days and Gatsby-era mansions.

• South Shore, the Island’s spectator sports and entertainment center, with world-famous Jones and Fire Island Beaches, and home to the New York Islanders.

• Central Suffolk, with beautiful forests and natural inlets, the world’s largest factory outlet center and a huge water park.

• North Fork, with an array of vineyards, waterfront ports and farm stands.

• South Fork, widely known as “The Hamptons,” with its pristine beaches and exclusive villages.

You can catch a Hofstra shuttle bus to Jones Beach – a state park with six miles of gorgeous coastline, a boardwalk, swimming pools, golf and outdoor concerts.

With everything from museums, historical sites and lighthouses, to sophisticated malls, designer outlets and shopping villages, to wineries and farm stands, to

family fun parks, aquariums and zoos, there is plenty to do on Long Island.

LONG ISLAND & NEW YORK CITYLONG ISLAND & NEW YORK CITY

Photo by Dr. Gale Reder-Anziano

012

LACROSSE


The Hofstra Men’s Lacrosse team completed The Program, a two-day leadership and team-building exercise at Tobay Beach this past October.

The Program was founded in 2008 with the mission of providing high schools, professional and collegiate teams, and corporate organizations with the best leadership and team building development in the country. Under the leadership of CEO and founder Eric Kapitulik, The Program creates personalized leadership development training that challenged every member of team to get “that much better.”

Pride student-athletes participated in two, two-hour, early morning physically and mentally challenging training sessions alongside The Program team. The Program team fi rst reviewed their ethos and three core principles and then challenged the team’s members and Captains to prove their commitment to them. Those three core principles are: we are strong and mentally tough; we don’t make excuses and we don’t let others make excuses for us; and we work hard. Following the physical portion of training,

the Program Lead Instructor met with team members and the coaching staff to lead a discussion on current team and leadership challenges.

Hofstra senior goalie Andrew Gvozden was cited for his excellent leadership abilities at the conclusion of the exercise. For more information on The Program, please go to www.TheProgram.org. 2

012

LACROSS

THE PROGRAMTHE PROGRAM


THE COLONIAL ATHLETIC ASSOCIATIONTHE COLONIAL ATHLETIC ASSOCIATIONThe Colonial Athletic Association continues to build on its reputation as one of the nation’s top collegiate conferences both athletically and academically.

The CAA encompasses fi ve of the nation’s nine largest metropolitan areas with a geographic footprint that stretches from Boston to Atlanta. The conference has produced 16 national team champions in fi ve different sports, 33 individual national champions, 12 national players of the year, 12 national coaches of the year and 12 Honda Award winners. Just as impressive, however, are the honors accumulated away from competition, which include fi ve Rhodes Scholars and 22 NCAA post-graduate scholars. In 2010-11, more than 1,900 of the league’s 4,000 student-athletes received the Commissioner’s Academic Award after posting at least a 3.2 grade point average while lettering in a varsity sport. The conference had 21 teams in 12 different sports receive NCAA Public Recognition Awards based on the latest Academic Progress Report released in 2011.

The landscape of the conference stretches along the majority of the East Coast, and includes six of the nation’s top 25 media markets – New York (1), Philadelphia (4), Boston (7), Atlanta (8), Washington, D.C. (9) and Baltimore (25). The number of television homes in the CAA market exceeds 20 million.

The CAA conducts championships in 23 sports. Male athletes compete for championships in baseball, basketball, cross country, football, golf, lacrosse, soccer, swimming & diving, tennis, track & fi eld and wrestling. Female athletes battle for conference titles in basketball, cross country, fi eld hockey, golf, lacrosse, rowing, soccer, softball, swimming & diving, tennis, track & fi eld and volleyball. In 2010-11, 25 teams earned NCAA Tournament berths and 50 student-athletes received All-America honors in 13 different sports.

The conference has made its presence known nationally in men’s basketball with two teams – George Mason (2006) and VCU (2011) – advancing to the NCAA Final Four over the past fi ve years. Three CAA teams earned NCAA Tournament berths for the fi rst time in 2011 as conference champion Old Dominion was joined by VCU and George Mason. VCU knocked off USC, Georgetown, Purdue, Florida State and top-seeded Kansas, while Mason defeated Villanova. The Rams were ranked No. 6 in the fi nal ESPN/USA Today Top 25 poll, which was the highest ranking ever for a CAA team. In 2006, George Mason captured the nation’s imagination by becoming the fi rst mid-major program since 1979 to reach the Final Four, posting victories over Michigan State, North Carolina, Wichita State and Connecticut along the way.

Six CAA women’s basketball teams advanced to postseason play in 2011. James Madison represented the conference in the NCAA Tournament after capturing its second straight conference championship. Delaware, Drexel, UNC Wilmington, Old Dominion and VCU participated in the WNIT, with the Seahawks advancing to the second round. ODU, which won an NCAA-record 17 straight CAA titles from 1992-2008, boasts three national championships (1979, 1980, 1985) and was national runner-up in 1997.

The conference also excels in many other sports. CAA squads have combined to win 10 fi eld hockey national titles since the championship began in 1981. At least two women’s soccer teams have advanced to the second round of the NCAA Tournament in three of the past four seasons and William & Mary gave the CAA a team in the fi nal 16 of the NCAA Men’s Soccer Championship for the sixth time in the last nine years. In men’s cross country, William & Mary advanced to the NCAA Championship for the 12th straight year and fi nished 19th overall. In the pool, Towson’s Meredith Budner fi nished as the runner-up in the 500 freestyle and 1650 freestyle at the 2011 NCAA Championship and received All-America honors along with George Mason’s Ashley Danner. Delaware and Towson have each reached the Final Four of the NCAA Men’s Lacrosse Championship in the past decade. The CAA has sent multiple teams to the NCAA Baseball Championship in nine of the last 14 years and has had at least 12 players selected in the eight of the last nine Major League Baseball drafts. The conference also boasts numerous All-Americans in lacrosse, tennis, golf, track and fi eld, women’s lacrosse and wrestling.

CAA member institutions are committed to excellence in the classroom. The Colonial Academic Alliance was created in 2002 by the league’s presidents with a goal of expanding their partnership to all aspects of university life outside of intercollegiate athletics. Among the programs that have been established are an undergraduate research conference, coordination of study abroad programs and granting visiting academic status to student-athletes traveling to an away contest so that they have access to libraries, academic resource centers and computer labs.

In 2002, two faculty members from CAA institutions were awarded academia’s most coveted distinction – the Nobel Prize. John B. Fenn, a research professor in the Department of Chemistry at Virginia Commonwealth University, received the Nobel Prize for chemistry, and Vernon Smith, a professor of economics and law at George Mason University, shared the Nobel Prize in economic sciences.

Commissioner Thomas E. Yeager has guided the CAA since its inception. The conference traces its roots back to 1983 when three of its current members- George Mason University, James Madison University, and the College of William and Mary - were aligned with East Carolina University, the United States Naval Academy and the University of Richmond as a basketball league (ECAC South). During the next two years, the league added 11 sports, acquired two new members (the University of North Carolina at Wilmington and American University) and decided to form a new association. The transformation from ECAC South to CAA took place on June 6, 1985.

Charter members George Mason, James Madison, UNC Wilmington and William and Mary were joined by Old Dominion University in 1991 and by Virginia Commonwealth University in 1995. The conference added the University of Delaware, Drexel University, Hofstra University and Towson University in 2001. Georgia State University and Northeastern University became members of the conference on July 1, 2005.

CAA A A A A A AAA AA meeeeeeeeembmmmmmm ererererererereerr iiiiiiinsnsnsnsnsnsssstititiiititiitititiiitutututututtututtututtuutut tittttittititititiiionoooooooththththeeeeee clclclclclclcllasasasasasasasaa srsrsrsrsrssrrroooooooooooooooom.mmmmmmm TTTTTTTTTThehhhhhhhhhhh CCCCCCCololololololloolo ononononononnnniaiaiaiaiaiaiaiaiaiiiiaalll llllll Ainiiinnn 2222000000002222 bbbbbybbbbbybyby ttttttttthehehehehehehehehehehehheeee llllllllllleaeaeaeaeaaeaeaeaeaeaeeaee gugugugugugugugguguugggg eeee’eeeee s prprprprrprprprprp eseseseseseee idididdidddiddididdideneeeeeeeeeeeeeetttheieieieieieir rr rr r papapapartrtrtrtnenenenersrsrsshihihihip p p p totototo aaaaaaaalllllllllllllllllllllllll aaaaaaaaaaaaaspspspspsspssps ececececececectstttttt oooooooof f fffff fffff ffff f uiiiiiniii ttttercrcccrcrcrcrcrccrccr oololololooooooo leleleeegigigigiigigigigig atatatataatatatatatatatttata eee eeeee tttathlhllhlhlhlllhlhlhlleeteteteeeeeteeeetete icicicics.sss AAAAAAAAAAAAAAAAAAAmomommomomomomoomoongngngngngngngngnng ttttttttthehehehhhhhhhhehhehebebebebebebebebbbebebeennnnnnnn eeeeeeeeeeeestssssttstss abbbabababbbabbbblillililililililliilishhhhhhhhhededeeeeeeeeee aaaaaaaarererereeerererererereer aaaan nnn unununundededededeeededededededdergrrrrrrr radudududududduduuuaaaaaaaaaacooooooooooordididididiidididiiidididinanananananananananannnaanattttittttt ononononononononnnn oooooooooooof fff fffff ffff stududududddudududdduddyyy y y yy yyyy ababababrorororoadaadadaddaddaadadadaa progrrrrrrraaaamaaacacacadaaaaaaaa emememememememememememmmemiciccccccc ssstatatatututus ss tot ssssssssssstututututututututtutututuudedededentntntnt-a-a-a-aaa-aa-a-aa--aththththththhthletessssssss tttttttttsooooooooo ttttttttttthahhhhhahahahhahhh ttttt ththththththththhhththhheeeyeeyeyey hhhhhhhhhavavavavavavvvaavavaave eeeee eee acacaccececececeeecececeeeeesssssssssssss ttttttttttttooooooooo llllilllll brarrrieieieieieieieieeeeei sssssanananandd d d cocococompmpmpmpututututututererereree llllllabababbbabbababa s.sss....

IInInInInInIn 2222222222220000000000000000000 2,2,2,2,2,22,2,, ttttttttttwowowowwooooo facacacacacacaccccaculuuuuuuuu tyyyyyyyyyyyy mmmmmmmememememememememmmmmme bebebebebbebebebbebebebebawaaaa arararrarararrara ddddedddd d ddddddd acadadadadadaddaddemmmmmmmmiaiaiaiaiaiaaaa’s’s’s’s’s’s’s’sssssss mmmmmmmmmmoPPrPrPrizzizizizizzizee..eeee.e. JJJJJJJJJJJohohohohohhohohohoohohohnnnnnnn nn BBBBBBBBBBBBB FFFFFFFFF

h amamamamaaamaamajjojojojojojojojojoojj riririririiririirir tytytytytytytyyytyttyyy t ooiooooooooonn’n’nn’n’n’n’nn sss s ss ss tototoototototootooppppppp 25252525252222525 mmmmmmmmmedeeeeeeeeee iaaaaaaaa

((4)4)4)4)4)4)4)4)4)4)4)4 , , ,,,,, BBoBoBoBoBoBBoBoBoststststststsstststonoooooo ((((((((((((7777)7777777 , AtAAAtAtAtAtAtAA lalalalalalalaantntntntntntntntntaaaaaaa a mmmmmmmooorororororoorororo eeeee eee (22222222225)5)5)5)55)5)555 . ThThThThThThThTTheeeeeee nununununununununununuuunuuumbmbmbmbmbmbmbmbmbmbmbmmbbmbm eeeeeerereeee ooooffffff ffffff

kkkkkkkkkeeeteteteeeetetetetetet excxcxcxcxcxccxxxceeeeeeee dsdsdsdsdsdssdsddss 22222222222220000000 0000000 mimimimillllllllioioioion.n.n.n

ihiiiiiiiiiiiippppppspppppp in 2323232323332323333223 ssssspopopoportrtrtrttrtrtrttrtrtrtrrtsssss.sssss MMMMMMMMMMalalalalalalalalallalalalleeee e ee eeeeeeee atatatatatatatattatattthhlhlhlhlhhlhlhlhlhlhlhhh eteetetee esesessessess baaasaasasasaaaseball,l,l,l,l,ll,l bbbbbbbbbbbbbasasasaskekekekekkkekekekkekkkk tbalalalalalalalalalalallllll,l,l,l,l,l,l,ll,lll,l ccccrooooror sssssssssssss

sssssooocoooooo cer,r,r,r,r,r,r,rr, ssssssssssssswiwiwiwiwiwiwiwimmmmmmmmmmmmm ininininninininnnnnnnnng g g g g g g g ggg ggg & &&& & & & &&&& & didididididididiidddidid vivivvivvv ngngngngngngngngnngngngngng, nggg.g.g.g.g.gg.ggggg Femalalalllallallalalallleeeeeeeeeeee ataatatatatatatatatttatathlhlhlhlhlhlhlhlhhlhlhlhlhh eteteteteteteteteeteteee esesesesesesesse bbbbbbbbatatatatatatatatatata tltltltltlltlttlttltlltleeee e ee e eeee foffffffoffofff r rrrrrr

osssssssssssssssssssssssss ccouuuuuuuuuuuntntntntntntnnnnnn ryryryryryryyy,,,,,,,,, fi fifi fi fi fi fi fi fifi fifififi eleleleeeeeeld dddddddd hohohohohohohhohooockckckkckckckeyeyeyeyeyeyeyyeye , ,baaaallllllllllllllllllllllll, ,,,,,,,, swssssssss immimimimimimimiiingnngngngngngnggg &&&&&&&&&&&&&& dddddddddddddiviviiiviviviviiviivvvinnnnininining,g,g,g,gg,gg,gg,

2222222222010101010101010101010100100 0-0-0-00-0-0-0-11111111111111111, 25525555555555 ttteaaaaaamsmsmsmsmsmsmsmsmm studedededededededededededeeeeentntntntnntntttnnnn -a-a-a-a-a-a-a- thttttttt leeleeleleleel tttttettttt s

012

LACROSSE


2011 HOFSTRA LACROSSE STATISTICS2011 HOFSTRA LACROSSE STATISTICS

DATE OPPONENT W/L SCORE ATTFeb. 15 Colgate W 6-3 1084Feb. 19 at Sacred Heart W 10-6 629Feb. 26 #8 Princeton W 11-9 2180Mar. 5 Harvard W 15-9 2753Mar. 13 Air Force W 11-6 1619Mar. 19 at Delaware* L 6-7 1028Mar. 22 St. John’s W 8-5 1060Mar. 26 Drexel* W 11-6 1773

Apr. 2 at Towson* W 12-5 1404Apr. 5 Manhattan W 13-8 778Apr. 9 at Saint Joseph’s* W 11-3 581Apr. 16 at Fairfi eld W 8-7 415Apr. 23 vs. #15 Massachusetts*! W 14-5 4748Apr. 30 #20 Penn State W 9-4 5484May 4 Delaware% L 9-10 809May 14 at #3 Johns Hopkins& L 5-12 1737

Name GP GS G A PTS SH SOG GW UP DN GB FO PEN MINJay Card 16 16 29 17 46 88 57 2 6 0 23 0-0 4 5:00Jamie Lincoln 16 16 29 11 40 73 44 1 5 0 21 0-0 3 2:00Stephen Bentz 16 16 23 14 37 55 35 2 3 0 27 0-0 3 2:30Ian Braddish 16 10 16 17 33 53 31 5 0 0 9 0-0 2 2:30Kevin Ford 16 15 16 10 26 75 38 0 3 0 20 0-0 2 1:30Adrian Sorichetti 12 0 12 1 13 23 16 1 1 0 5 0-0 2 1:30Brad Loizeaux 16 16 6 4 10 42 19 0 0 0 10 0-0 0 0:00Mike DeNapoli 13 0 5 5 10 14 9 0 3 0 2 0-0 0 0:00Steve Serling 4 4 3 6 9 13 11 0 0 0 2 0-0 0 0:00Aaron Jones 16 1 3 5 8 24 11 1 0 0 3 0-0 1 0:30Steven DeNapoli 16 0 4 3 7 12 6 0 0 0 60 0-0 7 6:00John Antoniades 16 0 2 4 6 4 2 0 0 0 84 174-271 5 4:00Lance Yapor 6 0 2 3 5 4 2 0 0 0 2 0-0 0 0:00Torin Varn 13 0 3 1 4 11 10 0 0 0 8 0-0 0 0:00Drew Coholan 5 2 2 2 4 5 3 1 9 9 3 0-0 0 0:00Michael Burke 14 0 3 0 3 7 6 0 3 0 5 0-0 0 0:00Adam Mojica 16 0 1 1 2 1 1 0 0 0 28 0-0 8 6:30Tim Holman 16 0 0 1 1 1 0 0 0 0 45 0-0 1 0:30Graham Horvath 4 0 0 0 0 3 1 0 0 0 0 0-0 0 0:00Stephen DiGiovanni 6 0 0 0 0 3 1 0 0 0 1 0-0 0 0:00Rich Rambo 5 0 0 0 0 3 1 0 0 0 0 0-0 1 1:00Zachary Pall 10 0 0 0 0 1 1 0 0 0 4 8-16 0 0:00Kevin Leary 2 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00Jerry Nobile 5 0 0 0 0 0 0 0 0 0 2 0-0 0 0:00Cullen Cassidy 8 0 0 0 0 0 0 0 0 0 3 14-28 1 1:00Anthony Zappone 5 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00Cole Koesterer 16 0 0 0 0 0 0 0 0 0 5 0-0 0 0:00Kyle Pratte 5 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00James Raveret 1 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00Jack Moorehead 5 0 0 0 0 0 0 0 0 0 2 0-0 0 0:00A.J. Leary 5 0 0 0 0 0 0 0 0 0 1 0-0 0 0:00Cody Solaja 15 15 0 0 0 0 0 0 0 0 14 0-0 6 4:00Michael Hamilton 6 0 0 0 0 0 0 0 0 0 2 0-0 2 2:30Rob Bellairs 9 0 0 0 0 0 0 0 0 0 1 0-0 0 0:00Mike Skudin 16 16 0 0 0 0 0 0 0 0 26 0-0 4 3:30Mark Mullen 16 3 0 0 0 0 0 0 0 0 11 0-0 1 1:00Corey Caputo 16 14 0 0 0 0 0 0 0 0 14 0-0 3 1:30Austin Wright 2 0 0 0 0 0 0 0 0 0 1 0-0 0 0:00Andrew Gvozden 16 16 0 0 0 0 0 0 0 0 35 0-0 1 0:30Jordan Fried 1 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00Tom Ferry 2 0 0 0 0 0 0 0 0 0 0 0-0 0 0:00Total 16 - 159 105 264 515 305 13 24 0 482 196-315 59 48:30Opponents 16 - 105 65 170 456 247 3 14 0 371 118-315 57 50:30

HOFSTRA GOALIE STATISTICSHOFSTRA GOALIE STATISTICSName GP GS MIN. GA GAA SAVES SV% W L T SFAndrew Gvozden 16 16 899:23 90 6.00 136 .602 13 3 0 416Rob Bellairs 9 0 60:37 15 14.85 6 .286 0 0 0 40Total 16 - 960:00 105 6.56 142 .575 13 3 0 456Opponents 16 - 960:00 159 9.94 146 .479 3 13 0 515

Clears: Hofstra - 250-277 (.903), Opponents - 251-293 (.857)

Man-Up Opportunities: Hofstra - 24-53 (.453), Opponents - 14-53 (.264)

Man-Up Opportunities: Hofstra - 25-75 (.333), Opponents - 16-48 (.333)RECORD: OVERALL HOME AWAY NEUTRALALL GAMES 13-3 8-1 4-2 1-0CONFERENCE 5-1 2-0 2-1 1-0NON-CONFERENCE 8-2-0 6-1 2-1 0-0

2012

LACROSS

2011 RESULTS2011 RESULTS


2011 GAME SUMMARIES2011 GAME SUMMARIES012

LACROSSE GAME 1

TUESDAY, FEBRUARY 15 VS. COLGATETUESDAY, FEBRUARY 15 VS. COLGATESix Pride players scored goals and junior goalie Andrew Gvozden made

eight saves to lead ninth-ranked Hofstra to a 6-3 victory over Colgate in

the season opener for both teams at James M. Shuart Stadium.

Senior All-American Jay Card tallied a goal in the four-

goal second quarter run that turned a 1-1 contest into

a 5-1 halftime lead. Card, who led the Pride with 22

assists last season, assisted on the goal by senior

Stephen Bentz that followed his own during the run.

Colgate senior attackman Andrew Mould scored back-

to-back goals in the third and fourth quarters to cut the

defi cit to 5-3 for the Raiders.

Battling against a slow-paced, deliberate

offense employed by Colgate, the Pride got

on the board 8:31 into the contest when

junior Brad Loizeaux scored on a runner

from nine yards out to the left of Raider

goalie Jared Madison for a 1-0 lead.

Madison would stop the Pride twice from

close range in the fi rst quarter to keep the

score at 1-0 after one period.

Colgate tied the game 5:55 into the

second quarter when junior Patrick

Campbell fed freshman Brendon

McCann with a short pass to the crease

to tie the game at 1-1. But in a span of 4:32,

the Pride took advantage of having the ball to

tally four unanswered goals. Sophomore Adrian

Sorichetti broke the tie, taking a short pass from

sophomore Aaron Jones in the middle of the box,

and fi ring a bullet past Madison from eight yards

with 5:30 to play in the half. Card made it 3-1 with

2:13 to play in the second, taking a short pass from

sophomore Ian Braddish fi ve yards to the right of the

Colgate goalie and fi ring a bullet into the cage. Just 10

seconds later, right off the face-off, Card fed Bentz who

scored from four yards in front of the cage. Junior Kevin

Ford ended the run with just 57 seconds remaining in the half on

a bullet from the middle of the fi eld from 14 yards out off a pass from

graduate-student Steve Serling.

The Raiders would try to mount a comeback with Mould scoring

4:52 into the third quarter on a runner from eight yards to the right of

Gvozden, and on a shot from 13 yards off a pass from sophomore Peter

Baum just 3:33 into the fourth quarter to cut the lead to 5-3. But Hofstra

All-American Jamie Lincoln dashed the Colgate hopes with 5:43 to play

in the game, dodging his defender, going in one-on-one with the goalie

and depositing the ball high in the cage for a 6-3 advantage.

Team 1 2 3 4 F

Colgate 0 1 1 1 3 Hofstra 1 4 0 1 6

COLGATE SCORING: GOALS: Mould, Andrew 2; McCann,

Brendon 1. ASSISTS: Baum, Peter 1; Campbell, Patrick 1.

HOFSTRA SCORING: GOALS: Card, Jay 1; Lincoln, Jamie 1;

Bentz, Stephen 1; Ford, Kevin 1; Loizeaux, Brad 1; Sorichetti, Adrian 1.

ASSISTS: Braddish, Ian 1; Card, Jay 1; Jones, Aaron 1; Serling, Steve 1.

GAME 2SATURDAY, FEBRUARY 19 AT SACRED HEART

Midfi elder Steve Serling tallied three goals and four assists and

attackman Stephen Bentz added three goals and one assist to lead #9

Hofstra to a 10-6 non-conference victory over Sacred Heart at

Campus Field.

Serling, a graduate-student transfer from Lafayette

College, scored two of his goals and three of his

assists in the second half to lead the Pride’s second

half charge after a 3-3 fi rst half. Bentz, a senior,

also tallied two goals and one assist in the second

half for Hofstra. Junior Matt King led the Pioneers

with two goals while sophomore Bryan Badolato

added two assists.

The Pride battled back from a 3-1 defi cit at the end of one

quarter to tie the game with goals in the fi nal 1:39 of the half as

Serling scored his fi rst as a member of the Pride, off a pass from

Kevin Ford, with 1:39 to play in the second, and Bentz tied the

game at 3-3 on a charge to the goal around two defenders for

his second of the season.

The Pioneers took the lead 2:57 into the third quarter as junior

Parker Wilson scored off a pass from Badolato. But Serling

helped give the Pride a 5-4 lead by assisting on senior Jay Card’s

second goal of the year, from 10 yards out, almost two minutes

later, and sophomore Michael Burke’s fi rst of the season, from just

off the crease on the man-up with 2:52 to play in the third quarter.

King tied the game up at 5-5 with his second of the contest, from

Mike Mawdsley, just 2:34 into the fourth, But the Pride responded

with fi ve unanswered goals in a span of 7:11 to blow the game open.

Serling scored his second of the game from junior Brad Loizeaux

just 2:10 after the Pioneer goal for a 6-5 lead. Sophomore Aaron Jones

notched his fi rst of the year on a bullet from 10 yards out, off a pass from

Bentz, at the 6:58 mark. Just 18 seconds later and directly off the face-

off, long-stick middie Adam Mojica fed Bentz, on the right side of the

crease, for his second of the contest and an 8-5 lead. Serling followed

with his third of the game 1:35 later on a charge to the goal from the left

of Sacred Heart goalie Zach Frank (eight saves). Bentz then notched his

third of the game and fourth of the year two minutes later, coming around

the cage after a perfect pass from Serling for a 10-5 advantage.

Pioneer sophomore Tim Sanders closed out the scoring with 55 seconds

to play on a bullet from 15 yards out, off a pass from senior Billy Skelos,

that beat Pride junior goalie Andrew Gvozden (seven saves).

Hofstra outshot Sacred Heart, 28-25, and picked up 31 ground balls to the

and junior goalie Andrew Gvozden made

Hofstra to a 6-3 victory over Colgatgatgate ie ie innn

ms at James M. Shuart Stadium.m.m.

allied a goal in the four-r-r--

ned a 1-1 contest into

ed the Pride with 22

he goal by senior

s own during the runnn..

ew Mould scored bacacck-k-k-kk-kkk-kk

ourth quarters to cut ut t thththetheheheeeee

deliberate

he Pride gogotgotgot

st when

a runneeerrr

f Raider r

lead.

wice frooommmmmmmmm

o keep tp tp tttthhehehehehehee

the

rick

n

e crease

span of 4:3222,

ing the ball to o o

phomore Adriaaaannnnnn

a short pass frooommmmmmmm

middle of the boboboooooxx,x,x, x, xx, xxxx,xx

from eight yardddsss

rd made it 3-1 wittthh hhhh

ng a short pass frommm m

ards to the right of tthhhheeee eeeee

et into the cage. Just 11000000010100

off, Card fed Bentz wwwhwhhhohohoooohohooh

of the cage. Junior Kevivinvininnnnnvinn

seconds remaining in the ee halhalllllhallhahalahalhalffff of off of off of of onnnnn n

fi eld from 14 yards out off a pass from m

GSSSASAASSSS TURDAY, FEBSSSASAASSSS TURDAY, FEB

MMMMMMMiMiMiiiddddMMMiMMM fi elder Steve Serling

aaaatatattttttttttaataa aacacacackckkkaaaa manmm Stephen Bentz

HoHofHofoffHoHoHoHHHHHHHH strstrst a to a 10-6 non

CamCamCamammmCaCamCamCamCamCaCa pusppp Field.

SerSerSerSerSerSerSerSeSeSeSS linlinnlinlinl g,g, g, g, a gra

ColColCollCollCoCoColC leleeeglll e,

aassssasa iists

hahhhalalalhh f ch

alsalsssalaaaa o too a

hhhahhahahalalhalh ff fo

wwiwith two

adadadded two

TThTheThe Pride batt

qqqquuuuauaaqququq arrtrter to tie the ga

SSSeSeSeeeerreSSeeS llling scored his fi

KKKKKKeKeeevevvvKKK in Ford, with 1

ggggagagagaaammmmagag e at 3-3 on a c

hhhihiiisshhihih s second of the s

TTTThThThheeeTTT Pioneers took th

PPPaPaPaaarrrPaPaPPP kkker Wilson scored

hhhhhheheheeelelellheh lpppped give the Pride

ssseseseeececcs csee oond goal of the yea

lalalatatatttaateeerer, and sophomore M

ooofffffffffofofoo f ttthe crease on the m

KKKKKKKKiKiKinininnnnKiKi ggg tied the game up a

MMMMMMMMMMiMiikikkkMiMiMM e Mawdsley, just 2:3

wwwwwiwiwiwitititwiwwwwitthhh h fi ve unanswered goa

SSSSeSeSeSerSerSerSeereS rrllilinling scored his second o

jjjujusjusjust 2:10 after the Pioneer go

notched his fi rst of the year o

Bentz at the 6:58 mark Just

JAY CARD


2011 GAME SUMMARIES2012

LACROSS

2011 GAME SUMMARIES2011 GAME SUMMARIESPioneers 26. Pride sophomore John Antoniades won 11-of-14 face-off as

Hofstra captured 14 of the 18 in the contest.

Team 1 2 3 4 F

Hofstra 1 2 2 5 10 Sacred Heart 3 0 1 2 6

HOFSTRA SCORING: GOALS: Serling, Steve 3; Bentz, Stephen

3; Card, Jay 1; Lincoln, Jamie 1; Jones, Aaron 1; Burke, Michael 1.

ASSISTS: Serling, Steve 4; Bentz, Stephen 1; Ford, Kevin 1; Loizeaux,

Brad 1; Mojica, Adam 1.

SACRED HEART SCORING: GOALS: King, Matt 2; Lupo, Aaron

1; Wilson, Parker 1; Marquis, Cody 1; Sanders, Tim 1. ASSISTS:

Badolato, Bryan 2; Crepinsek, Eric 1; Dauses, Trevor 1; Mawdsley,

Mike 1; Skelos, Billy 1.

GAME 3SATURDAY, FEBRUARY 26 VS. #8 PRINCETON: SATURDAY, FEBRUARY 26 VS. #8 PRINCETON:

Senior Jamie Lincoln scored four goals and Stephen Bentz added three to

lead the seventh-ranked Hofstra Pride to an 11-9 victory over the eighth-

ranked Princeton Tigers at James M. Shuart Stadium.

Lincoln, who tallied three goals in the fi rst half, added Hofstra’s 11th

goal of the game with 7:16 to play in the contest while Bentz scored

all three of his goals in the fi rst half. Junior goalie Andrew Gvozden

recorded six saves for the Pride including two big stops in the fourth

quarter. Sophomore midfi elder John Antoniades won 16 of 22 face-offs

and picked up a game-high nine ground balls for the Pride. Princeton was

led by sophomore Forest Sonnenfeldt with three goals while sophomore

Jeff Froccaro and freshman Tom Schreiber each tallied two goals. Junior

goalie Tyler Fiorito recorded 15 saves in the Princeton cage.

The Tigers jumped out to a 4-1 lead midway through the fi rst quarter as

Schreiber scored twice and Sonnenfeldt and Jack McBride each added

single goals around Lincoln’s third goal of the year. The Pride closed the

gap to 4-3 on an unassisted charge to the goal by Bentz with 5:53 to play

in the fi rst, and a man-up goal by Lincoln, off a perfect pass to the crease

by midfi elder Steve Serling 33 seconds later. Sonnenfeldt notched his

second of the game, off a pass from behind the cage by Luke Armour, to

boost the Princeton lead to 5-3.

The Pride then went on a 6-1 run to take a 9-6 lead at halftime. Bentz

got the ball rolling with his second of the game and sixth of the year off

a pass from Steven DeNapoli that sent him in one-on-one against Fiorito

with 49 seconds remaining in the fi rst quarter. Senior Jay Card extended

his consecutive games point-scoring streak to 31 with a man-up goal, off

a pass from Kevin Ford, just 14 seconds into the second quarter to tie the

contest at 5-5.

Sonnenfeldt would give the Tigers their last lead of the game, at 6-5,

just 1:23 later before the Pride scored four unanswered goals. Bentz

notched his third from six yards out to tie the game with 7:33 to play

in the half. Kevin Ford then scored Hofstra’s fourth man-up goal of the

game, off a pass from Card at the 4:55 mark, for a 7-6 advantage. Junior

Brad Loizeaux boosted the lead with a low shot to the far post from eight

yards almost two minutes later. Seven seconds later, right off the face-

off, Antoniades fed Lincoln, who buried his third of the game and fi fth of

the season and a 9-6 lead at halftime.

Princeton closed to within one at 9-8 with two goals midway through

the third quarter as Mark Field tallied a man-up goal from Armour at

the 9:44 mark, and Froccaro scored 1:01 later on a high bullet from 10

yards out. But Hofstra sophomore Drew Coholan scored his fi rst goal

of the year, going around two defenders and scoring from fi ve yards

out with 5:21 to play in the third before Lincoln closed out the Hofstra

scoring with a behind-the-head shot from 10 yards out, off a rebound of

a Steve Serling shot, at the 7:16 mark of the fourth quarter for an 11-8

lead. Froccaro scored an unassisted goal with 1:25 to close to 11-9.

