2010-11 Men's Golf Yearbook

30
V A N D A L G O L F 2010-11 UNIVERSITY OF IDAHO

description

Idaho Vandals men's golf

Transcript of 2010-11 Men's Golf Yearbook

Page 1: 2010-11 Men's Golf Yearbook

VANDAL

GOLF

2010-11UNIVERSITY OF IDAHO

Page 2: 2010-11 Men's Golf Yearbook

2

Hole 1 2 3 4 5 6 7 8 9 Out Total

Blue 386 156 390 556 171 491 526 375 293 3,344 6,637

White 355 139 376 526 147 473 491 334 276 3,117 6,154

Red 323 123 367 493 108 459 447 326 258 2.904 5,770

Par 4 3 4 5 3 5 5 4 4 37 72

Handicap 11 15 9 1 17 5 3 7 13

University of Idaho Golf Course ~ Designed by Francis L. James, (R) Bob Bolduck

Hole 10 11 12 13 14 15 16 17 18 In Total

Blue 375 406 400 504 227 351 383 232 415 3,293 6,637

White 337 391 377 484 202 295 365 204 382 3,037 6,154

Red 302 375 353 465 192 281 349 177 372 2,866 5,770

Par 4 4 4 5 3 4 4 3 4 35 72

Handicap 18 10 14 2 8 16 12 4 6

University of Idaho Golf Course ~ Designed by Francis L. James, (R) Bob Bolduck

Page 3: 2010-11 Men's Golf Yearbook

1

TABLE OF CONTENTS

2010-11 Schedule ..............................................22010-11 Team statistics ...................................2John Means .........................................................3Jarred Bossio ....................................................4-5Stefan Richardson ...........................................6-7Damian Telles ..................................................8-9Justin Kadin .......................................................10Zach Wanderscheid .........................................11Gordon Webb ................................................... 12Season results ............................................13-15President Duane Nellis ....................................16

Director of Athletics Rob Spear ......................17University of Idaho .....................................18-21Moscow, Idaho ..................................................22State of Idaho....................................................23Academic Support Services ............................24Athletic Training ................................................25Athletics staff directory .............................24-25Western Athletic Conference ..........................26Why Joe? ............................................................27Vandal Athletics Quick Facts ..........................27

2010-11 UNIVERSITY OF IDAHO VANDALSJarred Bossio Jr. 3L Capital High School Olympia, Wash.

Justin Kadin Jr. 1L Crescent Valley High School Corvallis, Ore.

Stefan Richardson Jr. 3L Eastside Catholic High School Renton, Wash.

Damian Telles So. 2L Whatonka High School The Dalles, Ore.

Zach Wanderscheid Fr. 1L Goldendale High School Goldendale, Wash.

Gordon Webb Jr. TR Malta High School Malta, Mont.

Coach John Means (fi rst season) • University of Oklahoma • Colorado State University

Page 4: 2010-11 Men's Golf Yearbook

2

2010-11 SCHEDULESEPTEMBER 13-14 Palouse Collegiate Palouse Ridge Golf Club Pullman, Wash. Par 72, 7,308 yards

2nd (281-278-280–839) • Top Vandal: Damian Telles, 1st, 66-70-65–201 20-22 Kikkor Golf Husky Invitational Washington National Golf Club Auburn, Wash. Par 72, 7,304 yards

5th (294-295-282–871) • Top Vandal: Jarred Bossio, 3rd, 75-73-63–211

OCTOBER 4-6 Wolf Pack Classic Edgewood Golf Club Stateline, Nev. Par, 72, 7,445 yards

7th (297-290–587) • Top Vandal: Damian Telles, T5th, 72-69–141 25-26 Herb Wimberly Intercollegiate New Mexico State Golf Course Las Cruces, N.M. Par, 71, 6999 yards

5th (285-297-285–87) • Top Vandal: Matt Rawitzer, T1st, 68-70-70–208

FEBRUARY 21-22 WSU Snowman Getaway Cat Tail @ Whirlwind Chandler, Ariz. Par 72, 7,173 yards

2nd (288-291-287–866) • Top Vandal: Zach Wanderscheid, T5th, 72-72-70–214

MARCH 14-15 Jackrabbit Invitational Primm Valley Golf Course (Desert) Primm, Nev. Par 72, 7,090 yards