But Gvozden made a big save off a shot from Armour with 46 seconds

remaining and DeNapoli picked up the ground ball with 34 seconds

remaining as the Pride ran out the clock.

Badolato, Bryan 2; Crepinsek, Eric 1; Dauses,es,es,, TrTrTrevoevoevor 1; Mawdsley,

Mike 1; Skelos, Billy 1.

STEPHEN BENTZ



LACROSSE

2011 GAME SUMMARIES


g , , p p g

Princeton’s 16 in the contest.

Team 1 2 3 4 F

#8 Princeton 5 1 2 1 9#7 Hofstra 4 5 1 1 11

PRINCETON SCORING: GOALS: Sonnenfeldt, Forest 3; Froccaro,

Jeff 2; Schreiber, Tom 2; Feild, Mark 1; McBride, Jack 1. ASSISTS:

Armour, Luke 2; Feild, Mark 1.

HOFSTRA SCORING: GOALS: Lincoln, Jamie 4; Bentz, Stephen

3; Card, Jay 1; Ford, Kevin 1; Coholan, Drew 1; Loizeaux, Brad 1.

ASSISTS: Card, Jay 2; Antoniades, John 1; Coholan, Drew 1; DeNapoli,

Steven 1; Ford, Kevin 1; Serling, Steve 1.

GAME 4TURDAY, MARCH 5 VS. HARVARD: TURDAY, MARCH 5 VS. HARVARD:

Lincoln scored a season-high fi ve goals and classmate

ded three goals and three assists to lead the fi fth-ranked

to a 15-9 victory over the Harvard Crimson at James M.

m.

llied four of his fi ve goals in the fi rst half as the Pride

ime lead, equaled his Hofstra high set last year against

and fell one goal short of tying his career-high set against

le at Denver. Card posted a season-high six points as did

ord with one goal and two assists. Senior Stephen Bentz

son high with four points on one goal and three assists.

Braddish tallied two goals. Hofstra goalie Andrew

ded a season-high 15 saves, two off of tying his career-

on were led by sophomore Alex White, who posted a

assists while juniors Jeff Cohen, Terry White and Kevin

allied two goals. Sophomore Harry Krieger made fi ve

mson cage.

traded the fi rst four goals before Cohen scored his fi rst

of the game with 7:41 to play in the fi rst to give the Crimson their last

lead of the contest at 3-2. At that point, Bentz dented the twine almost

a minute later to tie the game and Lincoln added his second and third of

the period in the fi nal 1:08 to give Hofstra a 5-3 lead after one quarter.

White cut the Harvard defi cit to 5-4 with an unassisted goal 48 seconds

into the second quarter but the Pride responded with four unanswered

goals, two by Card, and one each by Ford and Lincoln, to boost the

Hofstra lead to 9-4 with 5:45 to play in the half. Cohen added a man-up

goal 25 seconds later and Terry White notched his third of the season

with 1:06 to play in the period for the 9-6 margin at halftime.

Braddish scored his fi rst of the season just 2:47 into the third and

freshman Torin Varn tallied the fi rst of his college career four minutes

later to boost the Pride lead to 11-6. Harvard senior Dean Gibbons tallied

his fourth of the year 59 seconds later to close to 11-7 but Hofstra junior

Mike DeNapoli, who returned from a preseason injury, scored a man-

up goal, and Braddish and Card added all-even goals in the next fi ve

minutes to open up a 14-7 advantage.

White tallied his second of the game and fourth of the year with 1:38 to

play in the third for Harvard and Lincoln notched his fi fth just 4:04 into

the fourth quarter for Hofstra. Kevin Vaughan tallied his second of the

contest and third of the year with 4:37 to play to close out the scoring incontest and third of the year with 4:37 to play to close out the scoring in

the game for Harvard.

Harvard outshot the Pride, 49-31, while Hofstra picked up 39 ground

balls to the Crimson’s 34.

Team 1 2 3 4 F

Harvard 3 3 2 1 9#5 Hofstra 5 4 5 1 15

Hofstra outshot the Tigers, 40-28, and picked up 31 ground balls to

SATSATSenior Jamie

Jay Card add

Hofstra Pride

Shuart Stadium

Lincoln, who ta

built a 9-6 halfti

Johns Hopkins a

Quinnipiac whil

junior Kevin Fo

equaled his seas

Sophomore Ian

Gvozden record

best. The Crims

goal and three a

Vaughan each ta

saves in the Crim

The two teams t

of the game with

STEVEN DENAPOLI



LAHARVARD SCORING: GOALS: Vaughan, Kevin 2; Cohen, Jeff

2; White, Terry 2; White, Alex 1; Gibbons, Dean 1; Doyle, Jack 1.

ASSISTS: White, Alex 3; Slingerland, Eric 1.

HOFSTRA SCORING: GOALS: Lincoln, Jamie 5; Card, Jay 3;

Braddish, Ian 2; Bentz, Stephen 1; Ford, Kevin 1; Varn, Torin 1;

Loizeaux, Brad 1; DeNapoli, Mike 1. ASSISTS: Bentz, Stephen 3; Card,

Jay 3; Ford, Kevin 2; Coholan, Drew 1; Jones, Aaron 1; Lincoln, Jamie 1.

GAME 5SUNDAY, MARCH 13 VS. AIR FORCE: SUNDAY, MARCH 13 VS. AIR FORCE:

Senior Jay Card tallied three goals and two assists, junior Brad Loizeaux

added one goal and two assists, and goalie Andrew Gvozden stopped

eight shots to lead the fourth-ranked Hofstra Pride over Air Force, 11-6

at James

M. Shuart Stadium. The Pride, who equaled their best start to a season

since 1997, improved to 5-0 on the season.

Card, who became the eighth player in school history to record 100

career goals with his fi rst goal of the game Sunday, recorded his second

consecutive fi ve-point game after posting six against Harvard on March

5. Loizeaux, who assisted on Card’s fi nal goal of the game, notched a

season-high three points after posting a point in each of his fi rst four

games. Senior Jamie Lincoln added two assists. Gvozden, who posted

his fi fth victory of the season, made eight saves in 51:18 before being

relieved by sophomore Rob Bellairs.

The Falcons were led by senior Zach Carroll with two goals while senior

Vinny Sandtorv and junior Adam Paranka each chipped in with one goal

and one assist.

Hofstra jumped on Air Force early building a 6-1 lead midway through

the second quarter. Junior Mike DeNapoli opened the scoring 8:48 into

the contest on a bounce shot from 10 yards for a 1-0 lead. Loizeaux

boosted the lead less than a minute later on a shot from eight yards after

a short pass from Kevin Ford. The Falcons got on the board with 2:09 to

play in the fi rst quarter as Paranka capitalized on a Hofstra turnover near

midfi eld to score his third of the year off a pass from Tristan Newkirk.

But the Pride scored the next four as Card assisted on the next two goals

by senior Stephen Bentz (2 goals) and a man-up tally by sophomore

Michael Burke before scoring the 100th of his career, on a jump shot

from 10 yards, and sophomore Drew Coholan notching his second of the

year from Loizeaux for a 6-1 lead with 8:35 to play in the half.

Air Force rallied with three unanswered goals as freshman Kyle Cassady

tallied his second of the year from 12 yards out, and classmate Tommy

McKee added his seventh of the year, in transition, 50 seconds later and

Carroll posted his sixth of the season with 1:59 to play in the half to cut

the defi cit to 6-4.

But Hofstra went on a 5-1 run, including two goals in the fi nal minute of

the second quarter by sophomore Ian Braddish, and third quarter goals

by Card and Bentz to boost the lead to 10-5. Card and Carroll exchanged

fourth quarter goals to post the fi nal 11-6 score.

The Pride outshot Air Force, 32-27, and picked up 32 ground balls to the

Falcons’ 26. Hofstra was also dominant in face-offs, capturing 16 of 20

with sophomore John Antoniades winning 15 of 19.

Team 1 2 3 4 F

Air Force 1 3 1 1 6 #4 Hofstra 3 5 2 1 11

AIR FORCE SCORING: GOALS: Zack Carroll

2; Vinny Sandtorv 1; Adam Paranka 1; Kyle

Cassady 1; Tommy McKee 1. ASSISTS: Tristan

Newkirk 1; Adam Paranka 1; Vinny Sandtorv 1;

Erik Smith 1.

HOFSTRA SCORING: GOALS: Card,

Jay 3; Bentz, Stephen 2; Braddish, Ian 2;

Loizeaux, Brad 1; DeNapoli, Mike 1;

Burke, Michael 1; Coholan, Drew 1.

ASSISTS: Card, Jay 2; Jones, Aaron

2; Lincoln, Jamie 2; Loizeaux, Brad 2;

Ford, Kevin 1.

Loizeaux, Brad 1; DeNapoli, Mike 1. ASSISTS: Bentz, Stephen 3; Card,

Jay 3; Ford, Kevin 2; Coholan, Drewewew w w w w 11;1;1;1;1;11;1;;;; JJonJonJonJonJonnJonJonJonJonJoneseseseses,eses,es,es AaAAaAaAaAaAAaronrononronroror 1; Lincoln, Jamie 1.

the contes

boosted th

a short pa

p yplay in th

midfi eld t

But the P

by senior

Michael B

from 10 y

year from

Air Force

tallied his

McKM ee ad

CCCarCCC roll po

ththththheheeetththt defi cit

BBBBBBBBBBuuuuuuutttBBuutB HHHofst

tttthththththththeheheheeethhethheeeh sssecon

bbbybyby by b Card a

fourth qu

The Pride

Falcons’

with soph

Team

Air Force#4 Hofstr

AIR FOR

2; Vinny

Cassady 1

Newkirk

Erik Smit

HOFSTR

Jay 3; Be

A MEN’SS LALALALAAAAAAACRCRCRCRCRRCRCRCRCRCRCRCRCC OSOSOSOSOSOSOSSOSOSOSOSOSOSOSOSOSSESESESESESESESESESESESESESESESESS ——————— 7777777777777777775555555555555555

1 3 1 1 6 3 5 2 1 11111

G: GOALS: Zack Carroll

dam Paranka 1; Kyle

Kee 1. ASSISTS: Tristan

ka 1; Vinny Sandtorv 1;1;1;;;

: GOALS: Cardrdrd,d,,,

Braddish, Ian n n 22;2;2;;;;

poli, Mike 1;1;;

lan, Drew 111.

Jones, AaAarararroooon on n oon o

zeaux, BrBrBradd ddaadd 2;22;;222;

KEVIN FORD

ANDREW GVOZDEN



LACROSSE


GAME 6 SATURDAY, MARCH 19 AT DELAWARE: SATURDAY, MARCH 19 AT DELAWARE: Delaware junior Grant Kaleikau recorded two goals and

three assists to lead the Delaware Blue Hens to a 7-6

upset of the fourth-ranked Hofstra Pride in the CAA

season opener for both teams at Delaware Stadium.

Hofstra was led by senior Jay Card with two goals

and one assist, junior Kevin Ford with two goals and

classmate Mike DeNapoli with two assists. Junior goalie

Andrew Gvozden made 12 saves in the Pride goal. In

addition to Kaleikau, sophomore John Mills had two

goals for the Blue Hens while senior Nick Elsmo had a

goal and an assist. Senior Noah Fossner made 13 saves

in the Delaware cage to post his fi fth win of the year.

The Pride jumped out to a 2-0 lead after 3:51 of the fi rst

quarter on back-to-back goals by Card. His fi rst of the

day, and his 10th of the year, came off a pass from Mike

DeNapoli at the 11:29 mark while on the man-up. His

second came 20 seconds later on a charge from the right

of Fossner for his 11th of the year.

But the Blue Hens scored fi ve unanswered goals to take

a 5-2 lead early in the third quarter. Kaleikau started the run with his

fourth of the year on a high shot from the side of the cage with 6:26 to

play in the fi rst. He then assisted on the next two goals, a man-up tally by

Mills, 5:06 into the second, and an all-even goal on a charge to the goal

3:30 later to end the half tied at 2-2.

Kaleikau opened the scoring in the second half just seven seconds in off

a pass from Dan Cooney, who won the face-off. Elsmo closed out the

run with his eighth of the year 2:43 later for a 5-2 lead. But the Pride

answered with back-to-back goals by sophomore Ian Braddish on a run

to the cage 55 seconds later, and a man-up goal by senior Stephen Bentz

off a pass from Card with 8:13 to play in the third quarter to close to 5-4.

It was Braddish’s fi fth of the year and Bentz’s 11th. Junior middie Dom

Sebastiani notched his third of the year for UD with 3:33 to play in the

period and Ford notched his fourth of the season with 1:25 to close out

three quarters with the Blue Hens holding a 6-5 advantage.

Sophomore Nick Diachenko gave Delaware a little breathing room with

his sixth goal of the year from Kaleikau just 2:54 into the fourth quarter

which is how it stayed until Ford fi red in a man-up bullet, off a pass from

DeNapoli, with 1:56 to play to close to within one again at 7-6.

The Pride got the ball back twice in the last 90 seconds but turned the ball

over both times as the Blue Hens were able to break up both passes.

Delaware outshot Hofstra, 39-27, and picked up 29 ground balls to the

Pride’s 23. Hofstra, which ranks seventh in man-up percentage, boosted

its numbers by scoring on three of fi ve extra-man opportunities.

Team 1 2 3 4 F

#4 Hofstra 2 0 3 1 6Delaware 1 2 3 1 7

HOFSTRA SCORING: GOALS: Card, Jay 2; Ford, Kevin 2; Bentz,

Stephen 1; Braddish, Ian 1. ASSISTS: DeNapoli, Mike 2; Card, Jay 1.

DELAWARE SCORING: GOALS: Kaleikau, Grant 2; Mills, John

2; Elsmo, Nick 1; Diachenko, Nick 1; Sebastiani, Dom 1. ASSISTS:

Kaleikau, Grant 3; Cooney, Dan 1; Elsmo, Nick 1; Finegan, Sean 1;

Smith, Eric 1.

GAME 7TUESDAY, MARCH 22 VS. ST. JOHN’S:TUESDAY, MARCH 22 VS. ST. JOHN’S:

Senior attackmen Jay Card, Jamie Lincoln and Stephen Bentz combined

for fi ve goals and six assists to lead the eighth-ranked Hofstra Pride to an

8-5 non-conference victory over the St. John’s Red Storm at James M.

Shuart Stadium.

Card tallied two goals and two assists, Lincoln added one goal and three

TIM HOLMAN



LACROSS

assists and Bentz chipped in with two goals and one assist for the Pride.

Card’s two goals give him 106 in his career, moving him into sixth place

on the Pride career goals list. It also extended his consecutive game point

streak to 35 contests. Card also moved into seventh place on the Hofstra

career points list with 160 (106 goals, 54 assists). Junior goalie Andrew

Gvozden made 11 saves and allowed three goals in 55 minutes. St. John’s

was led by Ryan Fitzgerald with two goals while Kieran McArdle added a

goal and two assists.

The Pride, which led 6-0 at halftime, scored the fi rst seven goals of the

game and led 7-0 six minutes into the third quarter. Sophomore Ian

Braddish opened the scoring 1:32 into the game off a pass from Lincoln.

Junior Kevin Ford, who had a goal and an assist in the game, notched his

sixth goal of the year from Bentz with 3:21 to play in the period.

Hofstra added four more in the second as Bentz posted his 12th of the

year, from Card, right off the opening face-off seven seconds into the

period. Lincoln then fed Card for a man-up goal and his 12th overall on

the season with 8:33 to play in the half. Sophomore Adrian Sorichetti

added his second goal of the season almost two-and-a-half minutes later

before Bentz tallied his second of the game, from Card, 41 seconds after

Sorichetti’s tally for a 6-0 halftime lead. Card boosted the Pride lead

to 7-0 with a behind-the-head goal, cutting across in front of the cage,

off a pass from Lincoln 5:53 into the third. The Red Strom scored three

unanswered goals to cut the lead to 7-3 as Fitzgerald scored back-to-back

goals, his fi fth and sixth of the year, and Brandon Ayers notched his third

of the season with 1:33 to play in the third.

But Lincoln bumped up the Hofstra lead to 8-3 with his 12th goal of the

year, from Ford, 2:15 into the fi nal quarter before Joe Granata

scored with 3:27 to play and McArdle notched his 12th of the

season with one second remaining for the fi nal 8-5 margin.

The Red Storm outshot Hofstra, 33-27, and picked up 22 ground

balls to Hofstra’s 21.

Team 1 2 3 4 F

St. John’s 0 0 3 2 5 #8 Hofstra 2 4 1 1 8

ST. JOHN’S SCORING: GOALS: Fitzgerald, Ryan 2;

McArdle, Kieran 1; Ayers, Brandon 1; Granata, Joe 1.

ASSISTS: McArdle, Kieran 2.

HOFSTRA SCORING: GOALS: Card, Jay 2; Bentz, Stephen 2;

Lincoln, Jamie 1; Ford, Kevin 1; Braddish, Ian 1; Sorichetti, Adrian 1.

ASSISTS: Lincoln, Jamie 3; Card, Jay 2; Bentz, Stephen 1; Ford, Kevin

1.

GAME 8 SATURDAY, MARCH 26 VS. DREXEL:

Ian Braddish tallied a team-high three points on a goal and two assists

and John Antoniades won 15 of 21 face-offs to lead the eighth-ranked

Pride of Hofstra to an 11-6 victory over the Drexel Dragons in a

Colonial Athletic Association contest at James M. Shuart Stadium.

Braddish, a sophomore, recorded his best-output of the season with the

three points and scored the fi nal tally of a six-goal Hofstra run that gave

the Pride a 7-2 lead with just under seven minutes remaining in the fi rst

half. Antoniades, who continues his fi ne play at the face-off X, won 15

face-offs, assisted on a goal during the run, and picked up a game-high

eight ground balls. Four Pride players scored two goals as seniors Jamie

Lincoln and Jay Card, sophomore Aaron Jones and freshman Torin Varn

dented the twine twice. Junior goalie Andrew Gvozden made six saves to

post his seventh win of the year.

The Dragons of Drexel were led by Robert Church, who posted two goals

and three assists, while Scott Perri and Brendan Glynn each recorded a

goal and an assist.

Drexel scored the game’s fi rst goal and jumped out to a 2-1 lead after the

fi rst 10:25 as Glynn and Church sandwiched a Hofstra goal by Stephen

Bentz for the early advantage. But the Pride tallied six unanswered goals

and eight of the next nine to take a big lead. Card started the run with his

14th goal of the year, just fi ve seconds after Church’s goal off a pass from

Antoniades, to tie the game at 2-2. Just 58 seconds later, Jones notched his

second of the year on a 13-yard bullet that beat Drexel goalie Mark Manos

(11 saves). Senior Stephen DeNapoli was the benefactor of Antoniades’

hard work off the next face-off, taking a pass from the sophomore,

sprinting half the fi eld and scoring his fi rst of the year from fi ve yards out

11 seconds later. Lincoln gave the Pride a 5-2 advantage with his 13th

goal of the season, from Bentz, with 2:08 to play in the fi rst quarter.

Card notched his 15th on an unassisted goal 4:25 into the second quarter

and Braddish scored his seventh of the season, also unassisted, almost

four minutes later for a 7-2 lead with 6:57 to play in the half. Drexel

junior Kyle Bergman ended the run with his 10th goal of the year,

from Church, to cut the defi cit to 7-3. But Varn notched his second

of the year, from Braddish, with 2:45 to play in the second to close

out the scoring in the half with the Pride holding a comfortable 8-3

cushion. Hofstra outshot Drexel, 23-8 and picked up 18 ground

balls to the Dragons nine in the fi rst half.

Lincoln boosted the Hofstra lead to six at 9-3 with his second of

the day and 14th of the year 5:20 into the third quarter. Drexel

tallied the next two goals, as Perri scored his 25th of the year,

a man-up tally, 2:30 later, and Church added his second of

the day and 14th of the year with 4:58 remaining in the

2012 HOFSTRA MEN’S LAAAAAL CRCRCRCRCRCRCRCRCRCRRRRRRROOSOSOOOOOOOSSSSSSSSSSSSOOOO SESESSSEEEEEEEEEEE ———— 77

nd

n 2;

drian 1.

ord, Kevin

o assists

-ranked

a

ium.

with the

that gave

of the year, from Braddish, with 2:45 to play in the second to close

ououtou the scoring in the half with the Pride holding a comfortable 8-3

cccushion. Hofstra outshot Drexel, 23-8 and picked up 18 ground

babalbalb ls to the Dragons nine in the fi rst half.

fLLinininLL coln boosted the Hofstra lead to six at 9-3 with his second of

thththeheeett day and 14th of the year 5:20 into the third quarter. Drexel

tatatalallttt lilieli d the next two goals, as Perri scored his 25th of the year,

aaa mmmaaa anan-a up tally, 2:30 later, and Church added his seseconconcond odd f

ththeheethth dadaday ay ay ay nd n 14th of the year with 4:58 8 8 remremremre ainainainningingingg in thee

JAMIE LINCOLN



LACROSSE

period to close to 9-5 after three quarters.

But Hofstra’s Jones and Varn sandwiched a Drexel goal by Nick

Trizano in the fourth quarter to even its record at 1-1 in the CAA after a

conference opening loss to Delaware last week. The Pride fi nished the

game outshooting the Dragons, 39-15, and picked up 37 ground balls to

Drexel’s 19.

Team 1 2 3 4 F

Drexel 2 1 2 1 6 #8 Hofstra 5 3 1 2 11

DREXEL SCORING: GOALS: Church, Robert 2; Glynn, Brendan 1;

Perri, Scott 1; Bergman, Kyle 1; Trizano, Nick 1. ASSISTS: Church,

Robert 3; Glynn, Brendan 1; Perri, Scott 1.

HOFSTRA SCORING: GOALS: Lincoln, Jamie 2; Card, Jay 2; Jones,

Aaron 2; Varn, Torin 2; Braddish, Ian 1; Bentz, Stephen 1; DeNapoli,

Steven 1. ASSISTS: Braddish, Ian 2; Antoniades, John 1; Bentz, Stephen

1.

GAME 9 SATURDAY, APRIL 2 AT TOWSON:SATURDAY, APRIL 2 AT TOWSON:

Senior Jamie Lincoln tied his season-high with fi ve goals and junior

Andrew Gvozden made eight saves to lead the 10th -ranked Hofstra Pride

to a 12-5 CAA victory over the Towson Tigers at Johnny Unitas Stadium.

The Pride blew the game open in the third quarter scoring six times during

a 7-0 run to take a 9-3 lead after three quarters. Lincoln’s fi ve goals

equaled his fi ve against Harvard on March 5. Senior Stephen Bentz added

two goals and one assist while sophomore Ian Braddish chipped in with

one goal and two assists. The Tigers were led by junior Matt Lamon with

two goals while goalie Travis Love posted 11 saves in the Towson cage.

Towson got on the board fi rst as Matt Lamon notched his seventh of the

season off a pass to the crease from Sean McGuire 2:28 into the contest.

But the Pride responded with back-to-back goals by Lincoln. He scored

his 15th of the season just 16 seconds after the Tiger goal on a pass to the

side of the goal from John Antoniades to tie the game. Lincoln tallied his

second of the game when he raked in a rebound of a Brad Loizeaux shot

that was stopped by Love, with 2:41 to play in the quarter.

The Tigers tied the game 1:36 into the second quarter as senior Peter

Mezzanotte took a pass from Andrew Hodgson and fi red in a bullet from

15 yards. Towson took a brief 3-2 lead with 2:09 to play in the half as

senior Elliott Domanic fed Lamon, who beat Gvozden from fi ve yards

out. Hofstra came right back on the ensuing face-off with senior Steven

DeNapoli picking up the ground ball, charging the Tiger goal and beating

Love on a bounce shot just 10 seconds later to tie the game at 3-3.

Hofstra took a 4-3 lead just 4:14 into the second half as Bentz picked

up a loose ball in front of the Towson cage off a Tiger turnover and fed

Lincoln for a jump shot goal. Lincoln scored his fourth of the game and

18th of the year, taking a short bounce pass from Braddish and beating

Love from seven yards in front for a 5-3 lead with 5:58 to play in the

third. Sophomore Adrian Sorichetti notched his third of the season, on

the run from six yards out to the left side of Love, two minutes later for a

6-3 advantage. Bentz then scored his 15th of the season, coming out from

behind

the goal at the 2:26

mark. Antoniades

scored his fi rst of the

year fi ve seconds later,

winning the face-off

and going in on Love.

Braddish ended the Pride

seven-goal run with his

eighth of the season with 56

seconds to play in the third

period.

The Tigers scored 29

seconds into the fourth quarter

as McGuire converted a pass from

Mezzanotte. But Hofstra’s Jay Card extended his consecutive game

points scoring streak to 37 games with his 16th goal of the year, from

Braddish, to boost the lead to 10-4 with

13:04 to play in the contest. Lincoln then scored his fi fth of the game,

equaling his Pride best set earlier this year against Harvard, at the 7:17

mark. Bentz scored a man-up goal with 4:12 to play before Domanic

closed out the scoring with his fi rst of the year a minute late for Towson.

Hofstra outshot Towson, 37-30, and picked up 33 ground balls to the

Tigers’ 24.

Team 1 2 3 4 F

#10 Hofstra 2 1 6 3 12 Towson 1 2 0 2 5

HOFSTRA SCORING: GOALS: Lincoln, Jamie 5; Bentz, Stephen

2; Braddish, Ian 1; Antoniades, John 1; Card, Jay 1; Sorichetti, Adrian

1; DeNapoli, Steven 1. ASSISTS: Braddish, Ian 2; Antoniades, John 1;

Bentz, Stephen 1.

TOWSON SCORING: GOALS: Lamon, Matt 2; Mezzanotte, Peter

1; Domanic, Elliott 1; Maguire, Sean 1. ASSISTS: Domanic, Elliott 1;

Hodgson, Andrew 1; Maguire, Sean 1; Mezzanotte, Peter 1.

bbbbebehehehehehehbbeb hinininnndndndndinndd

thethehehtheth gogogogoggoalalalal aatat thethe 222:2:::22 262626 626 2266 6

mark. k AAntoniadeadedees sss

scored his fi rst of f f tf ttthhhehehe hh

year fi ve seconds s llaaatatatttteeer,er,r,er,,,

winning the face-oooff ffffffffff fff

and going in on Lovvveeee.

Braddish ended the PPrPrrrP idididddededeeeeii

seven-goal run with hhhisis sssii

eighth of the season wiwiitthhh h h 5555556666 6

seconds to play in the ttthhhihiirirrrddd dd

period.

The Tigers scored 29

seconds into the fourth h qququuauauaaaauaaartertetetetertetertertertertrtterr rrrrrrrr rr

as McGuire converted a passassassss frfffrfrrfrom omommomom mom om

Mezzanotte. But Hofstra’s Jay CarC d extended his consecutive gamgamameee

points scoring streak to 37 games with his 16th goal of the year, from

JOHN ANTONIADES



LACROSS

GAME 10 TUESDAY, APRIL 5 VS. MANHATTAN: TUESDAY, APRIL 5 VS. MANHATTAN:

Senior Jaime Lincoln tallied three goals and one assist and classmate

Stephen Bentz added one goal and three assists as the eighth-ranked Pride

of Hofstra cruised to a 13-8 victory over Manhattan College at James M.

Shuart Stadium.

The Pride scored the fi rst seven goals of the contest and led 10-2 at

halftime on their way to the easy victory. The Jaspers scored fi ve times in

the fourth quarter with Hofstra scoring just once to close the defi cit at the

end. Lincoln had his fourth hat trick of the season with just 3:01 gone in

the second quarter and fellow senior Jay Card had notched his third hat

trick of the year with 1:53 to play in the half. With his three points, Card

has tied Chris Unterstein (2003-06) for fi fth place on the Hofstra all-time

career points list with 166 (112-54). Sophomore Ian Braddish tallied two

goals and one assist. Senior short-stick defensive middie Steve DeNapoli

equaled his career-best with two assists while sophomore face-off

specialist John Antoniades won 12 of 17 face-offs and picked up a game-

high nine ground balls. Junior goalie Andrew Gvozden played the fi rst

33:47, allowing two goals and needed to make just one save.

Manhattan was led by freshman Marcel Godino with two goals while

junior Brendan Rogers had a goal and an assist.

Lincoln opened the scoring just 2:51 into the game with his 20th of the

season from six yards out. Card scored his 17th off a pass from Bentz with

9:31 to play in the quarter to make it 2-0. Sophomore Ian Braddish scored

the fi rst of two goals on the night, going around a Jasper for an unassisted

goal, his ninth of the season, fi ve minutes later. Bentz then notched his

17th of the year from Lincoln on a pass to the crease for a 4-0 advantage

with two minutes to play in the fi rst. Lincoln added his second of the

game and 21st of the season, from Bentz, with six seconds to play

for a 5-0 lead after one quarter.

Lincoln boosted the lead to 6-0 with a man-up goal from Kevin

Ford just 3:01 into the second and Card added a man-up goal,

from junior Mike DeNapoli, 39 seconds later for a 7-0 lead. Card

and Bentz extended their consecutive point scoring streaks to 38

and 25 games, respectively.

The Jaspers scored back-to-back goals starting almost a

minute later as senior

Justin Jensen

tallied his

16th of the

season at

the 10:28

mark and

junior Brendan

Rogers added his 10th of the season at the 7:54 mark to

close the gap to 7-2. But the Pride scored the next four

goals and fi ve of the next six to open up a bigger margin.

Sophomore Michael Burke started the four-goal run with

an extra-man goal from Bentz at the 4:12 mark. Card then

completed his hat-trick, off a pass from senior Tim Holman,

just under two minutes later and Mike DeNapoli, notched

his third of the season with an assist from his cousin Steven

DeNapoli just four seconds before halftime. Braddish completed the run

51 seconds into the third quarter with his 10th goal of the year.

Manhattan senior Mike Llewellyn ended the Hofstra run with his eighth

goal of the season before Hofstra sophomore Adrian Sorichetti closed out

the scoring in the period with his fourth goal of the year from freshman

Torin Varn with 16 seconds remaining for a 12-3 lead after three quarters.

Hofstra outshot the Jaspers, 25-19, and picked up 36 ground balls to

Manhattan’s 19 in the contest.

Team 1 2 3 4 F

Manhattan 0 2 1 5 8 #8 Hofstra 5 5 2 1 13

MANHATTAN SCORING: GOALS: Godino, Marcel 2; Rogers,

Brendan 1; Jensen, Justin 1; Jarvis, Tyler 1; LoGiudice, Chris 1;

Llewellyn, Mike 1; Mahon, Kelly 1. ASSISTS: Rogers, Brendan 2;

Brooks, Mike 1.

HOFSTRA SCORING: GOALS: Lincoln, Jamie 3; Card, Jay 3;

Braddish, Ian 2; Bentz, Stephen 1; DeNapoli, Mike 1; Sorichetti, Adrian

1; Mojica, Adam 1; Burke, Michael 1. ASSISTS: Bentz, Stephen 3;

DeNapoli, Steven 2; Braddish, Ian 1; DeNapoli, Mike 1; Ford, Kevin 1;

Holman, Tim 1; Lincoln, Jamie 1; Varn, Torin 1.

GAME 11 SATURDAY, APRIL 9 AT SAINT JOSEPH’S: The Hawks scored the fi rst goal of the game but the Pride

tallied the next 11 as eighth-ranked Hofstra rolled to an

11-3 CAA victory over Saint Joseph’s at Finnesey

Field.

Hofstra was led by Jamie Lincoln with three goals

and one assist, Jay Card with three goals and Ian

Braddish with a career-high four assists. Kevin

Ford added two goals and one assist while

Stephen Bentz had one goal and one assist.

Junior Andrew Gvozden allowed just one

goal and made seven saves in 53:45

of action before being relieved by

sophomore Rob Bellairs. The Hawks

of Saint Joseph’s were led by

senior Scott Cullinan with a goal

and an assist while Kyle Williams

and Kyle Mahoney each added one

goal.

The Pride found themselves in

a slow down game early as the

Hawks played keep away and held

the ball from 90 seconds to 150

seconds in their early possessions.

It paid off 6:16 into the contest

202020202020202020202 121212121212121212211 HOHOHOHOHOHOHOHOHOHOOOOOOOOOOOOHOHOOOHOHOOFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFSFFFFSFSFSTRTRTRTRTRTRTRTRTRTRTRTRTRTRTRTRRRRRTTRTRRTRTRTRTRRTRRRTRRRRRAAAA A A AAAA AA AA A AAA A AAA AAAAAAA MEMEMEMEMEMEMEMEMMEMEMEMEMEMEMEMMMMMM NNNNNNNNN’N’N’’’’NNNN SSSS LLAC

m six yards out. Card scored his 17th off a pass from Bentz with

ay in the quarter to make it 2-0. Sophomore Ian Braddish scored

f two goals on the night, going around a Jasper for an unassisted

ninth of the season, fi ve minutes later. Bentz then notched his

e year from Lincoln on a pass to the crease for a 4-0 advantagagagggeeeee

minutes to play in the fi rst. Lincoln added his second of ththhee e

21st of the season, from Bentz, with six seconds to pllaayayayyyyy

ead after one quarter.

oosted the lead to 6-0 with a man-up goal from Keviiinnn

3:01 into the second and Card added a man-up goal,

or Mike DeNapoli, 39 seconds later for a 7-0 lead. Carrrd d d

extended their consecutive point scoring streaks to 333888 88

mes, respectively.

rs scored babaack-ck-ck-to-to-to-bacbacback gk gk goaloaloals ss tarting almost a a a

er asass sseseseninionionioniooioiorrrrrr r rr

seseseenn n n

ee ee

ndan

ded his 1s 1110th0th0th0thhh0th0th0 ofofoffofo tthththhe se se seaseason at the 7:54 mark tk tk tto ooo

gap to 7-2. But the Pride scored the next four r

fi ve of the next six to open up a bigger marginnn..

re Michael Burke started the four-goal run with

man goal from Bentz at the 4:12 mark. Card then

d his hat-trick, off a pass from senior Tim Holman,n,n,

two minutes later and Mike DeNapoli, notched

f the season with an assist from his cousin Steven

GAME SSSATURDAY, APRIL 9 ASSSATURDAY, APRIL 9 AThTheheheThThT Hawks scored the fi rst goal

taltatalallatatata lilieiell d the next 11 as eighth-r

11-3 CAA victory over

Field.

HofH stra was led by Jam

andandnddandandandanananaan onoo e assist, Jay Car

BrBraBraBrarararaaraBraBBB ddddidididddddd sh with a care

FoFoFororororrForororFFF d d ad aadd dded two go

StStStteteettteSSSS ephphphepp n Bentz h

JuJuJuJununnnJJunJuJ iorioio Andrew

goagogoagoaoaoaagogooag aggggg l al al l nd ma

of of of fffof ffofofofooo acactctctaaacaa ioni

ssosooopopppsopopophohohomh

ofof ff f ofoooo SSaSaS

sssesesennseenseniiio

aanndnddnaa

ddddanaaandndddaann K

gggogogoagoaoaggooag lll.

The P

a slow

Hawk

thett b

sssecon

IIIt pai

AARON JONES



LACROSSE


when Matt Dougherty fed Cullinan from behind the cage for the games’

fi rst goal.

Hofstra started its run 5:20 later as senior Steven DeNapoli fi red a

running bounce shot past Hawks goalie Chris Moffa (33 min., 8 GA, 8

saves) to tie the game at 1-1. It was DeNapoli’s third goal of the year.

Just 49 seconds later, Lincoln took a pass from Ford on the left side of the

crease and buried it for his 23rd goal of the season.

The Pride added four more goals in the second quarter as Bentz notched

his 18th of the year off a short pass from Braddish 3:33 into the quarter

for a 3-1 advantage. Lincoln scored his second of the contest 1:11 later on

a pass from behind the cage from Bentz. Card then scored his 20th of the

season off a pass from a falling down Braddish in front at the 8:54 mark

to make it 5-1. The goals by Bentz and Card extended their consecutive

game goal scoring streaks to 13 and 12, respectively. Their points also

extended their points scoring streaks

to 26 and 39 games, respectively.

Ford closed out the scoring in the

fi rst half with an unassisted goal

after dodging two players for a

6-1 halftime lead. Hofstra outshot

the Hawks, 16-7, in the fi rst half.

The Pride added three more in the third

quarter and two more in the fourth to boost the

lead to 11-1 midway through the fi nal period. Ford scored his seventh

goal of the year to start the scoring in the second half just 1:53

into the third quarter. Card tallied his second of the game and

21st of the season, from Lincoln, almost two minutes later and

Lincoln scored from Braddish to make it a 9-1 game after three

quarters. Brad Loizeaux scored his fi fth of the season from Braddish

2:39 into the fourth quarter and Card notched his third, on

the man-up, almost fi ve minutes later to end the run.

Mahoney scored a man-up goal, from Cullinan, with 4:30

to play for the Hawks and Kyle Williams added an all-

even goal with 33 seconds to play to close out the scoring.

Hofstra outshot the Hawks, 35-20, and picked up 29

ground balls to Saint Joe’s 19.

Team 1 2 3 4 F

#8 Hofstra 2 4 3 2 11 Saint Joseph’s 1 0 0 2 3

HOFSTRA SCORING: GOALS: Lincoln, Jamie 3; Card,

Jay 3; Ford, Kevin 2; Bentz, Stephen 1; Loizeaux, Brad

1; DeNapoli, Steven 1. ASSISTS: Braddish, Ian 4; Bentz,

Stephen 1; DeNapoli, Mike 1; Ford, Kevin 1;Lincoln, Jamie 1.

SAINT JOSEPH’S SCORING: GOALS: Cullinan, Scott

1; Williams, Kyle 1; Mahoney, Kyle 1. ASSISTS: Cullinan,

Scott 1; Dougherty, Matt 1.

GAME 12SATURDAY, APRIL 16 AT FAIRFIELD:

Junior Andrew Gvozden made three of his 10 saves in the fi nal 2:30 and

sophomores Adrian Sorichetti and Ian Braddish each scored twice to lead

the eighth-ranked Hofstra Pride to an 8-7 non-conference victory over the

Fairfi eld Stags at Lessing Field.

Gvozden stopped the three key shots in the closing

minutes of the contest to hold onto an 8-6 lead

before senior Matt Plominski scored with two

seconds to play to close out the scoring in the

contest. Braddish continued his hot streak of

late with two goals and one assist to give

him six goals and 10 assists in his last

fi ve contests. Sorichetti posted a season-

high two goals. Senior Stephen Bentz,

who tallied a third quarter goal, and

classmate Jay Card, who posted a

goal and an assist, extended their

goal and point streaks Saturday.

Bentz boosted his goal streak to

14 games and the point streak

to 27. Card boosted his goal

streak to 13 and the point

streak to 40 contests.

Fairfi eld was led by

junior John Snellman

and senior Doug Kuring

with two goals each while

Plominski added a goal and an

assist. Junior goalie Charlie Cipriano recorded

eight saves in the Stags cage.

Hofstra jumped out to a 2-0 lead on unassisted fi rst

quarter goals by Braddish, his 11th of the year, and

Sorichetti, his fi fth. But the Stags tied the game in

the fi rst 4:30 of the second quarter as Kuring scored

off a pass from Brent Adams 1:16 into the second,

and Sam Snow notched an unassisted goal a little

over three minutes later.

The Pride took a 4-2 on goals by Card, his 23rd of

the year, off a pass from Braddish at the 8:32 mark, and

Sorichetti’s second with 6:54 to play in the half. Snellman

closed the defi cit to 4-3 with his 13th of the year almost

two minutes later. But Hofstra junior Mike DeNapoli tallied a man-up

goal, from Kevin Ford, with 38 seconds to play to boost the lead back to

two, 5-3, at halftime.

Hofstra increased the lead to 6-3 midway through the third quarter as

Card fed Ford for his ninth goal of the season. Kuring closed the gap

again to two with his 15th of the year, from Plominski, with 1:23 to play

falling down Braddish in front at the 8:54 mark

by Bentz and CarCard ed xtended their consecutive

s to 13 and nd d 1112,12,12,12,2,2,2,2,2,, rererererererererespespespespeespespespespespespep ctictiictictictctccc velvelvev y. Their points also

ring strtrtreakeaks

ectiveeelyly.y.y.

ng inn tthhht e eee

ed gogooaall

fororr a

a oututtshoshoshot t

rst half.

re in the thirdirdrdd

he fourth to boost tt ttt thehehehe hh

ugh the fi nal period. Ford d scoscocooredededededredrededdre hihihiihihhihh s ss ss ssss seveeveeveeveeveeveeveeveveveeveeveeventhnthnthnthhhnthnthnnnnthnnn

e scoring in the second half jususust 11111t t :5:53533:535:5:55

d tallied his second of the game anandndddan

Lincoln, almost two minutes later annd nddn

dish to make it a 9-1 game after three

cored his fifth of the season from Bradddddiisshshshh h shshhh

er and Card notched his third, on

minutes later to end the run.

p goal, from Cullinan, with 4:3000

Kyle Williams added an all-

s to play to close out the scorrriinnnnnnnnnggggg.g.g..g

s, 35-20, and picked up 29

s 19.

2 3 4 F

4 3 2 110 0 2 3

GOALS: Lincoln, Jamie 3; Card,

tz, Stephen 1; Loizeaux, Brad

SSISTS: Braddish, Ian 4; Bentz,

ke 1; Ford, Kevin 1;Lincoln, Jammmiieeeee 111111...

RING: GOALS: Cullinan, Scooottttt t t t

oney, Kyle 1. ASSISTS: Cullinnnaanannnnnan,,,,

1.

GAME 12SATURDAY, APRIL 16 AT FSATURDAY, APRIL 16 AT F

Junior Andrew Gvozden made three of his 10 sa

sophomores Adrian Sorichetti and Ian Braddish

the eighth-ranked Hofstra Pride to an 8-7 non-co

Fairfi eld Stags at Lessing Field.

Gvozden stopped the three ke

minutes of the contest to

before senior Matt Plo

seconds to play to clo

contest. Braddish co

late with two goal

him six goals and

fi ve contests. So

high two goals

who tallied a

classmate Ja

goal and a

goal and

Bentz b

14 gam

to 27

stre

str

an

with

Plomin

asassssa isti . Junior goalie Charl

eigigiggeeeiiee hhht saves in the Stags ca

HHHHHoooofffstra jumped out to a 2-

qqqququuuuuaaqqq rrrter goals by Braddish,

SooooororororrrrSSSSSSSSSooSSoS rSSS iccchi etti, his fi fth. But the

tttttthththhhhheeeeethheeth fi fi fifififirstrr 4:30 of the second

offfffffofofoffffofoofo foo aa aa ppasp s from Brent Ada

ananananannnndndddddana ddaaa SSSaaaS m Snow notched an

ooooooovovovovvveveveeeveveerrrrr r tttrr tr hhhree minutes later.

TheheTheThThTheTheThTheTheTheTheT e PPrPrPride took a 4-2 on goal

ththethehthethehthetheeee yeyeyeeeaarar,ar, off a pass from Braddishy , p

SorSS ichetti’s second with 6:54 to p

closed the defi cit to 4-3 with his 1

BRAD LOIZEAUX



LACROSS

in the third quarter. But Bentz scored his 19th of the season, from Brad

Loizeaux, with eight seconds to play in the period for a 7-4 lead after

three quarters.

Braddish scored his second of the game and 12th of the season 49

seconds into the fourth quarter to give the Pride an 8-4 advantage. But

the Stags did not quit as Nick Baglio notched his third goal of the season

with 11:43 to play and Snellman added his second of the game and 14th

of the year with 6:02 to play to cut the defi cit to 8-6.

From that point, the Pride defense took over as Gvozden stopped shots by

Snellman, Kuring and Max Trunz, and Steve DeNapoli defl ected a pass

to keep Fairfi eld at bay before Plominski dented the twine in the fi nal

seconds.

Hofstra outshot Fairfi eld, 33-27, and picked up 31 ground balls to the

Stags 15. Pride sophomore John Antoniades had another stellar day at the

face-off X, winning 14 of 18.

Team 1 2 3 4 F

#8 Hofstra 2 3 2 1 8 Fairfi eld 0 3 1 3 7

HOFSTRA SCORING: GOALS: Braddish, Ian 2; Sorichetti, Adrian

2; Card, Jay 1; Ford, Kevin 1; Bentz, Stephen 1; DeNapoli, Mike 1.

ASSISTS: Braddish, Ian 1; Card, Jay 1; Ford, Kevin 1; Loizeaux, Brad 1.

FAIRFIELD SCORING: GOALS: John Snellman 2; Doug Kuring 2;

Matt Plominski 1; Nick Baglio 1; Sam Snow 1. ASSISTS: Brent Adams

2; Matt Plominski 1; Max Trunz 1

GAME 13 SATURDAY, APRIL 23 VS. #15 MASSACHUSETTS: SATURDAY, APRIL 23 VS. #15 MASSACHUSETTS: Freshman Lance Yapor and senior Jay Card each tallied fi ve points, and

sophomore Adrian Sorichetti added four points to lead the eighth-ranked

Hofstra Pride to a 14-5 CAA victory over 15th-ranked Massachusetts in

the fi rst game of the ESPNU Warrior Classic at Rentschler Field.

Yapor posted career-highs of two goals and three assists while Card

notched a season-high four goals and added an assist. Card also extended

his consecutive game point and goal streaks to 41 and 14, respectively.

Sorichetti tied his career-high with three goals and set his personal best

with four points. Seniors Stephen Bentz and Jamie Lincoln each added

two goals for the Pride while junior Andrew Gvozden posted seven saves

to record his 12th win of the season.

UMass was led by junior Art Kell with two goals. Junior goalie Tim

McCormack tallied nine saves in the Minutemen cage.

The Pride came out aggressively and dominated the Minutemen on the

scoreboard for the fi rst 26:40, taking a 7-0 lead in the contest on two

fi rst quarter goals and fi ve in the second. Lincoln opened the scoring

7:57 into the contest on a bullet from 12 yards to the left of McCormack

after a pass from Braddish. It was Lincoln’s 26th of the season. Braddish

notched his 13th goal of the year with 58 seconds to play in the period,

faking a pass and fi ring a 10-yard bullet for a 2-0 lead.

Hofstra boosted the lead to 4-0 with two goals in the fi rst 2:41 of the

second quarter. Bentz extended his point and goal streaks to 28 and 15,

respectively, with his 20th of the season from Card at the 1:18 mark. Just

83 seconds later Card notched the fi rst of his four goals on the day with

his 24th of the season, from Braddish, for a 4-0 advantage.

Hofstra scored three more times in a 1:16 span later in the period as

Sorichetti notched his seventh of the year with 6:30 to play in the half,

hauling in a high pass with one hand and beating McCormack low. Just

25 seconds later, Card scored a man-up goal from 14 yards out, off a pass

from Mike DeNapoli , for a 6-0 lead, and Lincoln notched his second,

also a man-up goal, from Bentz with 5:14 to play in the half to end the

run. The Minutemen scored twice in the fi nal 3:19 of the second quarter

off of Pride turnovers as Biscardi scored his 18th of the year from Ryan

Hantverk from seven yards out, and Steve Zorkers bounced a shot off of

Gvozden’s chest and into the cage as the half ended to close the gap to

7-2.

But the Pride erupted for fi ve goals in the third quarter to blow the game

wide open with Card scoring his third and fourth of the game in the fi rst

7:12, off assists from Sorichetti and Yapor, and then Sorichetti added

consecutive goals 1:19 apart, from Aaron Jones and Yapor. Bentz tallied

his second of the game 47 seconds later, coming around the cage for his

21st of the season, for a 12-2 lead.

The Minutemen made a quick run in the fourth quarter, scoring three

times in the fi rst 3:24 of the period to close the gap to 12-5. Kell scored

consecutive unassisted goals in the fi rst 2:29 by coming around the cage

and beating Gvozden, and Colin Fleming added a man-up goal with

11:36 to play. But Yapor tallied the fi rst two goals of his career at the

7:14 and 5:30 marks of the quarter to add to his three assists and give the

Pride their nine-goal margin.

Hofstra outshot UMass, 47-22, including 25-10 in the second half, and

picked up 32 ground balls to the Minutemen’s 20. Pride sophomore John

Antoniades continued his success at the face-off X on Saturday. The

nation’s number two- face-off man captured 15 of 20 face-offs to boost

his season winning percentage to .677 (151-223).

Team 1 2 3 4 F

#15 UMass 0 2 0 3 5 #8 Hofstra 2 5 5 2 14

MASSACHUSETTS SCORING: GOALS: Art Kell 2; Colin Fleming

1; Anthony Biscardi 1; Stephen Zorkers 1. ASSISTS: Ryan Hantverk 1.

HOFSTRA SCORING: GOALS: Card, Jay 4; Sorichetti, Adrian 3;

Yapor, Lance 2; Bentz, Stephen 2; Lincoln, Jamie 2; Braddish, Ian 1.

ASSISTS: Yapor, Lance 3; Braddish, Ian 2; Bentz, Stephen 1; Card, Jay

1; DeNapoli, Mike 1; Jones, Aaron 1; Sorichetti, Adrian 1.



LACROSSE GAME 14

SATURDAY, APRIL 30 VS. #20 PENN STATE: SATURDAY, APRIL 30 VS. #20 PENN STATE: Sophomore Ian Braddish tallied three goals and one assist and junior

goalie Andrew Gvozden tied his career-high with 17 saves to lead the

eighth-ranked Hofstra Pride to a 9-4 victory over No. 20 Penn State at

James M. Shuart Stadium.

The victory gave the Pride the Colonial Athletic Association regular

season title and the number one seed in the CAA Championship

tournament that begins with semifi nal play May 4.

Braddish continued his torrid streak with four points in the game to record

his seventh consecutive contest with three points or more. He has 10 goals

and 13 assists over his last seven outings. Gvozden, the national leader

in goals against average, equaled his career high with 17 saves, tying

his 2009 mark against Army. The Pride also received two goals from

sophomore Adrian Sorichetti and senior Stephen Bentz. Bentz extended

his consecutive game point and goal streaks to 29 and 16, respectively.

The Nittany Lions were led by Gavin Ahern with two goals while Shane

Sturgis and Tom LaCrosse each scored once. Freshman goalie Austin

Kaut, the national leader in save percentage coming into the contest, made

eight saves in the Penn State cage.

Penn State jumped out to the early lead and led 2-1 after one quarter.

Sturgis opened the scoring 1:25 into the contest, coming around the cage

following a pass from Colton Vosburgh and netting his 17th goal of the

year. Braddish tied the game with 4:15 to play in the period on a run

up the middle and a bullet from 10 yards. But freshman Tom LaCrosse,

nephew of former Hofstra great Michael LaCrosse, gave the Nittany Lions

a 2-1 lead on a falling down shot from seven yards with 1:25 remaining in

the fi rst quarter.

Hofstra started a fi ve-goal run in the second quarter as Braddish notched

his second of the game and 15th of the year on a dodge and weave that

put him fi ve yards in front of the goal to knot the game at 22 with 10:36 to

play in the half. Junior Michael DeNapoli scored a man-up goal from 12

yards off a pass from Jay Card 71 seconds later to give the Pride a 3-2 lead

at halftime. The Pride then scored the fi rst three goals of the third quarter

as junior Kevin Ford scored a man-up goal from Jamie Lincoln 3:39 into

the quarter, and Braddish notched his third goal on another charge and

dodge to the goal 45 seconds later for a 5-2 lead. Sorichetti closed out the

run with his 10th goal of the season, on a bullet from 12 yards, with 8:01

to play in the third. Ahern scored the fi rst of his two goals, from in front,

four minutes later to close the Penn State defi cit to 6-3 after three quarters.

Hofstra put the game out of reach with three unanswered goals in the

fourth quarter despite heavy pressure from Penn State. The Nittany Lions

outshot the Pride, 16-9, in the quarter only to be snuffed out by Gvozden,

who made eight of his 17 saves in the fourth. Bentz opened the scoring in

the fourth with his 22nd of the season, on a pass to the crease from Ford,

1:16 into the period. Sorichetti notched his second of the game and 11th of

the year six minutes later on a charge to the cage, and Bentz notched his

second, from Braddish, with 6:06 to play to boost the lead to 9-3.

Ahern closed out the scoring in the game for Penn State with a man-up

goal, from Kyle Vanthof, with 2:16 to play in the contest.

Penn State outshot the Pride, 41-32, while the ground balls were even at

22 for each team.

Team 1 2 3 4 F

#20 Penn State 2 0 1 1 4 #8 Hofstra 1 2 3 3 9

PENN STATE SCORING: GOALS: Ahern, Gavin 2; Sturgis, Shane 1;

Lacrosse, Tom 1. ASSISTS: Vanthof, Kyle 1; Vosburgh, Colton 1.

HOFSTRA SCORING: GOALS: Braddish, Ian 3; Sorichetti, Adrian 2;

Bentz, Stephen 2; Ford, Kevin 1; DeNapoli, Mike 1. ASSISTS: Braddish,

Ian 1; Card, Jay 1; Ford, Kevin 1; Lincoln, Jamie 1.

GAME 15 CAA SEMIFINALS - MAY 4 VS. DELAWARE: CAA SEMIFINALS - MAY 4 VS. DELAWARE:

Junior Eric Smith had three goals, senior Grant Kaleikau tied his career-

high with fi ve assists and senior Noah Fossner made 11 saves to lead the

fourth-seed Delaware Blue Hens to a 10-9 upset of the eighth-ranked and

top-seeded Hofstra Pride in a CAA Tournament semifi nal game at James

M. Shuart Stadium.

In addition to Smith and Kaleikau, senior Kevin Kaminski tallied two

goals for the Blue Hens. Hofstra was led by junior Kevin Ford, who tied

his career-best with fi ve goals while Jamie Lincoln added two goals and

one assist and Jay Card chipped in with one goal and one assist. Junior

goalie Andrew Gvozden, the national leader in goals against average and

save percentage, made eight saves.

The Pride led just once in the contest at 2-1 after Card and Ford scored

45 seconds apart early in the fi rst quarter. But the Blue Hens scored the

next four goals (by four different scorers) to take a 5-2 lead at halftime.

Sophomore Nick Diachenko started the run with his 16th of the season,

from Kaleikau, with 3:46 to play in the fi rst quarter. Taylor Burns scored

off the face-off seven seconds later, from Dan Cooney, for a 3-2 lead.

Smith then scored his fi rst of the game and 21st of the season, from

Connor McRoy, with four seconds remaining for a 4-2 lead after one

quarter. Kaminski scored his fi rst of the game and 10th of the season 57

seconds into the second quarter for the 5-2 lead at the intermission.

The Pride closed the gap to 5-3 just 1:33 into the second half as Ford

scored his second of the game and 12th of the season. The Blue Hens then

boosted the lead to 7-3 with 5:17 to play in the third with goals by Smith

and John Mills, both off assists from Kaleikau. Hofstra closed the defi cit

again with an unassisted goal by Steven DeNapoli, his fourth of the year,

12 seconds after Mills’ tally, and Lincoln’s 28th goal of the year, off a

pass from Card, 50 seconds later to close to 7-5 after three quarters.

Smith tallied his third of the game and 23rd of the season just 22 seconds

into the fourth quarter for an 8-5 lead. But Ford came back with back-to-

back goals 48 seconds apart to close to one at 8-7. His third of the game

came off a short pass down to the crease from Ian Braddish (two assists) at

the 9:46 mark, while his fourth came off a short pass from Stephen Bentz

at the 8:58 mark. Bentz extended his consecutive game point streak to 30

but had his goal streak stopped at 16 by the Blue Hens.



LACROSS

TheThTheTheTheThThTh BlB ue HenHHH s gsss gaveaveeee thththththththttht emsemsemsemsmmsssssselvelvelvelvelvelelvelelvelelvlves a la litittle e eeeee brbrebbbbbb athingn rooooom om omom behbehbehbehehindind twtwo mo mo mo mo mo mmmmmo moreeeo

assassassassasasaa isstststststisststttiss s fs fs fs fs ffs fss fs fs ffs fs fs fromromromromromromromommromromromomromrom KKKaKaKaKaKaKaKaKaKKaaaleilellllll kaukauauauauauauuuauu asasasasasasasasaasasasasasas SeSeSeSeSeSeeSeSeSeSeSeeS aananan anan aaanaaaaan FinFinFFF egan nnnnotcheededededdeedee hihihihihhh s 1s 1s 11s 1s 1s 1s 1ss 1sss 88th8th8th8th8th8th8th8thth8th8th ofoffofofoffofff thhhhe yye yyyyeeearearareareearearaeee onononoonononnnno a aaaaaa

paspasppasppass ts ss o too to to to too to thehhehe hehe he he ehehe hh crecrecrecrecrecrecrercrecrerereereeeaseaseaseaseaaseeaseeseeseasesese atatattt thththhththhhthththe 6e 6e 6e 6e 66666e 6666666:23:23:23:23:23:23:232:23:2323:23:2333 mamamamammammamamamammmm rkrkrk,rkrkrkrkrkrkrk ananandd Kd Kd Kd Kamammim nskskskskskskskkskskski si si si si sii ssscorcccorcoccorcccoc rededed edededd d d hishishishis sssesesesecccconconononconc nnncconond od od od od od oodd ood oooooof tf tf ttf tf ttf tf tf tf tff thehehehehehehehhhehhehehehhh

gggamgamgamggamg e aaaaaaaaaaaandnddd ddndndd 11t11t11t1t11t11t1t11t1111t11t111 h oh oh oh oh oh oh oh oh hh oh ohh f tf tff tf tttf ttf ttff thhhhhhhehehhhhe yeayeaeaeaeaaayeyeaeaeear dr dr dr drrr duriuriuriuriuriuriruriuriuriuriurruriuriuriur nngng nngngng g ng ngng nngg thethehehehhethethehehthhetheththe PPPrPPrrPrPPPP ideideideide’s’ss’s fulfulfulfulfululfulfulfulullfuffu l-fil-fil-fil-fil-fil-fi-fifi-fi-fifil-fielele d ddd rd rd rd rrddd rd d ididididdedededdeddd wiwiwiththth 2:32:32:32:32:32:32:32:3:332:3:3:3: 3 t3 t3 t3 t3 t3 t3 t3 tt33 tt3 o o ooo o o oo oooo

pplaplaapppppppppp y fy fy fy ffffffffffor orororororrr r a 1a 1a 1a 1a 1111111111a 1100 70-70-770-70-70-70-70-70-70 70-700 adadadadadadddddadadaadvvvanv tagtagtagagagagtagtaaaagagageeeeee.eeeee forforforforforffforforfforfor aa aaaaa aaaaa 11110-10-10-10-00 7 a7 a7 a77 aaaa7 a7 aaaaddddvadvavadddd ntantantaaaantaaaage.gee.e.e.e.e.

HoHHHHHofHoH strstrtrra ddddddddda da da ddddid idididiid iddid idid didi notnotnotnotnotottnotnototnotoo ququququit it tit andandanda FoF rd notototchchchhehhhhhhhh d hd dd d dd dddd is fi ffth ththt ofof of of ththeheeetheeeeee gagagagagagaggg mmmemee eememem andandandandndndnd 1515151555151515155511155ttttththth thth ofofof thethethehet

sseaasonsononon ofofofofofofofff af af af af af af aff a papapaapappp ss ss from BBenttentz wz wz ith ooononoo e meeee inute to plaplayyyy, yyy,y andandandndndndnd clclclllclcllloseoseososeoseoses d td tdddd td hehehehe defidefidefifidefidefideficiciciciciiicitttt tttt

to toto 10-10-10 9 j9 j9 justustustust 1616161 seconds dsd latla er as facacfaceee-oe-oe ff ff specialist Johhnhnh AnAnAnntontontononiadiadiadiadeses es fedfedfe

LinLincolcoln fn foror hishis 2929thth goagoal ol of tf thehe yeayear.r.

Hofstra had two shots to tie the contest after Delaware turned the ball over

following Lincoln’s goal. Braddish fi red a bullet with 24 seconds to play

that Fossner stopped with his knee and Ford fi red wide with 13 seconds

remaining. The Pride got the ball back after Card checked Fossner into a

turnover but could not get off a shot on goal as time expired.

Hofstra outshot the Blue Hens, 38-29, in the game including 27-15 in the

second half. The Pride also picked up 36 ground balls to Delaware’s 33.

Team 1 2 3 4 F

Delaware 4 1 2 3 10 #8 Hofstra 2 0 3 4 9

DELAWARE SCORING: GOALS: Smith, Eric 3; Kaminski, Kevin

2; Diachenko, Nick 1; Mills, John 1; Burns, Taylor 1; Finegan, Sean 1;

Johnson, Garrett 1. ASSISTS: Kaleikau, Grant 5; Cooney, Dan 1; McRoy,

Connor 1; Sebastiani, Dom 1.

HOFSTRA SCORING: GOALS: Ford, Kevin 5; Lincoln, Jamie 2; Card,

Jay 1; DeNapoli, Steven 1. ASSISTS: Bentz, Stephen 2; Braddish, Ian 2;

Antoniades, John 1; Card, Jay 1; Lincoln, Jamie 1.

GAME 16NCAA FIRST ROUND – SATURDAY, MAY 14 NCAA FIRST ROUND – SATURDAY, MAY 14

AT #3 JOHNS HOPKINS: AT #3 JOHNS HOPKINS:The Blue Jays scored eight second half goals to blow open a 4-4 deadlock

at halftime as third-seed Johns Hopkins defeated the Hofstra Pride,

12-5 in the fi rst round of the 2011 NCAA Division I Men’s Lacrosse

Championship at Homewood Field.

The Pride, who recorded their 41st winning season in the program’s 63-

year history, fi nish the season with a 13-3 record. The Blue Jays advance to

the NCAA quarterfi nals at Hofstra’s James M. Shuart Stadium.

The Blue Jays were led by senior Chris Boland with two goals and three

assists while classmate Kyle Wharton posted a game-high three goals and

added an assist. Sophomore goalie Pierce Bassett recorded nine saves

including fi ve in the second half while holding Hofstra to just one goal in

the final 30 minutes Sophomore John Greeley also tallied two goals forthe fi nal 30 minutes. Sophomore John Greeley also tallied two goals for

Johns Hopkins.

The Pride, whichich hh had ad fi vfi ve de diffiffereerent nt goagoal sl scorcorerser , w, weree led by seninior JayJay

CarCard wd withith ononee goall andd twow assists. He H closess ouout ht hisis carcareereer wiwithth 122122 gogoalsals

ndand 6060 assists for 182 points and graduates second on theth PrP ided ’s careere

goaals list and is fi fth on the career points chart. Juniors Kevvin Ford and

BraBrad Loizoi eauux, and sophomores Adrian Sorichetti and John Antoniades

scoredre single goals for Hofstra. Junior goalie Andrew Gvozden made fi ve

saves e in the Pride cage.

InInInInInInIIn nInIn In nIn n a vaaa va va va vaa vaaaaaa eryryeryy deeeeeeelibliblllll eraraate te ete fi rfi rfi rfirfirfirfirfirfirrfi rrrst tst sts ququaquaquaquaquaququaquaquauq rtertrtrtrtrtrtertetrtterrrrr,r,r, rrr theee PrPPPP idedededededededededide jujujujujuujj mmmmmmpemmm d odd oooood od outututtttt t uttt totototototooo a 2-0 -0-0 lealeeaeaeaeaaaeaad oddddddd n

gogogoagoaggggg lslslsls in in in iniii the fi fi fififififirst 3:333 4242 42 42 of ofofofoff foofof ththetheheheheethheeeee cocococococooonnnnntennn st.st AAnAnAntonononnononnnnononiadiadiadiadiaddddiada ess opeopeopeopeopeopeopeopeopeopepeennnednednednednednednednednned ththththee se se se se ssee se se scorcccccocorcorcorcorccocoringiinginginginginginginginggg ririririririririririirirrr ghghghththtghhththththh

offooo thhhhhhhhheee e ooe pennnnnnniiiiingii face--------e offoffffffffffffffffff, w, w, w, w, w www, w, winninniinninnininniinnnnnnn ingingingingngngingngingingininggingingingg thththththththtttthththe de de de de rawrawrawrawrawarawrawarawrawrawrawww anannd d d d d rd dddd rd rdd unununununnunnnnunnunuuu inginginging iniinininiinin ononononononnononnnonooooon BlBlBlBlBlBlBlBlBlBlBlBlBlBB uueueueueueue ueueeeueee u JJJayJayJayJaJaysssss s ssss

gogogoaggoagoo lieieeeieieeelii PPiercccccccee Be Be Bee Bassettetettttttettet anananananaannnanaand bd bbbbbbbbbbeatteateateateateaeateaeea ingingingingnggginnnggingnging hhhhhhihihhihih m fmm fm fm fm fmm fmmm fm fmmmmm oror hhhhishh sssssseessess conconnnnndddd d d gd gdd dd oaaaalloaaaoaaaa ofofofofofofffooffff ththththththththhthththhhthhhe ye ye ye ye yye ye ye yyyye yyearearearearaararraarareararea jujujujuststst

sixsixsixs sssssseeeesssees cocconco ds iintintintinttntoo tooo he e gamgamg e.. AAAt AAA thethethethehethetththetheheht etth 1111111111111111111111111 :18:18:18:18:18:18:18::1: mamamaark, CaCaaCard rd rd rd tootootooo kk k aaak aaaaaaaa shshshshshhshshshshshortortortortortortortortortortor papapapapapapapapapapapp ss sss ffroff m

claclaclalalaaaalasssssssmsmmsss mss ate Jaaammiemiemiemmm LiLiLinconconcoln ln l in thetheethethee mimimimimimimimimimim ddlddlddlddlddlddddldldldlddlldlddld ee ooe ff tf tf he heh box andd fid rereeed ad adddddd ad adddd jujujuuuuuuj mpmp p p p p pp p shohoot

frffrfrfroroofrfrom 10 yyyyardardardrr s fs fs fs or oror his 299th thth goagoagoagoagoagoag l ol ol ol ol ool of tf tf tf tf hehehe heheh sseason and a 2-0 advaaaaaaaantantantantantantantaagegege.ge.ggeegege.ge. GGGvozdennnnn n

waswaswasw ouououtsttsttstandandandininingn in the Pridee ce cageageage mamamam kkking fourrur fi fi firstrstrst quququartartartererer r savsavsava eses.es.