2nd (269-279-280–828) • Top Vandal: Matt Rawitzer, T3rd, 67-67-70–204 21-22 The Duck Invitational Eugene Country Club Eugene, Ore. Par 72, 7,020 yards

8th (296-303-289–888) • Top Vandal: Damian Telles, T29th, 73-75-75–220 APRIL 4-5 Wyoming Cowboy Classic Talking Stick North Scottsdale, Ariz. Par 70, 7,133 yards

T7th (290-288-277–855) • Top Vandal: Jarred Bossio, T9th, 68-73-68–209 15-16 Ping Golf Cougar Classic Riverside Country Club Provo, Utah Par 72, 7,142 yards

5th (287-291-282–860) • Top Vandal: Damian Telles, T4th, 72-68-68–208 23-24 Boilermaker Invitational Kampen Course West Lafayette, Ind. Par 72, 7,456 yards

2nd (296-300-293–889) • Top Vandals: Damian Telles (74-72-74–220) and Jarred Bossio (72-74-74–220), T4th MAY 2-4 WAC Championship Rio Secco Golf Club Henderson, Nev. Par 72, 7, 313 yards

T4th (298-307-296–901 • Top Vandal: Damian Telles, T1*, 66-73-73–212 (*fi nished second in playoff)

INDIVIDUALS

Player Tournaments Best fi nish Rounds Low round Strokes Average Top 10 Top 25Jarred Bossio 10 2 30 63 2163 72.10 5 8Damian Telles 11 1 32 65, twice 2309 72.16 6 6Stefan Richardson 10 T5 29 67 2140 73.79 2 3Justin Kadin 4 T20 12 71 907 75.58 0 2Zach Wanderscheid 5 9 14 73 1110 79.29 1 1

Page 5: 2010-11 Men's Golf Yearbook

3

John MEANSHead coach • First season • University of Oklahoma • Colorado State

John Means, whose career has been established by his ability to build championship caliber teams, has accepted the men's golf coaching position at the University of Idaho.

Means' coaching career began at the U.S. Military Academy where his teams won 11 conference titles in 11 years. He further proved himself at the University of Minnesota, where, in just three seasons, he led the Golden Gophers to the NCAA Championship Tournament. That started a run of eight succes-sive NCAA appearances by the Golden Gophers and eight suc-cessive seasons ranked in the top 20.

His experience in building a winning golf program at a school with winter weather made him the choice of the search commit-tee.

Means said he likes the challenge of golf in a four-season cli-mate.

"There is an opportunity at Idaho to do something that has never been done before - compete for a national championship from the snowy country," said Means, who replaces Jon Reehoorn, who accepted the Oregon head coaching job last month.

"I'm really excited about what Jon Reehoorn did. ... We can do things to shake up the world of golf."

Women's coach Lisa Johnson said Means has the experience to continue to build on the sound base established by Reehoorn.

"Coach Means stood out throughout the search process," John-son said. "His accomplishments as a college coach and solid character are second to none. We are extremely excited to add him to the Vandal family and look for him to continue to build on Coach Reehoorn's successes."

Means left college golf in 2002 to start his own golf teaching center. He was the Director of Golf and Consultant for the Mul-ligan Masters Golf Learning Center in Lake Elmo, Minn., for the past four years. He doubled as the coach of the Wisconsin-Eau Claire women's team during that time and, as he had in the past, led the Blugolds to four NCAA tournaments.

He earned his bachelor's degree from the University of Oklaho-ma and his master's degree from Colorado State University.

333333

Page 6: 2010-11 Men's Golf Yearbook

4

Jarred BOSSIOJunior • 3L • Capital High School • Olympia, Wash.

2010-11: Earned second-team all-Western Athletic Conference honors as well as one Golfer of the Month and one Golfer of the Week award ... fi nished in the top 10 in fi ve tournaments and was out of the top 25 only twice in nine competitions ... is the second best scorer in the WAC at 71.70 and is 37th in the GolfStat.com rankings ... tied for the low round in the WAC (63) as well as the second-best round (64) and third-best round (65) ... is ranked second in the NCAA in subpar strokes per round (4.33) and is 12th nationally in par-5 scoring (4.61) ... fi nished in the top 10 in 50 percent of 2010-11 tournaments

and in the top 25 in 80 percent of 2010-11 tournaments.