But the Blue Jays came roaring back in the second quarter scoring four

unanswered goals to take a 4-2 lead. Like the Pride, Hopkins scored two

goals in the fi rst 3:14 to tie the game. Sophomore Zach Palmer sent a short

pass from behind to the side of the crease to Boland who beat Gvozden as

he was falling down at the 12:09 mark. It was Boland’s 31st goal of the

year. Just 25 seconds later, Blue Jay freshman Paul Castonova picked up a

ground ball in the Blue Jays zone near midfi eld, charged the Pride end and

beat Gvozden from 12 yards for his third goal of the year. Greeley gave

Hopkins its fi rst lead of the game at the 9:55 mark, backing in on the Pride

defense and fi ring a bullet from 10 yards for his 13th goal of the year and a

3-2 lead. Wharton then notched his 29th of the season, coming around the

right side of Gvozden and beating the netminder for a 4-2 lead with four

minutes to play in the half.

Hofstra closed the gap to one when sophomore Ian Braddish sent a perfect

pass from up top to the crease to Ford for his 16th goal of the year with

1:35 to play in the second. The Pride tied the game up with just six seconds

to play when Card sent a pass to the side of the goal to Loizeaux, who beat

Bassett high to the far corner for his sixth goal of the season.

The Blue Jays opened up a three-goal lead after three quarters at 8-5.

Freshman Rob Guida broke the tie with his 11th goal of the season at the

12:12 mark, taking a cross-fi eld lollipop pass from John Ranegan and

beating Gvozden for a 5-4 lead. Wharton boosted the lead to 6-4 with 7:29

to play in the period as Boland scooped up a missed shot behind the cage

and fed Wharton in front for a behind the back goal. Sorichetti closed the

gap to 6-5 for Hofstra with a man-up goal from 13 yards off a short pass

from Card at the 4:16 mark. It would be Hofstra’s last goal of the contest.

But the Blue Jays scored twice more in the third as Boland scored on a one-

handed shot coming around the goal at the 2:43 mark and Wharton notched

his third, from Boland, 51 seconds later for a 8-5 lead after three periods.

Hopkins added four more goals in the fourth as part of its six-goal run as

Greeley scored his second of the game and 14th of the season 3:20 into the

period, Palmer scored his 22nd of the year from Mark Goodrich at the 9:08

mark, Brandon Benn scored his fi fth of the year from Wharton and Tim

Donovan scoring with 3:10 to play to give the Blue Jays a 12-5 lead.

The Blue Jays outshot the Pride, 29-25, and picked up 34 ground balls to

Hofstra’s 23. Hopkins also held a big 14-7 advantage on face-offs with

senior Matt Dolente, the number one face-off specialist in the nation,

winning 13 of 20 face-offs. Hofstra’s John Antoniades, who ranks third in

the country in face-offs, won four of 14.

Team 1 2 3 4 F

#13Hofstra 2 2 1 0 5#3 Johns Hopkins 0 4 4 4 12

HOFSTRA SCORING: GOALS: Card, Jay 1; Ford, Kevin 1; Loizeaux,

Brad 1; Sorichetti, Adrian 1; Antoniades, John 1. ASSASSISTS S: Card, Jay 2;

BraBraddiddish,sh, IaIan 1n 1; L; Lincincolnoln, J, Jamiamie 1e 1..

JOHNS HOPKINS SCORING: GOALS: Kyle Wharton 3; Chris Boland

2; John Greeley 2; Zach Palmer 1; Rob Guida 1; Tim Donovan 1; Phil

Castronova 1; Brandono Benn 1. ASSISTS: Chris Boland 3; Mark Goodrich

1; Zach Palmer 1; John Ranagan 1; Kyle Wharton 1.


012

LACROSSE

2011 CAA MEN’S LACROSSE REVIEW2011 CAA MEN’S LACROSSE REVIEW

Goals Per GameTeam GP G GPGDrexel 14 158 11.29Hofstra 16 159 9.94Massachusetts 15 149 9.93Delaware 18 168 9.33Penn State 14 114 8.14Towson 13 102 7.85Saint Joseph’s 12 55 4.58

Assists Per GameTeam GP A APGDrexel 14 95 6.79Hofstra 16 105 6.56Massachusetts 15 87 5.80Delaware 18 102 5.67Towson 13 65 5.00Penn State 14 47 3.36Saint Joseph’s 12 27 2.25

Points Per GameTeam GP P PPGDrexel 14 253 18.07Hofstra 16 264 16.50Massachusetts 15 236 15.73Delaware 18 270 15.00Towson 13 167 12.85Penn State 14 161 11.50Saint Joseph’s 12 82 6.83

Ground Balls Per GameTeam GP GB GBPGDelaware 18 570 31.37Drexel 14 440 31.43Penn State 14 438 31.29Massachusetts 15 464 30.93Hofstra 16 482 30.12Towson 13 356 27.38Saint Joseph’s 12 264 22.00

Goals Against AverageTeam GP GA Min. GAAHofstra 16 105 960:00 6.56Penn State 14 112 850:23 7.90Towson 13 107 781:55 8.21Massachusetts 15 128 912:55 8.41Drexel 14 130 864:45 9.02Delaware 18 172 1082:42 9.53Saint Joseph’s 12 152 720:00 12.67

2011 CAA MEN’S LACROSSE STANDINGS CAA OverallTeam W L Pct. GF GA W L Pct. GF GAHofstra 5 1 .833 63 30 13 3 .812 159 105Massachusetts 4 2 .667 59 54 10 5 .667 149 128Delaware* 4 2 .667 42 50 11 7 .611 168 172Penn State 4 2 .667 59 45 7 7 .500 114 112Drexel 3 3 .500 60 58 8 6 .571 158 130Towson 1 5 .167 50 51 3 10 .231 102 107Saint Joseph’s 0 6 .000 31 76 0 12 .000 55 152

Team Statistics

First TeamName Pos. Cl.Jay Card, Hofstra A Sr.Matthew Mackrides, Penn State A Jr.Scott Perri, Drexel A Sr.Anthony Biscardi, Massachusetts M Jr.Ian Braddish, Hofstra M So.Kevin Kaminski, Delaware M Sr.Ad M ji H f t LSM SAdam Mojica, Hofstra LSM Sr.Frank Tufano, Drexel D Jr.Mike Skudin, Hofstra D Sr.Pat Dowling, Delaware D Sr.John Antoniades, Hofstra FOS So.Austin Kaut, Penn State GK Fr.

Second TeamName Pos. Cl.Grant Kaleikau, Delaware A Jr.Jamie Lincoln, Hofstra A Sr.Will Manny, Massachusetts A So.Nick Dolik, Penn Sate M So.Kyle Bergman, Drexel M Jr.Steven DeNapoli, Hofstra M Sr.R H ll b h M h tt LSM SRyan Hollenbaugh, Massachusetts LSM So.Matt Bernier, Penn State D Sr.Tom Celentani, Massachusetts D Jr.Marc Ingerman, Towson D Sr.Dan Cooney, Delaware FOS Jr.Danny Henneghan, Penn State FOS So.Andrew Gvozden, Hofstra GK Jr.

2011 ALL-CAA TEAMS

JAY CARD


2012

LACROSS

SSccoorriinnggggPlPlayayerr GGPP G-A-P PPGyy

ggScoto t t PeP rri, DU U 1414 39-27-66 4.711Robebert Chuhurcr h,h DU 14 27-22-49 3.3 50Willll Manny, UMUM 115 22-23-45 3.00ArA t KeKellll, UM 115 5 28-16-44 2.93JaJayy Caardrd, HUU 116 6 292 -17-46 2.88GrGraant KaK leikkauau, UDUD 116 155-3-30-0 45 2.81ErEricic SSmimithth, UDUD 118 25-20-0-4545 22 5.500Jamie Lincoln, HU 16 29-11-40 2.50Jamie Lincoln HU 16 29-11-40 2 50Shane Sturgis, PSU 14 18-16-34 2.43Stephen Bentz, HU 16 23-14-37 2.31

GoalsPlayer GP G yScott Perri, DU 14 Robert Church, DU 14 Art Kell, UM 15 Jay Card, HU 16 Jamie Lincoln, HU 16 Brendan Glynn, DU 14 Will Manny, UUM 15 Stephen Bentz, HU 16 Matt Mackrides, PSU 14 Kyle Williams, SJU 12

AAssistsPlayer GP A APGyScott Perri, DU 14 27 1.93Grant Kaleikau, UD 16 30 1.88Robert Church, DU 14 22 1.57Will Manny, UM 15 23 1.53Shane Sturgis, PSU 14 16 1.14Eric Smith, UD 18 20 1.11Peter Mezzanotte, TU 13 14 1.08Art Kell, UM 15 16 1.07Jay Card, HU 16 17 1.06Ian Braddish, HU 16 17 1.06

Ground BallsPlayer GP GB GBPGyGreg Rushing, UM 12 77 6.42John Antoniades, HU 16 84 5.25Dan Cooney, UD 18 94 5.22Danny Henneghan, PSU 14 71 5.07Steven DeNapoli, HU 16 60 3.75

Goals Against Averageg g

Playerer GGP P GAGA GGAAAAyAnAndrdrewew GGvozden, HU 116 990 66.0.000Austtini Kaua t, PSU 1144 111 11 7.7.9090Travis Love, TU 131 990 7.94Tim McCoormack, UM 15 126 8.333Mark Mannos, DU 14 4 129 9.09Noah Fossns er, UD 18 169 9.54

SSaavveessPlayer GP S SPGyAustin Kaut, PSU 14 192 13.71Mark Manos, DU 14 166 11.86Tim McCormack, UM 15 153 10.20

oah Fossner, UD 18 179 9.9413 111 8.54

U 16 136 8.50

rcentagegP W L Pct.

6 174 97 .64215 85 73 .53818 191 165 .53714 93 83 .528

SU 14 139 127 .523UM 12 70 66 .515

Michael Roe, DU 14 80 76 .513Matt Thomas, TU 13 63 68 .481Chris Jenkins, SJU 9 55 72 .433

CAA All-Rookie Team: Steven Bogert (Penn State), Thomas DeNapoli (Towson), Matt Dusek (Drexel), John Fennessy (Towson), Andrew Hodgson (Towson), Austin Kaut (Penn State), John Mills (Delaware), Connor Mooney (Massachusetts), Shane Sturgis (Penn State), Deven Thomas (Drexel)

CAA Player of the Year: Scott Perri, DrexelCAA Defensive Player of the Year: Mike Skudin, Hofstra

CAA Rookie of the Year: Austin Kaut, Penn State CAA Co-Coaches of the Year: Greg Cannellla, Massachusetts and Jeff Tambroni, Penn State

NoNoNoahahah FFFososossnsner,Trrravavavisss LLLovvve,e,e, TTTU U U AnAnAndrdrdrewewew GGGvvvozdzdzdennn,,, HUHUHU

FFFaaacceee-OOOfffff PPPeeerrrc(mmmininin. 5 aaattetetemmpm tsss ppperer ggamame)e)e)PlPP ayayayererer GGGPPyyyJoJJ hnhnhn AAAntntntonononiaiaiadeees,s,s, HHUU 161616AnAnAnthththonoo y Toorerescsco,oo, UUUM M M 1115DaDan n CoCoononeye , UDUD 1DeDeveen ThThomomomasasas, DDUDUDaDaDannnnnny yy HeHeHennnnegegeghaaan,n,n, PPPSUSUSUGrGrGreege RRRushihihingngng, , UMUMUMMiMiMichchchaeaelll RRo

G GPGPGPGGG39 99 2.2.79792227 77 1.1.93932828 11.8.87729299 1.8.8.812229 111.81818123 1.1.1.66462222 2 2 1..1.4747472233 1.1.4444222000 11.4343171717 111 4.4.4222

ADAM MOJICA

MIKE SKUDIN

INDIVIDUAL STATISTICSINDIVIDUAL STATISTICS


ALL-TIME ALUMNI012

LACROSSE

ArAA thur Abbbbbeyeyeyey 1959595957AAAAAAAAAAMMMiMichchchchaeaeaeaell l AdAdAddamamamams 1919191994999MMMMWWiWW lllliaiaiaiam m mm AdAdAddamammamss ss 191919199999999WWWWWWWWWWWWWWDDDaD nieeelel AAAAgogogogoststtstininno o o 1980000DDDDDDDDDDDDDDDJJJJack Alalalalaimimimimo ooo 20202020033303JJJJJJJJJJJJJAnAnAnA thththononony y AAlAlAlexexexananandededed rr r 19191 989898AAAAAAAAAMichael Allain 2003MMMMMMDouglas Altmansberger 1996Douglas Altmansberger 1996DDDDJoseph Amplo 2001JJErnest Angiulo 1957EEMichael Antino 1964MMScott Apgar 1994SSRichard Aquino 1986RRPaul Arena 1970PPGary Arnold 1982GGMark Arthus 1979MM

Jay Artinian 2004JJJoseph Astarita 1999JJWilliam Atkins 2007WWLewis Augusta 1966LLRobert Auguste 1974RRAaron Auster 1967AAPhilip Avillo 1963PPPeter Axel 1957PPJohn Azzariti 1989JJRichard Baer 1961RRWalter Bagley 1980WWStace Balitsos 1984SSSteven Banalett 1991SSJoseph Barile 2001JJJames Barnett 1974JJJoseph Barra 1992JJJJKevin Barry 1994KKKNicholas Baudo 1963NNNNKevin Baudo 1993KKBruce Bauer 1965BBBBBJames Bauer 1985JJJJJ

GaGaryry BBBBekekekekerererer 111998989 222DaDavid BeBelllllliaiaiaa 19994444MiMichchcc aeel BeBeBB nnnnnnnnetetetetttt t 2020202004040404RoRobebert BBBBenenenenssesesen n n n 19533RoRRRobebertrt BBenenee sosososon nnn 198222StStStepepephehhehennn BeBBeBentntntzz z 2020202011111111Martin Berg 1980Christopher Bergersen 1996Christopher Bergersen 1996Kevin Bergin 1966Arnold Berman 1960Clark Bernales 1990Seth Berrin 1983Michael Besio 1997Herbert Bessen 1957Teddy Betts 1977Paul Bjorneby 1996Hugh Blisard 1972Edward Boccuzzi 1964Ronald Bohlert 1996Sean Bolger 1988Robert Bonaguro 2007Dennis Bonn 1989Jake Born 2009Richard Bouwman 1985Richard Bowman 1969John Brais 1994Tyler Brant 2009William Braun 1957John Brazel 2005Terrance Brennan 1977Michael Brereton 1968John Bresnan 1970Henry Brill 1967Mitchell Brill 1972Timothy Brink 1991Charles Bromm 1950Jordan Bronstein 2006Douglas Brosky 1971Steven Buck 1987Stephen Buck 1991Carl Buehler 1981Michael Burke 2011Richard Burke 1971Gary Burton 1978Francis Busso 2003Ciro Buttacavoli 1959Thomas Byrne 1983Thomas Byrne 1989Matthew Cady 1992Bruce Cahill 1968

Thomasasasas CCCCalalalalddded r r r 1119197757575

Harold Cantilli 1957Theodore Caplan 1954Jay Card 2011Peter Carew 1962Andrew Carlson 1994Joseph Carrello 1991Ryan Carter 2009Glenn Caruso 1969Vincent Caruso 1973Brian Casey 1978Cullen Cassidy 2011Michael Castro 1986Michael Castro 1992Raymond Cavaliere 1974Robert Cavaliero 1974Joseph Caven 2009Richard Cestaro 1966Nicholas Christakis 1999Robert Churchill 2005Frank Cirillo 1965Ramar Clash 2002Rocky Cocchiola 1987Harvey Cohen 1969David Cohen 1992Allan Cohen 1994Martin Cohn 1981Jeffrey Cole 1994Matthew Coleman 1997Michael Colleluori 2009Nicholas Colleluori 2006Kevin Commins 1960Ramon Conchado 1964Dennis Condon 1980LJ Connolly 1982Timothy Connors 1967Kevin Conroy 1980John Conroy 1987

Frannnnkkk k CoCoCoConsnstaaaantntntntino 1111967JoJoJoJohnhnhnhn CCooper 1191919878787JJonaaatthththanana CCoooooopepepeper r 19191998989889Chrisssts opppheeer r r CoCoCoCoooopoperererer 1111999999222PePePeP teteteer Cooootooo s 19191959599WiWiWillliam Corbbbeteett 191919565656Joseph Corcoran 1982Tyler Corcoran 2010Tyler Corcoran 2010Robert Cordes 1970William Corkhill 1954Reynold Corn 1955Robert Corwin 1951Frank Costantino 1973Clifford Coughlin 1956Mark Cox 1992John Coyle 1965Frank Cozart 1962Brian Crichlow 2007Donald Cummings 1965Paul Cutrone 1983Julius D’Agostino 1962Chris Dale 2010Robert Dall 1955Michael D’Amato 1968Peter Damone 1956Barry Danels 1961Vincent Daniels 1991Edward Danowski 1963Stephen Darby 1954Raymond Dattwyler 1967Stephen Dauses 1970Stuart Davis 1954William Dawes 1995Thomas DeCurtis 2008Christopher Deeks 1974Michael Deem 1997Paul Defendini 2002Paul Delle 1980Robert Demarco 1970Robert Demarco 1972Michael Demeo 2002Jeffrey Dena 1977Steven DeNapoli 2011Robert DeNeef 1961Michael Denino 1965Christopher Depaolo 1996Robert DePasquale 2005Robert DePoto 1950David Depp 1948Edward Devereaux 1966Arthur Diamond 1978Louis DiBlasi 1961

GARY ARNOLD

THOMAS CALDER


ALL-TIME ALUMNIALL-TIME ALUMNI2012

LACROSS

LoLouiuis s s s DiDiDiiBlBBlB asasi i 191 6161DoDonan ldldldd DDiBBBlalalalasisisisi 119797000ThhTTT ommasasas DDDiciciccicicciccocococo 1119898989 111AnAAA drdrisss DDDikkkkkmmamamanininiss 202020200003KKyKK le DDDDDilillololoon n n 2010ViVitoto Dimimatattteo o 2007DDomenic c Dinanardrdo o 191995Raymond DiScala 1964Raymond DiScala 1964Francis Discala 1967Robert Dixon 1954Ronald Dobelstein 1969Robert Dolphin 1972Brian Donaghy 1996Gerald Donaghy 2002William Donahoe 1977David Donatello 1995William Donnelly 1953Michael Dooley 1983Scott Dooley 2004Tom Dooley 2009

Thomas Dorman 1970Kevin Dougherty 2003James Downing 1986George Dragonetti 1956Dennis Driscoll 1990James Dubovick 1966Vincent Dugan 1960Brian Dunn 1996Michael Dunne 1997Douglas Edmonds 1990Jonathan Edwards 2005William Effi ngham 1972Steven Effi ngham 1976Jude Ehrbar 1996Michael Elfl ein 2001Martin Enright 1979Stephen Espey 1979

WiWilllliaiam m EtEthehersonn 11119799 999RiRichhararrd d EuEuEuleer rr 19191995757557John FFFahaha eyeyey 11119595959 666Aloyyyssisiuusus FFFalalalaluusu sysysysy 11119987AnAnthhhony FaFaFaammmama 1999JaJamemess FaFarrelll l 1960Brian Farrelll l 2001Philip Faust 1981Philip Faust 1981Gerard Fay 2001Alex Fedoroff 1954Brian Ferrara 2005Joseph Ferrucci 1999Tom Ferry 2011John Fetzer 1956Jeffrey Fine 1969Edward Finegan 1966Erik Fitez 2000Thomas FitzGerald 1956Sean Fitzpatrick 1999Thomas Fitzsimons 1987John Flaherty 1969Gregory Fleming 1958Frank Flocco 2001Jason Fluger 2006Craig Flynn 1997Kevin Ford 2011Brian Foresta 1997James Forster 1981William Fowler 1974Paul Fowler 1977Michael Fowler 1979Joseph Fowler 1990

Gunther Franz 1963Robert Franz 1967Richard Frazer 1969Robert Freidah 1952Howard Fried 1974

MaMarkrk FFririeedman 1991 6666WaWWaWalttltltooonoo Gagagel 111959555ViVVincncceeent Gaagliardo 19191991 81818181DoDoDommim nic GaGG llina 1919199999999JoJoseseseseph Galllil na 22200000000555TTimooththyy GaGannn on 19696633RoR bertt Gannoon n 1982Richard Garguilo 1996Richard Garguilo 1996John Garofalo 1972Ed Gazich 1957Marco Gazich 1957Edward Gebhardt 1976Rudolph Gebig 1967Adam Gelcich 1994Charles Gennario 1977David Giannone 1992John Giannoni 1966Jacob Gidich 2005Thomas Gill 2001Robert Gilmartin 1961Robert Gilmartin 1979Robert Gleckler 2006Edward Goldstein 1954Norman Goldstein 1959Thomas Gordon 1973John Gorman 2008William Gould 1972Robert Graebe 1972John Graham 1953William Green 1967Martin Greenberg 1960Ryan Grimes 1997William Groom 1962Catherine Guerriere 2006Robert Guido 1976Connor Hagans 2008Matthew Haines 2011John Hall 1995Kenneth Hammer 1981Adam Hananel 2002Donald Hanington 1963Daniel Hanley 1993Vincent Hannigan 1996Ronald Hansen 1965Richard Harinsky 2000Richard Haunss 1970Thomas Hayes 1953Karl Hedstrom 1997John Heins 1959Peter Heinz 1960William Heiser 1962Jack Heller 1976

GGregg HHeller r 1919911GrGrregegory HeHeHHennnesssesey y y 19987AnAnAndrewewew HHHenryyy 199996PhPhilililllip pp HeHeHersrsrsh 200505505Thomas Hesss s 19787888Kevin n HiHillll 11979766JoJohnhn HHililll 19777John Hiller 1965John Hiller 1965Robert Hiller 1976Robert Hillman 1955P.J. Hogan 2010Tim Holman 2011Travis Howell 2004Athan Iannucci 2006Steven Iglio 1994Takashi Ikeda 2007Michael Infantino 2003Tom Interlicchio 2010Vincent Intini 1996Steven Izzo 2005Kevin Jacobs 1996Eric Jarry 2008Peter Johnson 1960Kevin Johnson 1992Kevin Johnson 1996Walter Jones 1952Kenneth Kaiser 1985Gregory Kalafatic 2004Jack Kaley 1961Jeffrey Karp 1968James Kaspar 1967Peter Kaspar 2007Richard Kates 1974Ari Katz 2006William Kay 1952George Kay 1966Ryan Kelaher 2007Lee Kellerman 1952Francis Kelly 1967Martin Kelly 1990David Kennedy 1983Thomas Kessler 2002Robert Keys 1981John Keysor 2007Douglas Kiernan 1973Patrick Killikelly 1959Saul Kimmel 1965Mitchell Kirschbaum 1970Eric Kitt 1977David Knaus 1972Robert Kobel 1985David Koehler 1987

JOE FOWLER

TOM DOOLEY


ALL-TIME ALUMNI012

LACROSSE

WaWaltl er KKohohananowo icich h 191 525WNichhololasas KKolb 20006NJaJ ck KKorort 1963JChristopher r Korzrzononkiewicz 2000CJoJ sip Kosttovovic 11999 8JAaA ron Kozlowski 2003AWiW lliam Kramerer 11953W

yLarry Kramer 1989LLLawrence Kramer 1998LRichard Kranzler 1954RStanley Krause 1991SChet Krinsky 1982CJoseph Krupinski 1958JRobert Kuhlke 1979RJames Kuhner 1973JMichael La Crosse 1991MEvan La Penna 2002EAlbert Lahood 1956AWilliam Laky 1959WHogan Lam 1980HRenzie Lamb 1959RMichael Lambrecht 1982MWilliam Lampe 1955WBrian Langtry 1998BRobert Lankenau 1956RBernard Larkin 1960BRolf Larson 1956RMichael Laudenslager 1991MMichael Laurano 1999MLionel Lauture 2005LJack Lawrence 1971JThomas Leanos 1970TAlfred Lettera 1968ARichard Lewton 1978RJamie Lincoln 2011JRobert Linker 1978RLouis Liotti 1970LCharles Lipp 1962CGerald Lipps 1954GJoseph Lobiondo 1987JJames Lollo 2008JRobert Lombardo 1976RThomas Lonergan 1982TGeorge Loros 1956GBarry Lublin 1965BRyan Lucas 2005RSean Lucas 2010SHoward Ludecker 1965HJohn Lundie 1964JJohn Lupetin 1975JJohn Lynch 1972JLawrence Lynch 1976L

Vincent MaMacccchihioo 19822William Macgc reregogor r 1962Douglas Maacchen 2004William Maddd ock 1993Michael Magee 1988Michael Magro 2005John MManningng 1961Michael Manzer 1960Anthony Manzione 1985Frank Marcinowski 1968Philip Marino 1976Michael Marino 1977Joseph Markanthony 1965Robert Martin 1970Joseph Mascaretti 2007Joseph Masone 1955Joseph Massaro 2005John Matthews 1952James Mau 1996Frank Mauro 1960James Mayer 1970James Mayer 1976Christopher Mayo 2007Anthony Mazzarella 1972Kevin McDonough 2007Martin McCarthy 1982Sean McCarthy 2006Daniel McCauley 1954David McCulloch 1986Francis McDermott 2003Gerard McDermott 1977Michael McGinley 1989Richard McGrath 2007James McGunnigle 1962Michael McHugh 1979Alexander McIlwraith 1957Daniel McMahone 1993Ryan McPherson 2008Thomas McShane 1965Thomas McShane 1980William Meddis 1975Keith Mekeel 2003Richard Mekeel 2004Garry Merkle 1990Hanford Merritt 1958James Merryman 1973Ryan Mertins 2008Kevin Metkiff 2008James Metzger 1982John Michielini 1990Francis Miller 1983Joseph Miller 1997

RyRyanan MMiller 2007RaR y y MiMillllss 19981Raamomon n MiMilllls s 1981Adamm MMinnelella 1984Michael Minisini 1987Barry MiMinknkin 1962Roobert MMini o 1997

jAdam Mojica 2011Rolf Moller 1954Joe Montemurro 2009James Moore 1991Kevin Moran 1994John Moran 2000Philip Mordente 1966Stephen Morea 1970Frank Moretti 1958Thomas Moriarty 1950Arthur Morr 1951Edward Morr 1953John Morris 1982Brett Moyer 2008Nicholas Mucciacciaro 2000George Muller 1982Malachy Mulligan 1980Thomas Mulrooney 1970Timothy Mulvihill 1988William Munck 1987Richard Murphy 1962David Murphy 1987Liam Murphy 2001Anthony Muscarella 2009Andrew Mustapich 1950Howard Myers 1967Brian Myers 1981Doug Nastro 1974Steven Nastro 1980Henry Natterer 1959Isaac Neal 2010David Neidhart 2001Jerry Nobile 2011Richard Northorn 1997Thomas Nunziata 1955Brad Obloj 1999Daniel O’Brien 1953Terrance O’Connor 1973Wesley O’Donnell 1985John O’Donnell 1995John Oliva 1971Alan Olsen 1961Chet O’Neill 1960Carl Orent 1955Danny Orlando 2009

John Orsen 2006Daaviv d d PaP dgett 1965Ralph h Palma 1970Leonard PaPananarelli 2006John Panarese 19196565Chris Panos 1996L Parcrcheher r 1958

g yGregory Parisi 1983Steven Parker 1972Robert Parrinelli 2000Thomas Passantino 1971Michael Passuello 2006Joseph Pavek 1981Jason Pearl 2003John Pedranghelu 1978Anthony Perettine 1987Christopher Pergola 2008Martin Peters 2002William Peters, IV 2007Frederick Peterson 1961Anthony Petillo 1978Richard Petillo 1983Lewis Petta 1956James Pezza 2010Frank Pigula 1983David Pike 2004Ronald Pimental 1987Armondo Polanco 1999William Pollock 1964Eddie Poreba 1982George Pratt 1958Kyle Pratte 2011Larry Price 1970Chris Prifte 1979

Keith Prifte 2009Steve Prifte 2009David Provenzano 1957James Pugh 1973

CHRIS PRIFTE


2012

LACROSS

ALL-TIME ALUMNIALL-TIME ALUMNIJaJamemessss PuPuPuPughghg 1197744MiM chhhc aeelll QuQQQuagagagaagerererer lelee li 11999922

Bruce Quinlan 1987James Quinn 2006James Rafferty 1952Richard Raganella 2000Peter Rainis 1986Rich Rambo 2011Robert Rao 1991James Raucci 1999Bruce Rauch 1969James Raveret 2011Bryan Read 2006Mikawato Red Arrow 1985Kevin Reich 1994Lawrence Reid 1968Edward Reilly 1955Keith Reilly 2003Andrew Reinesch 1950Michael Renga 1998Christopher Resch 1998Marc Riccio 1989James Richards 1964Michael Ricigliano 1995Stephen Rielly 1987Jonathan Rifenburg 2007Michael Rigney 2004Gary Rinaldi 1993William Risberg 1978John Rispoli 1952Joseph Ristuccia 1954Brian Robinson 1986Andrew Rodnite 1956Jack Rogan 2010Jack Rogan 2010Charles Rogener 1979Jacob Rogers 2000Chris Rogler 2001Dennis Rosa 1978Jordan Rosen 2009Sylvan Rosenbaum 1950Jeffrey Rosenberg 1968

JeJeffffrerey y RoRoststene 11119899 000LoLo iuis s RoR stststenen 111198989898111Ronaldd RRRototothh 1919191 696969Nate RRRoyoyoy 222200011HaHarrrry yy RoRoRoylylyle ee e 1970DaDaniniele Roylelle 2003JoJohn Ruddenenauer 2008William Ruggggieieroro 11979777Nicholas Ruocco 2000Ni h l R 2000Michael Russo 1958Robert Russo 1971Michael Sajkoski 1978Peter Salit 1958Joseph Sampieri 2001Patricia Sanders 1971Ronald Sandler 1968Frederick Sandler 1970Robert Santimays 1979Tomar Sarvis 2004Thomas Savio 1990William Sayrafe 1986Raymond Schaefer 1958George Scharnikow 1997L Scheer 1956Michael Scheno 1978Brian Schneider 2009Mark Schnellinger 1995Richard Schrage 1962Martin Schumacher 1967David Schwartzberg 2007Thomas Schwender 1962Anthony Sciortino 2008Donald Scott 2004Christian Scuderi 2010Warren Seaman 1958James Seifert 1986Harold Seikel 1950Richard Sesnewicz 1966Lee Sewell 1973Gerard Sewell 1981Scott Shafranek 2002Doug Shanahan 2002Thomas Shea 1971Jesse Sherer 2003James Sheridan 1961John Sherlock 1978James Shirley 1982James Shuart 1953Tom Shuey 2009Tom Shuey 2009Alexander Silenok 1975Matthew Silver 2006Jerry Simandl 1955Robert Sinclair 1986Michael Skudin 2011Gary Smalls 1972William Smith 1952