2009-10: Has one top-10 fi nish and six in the top 25... low round of 67 at Western Intercollegiate was a career mark ... low tournament was a one-over 217 at the Wolf Pack Classic ... averaging 74 strokes over 33 rounds .. fi n-ished 24th at WAC Championship.

2008-10: Western Athletic Conference Freshman of the Year ... played in all 11 tournaments ... best round was a four-under 68 at Herb Wimberly Inter-

collegiate ... Herb Wimberly also was best tournament fi nish (tie fourth) and best tournament total (six-under 210) ... had two top 10 fi nishes and fi nished in

the top 25 six times.

High school/other: 2008 graduate of Olympia’s Capital High School ... Western Cascade Conference Most Valuable Player in 2006 and 2007 ... broke Capital

High School nine- and 18-hole scoring records ... fi nished fourth at Washing-ton State 3A high school tournament in 2007 and seventh in 2008 ... won Suncadia Boys Invitational ... also played basketball.

Personal: Born Nov. 23, 1989 ... son of Rose and Brian Bossio ... major-ing in Business.

... ON A PERSONAL NOTE ...

What is your favorite meal?

“Chicken fry meal at Burger King”

Who, throughout all time, would you most like to meet?

“Tiger Woods”

Who would you put in your dream foursome?

“Tiger Woods, Francis Ouimet, Ben Hogan”

What is your favorite movie?

“Super Troopers”

Who is your favorite University of Idaho professor?

“Sanjay Sisodyia”

What is your favorite golf memory?

“playing in the U.S. amateur last summer.”

What is the best advice you’ve been given?

“Focus on the current task at hand.”

44444444

anannnndddddd innnin tttttheeeheeeeeeehheeeehee tttttopopopopoppp

2020200200020020202 09090909-1-1-1110000eWWeWeWeWWWeWWeWWeW sttststsststststeeeereeeerer

2121212121777777 aaaaaaisisisheheheheddddd

20202020020202020080800808000811111111111111111111 ttttttttttoooooo

cococoococccoooolllllllegeggegegegiiaiaaiaiabebebebebbeeesttsttstststtsts ttttttououououououuournrnrrnrnrnrnrn

ththtthththththe e e eeee e totototoot p p pppp 25255552525552525252525 sssssss

HiHiHighghgghgghg ssschchchhooooCaCascscscccadadadaaadee

HiHiHHHHighghghgg SSSSStotototonnn SSSSuSuSSS ncnc

PePePePeeininn

Page 7: 2010-11 Men's Golf Yearbook

5

FIN. 1ST 2ND 3RD TOTAL TO PAR Giustina Memorial T21 72 75 70 217 +1Husky Invitational T32 75 77 74 226 +10Wyoming Desert T4 73 73 71 217 +1Sycuan Invitational T79 75 72 76 223 +7 Herb Wimberly T4 68 70 72 210 -6Rees Jones T23 76 73 80 229 +13Triumph at Pauma Valley 57 78 78 75 231 +18Oregon Duck Invitational T12 75 74 71 220 +4Wyoming Cowboy Classic T33 72 73 70 215 +5BYU Cougar Classic T34 73 72 76 221 +5WAC Championship T4 71 73 72 216 E

2008-09 RESULTS

SUMMARYTournaments 11Best fi nish T4 (3 times) Rounds played 33Low round 68Strokes 2425Average 73.48Top 10 3Top 25 6

SUMMARYTournaments 12Best fi nish 9Rounds played 36Low round 67Strokes 2665Average 74.03Top 10 1Top 25 7

2009-10 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR Palouse Collegiate T12 69 71 80 220 +4Kansas Invitational 9 71 76 73 220 +4Wolf Pack Classic T17 73 72 72 217 +1Del Walker Collegiate T78 73 73 77 223 +13Herb Wimberly Intercollegiate T34 69 72 74 215 +2Jacksonville Invitational T51 87 75 79 241 +25Snowman Getaway T16 78 77 69 224 +8Oregon Duck Invitational T22 72 75 73 220 +4Wyoming Cowboy Classic T81 78 74 73 225 +15Western Intercollegiate T23 75 75 67 217 +7BYU Cougar Classic T38 75 73 72 220 +4WAC Championship 24 75 74 74 223 +7