RiRichcharard d SmS ith h 1991 6161RRiRiRichhhchcharaaa d Smmith 19911 7676RyRRyananan Smith 22220000000099ViViVincncncee Sombmbm rotto 1919198282828

Steven Sorrillo 2006Steven Souhrada 1990Edward Southard 1999Matthew Southard 2006Dean Spadaro 1995Eric Spallina 1998Brian Spallina 2000Mark Spruyt 1997Collin Stabler 2008Jeremy Stambovsky 2005William Stanley 1991Dan Stein 2010Michael Stencel 2001Robert Stewart 1972Charles Stile 1960Richard Stoecker 1978John Stranahan 1966Paul Sullivan 1958Richard Sullivan 2001Douglas Swanson 1981Adam Swarsen 2010David Sweeney 2003Gerard Sweet 2006Marc Szyluk 1997Richard Tamaro 1966Joseph Taylor 1987Lorel Teolis 1955John Tenet 2008Roger Testa 1973Roger Testa 1973Jared Testa 1998Brett Tietjen 2003Michael Tolkach 2008James Toone 1968Sam Toperoff 1960John Tortora 1972Samuel Trachtenberg 1952

JJamees s TTrainoon r r 1919722StStepeepheh n TrTrTrenene tacoostste e 19972TiTiTimmothhthhy y y TTTreubibibiig gg 2020060PePeP tetet rr TTrTrizizziziino 111969696622222Nicholas Turu chiaiaiaianonono 19663333William Tuurlr ey 195333RoRossss UUhlhlfef ldlderer 11969699ChChririss UnUntetersrsteteinin 22000066Kevin Unterstein 2008K i U i 2008Mike Unterstein 2008Mike Vaccaro 2011Alfred Vadnais 1958John Van Gelder 2000Richard Van Wickler 1988Gerald Vance 1964Philip Vangeli 1994Clayton VanNortwick 2004James Vaughan 1977Robert Veit 1956Richard Verne 1960Peter Verne 1964Vincent Vieten 1953Ryan Vilar 2005Americus Vitale 1963Jack Vivonetto 2009Steven Walakovits 1994Edward Wallace 1980Owen Walsh 1952Peter Walther 1987Joseph Wamser 1958Kevin Warne 2000James Watson 1982Patrick Watson 2009Julian Watts 2008Steven Wax 2007Gary Weller 1974Gary White 1977Jonathan Wicker 2005George Wiemer 1958John Wilkinson 1973Charles Wilkinson 1978James Wilkinson 1981Ryan Willey 2008Debra Wolther 1981Edward Woycik 1977Edward Wozniak 1968Austin Wright 2011Shane Wynn 2009Christopher Yeager 1988Christopher Yeager 1988Dennis Yeagle 2001Joseph Zaffuto 1980Allen Zagoren 1969Ronald Zoia 1963Brian Zuchelli 2004Brian Zusi 2002

VINCE SOMBROTTO

BOB QUINLAN


HOFSTRA RECORD BOOKHOFSTRA RECORD BOOK012

LACROSSE

GGGoooaaaallllsssGaGaGG meme:: 101000 - MMMMicicicichahahaael LaCCrrossse vsv . Virginia, 1989898989

SSeasasono :: 62626262 - AAAAththththaananan IIIannunuuccccccci,i,i, 22006

CaC reerer:: 1140404040 - TTTomomomm KKKKesesesesslslslsleereer, , 1999-022

BBEESSTT GGGOOOOAAAALLLLSSSS PPPPEEERR GGGAAMMMMEE AAVVVEERRRRAAAAGGGGEE, SSSEEEAAASSSOOONNNNo. Player Year GP Goals PPGN Pl Y GP G l PPG1 Michael Fowler 1979 12 40 3.33

2 Michael LaCrosse 1989 15 49 3.27

3 Athan Iannucci 2006 19 62 3.26

4 Tom Kessler 2000 16 48 3.00

4 Tom Kessler 2001 17 51 3.00

4 Bob Hiller 1974 12 36 3.00

MOST GOALS, SEASON,No. Player Year GP Goals1 Athan Iannucci 2006 19 62

2 Tom Kessler 2001 17 51

3 Michael LaCrosse 1989 15 49

4 Tom Kessler 2000 16 48

5 Chris Unterstein 2006 19 45

6 Jerry Simandl 1955 16 44

7 Doug Shanahan 2001 17 43

8 Billy Reid 1971 15 41

9 Michael Fowler 1979 12 40

MMMMOOOOSSSSTTT GGGGOOOOAAAALLLSS,,,, CCCCAAARRREEEEEER,,,NoNoo. PlPlPlPlayayayayerererer Year GGoaoaalslsls111 ToToToTomm m m KeKeKeessler 1999-2001 141 02 Jaayy CaC rd 2008-2011 11223 Jeerrrrrrrry y yy SiSSS mam ndndll l 191 52-1955 11119944 BoBoBob b bb HiHiHiH llllerer 11979733-19197676 11090955 ToToTomm DoDoDoolololeyeyey 22200006-6-20020090909 1110707075 Andy Carlson 1991 1994 1075 Andy Carlson 1991-1994 1077 Phil Mordente 1964-1966 1058 Athan Iannucci 2004-2006 1049 Doug Shanahan 1998-2001 9510 Scott Dooley 1999-2002 88

AssistsGame: 9 - Joe Masone vs. Trinity, 1953Season: 58 - Jerry Simandl, 1955Career: 119 - Jerry Simandl, 1952-55

BEST ASSISTS PER GAME AVERAGENo. Player Year GP Assists APG1 Paul Sullivan 1958 11 52 4.732 Joe Masone 1953 14 52 3.713 Jerry Simandl 1955 16 58 3.634 Steve Dauses 1970 16 49 3.065 Gary Rinaldi 1991 14 42 3.006 Steve Walakovits 1989 15 43 2.877 Kevin Jacobs 1995 14 40 2.868 James Metzger 1980 10 28 2.80

TEAM RECORDSTEAM RECORDSMost Games Won, Season - (17) 2006 (17-2)Most Games Lost, Season - (11) 1963 (5-11); 1972 (5-11); 1985 (3-11)Most Consecutive Wins - (17) 2006Most Consecutive Losses - (7) 1951Highest Winning Percentage - (.895) 2006 (17-2)Lowest Winning Percentage - (.214) 1985 (3-11)Most Goals Scored, Season - (247) 1955 (16 games)Most Goals Allowed, Season - (196) 1986 (13 games)Highest Goals per Game Average, Season - (15.4) 1955Fewest Goals Allowed per Game Average, Season - (3.4) 1955 (55 in 16 games)Most Shutouts, Season - (2) 1952 (Cortland and Western Maryland)Most Shutouts Against, Season - (1) three times - Last time in 1969 vs. NavyLongest Game - (73:47) at Towson, 4/15/90 (4OT) Hofstra 10, Towson 9Most Goals Scored, Game - (27) vs. CCNY, 1970Most Goals Allowed, Game - (30) at Syracuse, 1991Fewest Goals Scored, Game - (0) Three times - Last time in 1969 vs. Navy (0-11)Fewest Goals Scored by Opponent, Game - (0) Eight times - Last vs. CCNY, 1970 (27-0)

MICHAEL LACROSSE

PHIL MORDENTE

IIIInnddiiivvvviiiidddduuuuaaaallll RReeeecccoooorrrdddds

TOM KESSLER

KEVIN JACOBS


2012

LACROSS

MMMOOOOSSSSTTTT AAAASSISSSSTTTTSSSS,, , SSSSEASOOONNoNoN . PPlayayyyere YYYYeaeaeaear r r r GPGG AAssiststt1111 Jeeeerrrrr yyyy SiSiSiSimamamamandndndndl l l l 1999955555555 11116666 5582 222 Paaaauuulul SSSSulululu lilililivavavavannn n 119191958585858 1111111 52222 2 JoJoJoJoeeee MaMaMaMasosoosonenenen 111195333 14144 524 444 StStStStevvvve ee e DaDaDaDauuuuses 1970 161666 495 Phhilil MMMMoro dente 1966 17 777 456 Steve WaW lakovits 1989 15 437 Gary Rinaldi 1991 14 428 Kevin Jacobs 1995 14 408 Kevin Jacobs 1995 14 40

MOST ASSISTS, CAREER,No. Player Year Assists1 Jerry Simandl 1952-1955 1192 Kevin Jacobs 1992-1995 1123 Phil Mordente 1964-1966 1064 Chris Unterstein 2003-2006 795 Steve Dauses 1969-1970 716 Scott Dooley 1999-2002 697 Gary Rinaldi 1990-1991 688 Steve Walakovits 1988-1989 689 Tom Kessler 1999-2002 6710 Mike Magee 1987-1989 6210 Phil Marino 1973-1975 62

POINTSGame: 12 - Jerry Simandl vs. Cortland Stateand Union, 1955Season: 102 - Jerry Simandl, 1955Career: 238 - Jerry Simandl, 1952-55

BEST POINTS PER GAMEAVERAGENo. Player Year GP Pts PPG1 Jerry Simandl 1955 16 102 6.382 Steve Dauses 1970 16 84 5.253 Brian Langtry 1998 14 72 5.144 Kevin Jacobs 1995 14 69 4.935 James Metzger 1980 10 49 4.906 Michael Lacrosse 1989 15 67 4.467 Phil Marino 1975 13 57 4.388 Phil Mordente 1966 17 74 4.359 Tom Kessler 2001 17 74 4.3510 Michael Fowler 1979 12 52 4.3311 Chris Unterstein 2006 19 81 4.2612 Athan Iannucci 2006 19 80 4.2113 Vince Sombrotto 1980 13 54 4.1514 Rich Stoecker 1976 12 49 4.0815 Jay Card 2010 13 53 4.08

MOST POINTS, SEASON,No.Player Year GP G-A Pts.1 Jerry Simandl 1955 16 44-58 1022 Steve Dauses 1970 16 35-49 843 Chris Unterstein 2006 19 45-36 814 Athan Iannucci 2006 19 62-18 805 Phil Mordente 1966 17 29-45 745 Tom Kessler 2001 17 51-23 74

MMMMOOOST PPPOOOIIINNNNTTTTSSSS,,, CAREER,,,NoNoNoNo. Player YYeae r PPPts1111 JeJeJeJerry yy Siiiimamamamannndn l l l l 1999952525252-1-1-1-19595959555 5 5 2323232 82 2 2 2 PhPhPhPhilililil MMMMorrrrdedededentntntnte 1999964444-1-1-1-1969696966 2121212111113333 ToToToTom m m m KeKeKeKesssssssslleleler 1999999999-2-2-2-2000000002 2 22 2077774 KeKeKeKevivivivin nnn Jacobs 19999922-2-2-1999995 192222555 JaJaJaJ y yy CCCaC rd 2008-2020200111111 18266 ChChriis Unterstein 2003-202006 1667 Andy Carlson 1991-1994 1638 Scott Dooley 1999-2002 1578 Scott Dooley 1999 2002 1579 Athan Iannucci 2004-2006 14610 Brian Foresta 1987-1990 14210 Brian Langtry 1995-1998 142

SAVESGame: 36 - Joe Fowler at Navy, 1980Season: 278 - James Toone, 1966Career: 843 - Dave Giannone, 1987-90

BEST GOALS AGAINSTAVERAGE, SEASON,No. Player Year GP GAA1 Andrew Gvozden 2011 16 6.002 Matt Southard 2006 19 6.383 Mark Spruyt 1997 15 6.774 Jack Alaimo 2002 14 7.025 Danny Orlando 2007 14 7.21

MOST SAVES, SEASON,No. Player Year GP Saves 1 James Toone 1966 17 2782 Dave Giannone 1988 15 2683 Joe Romeo 1993 15 2344 Kevin Johnson 1996 14 2325 Kevin Barry 1991 14 224

MOST SAVES, CAREER,1 Dave Giannone 1987-1990 8432 Joe Zaffuto 1971-1974 7773 Dick Vielanowitz 1958-1960 6044 Mark Spruyt 1995-1998 5745 Matt Southard 2003-2006 572

ATHAN IANNUCCI

JOE ZAFFUTO

HOFSTRA RECORD BOOKHOFSTRA RECORD BOOK

DOUG SHANAHAN

DAVEGIANNONE



LACROSSE

Mosttt GGGGoooaaaallllsss iiinnnn OOOOnnee GGaammmeee101001 - MMMicicci hahaahaelelelel LaCCCrroror sse e vsvsvsvs. ViViViV rgginniaia, , 19198989 8 -- DDDDavavave e e DoDoDoDonnan tetetelllllllo o vsv . MaMaMaMassssssacacachuhusesetttts,s,s, 1993 8 - OOOwwwewenn nn WaWWaW lsh hh vsvvsv . LaLaafafafafayetttte,e,e,e, 11949499 7 - JJJimimimim FFFFememmemmimimiminennenelllllll a a vsvv .. Nootrre e DDaDaD memee, 2003 7 - Bririririanann LLLLanannggtgtgtryryryry vvvs.s.ss. HHHHarararrtftftftforororordd,dd 11999988877 - JJerere ryryy SSSimimimananandldldl vvvss. CCCororortltlt anand d d StStatte,e, 111959555

7 - Bruce Yancey vs. Brown, 1983 7 - Billy Reid vs. Morgan State, 1971 6 - Anthony Muscarella at Stony Brook,6 Anthon M scarella at Ston Brook

2008 6 - Athan Iannucci at Stony Brook, 2006 6 - Athan Iannucci vs. Sacred Heart, 2006 6 - Tom Dooley vs. Sacred Heart, 2006 6 - Tom Kessler at Delaware, 2002 6 - Tom Kessler vs. Army, 2000 6 - Tom Kessler vs. Towson, 2000 6 - Blake Miller vs. Delaware, 1996 6 - Chris Panos vs. Delaware, 1996 6 - Chris Panos vs. Delaware, 1995 6 - Andy Carlson vs. Towson State, 1991 6 - Gary Rinaldi vs. Lehigh, 1990 6 - Michael LaCrosse at Delaware, 1990 6 - Jon Cooper vs. UMBC, 1988 6 - Ken Curry vs. Hobart, 1988 6 - Vinnie Sombrotto vs. New Hampshire,

1980 6 - Mike Fowler vs. Brown, 1979 6 - Mike Fowler vs. LIU-C.W. Post, 1979 6 - Kevin Huff vs. NY Tech, 1978 6 - Bill Hanlon vs. MIT, 1969 6 - Mike D’Amato vs. MIT, 1968 6 - Phil Avillo vs. Rutgers, 1963 6 - Joe Krupinski vs. New Hampshire, 1958 6 - Joe Krupinski vs. MIT, 1958 6 - Alex Fedoroff vs. Trinity, 1953 5 - Kevin Ford vs. Delaware, 2011 5 - Jamie Lincoln at Towson, 2011 5 - Jamie Lincoln vs. Harvard, 2011 5 - Stephen Bentz vs. Towson, 2010 5 - Jay Card vs. Army, 2010 5 - Stephen Bentz vs. Sacred Heart, 2010 5 - Jamie Lincoln vs. Johns Hopkins, 2010 5 - Jay Card vs. Delaware, 2009

5 --- KKKKevevevÒiÒiÒin nn FoFoFoFordrdrd vvvs.s.s.s. Stony Brororookokokok,, 20202 09005555 -- JJJJayayaay CCCCaara d vs. SaSaSacrcrcc ed HHHHeaeaeaartrtrtrt,, 202022 0808085555 -- TTTTom DDDDoooo ley y vsvsvs. Sacrrrredededd HHHHeart, 2022 08555 - AAAAntntnthohooonynyny MMMususccacc rella a vsvsvs. Towswssonononon,,,, 202020008080808555 - AAAAththththanananan IIIIanannunucccciii vsvsvs.. PPrP ovovidididi encece*,*, 220000006665555 ---- AAAAthththananan IIIananannunuccccii i at RRoboboo ere t t MoMoMoM rrrrisiss,, 2020200606655 --- TTTTomom DDDooooolelel y y aatata VVililllalal nnon vaaa,,, 20202006060606

5 - AAthan Iannucci i vs. Brown, 200066 5 - Scott Dooley vs. Army, 2002 5 Tom Kessler vs. Air Force, 20015 - Tom Kessler vs. Air Force, 2001 5 - Tom Kessler vs. Hartford, 2001 5 - Tom Kessler vs. Towson, 2001 5 - Tom Kessler vs. Virginia*, 2001 5 - Doug Shanahan vs. Drexel, 2001 5 - Doug Shanahan vs. Delaware, 2001 5 - Tom Kessler vs. Air Force, 2000 5 - Joe Kostolansky vs. Towson, 2000 5 - Doug Shanahan vs. Brown, 1998 5 - Jarred Testa vs. Towson, 1997 5 - Anthony Alexander vs. Rutgers, 1996 5 - Kevin Jacobs vs. New Hampshire, 1995 5 - Andy Carlson vs. Rutgers, 1994 5 - Andy Carlson vs. Air Force, 1994 5 - Andy Carlson vs. Providence, 1993 5 - Dave Donatello vs. Loyola, 1993 5 - Joe Barra vs. UMBC, 1992 5 - Dom DiNardo vs. St. John’s, 1991 5 - Dom DiNardo vs. Virginia, 1991 5 - Joe Barra vs. Drexel, 1991 5 - Michael Ricigliano at LIU-C.W. Post,

1990 5 - Michael Laudenslager vs. Cornell, 1990 5 - Michael Laudenslager vs. Penn State,

1990 5 - Jon Cooper vs. Drexel, 1988 5 - Brian Foresta vs. Lehigh, 1988 5 - Brian Foresta vs. Lafayette, 1987 5 - Tony Perettine vs. St. John’s, 1984 5 - Tony Perettine vs Towson, 1984 5 - Bruce Yancey vs. Baltimore, 1983 5 - Dave McCulloch vs. Navy, 1983 5 - Vinnie Sombrotto vs. Penn State, 1980 5 - Vinnie Sombrotto vs. Army, 1980 5 - Vinnie Sombrotto at Brown, 1980 5 - Mike Fowler vs. Boston College, 1979 5 - Mike Fowler vs. Dartmouth, 1979 5 - Mike Fowler vs. Washington & Lee,

1979 5 - Vinnie Sombrotto vs. Massachusetts,

1978 5 - Jim Kuhner vs. LIU-C.W. Post, 1972 5 - Steve Dauses vs. Air Force, 1970 5 - Alfred Lettera vs. New Hampshire, 1966 5 - Phil Mordente vs. Bowdoin, 1966 5 - Phil Mordente vs. Washington, 1966 5 - Alex Fedoroff vs. CCNY, 1953 5 - Alex Fedoroff vs. Milburn LC, 1953

MMMMooosssttt AAAsssssssiiissstttsss iiinnnn OOOOnnnneeee GGGGaammmee99 -- Joossephphp MMasoononone e vsvsvsvs.. TrTrinini ity,yy 119595953 8 -- PhPhilil MMoro dennnte vs. AdAddelelelphphphhi,i,i 11196969 4448 -- PaPaulul SSululllil vavavann vs.. MITT, 11959588 - JeJerrrry y y SiiSimamandl vss. Unnioion,nnn 1195955588 - Jerry SiSimandl vs. Miidddleebuburyry, 1195557 - Kevin Jacobs vs. Delaware, 1995

y7 - Steve Walakovits vs. Army, 19897 - Steve Dauses vs. CCNY, 19707 - Phil Mordente vs. Adelphi, 19666 - Brian Langtry vs. Towson, 19986 - Kevin Jacobs vs. New Hampshire, 19956 - Jim Metzger vs. Towson, 19806 - Jim Metzger vs. Penn State, 19805 - Chris Unterstein at Robert Morris, 20065 - Brian Langtry vs. Army, 19985 - Kevin Jacobs vs. St. John’s, 19955 - Andy Carlson vs. Army, 19945 - Kevin Jacobs vs. Michigan State, 19945 - Kevin Jacobs vs. Lafayette, 19935 - Steve Walakovits vs. Delaware, 19895 - Steve Walakovits vs. St. John’s, 19895 - Jim Metzger vs. North Carolina State,

19805 - Vinnie Sombrotto vs. Baltimore, 19805 - Kevin Huff vs. NY Tech, 19785 - Doug Nastro vs. Baltimore, 19745 - Mike D’Amato vs. Bowdoin, 19685 - Paul Sullivan vs. Washington College,

19585 - Jerry Simandl vs Cortland State, 1955

eMost Points in One Game12 - Jerry Simandl vs. Cortland State, 1955

(7-5)12 - Jerry Simandl vs. Union, 1955 (4-8)

511 - Kevin Jacobs vs. New Hampshire, 1995(5-6)

11 - Michael LaCrosse vs. Virginia, 1989(10-1)

11 - Kevin Huff vs. NY Tech, 1978 (6-5)11 - Phil Mordente vs. Adelphi, 1964 (3-8)10 - Jerry Simandl vs. Middlebury, 1955

(2-8)10 - Steve Walakovits vs. Army, 1989 (3-7)10 - Steve Dauses vs. CCNY, 1970 (3-7)10 - Paul Sullivan vs. MIT, 1958 (2-8)10 - Joseph Masone vs. CCNY, 1953 (4-6)10 - Joseph Masone vs. Trinity, 1953 (1-9) 9 - Chris Unterstein at Robert Morris, 2006

(4-5)3 9 - Dave Donatello vs. Massachusetts, 1993

(8-1) 9 - Gary Rinaldi vs. Lehigh, 1990 (6-3) 9 - Michael LaCrosse vs. Army, 1989 (5-4)y ( ) 9 - Dave McCulloch vs. Navy, 1983 (5-4) 9 - Billy Reid vs. Morgan State, 1971 (7-2)

) 9 - Mike D’Amato vs. Bowdoin, 1968 (4-5) 9 - Phil Mordente vs. Adelphi, 1966 (2-7) 9 - Doug Nastro vs. Baltimore, 1974 (4-5) 8 - Jay Card vs. Army, 2010 (5-3) 8 - Jamie Lincoln at St. John’s, 2010 (4-4) 8 - Jamie Lincoln vs. Johns Hopkins, 2010

(5-3)

JIM METZGER



LACROSS

GARY RINALDI

8 - Athan Iannucci vs. Providence*, 2006 (5-3)

8 - Athan Iannucci at Villanova, 2006 (4-4)

8 - Tom Kessler vs. Hartford, 2001 (5-3) 8 - Tom Kessler vs. Towson, 2001 (5-3) 8 - Tom Kessler vs. Army, 2000 (6-2) 8 - Kevin Jacobs vs. St. John’s, 1995 (3-5) 8 - Kevin Jacobs vs. Delaware, 1995 (1-7) 8 - Andy Carlson vs. Army, 1994 (3-5) 8 - Gary Rinaldi vs. Drexel, 1991 (4-4) 8 - Vinnie Sombrotto vs. New Hampshire,

1980 (6-2) 8 - Vinnie Sombrotto vs. Baltimore, 1980

(3-5) 8 - Jim Metzger vs. Penn State, 1980 (2-6) 8 - Jim Metzger vs. Towson, 1980 (2-6) 8 - Jim Metzger vs. North Carolina State,

1980 (3-5)

Most Goals in One Season62 - Athan Iannucci, 2006 (1)51 - Tom Kessler, 2001 (6)49 - Michael LaCrosse, 198948 - Tom Kessler, 2000 (5)45 - Chris Unterstein, 2006 (10)44 - Jerry Simandl, 1955 (2)43 - Doug Shanahan, 2001 (20)41 - Billy Reid, 197140 - Michael Fowler, 1979 (10)39 - Phil Mordente, 1965 (4)38 - Tom Dooley, 200638 - Sean Bolger, 198837 - Joe Kostolansky, 200037 - Brian Langtry, 1998 (22)37 - Bruce Yancey, 198337 - Vinnie Sombrotto, 198037 - John Stranahan, 1954 (4)36 - Bob Hiller, 197436 - Blake Miller, 199635 - Jay Card, 2009 (16)35 - Jim Femminella, 200335 - Andy Carlson, 199135 - Steve Dauses, 1970 (7)34 - Gary Boyle, 195534 - Mike D’Amato, 196834 - Alex Fedoroff, 1953 (7)33 - Jamie Lincoln, 2010 (21)33 - Dave Donatello, 199333 - Joe Krupinski, 1958 (7)33 - John Stranahan, 1955 33 - Jerry Simandl, 1953 (9)32 - Mike D’Amato, 1967 (10)32 - Bob Hiller, 197631 - Jay Card, 2010 (19)31 - Scott Dooley, 200231 - Bob Hiller, 197330 - Andy Carlson, 199430 - Bob Hiller, 1975

Most Assists in One Season58 - Jerry Simandl, 1955 (1)52 - Paul Sullivan, 195852 - Joseph Masone, 1953 (2)49 - Steve Dauses, 1970 (1)45 - Phil Mordente, 1966 (2)43 - Steve Walakovits, 198942 - Gary Rinaldi, 199140 - Kevin Jacobs, 199540 - Paul Sullivan, 195836 - Chris Unterstein, 2006 (2)35 - Brian Langtry, 1998 (4)34 - Jerry Simandl, 1954 (6)33 - Kevin Jacobs, 199332 - Phil Mordente, 1965 (8)31 - Tim Goldstein, 198531 - Rich Stoecker, 197631 - Phil Marino, 1975 (8)30 - Joseph Masone, 1952 (7)

Most Points in One Season102 - Jerry Simandl, 1955 (44-58) (1) 84 - Steve Dauses, 1970 (35-49) (1) 81 - Chris Unterstein, 2006 (45-36) (2) 80 - Athan Iannucci, 2006 (62-18) (3) 74 - Phil Mordente, 1966 (29-45) (3) 74 - Tom Kessler, 2001 (51-23) (8) 72 - Brian Langtry, 1998 (37-35) (3) 72 - Paul Sullivan, 1958 (20-52) 71 - Phil Mordente, 1965 (32-39) (3) 70 - Joseph Masone, 1953 (18-52) 69 - Kevin Jacobs, 1995 (29-40) 67 - Michael LaCrosse, 1989 (49-18) 64 - Phil Mordente, 1964 (5) 61 - Tom Kessler, 2000 (48-13) (17) 60 - Joe Kostolansky, 2000 (37-23) (17) 58 - Steve Walakovits, 1989 (15-43) 57 - Phil Marino, 1975 (26-31) (13) 56 - Sean Bolger, 1988 (38-18) 56 - Jerry Simandl, 1954 (22-34) 56 - Doug Shanahan, 2001 (43-13) 54 - Vinnie Sombrotto, 1980 (37-17) 54 - Gary Boyle, 1955 (34-20) 53 - Jay Card, 2010 (31-22) 53 - Jamie Lincoln, 2010 (33-20) 53 - Blake Miller, 1996 (36-17) 53 - Steve Walakovits, 1988 (28-25) 53 - Phil Marino, 1975 (25-28) 53 - Billy Reid, 1971 (41-12) 52 - Michael Fowler, 1979 (40-12) 52 - Joseph Masone, 1952 (22-30) 51 - Tom Dooley, 2006 (38-13) 51 - Kevin Jacobs, 1993 (18-33) 51 - Gary Rinaldi, 1990 (25-26) 51 - Kevin Huff, 1978 (32-19) 50 - Joe Kostolansky, 2003 (29-21) 50 - Andy Carlson, 1994 (30-20) 50 - Gary Rinaldi, 1991 (8-42) 50 - Steve Dauses, 1969 (28-22) 50 - Mike D’Amato, 1967 (32-18)

]Most Saves in One Season278 - James Toone, 1966 (2)268 - Dave Giannone, 1988234 - Joe Romeo, 1993232 - Kevin Johnson, 1996229 - Joe Zaffuto, 1972224 - Kevin Barry, 1991213 - Dick Vielkanowitz, 1960 (4)210 - James Toone, 1967 (4)202 - Dave Giannone, 1989202 - Ross Uhlfelder, 1969202 - Dick Vielkanowitz, 1958 (6)195 - Mark Spruyt, 1998 (3)195 - Mark Spruyt, 1997195 - Joe Zaffuto, 1973 (4)194 - Dick Vielkanowitz, 1959 (3)192 - Dave Giannone, 1990188 - Mark Anthony, 1984183 - Mark Spruyt, 1995181 - Matt Southard, 2003181 - Dave Giannone, 1987181 - Ross Uhlfelder, 1968179 - Mike Demeo, 2000179 - Joe Romeo, 1994177 - Joe Zaffuto, 1971

Number in bold () is national ranking

The records included in this section are the only Men’s Lacrosse records that are documented in the Hofstra Athletic Communications Offi ce. That offi ce welcomes documented additions or corrections to the record book from media, alumni or boosters. A hearty thanks is extended to Hofstra alumni who contributed to the development of this record section.


HOFSTRA LACROSSE ANNUAL LEADERSHOFSTRA LACROSSE ANNUAL LEADERS(Through the 2011 season)

GOALSYear Name GP Goals GPG1966 Alfred Lettera 17 33 1.941967 Michael D’Amato 15 32 2.131968 Michael D’Amato 13 34 2.341969 Steve Dauses 14 28 2.001970 Steve Dauses 16 35 2.191971 Billy Reid 15 41 2.731972 Jim Kuhner 16 18 1.131973 Bob Hiller 14 31 2.211974 Bob Hiller 12 36 3.001975 Bob Hiller 12 30 2.501976 Bob Hiller 12 32 2.671977 Rich Stoecker 12 18 1.501978 Kevin Huff 13 32 2.381979 Michael Fowler 12 40 3.331980 Vince Sombrotto 13 37 2.381981 Gary Arnold 11 23 2.091982 Gary Arnold 13 18 1.381983 Bruce Yancey 14 37 2.641984 Tony Perettine 14 26 1.861985 John Conroy 12 26 2.171986 John Conroy 12 21 1.751987 Jon Cooper 16 24 1.501988 Sean Bolger 15 38 2.531989 Michael LaCrosse 15 49 3.271990 Michael Laudenslager 14 32 2.291991 Andy Carlson 14 35 2.501992 Joe Barra 13 18 1.381993 Dave Donatello 16 33 2.061994 Andy Carlson 13 30 2.30

1995 Kevin Jacobs 14 29 2.071996 Blake Miller 14 36 2.571997 Jarred Testa 15 22 1.471998 Brian Langtry 14 37 2.641999 Chad Eisenhart 16 22 1.382000 Tom Kessler 16 48 3.002001 Tom Kessler 17 51 3.002002 Scott Dooley 14 31 2.212003 Jim Femminella 17 35 2.062004 Chris Unterstein 14 18 1.292005 Athan Iannucci 15 27 1.802006 Athan Iannucci 19 62 3.262007 Tom Dooley 14 26 1.862008 Anthony Muscarella 16 28 1.752009 Jay Card 15 35 2.332010 Jay Card 13 31 2.38 Jamie Lincoln 14 33 2.362011 Jay Card 16 29 1.81 Jamie Lincoln 16 29 1.81

ASSISTSYear Name GP ASTS. APG1966 Phil Mordente 17 45 2.651967 Michael D’Amato 15 18 1.201968 Michael D’Amato 13 15 1.15 Paul Arena 13 15 1.151969 Steve Dauses 14 22 1.571970 Steve Dauses 16 49 3.061971 Bruce Ramirez 15 19 1.271972 Bob DeMarco 16 13 0.811973 Bob Auguste 14 26 1.861974 Doug Nastro 12 27 2.251975 Phil Marino 13 31 2.381976 Rich Stoecker 12 31 2.581977 Rich Stoecker 12 18 1.501978 Kevin Huff 13 19 1.461979 James Metzger 11 12 1.09 Michael Fowler 12 12 1.001980 James Metzger 10 28 2.801981 George Mueller 11 13 1.181982 Gary Arnold 13 12 0.921983 Dave McCulloch 14 23 1.641984 Tim Goldstein 14 23 1.641985 Tim Goldstein 12 31 2.581986 Brian Robinson 13 15 1.151987 Mike Magee 7 17 2.431988 Steve Walakovits 14 25 1.791989 Steve Walakovits 15 43 2.871990 Gary Rinaldi 14 26 1.861991 Gary Rinaldi 14 42 3.001992 Kevin Jacobs 13 13 1.001993 Kevin Jacobs 16 33 2.061994 Kevin Jacobs 13 26 2.001995 Kevin Jacobs 14 40 2.861996 Blake Miller 14 17 1.211997 Paul Judge 15 13 0.871998 Brian Langtry 14 35 2.501999 Brad Obloj 16 19 1.192000 Joe Kostolansky 16 23 1.442001 Tom Kessler 17 23 1.35 Scott Dooley 17 23 1.352002 Tom Kessler 14 21 1.502003 Joe Kostolansky 17 21 1.232004 Chris Unterstein 14 13 0.932005 Chris Unterstein 16 22 1.382006 Chris Unterstein 19 36 1.892007 Mike Unterstein 14 18 1.292008 Michael Colleluori 16 15 0.942009 Michael Colleluori 15 22 1.462010 Jay Card 13 22 1.692011 Jay Card 16 17 1.06 Ian Braddish 16 17 1.06

012

LACROSSE

PHIL MARINO


HOFSTRA LACROSSE ANNUAL LEADERSHOFSTRA LACROSSE ANNUAL LEADERSPOINTSYear Name GP G-A Pts.1966 Phil Mordente 17 29-45 741967 Michael D’Amato 15 32-18 501968 Michael D’Amato 13 34-15 491969 Steve Dauses 14 28-20 501970 Steve Dauses 16 35-49 841971 Billy Reid 15 41-12 531972 Jim Kuhner 16 18-5 231973 Billy Reid 14 30-12 421974 Doug Nastro 12 19-27 461975 Phil Marino 13 26-31 571976 Rich Stoecker 12 18-31 491977 Rich Stoecker 12 18-18 361978 Kevin Huff 13 32-19 511979 Michael Fowler 12 40-12 521980 Vince Sombrotto 13 37-17 54 James Metzger 10 21-28 491981 Gary Arnold 11 23-12 351982 Gary Arnold 13 18-12 301983 Dave McCulloch 14 26-23 491984 Dave McCulloch 14 20-16 36 Tony Perettine 14 26-10 361985 Tim Goldstein 12 9-31 401986 Brian Robinson 13 18-15 331987 Brian Foresta 14 22-14 341988 Sean Bolger 15 38-18 561989 Michael LaCrosse 15 49-18 671990 Gary Rinaldi 14 25-26 511991 Gary Rinaldi 14 8-42 501992 Andy Carlson 13 17-11 281993 Kevin Jacobs 16 18-33 511994 Andy Carlson 13 30-20 501995 Kevin Jacobs 14 29-40 691996 Blake Miller 14 36-17 531997 Paul Judge 15 21-13 341998 Brian Langtry 14 37-35 721999 Doug Shanahan 16 21-14 352000 Tom Kessler 16 48-13 612001 Tom Kessler 17 51-23 742002 Tom Kessler 14 28-21 492003 Joe Kostolansky 17 29-21 502004 Chris Unterstein 14 18-13 312005 Athan Iannucci 15 27-13 402006 Chris Unterstein 19 45-36 812007 Tom Dooley 14 26-2 282008 Anthony Muscarella 16 28-14 422009 Jay Card 15 35-9 442010 Jay Card 13 31-22 53 Jamie Lincoln 14 33-20 532011 Jay Card 16 29-17 46

GOALS AGAINST AVERAGEYear Name GP GA-SVS. GAA1985 Gary Merkle 9 115-98 12.78*1986 Marc Riccio 12 116-161 9.671987 Dave Giannone 11 97-181 8.82*1988 Dave Giannone 15 113-268 7.79*1989 Dave Giannone 15 129-202 8.601990 Dave Giannone 14 115-192 10.131991 Kevin Barry 14 176-224 13.101992 Kevin Johnson 11 82-91 10.491993 Joe Romeo 15 140-234 9.891994 Joe Romeo 12 121-179 10.611995 Mark Spruyt 14 115-183 9.971996 Kevin Johnson 14 157-232 11.321997 Mark Spruyt 15 100-195 6.771998 Mark Spruyt 14 116-195 8.611999 Michael Demeo 16 110-172 7.672000 Michael Demeo 16 141-179 9.142001 Jack Alaimo 12 86-103 11.022002 Jack Alaimo 14 92-118 7.022003 Matt Southard 17 145-181 9.232004 Matt Southard 14 146-168 10.822005 Matt Southard 13 96-106 8.422006 Matt Southard 19 116-117 6.382007 Danny Orlando 14 101-130 7.212008 Danny Orlando 16 138-133 8.562009 Andrew Gvozden 13 109-137 8.382010 Rob Bellairs 10 62-41 8.812011 Andrew Gvozden 16 90-136 6.00

*Offi cial goals against average unavailable. Average indicated is based on total team games and goals allowed.

2012

LACROSS

ANDREW GVOZDEN

KEVIN HUFF


HOFSTRA LACROSSE AWARD WINNERSHOFSTRA LACROSSE AWARD WINNERSUNITED STATES WORLD TEAM MEMBERSJack Kaley - 1974 (Assistant Coach)

Phil Marino - 1978

Vin Sombrotto - 1982, 1986, 1990, 1994

Rich Garguilo - 1992 (Under 19)

Kevin Jacobs - 1992 (Under 19)

Blake Miller - 1998, 2006

Evan Kostewka - 1998 (Under 19)

Doug Shanahan - 2002 (MVP), 2006

Nicky Polanco - 2002 (Alternate), 2006

Brett Moyer - 2003 (Under 19)

NICKY POLANCO

Year Name Position Team1952 Joe Masone Attack H.M. Vincent Vieten Defense H.M. Owen Walsh Midfi eld H.M.1953 William Donnolly Midfi eld 1st Vincent Vieten Defense 3rd Joe Masone Attack H.M.1954 Carl Orent Defense 3rd Albert Lahood Defense H.M.1955 Carl Orent Defense 1st Jerry Simandl Attack 2nd John Stranahan Midfi eld 3rd John Fahey Midfi eld H.M. Al Lahood Defense H.M. Lorel Teolis Defense H.M. Gary Boyle Attack H.M.1956 John Stranahan Midfi eld 3rd Gary Boyle Attack H.M. Peter Salit Attack H.M.1957 Marco Gazich Defense 3rd1958 Paul Sullivan Attack H.M. Richard Vielkanowitz Goal H.M. George Wiemer Midfi eld H.M.1959 Richard Vielkanowitz Goal H.M.1960 Richard Vielkanowitz Goal 2nd Frank Cozart Attack H.M. William Heiser Defense H.M. Frank Mauro Midfi eld H.M.1961 Frank Cozart Attack H.M. William Heiser Defense H.M.1965 Ronald Hansen Defense H.M. Phil Mordente Midfi eld H.M.1966 Phil Mordente Attack 3rd1967 Frank Marcinowski Defense H.M.1968 Frank Marcinowski Defense 1st Mike D’Amato Attack 2nd Dick Swanson Defense 3rd1970 Steve Dauses Attack 3rd

1971 John Overs Defense 1st William Hanlon Midfi eld H.M.1972 Joseph Zaffuto Goal H.M.1973 Phil Marino Midfi eld 1st Joseph Zaffuto Goal 3rd Doug Nastro Attack H.M.1974 Tom Calder Midfi eld H.M. Bob Rullan Defense H.M. Joseph Zaffuto Goal H.M.1975 Tom Calder Midfi eld 2nd Ray Mills Defense 3rd Phil Marino Attack H.M.1976 Bob Hiller Attack 3rd Richard Lewton Defense H.M.1977 Kevin Huff Midfi eld 3rd Richard Lewton Defense H.M.1978 Kevin Huff Midfi eld 2nd Richard Lewton Defense H.M.1979 Michael Fowler Attack 3rd1980 Vin Sombrotto Midfi eld 2nd Ed Wallace Defense 2nd James Metzger Attack H.M.1983 Joseph Fowler Defense H.M. Bob Quinlan Midfi eld H.M.1984 Dave McCulloch Midfi eld 3rd Mikko Red Arrow Midfi eld H.M.1985 Dave McCulloch Midfi eld 3rd Ed Geiger Defense H.M.1989 Michael LaCrosse Attack H.M.1990 Michael Laudenslager Midfi eld H.M.1991 Michael Laudenslager Midfi eld H.M.1993 Dave Heumann Defense 3rd Dave Donatello Attack H.M. Michael Ricigliano Midfi eld H.M.1994 Dom DiNardo Midfi eld H.M. Dave Heumann Defense H.M.1995 Kevin Jacobs Midfi eld H.M.

1996 Anthony Alexander Midfi eld 3rd Blake Miller Attack H.M.1997 Mark Spruyt Goal 3rd1998 Mark Spruyt Goal 3rd Brian Langtry Attack H.M.1999 Doug Shanahan Midfi eld H.M. Brain Spallina Midfi eld H.M. Kevin Warne Defense H.M.2000 Brian Spallina Midfi eld 1st Doug Shanahan Midfi eld 2nd2001 Doug Shanahan Midfi eld 1st Tom Kessler Attack 3rd Nicky Polanco Defense H.M.2002 Nicky Polanco Defense 1st Tom Kessler Attack 2nd Paul Rao Midfi eld H.M.2003 Brian Zuchelli Defense H.M.2004 Brett Moyer Defense H.M.2005 Brett Moyer Defense 2nd2006 Chris Unterstein Attack 1st Brett Moyer Defense 1st Athan Iannucci Attack 2nd John Keysor Midfi eld 2nd Sean McCarthy Defense H.M. John Orsen Midfi eld H.M.2007 Kevin Unterstein Midfi eld H.M.2008 Anthony Muscarella Midfi eld H.M.2009 Jay Card Attack H.M. Michael Colleluori Midfi eld H.M. Christian Scuderi Defense H.M.2010 Jay Card Attack H.M. Jamie Lincoln Attack H.M.2011 John Antoniades Midfi eld H.M. Jay Card Attack H.M. Andrew Gvozden Goal H.M. Michael Skudin Defense H.M.

HOFSTRA LACROSSE ALL-AMERICANS

012

LACROSSE

NATIONAL LACROSSE HALL OF FAMEAl Brisotti - Elected 1959

Howdy Myers - Elected 1973

Vin Sombrotto - Elected 1997

LONG ISLAND LACROSSE HALL OF FAMEHowdy Myers - Elected 1986

Jim Condon - Elected 1986

Al Brisotti - Elected 1987

Jack Kaley - Elected 1987

Phil Marino - Elected 1990

Jim Garvey - Elected 1993

Vin Sombrotto - Elected 1994

Carl Orent - Elected 1996

Joe Kovar - Elected 1996

Ray Buckley - Elected 1998

John Danowski - Elected 2000

Tim Goldstein - Elected 2003

Kevin Huff - Elected 2010

Dave McCulloch - Elected 2011

Jerry Simandl - Elected 2011

Blake Miller - Elected 2012

HOFSTRA UNIVERSITY ATHLETICS HALL OF FAMEWalt Kohanowich - Hofstra College & Class of 2006Owen Walsh - Hofstra College & Class of 2006Howdy Myers - Class of 2006Carl Orent - Class of 2006Dr. James M. Shuart - Class of 2006Jerry Simandl - Class of 2007Phil Marino - Class of 2008Bob Hiller - Class of 2009Al LaHood - Class of 2009Phil Mordente - Class of 2009Harry Royle - Class of 2009

Mike D’Amato - Class of 2011

Rudy Fiorvanti - Class of 2011

HOWDY MYERS


HOFSTRA LACROSSE AWARD WINNERSHOFSTRA LACROSSE AWARD WINNERS2012

LACROSS

LAURIE COX DIVISION ALL-STARS 1955 Carl Orent Defense Jerry Simandl Attack John Stranahan Midfi eld Lorel Teolis Defense1961 William Heiser Midfi eld1963 William Heiser Midfi eld1964 Charles Menagh Defense Phil Mordente Attack1965 Ron Hansen Defense Phil Mordente Attack Howard Myers III Attack1966 Phil Mordente Attack1967 Mike D’Amato Attack Art Konopacki Midfi eld Frank Marcinowski Defense Larry Reid Defense Ed Wozniak Defense

EAST COAST CONFERENCE ALL-STARS 1986 Dave McCulloch Midfi eld1987 Mike Minisini Midfi eld1988 Dave Giannone Goalie (MVP) Steve Walakovits Attack Mike McGinley Midfi eld Mike Magee Midfi eld Sean Bolger Attack Tom Byrne Defense1989 Michael LaCrosse Attack (MVP) Steve Walakovits Attack Michael Laudenslager Midfi eld Mike Magee Midfi eld Tom Byrne Defense1990 Michael Laudenslager Midfi eld (MVP) Gary Rinaldi Attack Matt Cady Defense1991 Joe Barra Midfi eld Michael Laudenslager Midfi eld Gary Rinaldi Attack1992 Joe Barra Midfi eld Anthony Bellomo Defense Andy Carlson Attack Dom DiNardo Attack Kevin Johnson Goalie

NORTH ATLANTIC CONFERENCE ALL-STARS1995 Kevin Jacobs Attack (MVP) Doug Altmansberger Defense Dave Heumann Defense Brian Holland Midfi eld Mark Spruyt Goalie1996 Blake Miller Attack (MVP) Anthony Alexander Midfi eld Craig Flynn Defense Chris Panos Attack - 2nd

AMERICA EAST ALL-STARS1997 Paul Judge Midfi eld Ryan Grimes Defense Jarred Testa Attack - 2nd Rich Langtry Midfi eld - 2nd Jamie Delgado Defense - 2nd Mark Spruyt Goalie - 2nd1998 Brian Langtry Attack - 1st (MVP) Doug Shanahan Midfi eld - 1st (Rookie) Kevin Warne Defense - 1st

Mark Spruyt Goalie -1st Joe Ghedina Midfi eld - 2nd1999 Brad Obloj Attack - 1st Doug Shanahan Midfi eld - 1st Joe Ghedina Midfi eld - 1st Kevin Warne Defense - 1st Joe Amplo Defense - 1st Mike Demeo Goalie - 1st Brian Spallina Midfi eld - 2nd Scott Dooley Midfi eld - 2nd (Rookie)2000 Tom Kessler Attack - 1st Joe Kostolansky Attack - 1st Brian Spallina Midfi eld - 1st Mike Demeo Goalie - 1st Doug Shanahan Midfi eld - 2nd Evan Kostewka Midfi eld - 2nd2001 Doug Shanahan Midfi eld - 1st (MVP) Tom Kessler Attack - 1st Mike Tierney Midfi eld - 2nd Nick Polanco Defense - 2nd

COLONIAL ATHLETIC ASSOCIATION ALL-STARS2002 Nicky Polanco Defense - 1st (Player of the Year & Defensive Player of the Year) Tom Kessler Attack - 1st Scott Dooley Attack - 2nd Evan LaPenna Defense - 2nd Jack Alaimo Goalie - 2nd2003 Joe Kostolansky Attack - 1st Mike Morrison Midfi eld - 1st Brian Zuchelli Defense - 1st Brett Moyer Defense - 2nd (Rookie of the Year) Jim Femminella Attack - 2nd Michael Allain Midfi eld - 2nd Matthew Southard Goalie - 2nd2004 Brett Moyer Defense - 1st Chris Unterstein Attack - 1st Ryan Vilar Midfi eld - 2nd2005 Brett Moyer Defense - 1st (Defensive Player of the Year) Athan Iannucci Attack - 1st Chris Unterstein Attack - 2nd Mike Unterstein Midfi eld - Rookie (Rookie of the Year) Kevin Unterstein Midfi elder - Rookie James Tuohy Goalie - Rookie2006 Chris Unterstein Attack - 1st (Player of the Year) Brett Moyer Defense - 1st (Defensive Player of the Year) Sean McCarthy Defense - 1st Athan Iannucci Attack - 1st John Keysor Midfi eld - 1st John Orsen Midfi eld - 1st Matt Southard Goal - 1st Tom Dooley Attack (Rookie of the Year)2007 Tom Dooley Attack - 2nd Adam Swarsen Defense - 2nd Kevin Unterstein Midfi eld - 2nd Michael Unterstein Midfi eld - 2nd2008 Kevin Unterstein Midfi eld - 1st (Defensive Player of the Year) Anthony Muscarella Midfi eld - 1st

Jay Card Attack - 2nd (Rookie of the Year) Michael Unterstein Midfi eld - 2nd Steve Prifte Midfi eld - 2nd2009 Jay Card Attack - 1st (Player of the Year) Michael Colleluori Midfi eld - 1st Christian Scuderi Defense - 1st Steven DeNapoli Midfi eld - 2nd Steve Prifte Defense - 2nd2010 Jay Card Attack - 1st Brad Loizeaux Midfi eld - 1st Jamie Lincoln Attack - 2nd Adam Mojica Midfi eld - 2nd Michael Skudin Defense - 2nd2011 Michael Skudin Defense - 1st (Defensive Player of the Year) John Antoniades Midfi eld - 1st Ian Braddish Midfi eld - 1st Jay Card Attack - 1st Adam Mojica Midfi eld - 1st Steve DeNapoli Midfi eld - 2nd Andrew Gvozden Goal - 2nd Jamie Lincoln Attack - 2nd

COLONIAL ATHLETIC ASSOCIATION ALL-TOURNAMENT TEAM2003 Joe Kostolansky Attack Brian Zuchelli Defense Bryan Walker Midfi eld2004 Athan Ianucci Attack Chris Unterstein Attack2005 Jon Edwards Defense Len Panarelli Midfi eld2006 Athan Iannucci Attack (Most Valuable Player) Tim Treubig Midfi eld Ryan Kelaher Defense Matt Southard Goal2007 Kevin Unterstein Midfi eld Julian Watts Defense2008 Kevin Unterstein Midfi eld (Most Valuable Player) Collin Stabler Defense Jack Vivonetto Defense Joe Montemurro Midfi eld2009 Steve DeNapoli Midfi eld2011 Michael Skudin Defense Steve DeNapoli Midfi eld

COLONIAL ATHLETIC ASSOCIATION ALL-ROOKIE TEAM2007 Tom Interlicchio Midfi eld Danny Orlando Goal Dan Stein Attack2008 Jay Card Attack (Rookie of the Year) Steve DeNapoli Midfi eld2009 Andrew Gvozden Goalie Kevin Ford Attack2010 John Antoniades Midfi eld Cody Solaja Defense Adrian Sorichetti Midfi eld

ALL-CONFERENCE SELECTIONS


HOFSTRA LACROSSE AWARD WINNERSHOFSTRA LACROSSE AWARD WINNERSRETIRED UNIFORMSJerry Simandl #10

Doug Shanahan #26

INTERNATIONAL WORLD TEAM MEMBERSJim Dobreff - 2002 (Sweden Coach)

Gerry Donaghy - 2002 (Scotland)

Michael Tierney - 2002 (Ireland)

Jack Kaley - 2002 (Germany Coach)

Jay Card - 2008 (Canada - Under 19)

TEWAARATON TROPHY (College Lacrosse Player of the Year)

Doug Shanahan - 2001

F. MORRIS TOUCHSTONE AWARD WINNER(USILA Division I Coach of the Year)

1970 - Howdy Myers

1993 - John Danowski

LT. RAY ENNERS AWARD WINNER(USILA Division I Player of the Year)


LT. DONALD MCLAUGHLIN AWARD WINNER(USILA Division I Midfi elder of the Year)


HOFSTRA LEAGUE CHAMPIONSHIPS1955 - Laurie Cox Division

1960 - Laurie Cox Division - Northwest

1961 - Laurie Cox Division - Northwest

1965 - Laurie Cox Division

1969 - Metropolitan Division




1988 - East Coast Conference

1989 - East Coast Conference

1995 - North Atlantic Conference

1996 - North Atlantic Conference

1997 - America East

1998 - America East

2000 - America East

2006 - Colonial Athletic Association

2008 - Colonial Athletic Association

USILA SCHOLAR-ATHLETE ALL-AMERICA TEAM1998 Mark Spruyt Goalie

2000 Brian Spallina Midfi eld

2003 Michael Allain Midfi eld

2005 Jon Edwards Defense

2005 Ryan Vilar Midfi eld

2006 Chris Unterstein Attack

2009 Michael Colleluori Midfi eld

2011 Michael Skudin Defense

AMERICA EAST CONFERENCESCHOLAR-ATHLETE OF THE YEAR AWARD2001 Lance Yeagle

Defense

COLONIAL ATHLETIC ASSOCIATION SCHOLAR-ATHLETE OF THE YEAR AWARD2003 Aaron Kozlowski

Defense

2011 Michael Skudin Defense

HOFSTRA NORTH-SOUTH ALL-STAR GAME COACHESHowdy Myers - North Head Coach 1957, North Assistant Coach 1953, 1962, 1974Harry Royle - North Assistant Coach 1984John Danowski - North Assistant Coach 1990

USILA NORTH-SOUTH GAME MOST VALUABLE PLAYER1975 - Phil Marino2001 - Doug Shanahan

2006 - Brett Moyer

CONFERENCE COACH OF THE YEAR AWARD1995 - John Danowski - North Atlantic Conference1996 - John Danowski - North Atlantic Conference2002 - John Danowski - Colonial Athletic Association2006 - John Danowski - Colonial Athletic Association2009 - Seth Tierney - Colonial Athletic

Association

THE JAMES ADAMS SPORTSMANSHIP AWARD(Presented by National Intercollegiate Lacrosse Offi cials Association)1994 - Hofstra University - Coach John

Danowski

THE JOSEPH “FRENCHY” JULIEN SPORTSMANSHIP AWARD(Presented by the Metropolitan New York Offi cials Association)1988 - Hofstra University - Coach John Danowski1989 - Hofstra University - Coach John Danowski1994 - Hofstra University - Coach John

Danowski

NCAA DIVISION I TOURNAMENT TEAMS1971 - First Round

1973 - First Round

1974 - First Round

1975 - First Round

1978 - First Round

1993 - Quarterfi nals

1996 - First Round

1997 - First Round


2000 - First Round


2003 - First Round


2008 - First Round

2009 - First Round

2010 - First Round

2011 - First Round

CONFERENCE SPECIAL AWARD WINNERS1988 Dave Giannone Goalie ECC Most Valuable Player1989 Michael LaCrosse Attack ECC Most Valuable Player1990 Michael Laudenslager Midfi eld ECC Most Valuable Player1995 Kevin Jacobs Attack NAC Most Valuable Player1996 Blake Miller Attack NAC Most Valuable Player1998 Brian Langtry Attack AEC Most Valuable Player Doug Shanahan Midfi eld AEC Rookie of the Year 1999 Scott Dooley Midfi eld AEC Rookie of the Year2001 Doug Shanahan Midfi eld AEC Most Valuable Player2002 Nicky Polanco Defense CAA Player of the Year Defensive Player of the Year2003 Brett Moyer Defense CAA Rookie of the Year2005 Brett Moyer Defense CAA Defensive Player of the Year Mike Unterstein Midfi eld CAA Rookie of the Year2006 Chris Unterstein Attack CAA Player of the Year Brett Moyer Defense CAA Defensive Player of the Year Tom Dooley Attack CAA Rookie of the Year2008 Kevin Unterstein Defense CAA Defensive Player of the Year Jay Card Attack CAA Rookie of the Year2009 Jay Card Attack CAA Player of the Year2011 Michael Skudin Defense CAA Defensive Player of the Year

1952 - 15th

1953 - 13th

1954 - 11th

1955 - 3rd

1956 - 11th

1957 - 13th

1958 - 9th

1959 - 14th

1960 - 14th

1961 - 15th

1962 - 13th

1965 - 18th

1969 - 14th

1970 - 10th

1971 - 10th

1972 - 20th

1973 - 5th

1974 - 7th

1975 - 6th

1976 - 10th

1977 - 13th

1978 - 7th

1983 - 9th

1984 - 11th

1988 - 13th

1989 - 14th

1990 - 19th

1991 - 16th

1993 - 11th

1994 - 20th

1995 - 17th

1996 - 12th

1997 - 12th

1998 - 14th

1999 - 8th

2000 - 10th

2001 - 11th

2002 - 6th

2003 -10th

2005 - 20th

2006 - 2nd

2008 - 16th

2009 - 10th

2010 - 14th

2011 - 13th

FINAL NATIONAL RANKINGS

012

LACROSSE


HOFSTRA LACROSSE AWARD WINNERSHOFSTRA LACROSSE AWARD WINNERSTHE STEVE CARLIN UNSUNG HERO AWARD1989 - Matt Cady - Defense

1990 - Joe Carrello - Midfi eld

1991 - Brian Donaghy - Defense

1992 - Scott Apgar - Midfi eld

1993 - Brian Holland - Midfi eld

1994 - Doug Altmansberger -

Defense

1995 - Chris Bergersen - Midfi eld

1996 - Jude Ehrbar - Defense

1997 - Karl Hedstrom - Goalie

1998 - Larry Kramer - Defense

1999 - Chris Korzonkiewicz -

Midfi eld

2000 - Ed Hilbert - Midfi eld

2001 - Gerry Donaghy - Midfi eld

2002 - Scott Dooley - Attack

2003 - Dave Sweeney - Midfi eld

2004 - Len Panarelli - Midfi eld

2005 - James Morgan - Midfi eld

2006 - Joe Mascaretti - Midfi eld

2007 - Julian Watts - Defense

2008 - Michael Unterstein - Midfi eld

2009 - Ryan Carter - Midfi eld

2010 - Isaac Neal - Defense

2011 - Tim Holman - Midfi eld

THE BENGT BARBACCIA AWARD1994 - Andy Carlson - Attack1995 - Doug Altmansberger - Defense1996 - Blake Miller - Attack 1997 - Rich Langtry - Midfi eld1998 - Armando Polanco - Defense1999 - Jay Artinian - Midfi eld2000 - David Neidhart - Goalie2001 - Ed Hilbert - Midfi eld2002 - Dave Sweeny - Defense2003 - Steve Izzo - Goalie2004 - Jon Edwards - Defense2005 - Len Panarelli - Midfi eld2006 - John Gorman - Midfi eld2007 - John Gorman - Midfi eld2008 - Anthony Muscarella - Midfi eld2009 - Jack Vivonetto - Defense2010 - Tom Interlicchio - Midfi eld2011 - Steve DeNapoli - Midfi eld

THE DAVID MCCARTNEY MEMORIAL ENDOWED SCHOLARSHIP2003 - James Morgan - Attack2004 - John Orsen - Midfi eld2005 - John Gorman - Defense2006 - Collin Stabler - Defense2007 - Kevin Unterstein - Midfi eld 2008 - Michael Unterstein - Midfi eld 2009 - Steven DeNapoli - Midfi eld

2010 - Sean Lucas - Midfi eld

2011 - Michael Skudin - Defense

USILA NORTH-SOUTH GAME ALL-STARSYear Player Position

1953 Vincent Vieten Defense

William Donnelly Midfi eld

Bob Rupp Attack

1954 Joseph Masone Attack

1955 Carl Orent Defense

Al Lahood Defense

Jerry Simandl Attack

1956 Gary Boyle Attack

John Stranahan Midfi eld

1957 Marco Gazich Defense

1958 Paul Sullivan Attack

George Wiemer Midfi eld

Al Vadnais Defense

1960 Jack Kaley Midfi eld

Richard Vielkanowitz Goal

Frank Mauro Defense

1961 Frank Cozart Attack

William Heiser Midfi eld

1962 Tim Gannon Midfi eld

Peter Trizzino Goal

Rich Schrage Defense

1963 Phil Avillo Midfi eld

1966 Phil Mordente Attack

1968 Frank Marcinowski Defense

Mike D’Amato Attack

1970 Don DiBlasi Defense

Tom Leonas Midfi eld

1971 Bill Hanlon Midfi eld

1973 Bill Reid Midfi eld

Bob Auguste Midfi eld

1974 Doug Nastro Attack

Bob Rullan Defense

Chris Deeks Defense

1975 Phil Marino Attack (MVP)

Tom Calder Midfi eld

1976 Robert Guido Midfi eld

1977 Joe Taylor Midfi eld

1978 Kevin Huff Midfi eld

1979 Bob Gilmartin Midfi eld

1980 Ed Wallace Defense

1983 Bob Quinlan Midfi eld

1984 Mikko Red Arrow Midfi eld

1986 Dave McCulloch Midfi eld

1989 Steve Walakovits Attack

Michael Magee Midfi eld

1990 Dave Giannone Goal

1991 Michael Laudenslager Midfi eld

Gary Rinaldi Attack

1993 Michael Ricigliano Midfi eld

Anthony Bellomo Defense

1994 Andy Carlson Attack

1995 Doug Altmansberger Defense

Kevin Jacobs Midfi eld

1996 Vince Hannigan Midfi eld

Kevin Johnson Goal

Blake Miller Attack

1997 Rich Langtry Midfi eld

Ryan Grimes Defense

1998 Mark Spruyt Goal

Brian Langtry Attack

1999 Brad Obloj Attack

Joe Ghedina Midfi eld

2000 Bob Parrinelli Defense

Brian Spallina Midfi eld

2001 Doug Shanahan Midfi eld

(MVP)

Michael Tierney Midfi eld

2002 Tom Kessler Attack

Nicky Polanco Defense

2003 Michael Allain Midfi eld

Jim Femminella Attack

2005 Jon Edwards Defense

Ryan Vilar Midfi eld

2006 Brett Moyer Defense (MVP)

Chris Unterstein Attack

2008 Kevin Unterstein Midfi eld

Michael Unterstein Midfi eld

2009 Michael Colleluori Midfi eld

Anthony Muscarella Midfi eld

2010 Christian Scuderi Defense

Dan Stein Midfi eld

2011 Jay Card Attack

Steve DeNapoli Midfi eld

Michael Skudin Defense

2006 fi rst team All-Americans Chris Unter-stein and Brett Moyer (Game MVP) after the North-South Senior All-Star Game

MIKE SKUDIN

TIM HOLMAN

2012

LACROSS

STEVE DENAPOLI


HOFSTRA LACROSSE IN THE PROSHOFSTRA LACROSSE IN THE PROS

National Lacrosse League (NLL) and North American Lacrosse League (NALL)

National Lacrosse League (NLL)Active PlayersBrian Langtry - New York Saints, Colorado Mammoth (2003 NLL Rookie of the Year)Brett Moyer - Philadelphia WingsJohn Orsen - New York Titans, Orlando TitansChristian Scuderi - Philadelphia WingsMichael Unterstein - Kentucky Stick Horse’s (NALL)

All-Time PlayersAnthony Alexander - New York SaintsRamar Clash - New York SaintsJoe Ghedina - New York Saints, Anaheim Storm, New York TitansKevin Huff - New York SaintsAthan Iannucci - Philadelphia Wings (2008 NLL Most Valuable Player)Brian Langtry - New York Saints, Colorado Mammoth (2003 NLL Rookie of the Year)Michael Laurano - New Jersey Storm, Anaheim StormDave McCulloch - New York SaintsMike McGinley - New York SaintsBlake Miller - New York Saints, New Jersey Storm, Anaheim Storm, Rochester Knighthawks, New York TitansBrett Moyer - Philadelphia WingsJohn Orsen - New York TitansChris Panos - Boston Blazers, Baltimore Thunder, New York Saints, Buffalo Bandits, Philadelphia Wings, Calgary Roughnecks, Anaheim Storm, Arizona Sting, Colorado Mammoth, Chicago ShamroxArmando Polanco - New York SaintsNicky Polanco - New York Saints, New York TitansMikko Red Arrow - New York SaintsChristian Scuderi - Philadelphia WingsDoug Shanahan - New York SaintsVinnie Sombrotto - New York SaintsBrian Spallina - New York SaintsJarred Testa - New York Saints, Washington PowerKevin Unterstein - Colorado MammothMichael Unterstein - Kentucky Stick Horse’s (NALL)

INDOOR PLAYERSINDOOR PLAYERS

BRIAN LANGTRY

CHRIS PANOS

ATHAN IANNUCCI

BLAKE MILLER

012

LACROSSE


INDOOR PLAYERSHOFSTRA LACROSSE IN THE PROSHOFSTRA LACROSSE IN THE PROS

(The following Hofstra Lacrosse alumni have been on the rosters of Major League Lacrosse (MLL) teams)

Major League Lacrosse (MLL)Active PlayersJay Card - Long Island LizardsSteven DeNapoli - Chesapeake BayhawksAthan Iannucci - Toronto Nationals Brian Langtry - Long Island Lizards, Baltimore Bayhawks, Rochester Rattlers, Denver OutlawsSean McCarthy - Denver OutlawsBlake Miller - Bridgeport Barrage, Philadelphia Barrage, Long Island LizardsAnthony Muscarella - Long Island LizardsJohn Orsen - Long Island LizardsNicky Polanco - Bridgeport Barrage, Philadelphia Barrage, Long Island LizardsChristian Scuderi - Long Island LizardsMichael Skudin - Long Island Lizards Brian Spallina - Long Island Lizards, Philadelphia Barrage, Long Island Lizards, Chesapeake BayhawksKevin Unterstein - New Jersey Pride, Denver Outlaws, Long Island LizardsMichael Unterstein - Long Island LizardsJulian Watts - Los Angeles RipTide, Long Island Lizards

All-Time PlayersTony Alexander - Long Island LizardsJoe Astarita - Long Island LizardsRob Bonaguro - Long Island LizardsJay Card - Long Island LizardsRamar Clash - Long Island LizardsSteven DeNapoli - Chesapeake BayhawksScott Dooley - New Jersey Pride, Chicago MachineJim Femminella - Boston CanonsJoe Ghedina - Long Island Lizards, New Jersey PrideAthan Iannucci - Toronto Nationals, Chicago Machine Tom Kessler - Baltimore Bayhawks, Bridgeport Barrage, Philadelphia Barrage, Long Island LizardsJohn Keysor - San Francisco Dragons, Baltimore BayhawksJoe Kostolansky - Rochester Rattlers, Boston Canons, San Francisco DragonsBrian Langtry - Long Island Lizards, Baltimore Bayhawks, Bridgeport Barrage, Denver OutlawsEvan LaPenna - Bridgeport BarrageJoe Mascaretti - Long Island LizardsSean McCarthy - Denver OutlawsBlake Miller - Bridgeport Barrage, Philadelphia Barrage, Long Island LizardsBrett Moyer - Philadelphia BarrageAnthony Muscarella - Long Island LizardsJohn Orsen - Long Island LizardsArmando Polanco - Philadelphia Barrage

Nicky Polanco - Bridgeport Barrage, Philadelphia Barrage, Long Island LizardsPaul Rao - Bridgeport Barrage, Long Island LizardsChris Rogler -Bridgeport Barrage, Philadelphia BarrageChristian Scuderi - Long Island LizardsMichael Skudin - Long Island Lizards Brian Spallina - Long Island Lizards, Philadelphia Barrage, Long Island LizardsDoug Shanahan - Bridgeport Barrage, Philadelphia Barrage, Chicago Machine, Long Island LizardsVinnie Sombrotto - Long Island LizardsMark Spruyt - Bridgeport Barrage, Rochester RattlersJarred Testa - Baltimore Bay Hawks, Denver Outlaws (Head Coach), Washington Bayhawks (Head Coach)Tim Treubig - San Francisco Dragons, New Jersey PrideChris Unterstein - Boston Canons, Denver Outlaws, New Jersey Pride, Rochester Rattlers, Long Island LizardsKevin Unterstein - New Jersey Pride, Long Island Lizards

Michael Unterstein - Denver Outlaws, Long Island Lizards Julian Watts - Los Angeles RipTide, Long Island Lizards

OUTDOOR PLAYERSOUTDOOR PLAYERS

JOE KOSTOLANSKY

DOUG SHANAHAN

COACH JARRED TESTA

NICKY POLANCO

CHRIS ROGLER

JOHN ORSEN

CHRIS UNTERSTEIN

BLAKE MILLER

JOE GHEDINA

BRIAN SPALLINA

2012

LACROSS


NATIONAL TEAM ALUMNINATIONAL TEAM ALUMNIHofstra has had 10 alumni play or coach on a United States World Team. In 2006 three former Pride lacrosse players were members of the United States National Lacrosse Team at the 2006 International Lacrosse Federation World Championship in Hamilton, Ontario, Canada. Attackman Blake Miller ’96, midfi elder Doug Shanahan ’01 and defenseman Nicky Polanco ’02 all played key roles in the United States’ silver medal fi nish. Shanahan scored eight goals, added three assists and scooped up a team-high 27 ground balls in seven games at the World Championship, while Miller added four goals and two assists, and Polanco, the team’s key defender, picked up 10 ground balls.

Miller and Shanahan were making their second appearance on the U.S. National Team, while Polanco was a fi rst-time selection after

serving as an alternate in 2002.

The complete list of Hofstra’s U.S. Team members is as follows:Jack Kaley - 1974 (Assistant Coach)Phil Marino - 1978Vin Sombrotto - 1982, 1986, 1990, 1994Rich Garguilo - 1992 (Under 19)Kevin Jacobs - 1992 (Under 19) Blake Miller - 1998, 2006Evan Kostewka - 1998 (Under 19)Doug Shanahan - 2002 (MVP), 2006Nicky Polanco - 2002 (Alternate), 2006Brett Moyer - 2003 (Under 19)

The Pride has had three players named to the United States National Indoor Team, which competed in the 2011 World Indoor Lacrosse Championship in May. The World Indoor Lacrosse Championship took place at Telsa Arena in Prague, Czech Republic, on May 21-28, 2011. Australia, Canada, Czech Republic, England, Finland, Ireland and the Iroquois Nationals joined the United States in the one-week tournament with the U.S. placing third behind Canada and the Iroquois Nationals. Hofstra’s representatives were:

John OrsenBrian LangtryChris Panos

In addition to Hofstra’s connection with the U.S. World and National Teams, the Pride has been well represented as coach or player for foreign teams. The most recent is Jay Card, who was named to Canada’s U-19 National Team in 2008. The complete list as follows:

Jim Dobreff - 2002 (Sweden Coach)Gerry Donaghy - 2002 (Scotland)Michael Tierney - 2002 (Ireland)Jack Kaley - 2002 (Germany Coach)Jay Card - 2008 (Canada Under 19)

NICKY POLANCO

BLAKE MILLER

DOUG SHANAHAN

VIN SOMBROTTO

012

LACROSSE


COACHING ALUMNICOACHING ALUMNI

Chris Bergersen* MacArthurDennis Bonn* Cold Spring HarborBrian Casey School of the CathedralBob Cavaliero Trinity Catholic, Greenwich, KingEd Danowski SeafordSteve Dauses Perry HallChris Deeks Floral ParkSteven DeNapoli Hewlitt Mike Demeo* ChaminadeDon DiBlasi Our Lady of Mt. CarmelLou DiBlasi HHHEDom Dinardo* Corning EastScott Dooley RyeJon Edwards* Calvert HallGerry Fay* ChaminadeJim Femminella Bellmore-JFKCraig Flynn Billerica (MA)Joe Fowler* NYC EmpireRich Garguilo* BaldwinJohn Gorman* South Side

Adam Hananel* East MeadowKarl Hedstrom Garden City Kevin Huff* Eastport-South Manor, Smithtown East and West, SyossetTom Kessler Bergen CatholicJack Kort Walt WhitmanJoe Kostolansky Marin Catholic (CA)Aaron Kozlowski* North ShoreLarry Kramer* Severna Park (MD)Bill Laky UniondaleMike Lambrecht Monte Vista (CA)Brian Langtry* Cherrry Creek (CO) Rich Langtry MacArthurRyan Lucas* OceansideHank Lunde HempsteadJay Lupetin MephamMike Magee* HicksvilleSean McCarthy* Heritage (CO)Keith Mekeel* WantaghBlake Miller Greenwich, DarienRay Mills* Wyandanch

Brad Obloj PlainviewTerry O’Connor MephamLen Panarelli* FarmingdaleJason Pearl* Long BeachRich Petillo* Sachem NorthTony Petillo* BellportBob Quinlan Levittown DivisionBob Rao* Island TreesChris Rogler* Plainview-JFKDan Royle* Long BeachPaul Sanit* Poway (CA)Doug Shanahan* Pine Crest (FLA)Eric Spallina* UniondaleMark Spruyt* East IslipJoe Taylor Westhampton BeachMike Tierney* Deer ParkBryan Walker* Garden CityGary Allen Wellner Ledyard Ron Zoia Macarthur, Division

The Hofstra Lacrosse program has produced more than 50 players who have gone on to coach the sport at the professional, collegiate and scholastic level. Here is a list of Hofstra alumni that have pursued careers in the coaching ranks.

ProfessionalJared Testa Washington Bayhawks (MLL), Denver OutlawsVinny Sombrotto LI Lizards

Joe Amplo* Hofstra, MarquetteGary Arnold HofstraPhil Avillo YorkSteve Banaletti HartfordJ.P. Brazel* Delaware, HofstraTom Calder Roanoke, UNCBob Cavaliero HofstraVinnie Daniels* NYUPat Debolt* Ohio StateBob Demarco RutgersAndris Dikmanis VermontTim Gannon Hofstra, WilliamsTom Gill* Kings PointDon Hannington Hofstra, ColgateKarl Hedstrom* NYITBill Heiser KenyonBob Hiller North Carolina StateKevin Huff Hofstra/SCCCKevin Johnson BrownJack Kaley New York TechJoe Kostolansky* Arizona State, VermontRenzie Lamb Williams

Brian Langtry DowlingRich Langtry DowlingEvan LaPenna WhittierTom Leanos* DrewJoe Mascaretti Nassau CCJames Morgan* WhittierBrett Moyer Kings PointAnthony Muscarella* NYITChet O’Neil Hofstra, Colgate, HarvardJohn Orsen* MarquetteBill Reid Hampden-SydneyBob Rullan C.W. PostBrian Schneider YaleBrian Spallina AdelphiScott Sullivan* MuhlenbergDave Sweeney WesleyJared Testa UMBCMike Tierney Kings PointChris Unterstein Kings PointKevin Unterstein* Denver, Princeton, HofstraKevin Warne* MarylandGary Allen Wellner Mitchell College

High School Varsity

PAT DEBOLT

BRIAN LANGTRY

JOE AMPLO

MARK SPRUYTTOM SHUEY High School JuniorVarsityKevin Baudo Port WashingtonMatt Cady* East MeadowPaul Defendini FarmingdaleJim Dobreff Grosse Point South, Detroit Country DayGeorge Kay William FloydTommy Shuey* Highland ParkPhil Vangeli* River HillBrian Zuchelli* Half Hollow Hills

*Active

KEVIN WARNE

BRIAN SPALLINA

College

2012

LACROSS

2


Opponent Won-Lost First Meeting Last Hofstra Win Last Opponent WinAdelphi 16-14 1963 1983 - 12-6 1989 - 10-15Air Force 8-0 1970 2011 - 11-6 NoneArmy 17-37 1955 2010 - 17-2 2008 - 7-8Baltimore 10-15 1952 1983 - 15-6 1972 - 2-4Binghamton 3-0 2003 2005 - 7-5 NoneBoston College 1-0 1979 1979 - 13-6 NoneBowdoin 4-0 1965 1968 - 18-6 NoneBrown 13-11 1976 2010 -15-12 2007 - 6-7Bucknell 3-1 1987 1990 - 15-11 1987 - 13-15CCNY 7-0 1950 1971 - 1-0 NoneCCNY (LC) 1-0 1952 1952 - 10-1 NoneColgate 3-0 1960 2011 - 6-3 NoneCornell 1-6 1972 2003 - 13-5 2009 - 8-11 Cortland State 7-0 1951 1972 - 5-4 NoneDartmouth 5-2 1951 1979 - 12-10 1953 - 4-6Delaware 23-12 1951 2010 - 12-11 2011 - 9-10Denison 0-1 1963 None 1963 - 2-4Drexel 21-3 1986 2011 -11-6 2010 - 11-13Duke 6-0 1956 2003 - 9-8 NoneFairfi eld 2-0 2002 2011 - 8-7 NoneFairleigh Dickinson 5-0 1969 1973 - 15-3 NoneGeorgetown 1-3 1994 1994 - 13-10 1997 - 5-18Gettysburg 1-0 1959 1959 - 19-2 NoneHartford 6-0 1995 2001 - 21-9 NoneHarvard 9-8 1951 2011 - 15-9 1996 - 12-15Hobart 9-8 1959 1973 - 13-9 1988 - 10-15Jacksonville 1-0 2010 2010 - 14-10 NoneJohns Hopkins 5-19 1974 2010 -14-6 2011 - 5-12Lafayette 17-0 1949 2007 - 9-3 NoneLehigh 5-0 1986 1990 - 22-7 NoneLIU-C.W. Post 15-8 1963 1990 - 14-5 1987 - 7-8Loyola 14-12 1956 2004 - 9-8 2003 - 4-10Manhasset 1-1 1951 1952 - 14-6 1951 - 3-4Manhattan 2-0 2010 2011 - 13-8 NoneMaryland 1-9 1949 1984 - 10-7 2010 - 8-11Maryland-Balt. Co. 3-1 1988 1991 - 12-8 1992 - 12-15Massachusetts 17-19 1974 2011 - 14-5 2010 - 9-11MIT 12-1 1958 1973 - 24-3 1967 -8-11Michigan State 2-0 1988 1994 - 14-5 NoneMiddlebury 2-0 1955 1967 - 9-2 NoneMilburn (LC) 3-0 1952 1954 - 11-1 NoneMontclair State 0-2 1950 None 1951 - 4-6Mt. Washington (LC) 0-7 1953 None 1961 - 0-7Morgan State 2-0 1971 1972 - 10-4 NoneNavy 6-13 1965 1999 - 15-7 1985 - 9-20New England (LC) 1-0 1949 1949 - 7-3 NoneNew Hampshire 17-2 1955 1997 - 10-3 1978 - 10-11New York Tech 5-0 1974 1978 - 23-4 NoneNorth Carolina 6-3 1978 2006 - 6-5 2009 - 8-13North Carolina State 1-0 1980 1980 - 17-15 NoneNotre Dame 7-6 1991 2006 - 13-5 2005 - 8-9 (2 OT)Ohio State 1-0 1987 1987 - 15-4 NonePenn State 9-5 1955 2011 - 9-4 2010 - 10-11 (OT)Pennsylvania 5-13 1970 1976 - 10-9 1987 - 5-13Philadelphia (LC) 1-0 1953 1953 - 12-3 NonePrinceton 13-11 1972 2011 - 11-9 2010 - 14-17Providence 4-0 1993 2006 - 14-8 NoneRadford 1-0 1992 1992 - 17-7 NoneRobert Morris 4-0 2006 2009 - 11-5 NoneR.P.I. 7-2-1 1956 1965 - 15-6 1961 - 4-5Rutgers 14-15 1955 1999 - 15-6 1995 - 11-14Sacred Heart 10-0 2002 2011 - 10-6 NoneSt. John’s 11-2 1983 2011 - 8-5 1992 - 7-9Saint Joseph’s 1-0 2011 2011 - 11-3 NoneStevens Tech 2-0 1951 1952 - 8-2 NoneStony Brook 4-2 2004 2009 - 12-11 2007 - 12-13 (OT)Syracuse 4-12 1960 2003 - 8-6 2001 - 13-18Towson 24-18 1961 2011 - 12-5 2007 - 5-11Trinity 4-0 1950 1953 - 20-1 NoneTufts 2-0 1953 1955 - 21-1 NoneUnion 2-2 1951 1955 - 20-2 1954 - 6-7Vermont 8-0 1993 2001 - 16-7 NoneVillanova 8-5 1988 2009 -10-3 2009 - 7-9Virginia 4-11 1957 2001 - 15-14 (OT) 1992 - 5-17Washington (MD) 9-10 1949 1973 - 13-5 1972 - 5-9Washington & Lee 15-4 1956 1980 - 7-6 (OT) 1982 - 10-19Western Maryland 2-1 1949 1952 - 16-0 1949 - 8-17Williams 6-3 1953 1964 - 14-7 1965 - 5-11Yale 4-8 1952 1995 - 10-9 1994 - 5-8

O t W L t Fi t M ti L t H f t Wi L t O t Wi

HOFSTRA LACROSSE SERIES RECORDS HOFSTRA LACROSSE SERIES RECORDS (1949-2011)(1949-2011)

012

LACROSSE


YEAR-BY-YEAR TEAM STATISTICSYEAR-BY-YEAR TEAM STATISTICS(1949-2011)(1949-2011)

Year Record GF GPGF GA GPGA COACH1949 2-4 38 6.3 67 11.1 Al Brisotti1950 3-4 44 6.3 52 7.4 Howdy Myers1951 4-7 61 5.5 73 6.6 Howdy Myers1952 12-2-1 160 10.7 56 3.7 Howdy Myers1953 11-3 167 12.8 52 4.0 Howdy Myers1954 9-4 134 10.4 68 5.2 Howdy Myers1955 14-2 247 15.4 55 3.4 Howdy Myers1956 8-5-1 125 8.9 89 6.4 Howdy Myers1957 8-5 118 9.1 87 6.7 Howdy Myers1958 8-3 126 11.5 94 8.5 Howdy Myers1959 5-7 93 7.8 106 8.8 Howdy Myers1960 7-4 89 8.1 68 6.2 Howdy Myers1961 7-7 112 8.0 126 9.0 Howdy Myers1962 10-3 73 7.3 59 5.9 Howdy Myers1963 5-11 62 3.9 91 5.7 Howdy Myers1964 6-9 105 7.0 107 7.1 Howdy Myers1965 9-6 142 9.5 144 9.6 Howdy Myers1966 7-9-1 121 7.1 145 8.5 Howdy Myers1967 7-8 117 7.8 129 8.6 Howdy Myers1968 7-5-1 118 9.1 87 6.7 Howdy Myers1969 8-6 125 8.9 97 6.9 Howdy Myers1970 12-5 162 10.1 68 4.3 Howdy Myers1971 12-4 153 10.2 107 7.1 Howdy Myers1972 5-11 105 6.6 97 6.1 Howdy Myers1973 12-2 176 12.6 95 6.8 Howdy Myers1974 9-3 138 11.5 98 8.2 Howdy Myers1975 10-3 152 11.7 125 9.6 Howdy Myers1976 7-4 114 10.4 108 9.8 Harry Royle1977 7-5 105 8.8 88 7.3 Harry Royle1978 8-5 128 9.8 121 9.3 Harry Royle1979 6-6 145 12.1 140 11.7 Harry Royle1980 7-6 150 11.5 151 11.6 Harry Royle1981 3-8 92 8.4 116 10.5 Harry Royle1982 3-10 121 9.3 168 12.9 Harry Royle1983 9-5 163 11.6 115 8.2 Harry Royle1984 8-6 136 9.7 117 8.4 Harry Royle1985 3-11 147 10.5 191 13.6 Harry Royle1986 4-9 127 9.8 196 15.1 John Danowski1987 7-9 154 9.6 175 10.9 John Danowski1988 12-3 191 12.7 135 9.0 John Danowski1989 11-4 204 13.6 142 9.5 John Danowski1990 9-5 191 13.6 141 10.1 John Danowski1991 7-7 169 12.1 195 13.9 John Danowski1992 4-9 109 8.4 143 11.0 John Danowski1993 10-6 168 10.5 152 9.5 John Danowski1994 6-7 147 11.3 129 9.9 John Danowski1995 9-5 164 11.7 136 9.7 John Danowski1996 9-5 169 12.1 161 11.5 John Danowski1997 9-6 115 7.7 104 6.9 John Danowski1998 10-4 184 13.1 118 8.4 John Danowski1999 13-3 185 11.6 124 7.8 John Danowski2000 11-5 212 13.3 145 9.1 John Danowski2001 10-7 229 13.5 190 11.2 John Danowski2002 11-3 178 12.7 107 7.6 John Danowski2003 11-6 159 9.3 161 9.4 John Danowski2004 4-10 117 8.4 147 10.5 John Danowski2005 8-8 138 8.6 131 8.1 John Danowski2006 17-2 239 12.5 125 6.5 John Danowski2007 6-8 110 7.9 101 7.2 Seth Tierney2008 10-6 150 9.2 138 8.4 Seth Tierney2009 11-4 142 9.3 129 8.5 Seth Tierney2010 9-5 181 12.9 126 8.9 Seth Tierney2011 13-3 159 9.9 105 6.6 Seth Tierney

Hofstra University All-Time Coaching Records (1949-2010)

Coach Years Gms. Won Lost Tied Pct.

Hofstra University All-Time Coaching Records (1949-2011)Coach Years Gms. Won Lost Tied Pct.1) Seth Tierney 2007-pres. 75 49 26 0 .6532) John Danowski 1986-06 315 192 123 0 .6103) Howdy Myers 1950-75 359 216 139 4 .6074) Harry Royle 1976-85 113 58 55 0 .5135) Al Brisotti 1949 6 2 4 0 .333Total 63 years 868 517 347 4 .598

2012

LACROSS


HOFSTRA ALL-TIME LACROSSE RESULTS(1949-2011)HOFSTRA ALL-TIME LACROSSE RESULTSHOFSTRA ALL-TIME LACROSSE RESULTS(1949-2011)(1949-2011)

012

LACROSSE 1949

Coach: Al Brisotti Record: 2-4

Washington (MD) 1-16 LWestern Maryland 8-17 LMaryland 1-17 LNew England 8-3 WLafayette 17-6 WAdelphi 3-8 L

1950Coach: Howdy Myers Record: 3-4

CCNY 5-15 LLafayette 14-2 WWestern Maryland 6-3 WMontclair 4-11 LAdelphi 4-14 LCortland 4-6 L Trinity 7-1 W


Montclair 4-6 LDelaware 3-7 LWashington (MD) 2-10 LHarvard 3-10 LDartmouth 4-7 LManhasset 3-4 LCCNY 4-5 LStevens Tech 4-1 WUnion 9-12 L (OT)Trinity 11-1 WCortland 5-4 WLafayette 9-6 W

1952Coach: Howdy Myers Record: 12-2-1 (15th ranked)

Manhasset 14-6 WHarvard 4-4 TCCNY L.C. 10-1 WCCNY 6-2 WBaltimore 6-8 LWestern Maryland 16-0 WDelaware 8-5 WUnion 5-4 WCortland 23-0 WTrinity 7-1 WCCNY 14-2 WYale 4-10 LMilburn L.C. 11-7 WStevens Tech. 8-2 WLafayette 24-4 W

1953Coach: Howdy Myers Record: 11-3 (13th ranked)

Philadelphia L.C. 12-3 WMt. Washington L.C. 4-17 LDartmouth 4-6 LWashington (MD) 10-4 WTufts 19-4 WDelaware 19-0 WYale 2-9 LUnion 20-11 WCortland 10-2 WCCNY 24-1 WBaltimore 5-4 WTrinity 20-1 WWilliams 4-3 WMilburn L.C. 17-4 W


Mt. Washington L.C. 3-15 LDartmouth 7-6 WBaltimore 4-7 LNew Hampshire 14-5 WWashington 5-8 LRutgers 8-7 WCCNY 17-2 WYale 10-5 WCortland 18-2 WDelaware 19-3 WWilliams 13-0 WUnion 6-7 LMilburn L.C. 11-1 W

1955Coach: Howdy Myers Record: 14-2 (3rd ranked)

Mt. Washington L.C. 7-13 LOhio State 20-1 WDartmouth 19-5 WMiddlebury 20-1 WTufts 21-1 WNew Hampshire 12-0 WArmy 7-8 LPenn St. 13-3 WWashington Coll. 16-2 WYale 6-3 WDelaware 19-1 WUnion 20-2 WWilliams 16-1 WBaltimore 15-4 WCortland 20-4 WRutgers 16-6 W

1956Coach: Howdy Myers Record: 8-5-1 (11th ranked)

Dartmouth 6-4 WNew Hampshire 6-3 WHarvard 13-7 WPenn State 3-9 LWashington & Lee 9-6 WDuke 11-1 WWashington (MD) 14-16 L (2 OT)Yale 6-8 LLoyola (MD) 8-3 WRPI 7-7 TWilliams 17-2 WArmy 4-8 LCortland 14-3 WBaltimore 13-18 L


HOFSTRA ALL-TIME LACROSSE RESULTS(1949-2011)HOFSTRA ALL-TIME LACROSSE RESULTSHOFSTRA ALL-TIME LACROSSE RESULTS(1949-2011)(1949-2011)

2012

LACROSS


Swathmore 7-5 WMIT 20-1 WDartmouth 16-10 WNew Hampshire 6-3 WWashington & Lee 9-4 WWashington (MD) 8-10 LPenn State 11-7 WVirginia 5-8 LRPI 3-10 LArmy 2-14 LLoyola (MD) 13-0 WBaltimore 6-13 LDuke 12-2 W


MIT 25-2 WHarvard 16-5 WWashington & Lee 10-9 WPenn State 13-2 WNew Hampshire 7-5 WMt. Washington L.C. 6-15 LRPI 11-7 WWashington (MD) 11-10 WArmy 1-15 LLoyola (MD) 17-3 WBaltimore 8-21 L

1959 Coach: Howdy Myers Record: 5-7 (14th ranked)

New Hampshire 4-3 WHarvard 4-5 LWashington & Lee 5-6 LMt. Washington L.C. 4-11 LRPI 11-10 WBaltimore 1-13 LWashington (MD) 7-8 LHobart 10-5 WLoyola (MD) 15-1 WWilliams 9-15 LGettysburg 19-2 WArmy 4-27 L


Hobart 6-1 WWashington & Lee 11-4 WNew Hampshire 13-4 WColgate 9-6 WMt. Washington L.C. 1-12 LSyracuse 9-11 LWashington (MD) 7-5 WArmy 2-11 LBaltimore 6-8 LLoyola (MD) 11-5 WRPI 14-1 W


Baltimore L.C. 4-16 LMt. Washington L.C. 8-21 LWashington & Lee 13-8 WNew Hampshire 9-4 WHarvard 6-18 LColgate 7-4 WSyracuse 7-6 WBaltimore 2-20 LWashington (MD) 0-7 LArmy 2-10 LLoyola (MD) 19-2 WTowson State 14-2 WRPI 4-5 LAdelphi 17-3 W


MIT 8-4 WWashington & Lee 6-3 WHarvard 4-10 LNew Hampshire 6-4 WLoyola (MD) 8-4 WBaltimore 7-9 LRutgers 10-9 WWilliams 8-2 WTowson State 12-2 WRPI 11-2 WAdelphi 7-3 WWashington (MD) 6-5 WArmy 0-17 L


MIT 5-3 WWashington & Lee 12-1 WHarvard 1-5 LDenison 2-4 LBaltimore 3-12 LNew Hampshire 2-3 LWashington (MD) 2-4 LHobart 7-2 WRutgers 8-13 LTowson State 3-6 LLIU-C.W. Post 4-3 WLoyola (MD) 3-4 LRPI 7-4 WAdelphi 2-7 LArmy 2-10 LWilliams 2-10 L


Washington & Lee 4-8 LNew Hampshire 4-2 WMIT 7-0 WArmy 1-8 LAdelphi 10-3 WSyracuse 6-12 LHobart 7-10 LWashington (MD) 6-8 LTowson State 14-1 WRutgers 4-12 LLIU-C.W. Post 4-6 LWilliams 14-7 WRPI 11-9 WBaltimore 9-12 LLoyola (MD) 4-9 L


HOFSTRA ALL-TIME LACROSSE RESULTSHOFSTRA ALL-TIME LACROSSE RESULTS(1949-2011)(1949-2011)

012

LACROSSE

012

LACROSSE 1965

Coach: Howdy Myers Record: 9-6 (18th ranked)

Bowdoin 12-0 WMIT 12-3 WArmy 4-20 LNew Hampshire 10-4 WSyracuse 10-9 WLoyola (MD) 5-6 LRutgers 8-16 LLIU-C.W. Post 17-6 WHobart 8-7 WWashington & Lee 17-11 WNavy 2-19 LWashington (MD) 4-15 LWilliams 5-11 LAdelphi 13-11 WRPI 15-6 W

1966Coach: Howdy Myers Record: 7-9-1

Virginia 6-3 WWashington & Lee 11-3 WBowdoin 11-2 WMIT 9-8 WArmy 3-14 LHarvard 7-14 LNew Hampshire 11-11 TSyracuse 6-10 LHobart 5-10 LRutgers 5-15 LAdelphi 10-5 WBaltimore 4-8 LNavy 2-11 LLoyola (MD) 9-7 WWashington (MD) 9-10 LDelaware 6-9 LLIU-C.W. Post 10-5 W


Washington & Lee 13-5 WBowdoin 15-4 WNew Hampshire 11-3 WMIT 8-11 LHarvard 5-9 LMiddlebury 9-2 WHobart 7-6 WRutgers 3-13 LArmy 4-19 LAdelphi 12-9 WSyracuse 3-6 LBaltimore 7-8 LWashington (MD) 3-16 LLoyola (MD) 9-7 LLIU-C.W. Post 8-11 L

1968Coach: Howdy Myers Record: 7-5-1

Bowdoin 18-6 WMIT 18-1 WWashington & Lee 6-2 WHobart 12-5 WNew Hampshire 9-2 WRutgers 2-11 LArmy 4-12 LAdelphi 9-4 WSyracuse 6-10 LWashington (MD) 8-8 TBaltimore 5-7 LLoyola (MD) 13-8 LLIU-C.W. Post 8-11 L

1969 Coach: Howdy Myers Record: 8-6 (14th ranked)

MIT 15-8 WHobart 9-10 LNew Hampshire 9-2 WRutgers 8-6 WBaltimore 3-9 LArmy 2-15 LAdelphi 20-5 WSyracuse 4-9 LFairleigh Dickinson 6-5 WNavy 0-11 LWashington (MD) 6-5 WLIU-C.W. Post 6-8 LCCNY 15-1 WLoyola (MD) 22-3 W


Loyola (MD) 13-4 WPennsylvania 5-3 WNew Hampshire 12-4 WMIT 11-4 WHobart 16-2 WCCNY 27-0 WRutgers 9-10 LYale 3-6 LArmy 2-9 LAdelphi 10-2 WAir Force 9-3 WFairleigh Dickinson 8-3 WNavy 4-9 LWashington (MD) 1-0 W**Baltimore 11-3 WLIU-C.W. Post 16-2 WVirginia 3-4 L**forfeit


3/27 Pennsylvania 6-2 W4/1 MIT 23-3 W4/3 Hobart 11-7 W4/7 CCNY 1-0 W**4/10 Rutgers 15-3 W4/14 Yale 9-5 W4/17 Army 10-15 L4/21 Washington (MD) 13-2 W4/24 Fairleigh Dickinson 8-4 W4/30 Morgan State 16-7 W5/1 Navy 5-8 L5/8 Baltimore 9-4 W5/12 Adelphi 7-6 W5/15 Virginia 6-12 L5/19 LIU-C.W. Post 12-11 W (OT)Army (NCAA) 3-19 L**forfeit


Cornell 3-5 LPennsylvania 3-6 LWashington (MD) 5-9 LMIT 21-4 WHobart 3-4 LLIU-C.W. Post 14-3 WRutgers 3-4 LTowson State 6-11 LArmy 8-9 L (OT)Princeton 5-8 LCortland 5-4 WFairleigh Dickinson 8-4 WAdelphi 6-10 LBaltimore 2-4 LNavy 3-8 LMorgan State 10-4 W



2012

LACROSS

2012

LACROSS


Pennsylvania 8-7 WMIT 24-3 WHobart 13-9 WBaltimore 16-6 WWashington (MD) 13-5 WPrinceton 9-5 WArmy 6-8 LFairleigh Dickinson 15-3 WNavy 10-9 WTowson State 9-7 WRutgers 12-8 WAdelphi 10-9 WAir Force 16-4 WVirginia (NCAA) 5-12 L


3/23 Pennsylvania 11-9 W3/27 Baltimore 15-9 W3/30 Massachusetts 7-6 W4/3 at Princeton 16-13 W4/6 Navy 6-17 L4/13 Army 12-5 W4/20 NY Tech 21-3 W4/27 at Adelphi 11-3 W5/1 at Towson State 11-15 L5/4 at Rutgers 6-5 W5/11 LIU-C.W. Post 12-5 WJohns Hopkins (NCAA) 10-18 L


Pennsylvania 3-18 LSyracuse 15-3 WMassachusetts 14-10 WPrinceton 17-5 WTowson State 15-10 WWashington & Lee 14-13 WArmy 9-8 W (OT)Navy 10-15 LAdelphi 11-8 WNY Tech 13-3 WRutgers 14-10 WLIU-C.W. Post 10-3 WMaryland (NCAA) 11-19 L

1976Coach Harry Royle Record: 7-4 (10th ranked)

Pennsylvania 10-9 WMassachusetts 11-9 WHarvard 11-7 Wat Brown 7-14 LArmy 7-8 LWashington & Lee 10-7 WNavy 13-17 LAdelphi 10-8 WNY Tech 12-7 WRutgers 7-13 LLIU-C.W. Post 13-9 W

1977Coach: Harry Royle Record: 7-5 (13th ranked)

3/19 at Pennsylvania 3-10 L3/23 Dartmouth 13-6 W3/26 Massachusetts 10-8 W3/30 Brown 9-7 W4/2 Harvard 14-4 W4/6 Washington & Lee 13-9 W4/9 at Army 2-7 L4/16 at Navy 7-15 L4/23 Adelphi 6-7 L4/27 at NY Tech 16-6 W4/30 Rutgers 5-6 L5/4 at LIU-C.W. Post 6-3 W


Pennsylvania 11-12 LVirginia 11-15 LNew Hampshire 10-11 LHarvard 10-9 WArmy 4-8 LNorth Carolina 10-9 WNY Tech 23-4 WAdelphi 14-9 WMassachusetts 14-11 WPenn State 14-11 WLIU-C.W. Post 11-7 WWashington & Lee 12-6 WJohns Hopkins (NCAA) 8-20 L

1979Coach: Harry Royle Record: 6-6

Boston College 13-6 WDartmouth 12-10 WVirginia 5-13 LBrown 10-15 LArmy 8-10 LNavy 12-19 LAdelphi 12-11 WMassachusetts 11-10 WPenn State 18-10 WLIU-C.W. Post 23-11 WPennsylvania 12-13 LWashington & Lee 9-


3/15 New Hampshire 15-10 W3/19 Baltimore 15-9 W3/22 Virginia 5-10 L3/29 at Brown 10-22 L4/5 Army 11-9 W4/12 at Navy 9-14 L4/19 at Adelphi 9-13 L4/23 at Massachusetts 8-16 L4/26 Penn State 20-9 W4/30 Towson State 16-8 W5/3 Pennsylvania 8-10 L5/9 North Carolina State 17-15 W5/17 Washington & Lee 7-6 W (OT)



012

LACROSSE

012

LACROSSE 1981

Coach: Harry Royle Record: 3-8

3/21 Virginia 11-18 L3/28 Brown 10-7 W4/4 Army 6-10 L4/8 Lafayette 10-3 W4/15 Maryland 3-10 L4/18 Adelphi 11-16 L4/22 Massachusetts 8-14 L4/25 Penn State 5-10 L4/29 Towson State 7-14 L5/2 Pennsylvania 8-10 L5/9 Baltimore 13-4 W


Baltimore 10-7 WVirginia 8-16 LMaryland 12-13 L (OT)Brown 3-9 LArmy 6-12 LPenn State 10-16 LLafayette 10-7 WAdelphi 10-17 LMassachusetts 10-18 LTowson State 18-10 WPennsylvania 8-11 LRutgers 6-13 LWashington & Lee 10-19 L


Baltimore 15-6 WNavy 14-10 WBrown 15-11 WMaryland 7-9 LArmy 3-9 LLIU-C.W. Post 8-9 LPenn State 9-3 WLafayette 25-9 WAdelphi 12-6 WMassachusetts 10-8 WTowson State 8-9 LSt. John’s 12-4 WPennsylvania 10-11 L (OT)Rutgers 15-11 W


3/10 at Princeton 13-7 W3/17 at Brown 9-8 W (OT)3/24 Maryland 10-7 W3/31 Army 7-11 L4/4 LIU-C.W. Post 10-6 W4/7 Penn State 10-11 L (OT)4/11 at Lafayette 16-3 W4/14 at Adelphi 5-6 L4/18 at Massachusetts 5-12 L4/21 Towson State 12-8 W4/25 at St. John’s 13-8 W4/28 Pennsylvania 5-6 L (OT)5/5 at Rutgers 7-11 L5/12 at Navy 14-13 W


3/9 at Princeton 12-14 L3/16 Brown 13-14 L3/23 at Maryland 9-14 L3/30 at Army 12-14 L4/3 at LIU-C.W. Post 6-16 L4/6 at Penn State 14-13 W4/10 Lafayette 15-1 W4/13 Adelphi 7-12 L4/17 Massachusetts 8-13 L4/20 at Towson State 12-19 L4/24 St. John’s 9-14 L4/27 Pennsylvania 11-19 L5/4 Rutgers 10-9 W4/11 Navy 9-20 L

1986Coach: John Danowski Record: 4-9

3/8 Princeton 9-8 W3/15 at Brown 3-20 L3/22 Maryland 2-16 L3/29 Army 6-18 L4/5 at Delaware 6-15 L4/9 at Lafayette 16-11 W4/12 at Adelphi 10-20 L4/19 Towson State 6-8 L4/26 Pennsylvania 9-15 L4/30 Lehigh 15-9 W5/3 Hobart 10-24 L5/7 Drexel 23-13 W5/10 LIU-C.W. Post 12-19 L

1987Coach: John Danowski Record: 7-9, 3-3

3/7 at Princeton 9-7 W3/13 Duke 12-11 W3/15 Brown 5-11 L3/21 Maryland 1-15 L3/25 Ohio State 15-4 W3/28 Bucknell* 13-15 L4/4 Delaware* 8-9 L4/8 Lafayette* 18-6 W4/11 Adelphi 7-15 L4/18 at Towson State* 4-15 L4/25 Pennsylvania 5-13 L4/27 Air Force 12-5 W4/29 at Lehigh* 15-11 W5/2 at Hobart 9-21 L5/6 at Drexel* 14-9 W5/9 at LIU-C.W. Post 7-8 L*East Coast Conference game

1988Coach: John Danowski Record: 12-3, 5-0 (13th ranked)

3/12 St. John’s 14-6 W3/19 at Bucknell 14-7 W3/25 Michigan State 10-3 W3/27 at Adelphi 12-13 L4/2 at Delaware* 14-8 W4/6 at Lafayette* 17-9 W4/9 Syracuse 5-18 L4/16 Towson State* 10-9 W4/23 at Villanova 13-8 W4/27 Lehigh* 21-13 W4/30 Hobart 10-15 L5/4 Drexel* 20-6 W5/7 at UMBC 15-9 W5/11 LIU-C.W. Post 9-8 W5/14 Princeton 7-3 W*East Coast Conference game



2012

LACROSS

2012

LACROSS


3/11 Virginia 16-14 W3/18 Bucknell 17-4 W3/22 at St. John’s 17-11 W3/25 Adelphi 10-15 L3/29 Army 16-10 W4/1 Delaware* 15-13 W4/5 Lafayette* 20-2 W4/8 at Syracuse 7-16 L4/15 at Towson State* 10-9 W (4 OT)4/22 Villanova 9-12 L4/25 at Lehigh* 18-8 W4/29 at Hobart 6-14 L5/3 at Drexel* 17-7 W5/6 UMBC 16-4 W5/13 Princeton 10-3 W*East Coast Conference game


3/10 Penn State 17-6 W3/17 Bucknell 15-11 W3/21 St. John’s 14-8 W3/24 Cornell 14-15 L3/27 at Army 13-15 L3/31 at Delaware* 15-5 W4/4 at Yale 5-18 L4/7 Syracuse 9-20 L4/14 Towson State* 11-14 L4/25 Lehigh* 22-7 W4/28 at Lafayette* 13-7 W5/2 Drexel* 22-4 W5/5 at LIU-C.W. Post 14-5 W5/11 Princeton 7-6 W*East Coast Conference game

.1991Coach: John Danowski Record: 7-7, 2-2 (16th ranked)

3/9 Notre Dame 10-5 W3/16 at UMBC* 12-8 W3/20 at St. John’s 13-12 W3/23 at #9 Cornell 4-9 L3/30 #20 Delaware* 9-10 L4/3 Lafayette 24-14 W4/6 at #8 Syracuse 10-30 L4/13 at #9 Towson State* 8-20 L4/20 #4 Virginia 10-18 L4/23 at Drexel* 21-11 W4/27 at #11 Army 14-13 W (OT)5/1 #7 Johns Hopkins 11-20 L5/4 #15 Yale 12-10 W5/11 at #4 Princeton 11-15 L

1992Coach: John Danowski Record: 4-9

3/7 Rutgers 13-9 W3/10 Radford 17-7 W3/14 UMBC 12-15 L3/21 Cornell 7-9 L3/28 at Notre Dame 9-12 L4/1 at Massachusetts 4-17 L4/11 Towson State 10-9 W4/15 St. John’s 7-9 L4/18 at Virginia 5-17 L4/21 Lafayette 12-5 W4/24 Army 5-9 L4/29 at Johns Hopkins 4-15 L5/2 at Yale 4-10 L

1993Coach: John Danowski Record: 10-6 (11th ranked)

3/7 Notre Dame 8-9 L3/21 Vermont 12-10 W3/28 Providence 19-6 W4/3 #10 Massachusetts 16-8 W4/4 Harvard 12-7 W4/9 #5 Loyola (MD) 13-12 W4/14 at St. John’s 9-8 W4/17 #5 Virginia 7-6 W (OT)4/21 Lafayette 21-3 W4/24 at #12 Army 11-10 W4/28 #4 Johns Hopkins 5-11 L5/1 #20 Yale 6-9 L5/4 at #16 Rutgers 6-16 L5/8 #2 Princeton 6-9 L5/15 Massachusetts (NCAA) 9-8 W5/22 at Syracuse (NCAA) 8-20 L

1994Coach: John DanowskiRecord: 6-7 (20th ranked)

3/5 St. John’s 15-3 W3/12 Michigan State 14-5 W3/20 #10 Brown 10-9 W3/23 Air Force 13-5 W4/1 #13 Massachusetts+ 8-11 L4/2 at #14 Brown+ 6-15 L4/9 at #2 Loyola 10-13 L4/16 #13 Georgetown 13-10 W4/17 Providence 17-4 W4/22 #20 Army 14-15 L (OT)4/26 #6 Johns Hopkins 7-15 L4/30 at #18 Yale 5-8 L5/7 Rutgers 15-16 L (OT)+Fleet Classic at Brown

1995Coach: John DanowskiRecord: 9-5, 5-0 (17th ranked)

3/11 #17 Delaware* 15-6 W3/18 #8 Brown 10-9 W (OT)3/25 Vermont* 11-10 W3/31 #13 Massachusetts 5-11 L4/2 New Hampshire* 21-9 W4/7 #6 Loyola 7-15 L4/11 at Hartford* 10-5 W4/12 at St. John’s 19-3 W4/15 at #12 Georgetown 6-17 L4/21 at Army 12-8 W4/25 #1 Johns Hopkins 11-15 L4/29 Yale 10-9 W5/2 Drexel* 16-5 W5/6 at #19 Rutgers 11-14 L*North Atlantic Conference game


3/3 at #14 Towson State*^ 13-12 W3/10 at #19 Delaware*# 19-13 W3/13 at #8 Loyola 8-17 L3/17 #6 Brown 7-16 L3/22 #12 Massachusetts 15-14 W (OT)3/30 New Hampshire* 12-6 W4/6 at Vermont* 17-11 W4/13 #17 Georgetown 15-16 L (OT)4/19 #20 Army 10-14 L4/23 #5 Johns Hopkins 9-7 W4/27 at Drexel* 10-7 W4/30 #20 Rutgers 12-4 W5/5 #2 North Carolina 10-9 W5/11 Harvard (NCAA)*** 12-15 L*North Atlantic Conference game^at Johns Hopkins#at Loyola***at Cornell



012

LACROSSE

012

LACROSSE 1997

Coach: John DanowskiRecord: 9-6, 6-0 (12th ranked)

3/1 #10 Towson State* 13-10 W3/8 Delaware* 12-7 W3/15 #9 Brown 9-4 W3/22 #15 Massachusetts 7-6 W (2 OT)3/29 at New Hampshire*^ 10-3 W4/4 at #13 Notre Dame 9-10 L4/6 Vermont* 7-6 W4/8 at #14 Hartford* 7-2 W4/12 at #6 Georgetown 5-18 L4/19 at Army 2-6 L4/22 #4 Johns Hopkins 5-8 L4/25 Drexel* 16-4 W4/29 at Rutgers 5-4 W5/3 #16 North Carolina 4-10 L5/10 Massachusetts (NCAA)** 4-6 L*America East gameât Holy Cross**at Army


2/28 #5 Loyola 6-8 L3/7 at #20 Delaware* 13-11 W3/10 Providence 18-2 W3/14 #17 Brown 20-11 W3/22 at #10 Massachusetts 6-7 L3/27 Hartford* 22-8 W4/1 at #17 Towson* 15-11 W4/4 Vermont* 22-5 W4/10 #17 Navy 9-8 W4/17 Army 13-9 W4/22 at #3 Johns Hopkins 10-16 L4/25 at #19 Drexel* 13-5 W4/28 #19 Rutgers 13-9 W5/2 at Notre Dame 4-8 L*America East game


3/6 #3 Loyola ^ 4-10 L3/13 #14 Delaware* 7-13 L3/20 at Brown 11-9 W3/22 Air Force 19-5 W3/27 #20 Massachusetts 8-7 W3/31 at Hartford* 15-6 W4/3 #13 Notre Dame 10-9 W4/7 #15 Towson* 9-6 W4/10 Vermont* 14-4 W4/16 #10 Navy 8-7 W4/24 at Army 16-9 W4/28 Drexel* 18-7 W5/4 at Rutgers 15-6 W5/8 #2 Johns Hopkins 9-8 W (OT)5/15 Navy (NCAA)** 15-7 W5/22 #2 Johns Hopkins (NCAA) 7-11 L*America East gameât Navy**at Brown


2/26 at #15 Massachusetts 10-7 W3/4 #3 Loyola 12-16 L3/11 #7 Johns Hopkins 6-12 L3/19 at #5 Princeton 8-11 L3/26 at #13 Notre Dame 8-7 W3/27 Air Force 21-4 W4/7 Vermont* 12-8 W4/9 Hartford* 17-5 W4/14 at Delaware* 7-8 L4/16 at Towson* 18-11 W4/20 at Drexel* 13-6 W4/22 #19 Army 18-10 W4/29 #11 North Carolina 20-12 W5/3 Towson# 18-10 W5/6 Delaware# 14-4 W5/14 #6 Maryland (NCAA)! 12-14 L*America East game#America East Tournament!at UMBC


2/24 #19 Massachusetts 13-17 L3/3 at #8 Loyola 12-17 L3/10 at #8 Johns Hopkins 6-7 L3/17 #2 Princeton 5-10 L3/24 #2 Notre Dame 11-10 W (OT)3/28 Air Force 22-8 W3/31 Hartford*^ 21-9 W4/4 Drexel* 18-7 W4/7 #11 Towson* 12-16 L4/10 at Army 17-9 W4/14 Delaware* 11-10 W4/21 at Vermont* 16-7 W4/28 #9 Duke 15-10 W5/2 Delaware# 11-8 W5/5 at #9 Towson# 11-13 L5/13 #8 Virginia (NCAA)! 15-14 W (OT)5/19 #1 Syracuse (NCAA)$ 13-18 L*America East gameât Springfi eld, Massachusetts#America East Tournament!at West Point, New York$at Hofstra Stadium


2/23 at #12 Massachusetts 12-11 W(OT)3/2 #8 Loyola* 7-8 L3/5 Villanova* 12-5 W3/9 #2 Johns Hopkins 8-9 L3/16 at #8 Princeton 4-12 L3/19 Fairfi eld 11-8 W3/23 at #18 Notre Dame 15-5 W3/26 at Drexel* 18-10 W3/30 Army 16-9 W4/6 at #14 Towson* 13-7 W4/13 at Delaware* 17-5 W4/19 Sacred Heart 19-5 W4/26 #7 Duke 14-6 W5/1 #12 North Carolina 12-7 W*Colonial Athletic Association game


3/1 at #12 Loyola 4-10 L3/4 Binghamton 15-5 W3/8 #14 Cornell 13-5 W3/15 #7 Princeton 5-18 L3/21 #11 Notre Dame 9-8 W3/23 #6 Massachusetts 7-14 L3/26 at Army 12-11 W3/29 Drexel* 14-8 W4/4 at #13 Towson* 8-15 L4/11 Delaware* 11-9 W4/17 #7 Syracuse 8-6 W4/19 at Sacred Heart* 9-8 W (OT)4/23 Villanova* 9-5 W4/26 #11 Duke 9-8 W4/30 Villanova# 9-6 W5/3 at #11 Towson# 11-16 L5/11 at #5 Massachusetts 6-9 L (NCAA)*Colonial Athletic Association game#CAA Tournament

2004Coach: John DanowskiRecord: 4-10, 2-3

2/28 #12 Cornell 12-14 L3/6 #7 Loyola 9-8 W3/8 Binghamton 14-9 W3/13 #1 Johns Hopkins 6-13 L3/20 at #6 Princeton 5-10 L3/24 at #15 Notre Dame 11-19 L3/28 at Massachusetts 3-6 L4/3 at #18 Delaware* 10-12 L4/7 Sacred Heart* 12-11 W4/10 at Drexel* 8-7 W4/17 #18 Towson* 6-12 L4/24 at Villanova* 10-13 L4/27 at Stony Brook 6-9 L5/5 at #11 Towson# 5-6 L*Colonial Athletic Association game#CAA Tournament game



2012

LACROSS

2012

LACROSS

22


2/26 #15 Massachusetts 7-12 L3/5 at #20 Brown 2-10 L3/12 at #1 Johns Hopkins 5-11 L3/16 #15 North Carolina 12-8 W3/19 #11 Princeton 9-8 W3/21 Binghamton 7-5 W3/26 #9 Notre Dame 8-9 L (2 OT)3/29 at #5 Army 10-11 L4/1 Villanova* 5-11 L4/6 at Sacred Heart* 14-10 W4/9 at #17 Delaware* 13-3 W4/15 Drexel* 11-5 W4/23 at #14 Towson* 6-10 L4/26 #17 Stony Brook 13-5 W4/30 Harvard 11-5 W5/4 at #16 Delaware# 5-8 L*Colonial Athletic Association game#CAA Tournament game

2006Coach: John DanowskiRecord: 17-2, 6-0 (2nd ranked)

2/26 at #9 Massachusetts 7-11 L3/4 Brown 14-4 W3/11 #11 Johns Hopkins 11-6 W3/15 North Carolina 6-5 W3/18 at #6 Princeton 9-5 W3/25 #11 Notre Dame 13-5 W3/28 #20 Army 11-6 W3/31 #12 Towson* 10-9 W (OT)4/5 Sacred Heart* 19-8 W4/8 at Villanova* 13-4 W4/12 at Robert Morris* 21-2 W4/14 Delaware* 12-10 W4/22 at Drexel* 12-4 W4/25 at #19 Stony Brook 18-8 W4/29 #16 Harvard 13-6 W5/3 Villanova# 14-7 W5/6 #19 Delaware# 12-6 W5/14 Providence (NCAA1) 14-8 W5/20 Massachusetts (NCAA2) 10-11 L (OT)*Colonial Athletic Association game#CAA Tournament gameNCAA1-Opening round at HofstraNCAA2-Quarterfi nal at Stony Brook

2007Coach: Seth TierneyRecord: 6-8, 3-3

2/24 #9 Massachusetts 8-6 W3/3 at Brown 6-7 L3/10 at #5 Johns Hopkins 8-9 L3/18 #12 Princeton 4-5 L3/24 at #14 Delaware* 5-6 L3/27 at #9 Army 5-3 W3/30 Villanova* 8-9 L4/7 Robert Morris* 14-5 W4/11 at Sacred Heart* 10-8 W4/14 at #14 Towson* 9-8 W (OT)4/20 Lafayette 9-3 W4/24 Stony Brook 12-13 L (OT)4/28 #17 Drexel* 7-8 L5/2 at #14 Towson# 5-11 L*Colonial Athletic Association game#CAA Tournament game91

2008Coach: Seth TierneyRecord: 10-6, 5-1 CAA (15th ranked)

2/23 at Massachusetts 4-8 L3/1 Brown 7-6 W3/8 #1 Johns Hopkins 8-7 W3/15 at #13 Princeton 6-11 L3/21 Towson* 13-8 W3/25 #16 Army 7-8 L3/29 at #11 Drexel* 8-9 L4/5 Sacred Heart* 20-3 W4/9 at Villanova* 7-6 W4/12 Delaware* 11-8 W4/19 at #13 North Carolina 9-13 L4/22 at Stony Brook 14-13 W4/26 at Robert Morris* 13-12 W4/30 Delaware% 9-7 W5/3 at #11 Drexel& 10-9 W5/11 at #4 Johns Hopkins 4-10 L (NCAA)*CAA game%CAA Semifi nals&CAA Championship NCAA-Opening Round at Johns Hopkins

2009Coach: Seth TierneyRecord: 11-4, 6-0

2/21 #20 Massachusetts 11-10 W2/28 at #15 Brown 11-10 W (2OT)3/7 at #10 Johns Hopkins 7-12 L3/14 #3 Princeton 9-7 W3/21 at Sacred Heart* 6-5 W3/24 at Army 9-8 W (2OT)3/28 Robert Morris* 11-5 W4/4 Delaware *+ 10-8 W4/8 Drexel* 12-7 W4/11 at Towson* 11-10 W4/18 #10 North Carolina 8-13 L4/21 Stony Brook 12-11 W4/25 Villanova* 10-3 W4/29 Villanova # 7-9 L5/9 at #7 Cornell (NCAA1) 8-11 L*Colonial Athletic Association game#CAA Tournament gameNCAA1-Opening round at Cornell

2010Coach: Seth TierneyRecord: 9-5, 2-3 (14th ranked)

2/27 at #9 Princeton 14-17 L3/6 #19 Brown 15-12 W3/13 #7 Johns Hopkins 14-6 W3/20 Sacred Heart* 14-6 W3/23 at St. John’s 13-4 W3/27 at #18 Massachusetts* 9-11 L3/30 Army 17-2 W4/3 at #11 Drexel* 11-13 L4/6 Manhattan 18-2 W4/10 Delaware* + 12-11 W4/17 at Penn State* 10-11 L (OT)4/24 Jacksonville 14-10 W5/1 #11 Towson* 12-10 W5/15 at #3 Maryland (NCAA1) 8-11 L

*-Colonial Athletic Association game+- Big City Classic at Meadowlands#CAA Tournament gameNCAA1-Opening round at Maryland

2011Coach: Seth TierneyRecord: 13-3, 5-1 (13th ranked)

2/15 Colgate 6-3 W2/19 at Sacred Heart 10-6 W2/26 #8 Princeton 11-9 W3/5 Harvard 15-9 W3/13 Air Force 11-6 W3/19 at Delaware* 6-7 L3/22 St. John’s 8-5 W3/26 Drexel* 11-6 W4/2 at Towson* 12-5 W4/5 Manhattan 13-8 W4/9 at Saint Joseph’s (PA)* 11-3 W4/16 at Fairfi eld 8-7 W4/23 vs. #15 Massachusetts* + 14-5 W4/30 #20 Penn State* 9-4 W5/4 Delaware# 9-10 L5/14 at #3 Johns Hopkins (NCAA1) 5-12 L

*Colonial Athletic Association game+Warrior Classic, East Hartford, CT#CAA Tournament gameNCAA1-Opening round at Johns Hopkins


012

LACROSSE

2012 HOFSTRA MEDIA INFORMATION2012 HOFSTRA MEDIA INFORMATIONThe Hofstra University Offi ce of Athletic Communications welcomes the members of the media covering the 2012 Hofstra Men’s Lacrosse team. If we can be of any assistance to you throughout the year, please do not hesitate to contact us. We hope the following items will help you during your visits to Hofstra University. Enjoy the season.

Jim SheehanSenior Sports Information Director/Lacrosse Contact

Hofstra UniversitySwim Center – Suite 262Hempstead, NY 11549(516) 463-6764 - Offi ce(516) 523-6692 - Cell(516) 463-5033 - Fax

(516) 463-5274 - Shuart Stadium Press Box Phone

Jim Sheehan is in his 33rd year in the sports public relations profession and in his 25th year at Hofstra University. Sheehan came to Hofstra in 1988 after serving as assistant commissioner of the I-AA Gateway Collegiate Athletic Conference in St. Louis, Missouri, from 1985 through 1988. Prior to his Gateway stint, he served as coordinator of media relations for the Houston Gamblers of the United States Football League in 1984-85. Sheehan has also served as director of sports information at the University of Tampa from 1982 through 1984; assistant to the commissioner/information director of the Sunshine State Conference from 1980 through 1984 and director of sports information at his alma mater, Biscayne College, in 1981-82. Jim and his wife, Maureen, have a daughter, Jillian (19). The Sheehan family resides in Middle Village, New York.

The James M. Shuart Stadium press box, located on the fourth fl oor of the Shuart Stadium Building, is intended for working media and scouts. All media members, including radio and television stations, will be seated on the fourth fl oor while video and television camera locations are on the roof. All press box guests must have a pass, issued by the Hofstra Offi ce of Athletic Communications, to gain entrance.

The James M. Shuart Stadium Press Box is equipped with high-speed wireless internet access. To access the wireless network, select HUGuest and enter your email address when prompted.C All members of the press should contact the Offi ce of Athletic

Communications at least 48 hours before each game for press box space and credentials. Press passes will be left at the media entrance (Gate A) on the west side of the stadium on Meadowbrook Place.

Media parking passes should be requested at the same time press box/sideline passes are requested. The Reserved-Media parking lot is located across the street from the Stadium Building, which houses the press box, on the corner of Belmont Place and Meadowbrook Place. To enter the lot off of Hempstead Turnpike, go south (turn left if coming from the east) on California Avenue. Go 20 yards on California Avenue to Belmont Place and turn left. Go down the block to the last lot on the left, which is on the corner of Meadowbrook Place. Parking is limited and on a fi rst-come, fi rst-serve basis in the Reserved-Media lot. Once that lot is fi lled, media will be directed to the general public parking areas around Shuart Stadium.

Photographers who intend to shoot from the fi eld should request a sideline photo pass. Only press and staff photographers will be allowed on the sidelines. All members of the press photo corps are reminded to stay out of the bench areas and stand fi ve yards behind the sideline during the course of the game. Photo sideline passes should always be visible when on the fi eld. Freelance photographers are not allowed on the James M. Shuart Stadium fi eld.

Members of the media are asked to pick up their game information packets consisting of media guides, programs, releases and notes on the tables behind the fi rst row of press seating. A quickie statistics sheet will be distributed at halftime. Several stats monitors are placed in the working press area. Complete game statistical books will be available in the press box 20 minutes after each game.

Hofstra University provides numerous telephones for use by the media in the press box. Please indicate your telephone needs when you request your credentials.

The Hofstra Offi ce of Athletic Communications will provide a touch-tone digital phone line for the opponent’s commercial and student radio stations. Visiting teams will need to give the Athletic Communications Offi ce two weeks notice of their intention to broadcast. All calls must be made collect or direct dial from the radio station to James M. Shuart Stadium.

Hofstra players and coaches will be available for postgame interviews in the Hofstra Theater on the lower level of Margiotta Hall. Media with credentials should enter Margiotta Hall at the north side door facing the fi eld and take the elevator down. Please contact the visiting publicist concerning the visiting team’s post-game policy in their locker room on the east side of Shuart Stadium.

All requests for player interviews during the week should be made at least one day in advance with the Offi ce of Athletic Communications. If you are requesting a phone interview, we will either put you through to the player requested or have the player return your call at a mutually convenient time. Player home phone numbers will not be distributed. In-person interviews may be conducted in a number of locations in and around Margiotta Hall. However, interviews may not be conducted in the locker room or the athletic training room.Hofstra Lacrosse on the Web: Visit GoHofstra.com for the latest information on Hofstra Men’s Lacrosse or any of the University’s 17 athletic teams.

Stephen GorchovAssociate Director

of Athletics for Communications

Jim SheehanSenior Sports

Information Director Communications

Len SkorosDirector of Athletic

Publicationss

Brian BohlSenior Assistant

Director of Athletic Communications

Jim Sheehan


MEDIA OUTLETSMEDIA OUTLETS2012

LACROSS

WIRE SERVICES

THE ASSOCIATED PRESS

50 Rockefeller Plaza

New York, NY 10020

(212) 621-1630 - Offi ce

(212) 621-1639 - Fax

NEWSPAPERS

NEWSDAY

235 Pinelawn Road

Melville, NY 11747

(631) 843-2820 - Offi ce

(631) 454-6892 - Fax

NEW YORK TIMES

620 Eighth Avenue

New York, NY 10018

(212) 556-7384 - Offi ce

(646) 428-6147 - Fax

NEW YORK DAILY NEWS

4 New York Plaza

New York, NY 10004

(212) 210-1692 - Offi ce

(212) 643-7845 - Fax

NEW YORK POST

1211 Avenue of the Americas

New York, NY 10036

(212) 930-8700 - Offi ce

(212) 930-8727 - Fax

LONG ISLAND HERALD

2 Endo Boulevard

Garden City, NY 11553

(516) 569-4000 - Offi ce

(516) 469-4942 - Fax

HOFSTRA CHRONICLE

Mack Student Center

Hempstead, NY 11550

(516) 463-6965 - Offi ce

(516) 463-6977 - Fax

TELEVISION

NEWS 12 LONG ISLAND

One Media Crossways

Woodbury, NY 11797

(516) 393-3740 - Offi ce

(516) 393-1269 - Fax

WLNY-TV 10/55

270 South Service Road

Melville, NY 11747

(631) 753-6397 - Offi ce

(631) 420-4846 - Fax

MSG NY

2 Penn Plaza

New York, NY 10001

(212) 465-5955 - Offi ce

(212) 465-5944 - Fax

SPORTSNET NY

110 West 51st Street

New York, NY 10020

(212) 485-4900 - Offi ce

(212) 485-4975 - Fax

WCBS-TV 2

524 West 57th Street

New York, NY 10019

(212) 975-1741 - Offi ce

(212) 975-9387 - Fax

WNBC-TV 4

30 Rockefeller Plaza

New York, NY 10020

(212) 664-5313 - Offi ce

(212) 664-2994 - Fax

WNYW-TV 5

205 E. 67th Street,

New York, NY 10021

(212) 452-3786 - Offi ce

(212) 452-5517 - Fax

WABC-TV 7

7 Lincoln Square

New York, NY 10023

(212) 456-3125 - Offi ce

(212) 456-2930 - Fax

WPIX-TV 11

220 E. 42nd Street

New York, NY 10017

(212) 210-2513 - Offi ce

(212) 210-2591 - Fax

RADIO

WRHU-FM 88.7

Hofstra University

Dempster Hall

Hempstead, NY 11549

(516) 463-5667 - Offi ce

(516) 463-5668 - Fax

WCBS-AM 880

345 Hudson Street

New York, NY 10014

(212) 314-9200 - Offi ce

(212) 975-5539 - Fax

WINS-AM 1010

345 Hudson Street

New York, NY 10014

(212) 315-7090 - Offi ce

(212) 489-7034 - Fax

ESPN RADIO 1050 AM

2 Penn Plaza

New York, NY 10121

(212) 613-3800 - Offi ce

(212) 613-3861 - Fax

WFAN-AM 660

345 Hudson Street

New York, NY 10014

(212) 314-9200 - Offi ce

(646) 792-4152 - Fax

(718) 383-5734 - Fax

JOHN ANTONIADES

CODY SOLAJA

IAN BRADDISH

MARK MULLEN

ADRIAN SORICHETTI

COREY CAPUTO

AARON JONES

2012 HOFSTRA UNIVERSITY MEN’S LACROSSE SCHEDULE

2012 PRE SEASONFEBRUARY

5 Sunday at Syracuse Noon11 Saturday at Pennsylvania Noon

2012 REGULAR SEASONFEBRUARY

18 Saturday SACRED HEART 12:30 p.m.25 Saturday at Princeton 1 p.m. 28 Tuesday FAIRFIELD 7 p.m.

MARCH3 Saturday at Harvard 3 p.m.10 Saturday NOTRE DAME 3 p.m.17 Saturday DELAWARE* 1 p.m.20 Tuesday ST. JOHN’S 7 p.m.24 Saturday at Drexel* 7 p.m.31 Saturday TOWSON* 7 p.m.

APRIL3 Tuesday DARTMOUTH 7 p.m.7 Saturday SAINT JOSEPH’S (PA)* 1 p.m.1 Saturday at North Carolina (at Charlotte, NC) 1:30 p.m.21 Saturday at Massachusetts* (at Foxborough, MA) 4 p.m.28 Saturday at Penn State* 12 p.m.

MAY2 WednesdayCAAChampionshipSemifinals TBA 5 Saturday CAAChampionshipFinal TBA

12 Saturday NCAAChampionshipFirstRound TBA13 Sunday NCAAChampionshipFirstRound TBA19 Saturday NCAAQuarterfinals(Annapolis,MD) TBA20 Sunday NCAAQuarterfinals(Philadelphia,PA) TBA26 Saturday NCAASemifinals(Foxborough,MA) TBA28 Monday NCAAChampionship(Foxborough,MA) TBA

*CAA gameHome games in BOLD CAPSDates and times subject to change.GoHofstra.com

GoHofstra.com

2012 Hofstra Men's Lacrosse Guide

Documents

Transcript of 2012 Hofstra Men's Lacrosse Guide