2010-11 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR 2010-11 ROUND-BY-ROUND RESULTS

Fin. 1st 2nd 3rd Total To par Palouse Collegiate 2 68 65 70 203 -13Kikkor Golf Husky Invitational 3 75 73 63 211 -5Herb Wimberly Intercollegiate T5 73 74 64 211 -2WSU Snowman Getaway T22 74 77 68 219 +3Jackrabbit Invitational T14 71 72 70 213 -3The Duck Invitational T46 74 77 74 225 +9Wyoming Cowboy Classic T9 68 73 68 209 -1Ping Golf Cougar Classic T68 72 74 79 225 +9Boilermaker Invitational T6 72 74 74 220 +4WAC Championship 17 76 80 71 227 +11

SUMMARYTournaments 10Best fi nish 2Rounds played 30Low round 63Strokes 2163Average 72.10Top 10 5Top 25 8

BOSSIO’S

CAREER

CAREER

~ 2010-11- Second-team all-Western Athletic Conference ~

~ 2010-11 Western Athletic Conference Golfer of the Month for September ~

~ 2008-09 Second-team all-Western Athletic Conference ~

~ 2008-09 Western Athletic Conference Freshman of the Year ~

~ Finished in the top 10 in 28 percent of career tournaments ~

~ Finished in top 25 in 63.6 percent of career tournaments ~

SUMMARYTournaments 33Best fi nish 2 Rounds played 99Low round 63Strokes 7253Average 72.53Top 10 9Top 25 21

Page 8: 2010-11 Men's Golf Yearbook

6

Stefan RICHARDSONJunior • 3L • Eastside Catholic High School • Renton, Wash.

... ON A PERSONAL NOTE ...What is your favorite meal?

“steak and tater tots”

Who, throughout all time, would you most like to meet?

“Tiger Woods”

Who would you put in your dream foursome?

“me, my dad, tiger woods, jack nicklaus”

What is your favorite movie?

“Step Brothers”

Who is your favorite University of Idaho professor?

“Steve Yoder - my sports in american society professor for my freshman core class.”

What is your favorite golf memory?

“playing in the 2007 Junior World Championships at Torrey Pines.”

What is the best advice you’ve been given?

“Care more than others think is wise, risk more than oth-ers think is safe, dream more than others think is practi-

cal, and expect more than others think is possible.”

2010-11: Finished in the top 10 twice and in the top 25 three times in nine tournaments played ... two of the top-10 outings were in the Vandals’ last fi ve tournaments.

2009-10: Career low round of 68 at Oregon Duck Invitational where he also had career best fi nish (tie for second) and career low tournament (fi ve-under 211) ... also had top-10 fi nish at rain abbreviated Bandon

Dunes where he was fourth ... other top-25 outing was a tie for 24th at BYU Cougar Clas-sic ... tied for 31st at WAC Championship.

2008-09: Played in fi ve tournaments with a tie for 25 at the BYU Cougar Clas-sic his best outing ... low round of 72 on two occasions ... best tournament score was three-over 219 at BYU tournament.

High School: Gaduated in 2008 from Bellevue’s Eastside Catholic High School ... golf team captain for two seasons ... four-year golf letterman and

four-year participant in state golf tournament ... 2008 SeaKing District Cham-pion ... also played soccer and was two-year letterman ... member of Honor Roll and National Honor Society.

Personal: Shari Cooper and the late Todd Richardson ... born June 13, 1990 ... majoring in Accounting.

6666666666

WhWhWhhhooo

WhWhWhWhWhW ooooooooo

“S“S“S“SSSSSSSteteteeteteeeteeeeeeteveveveveev

“p“p““p““p“p“p“““ppppplalalalalalalaaalall yiyiyiyiyiyiyyiyiyyy ngnngngngnnnnng

“C“C“CCCCC“C“C“CC“C“C“CCCCaarararararaarrarara eeeeeeeeeerererrrerrerereeeeree sssssssss thththththtththhhhtht iiiiiii

cacacaaccacccacacal,l,l,ll,l,,,,,

202020202022 00909099 110:000:00 CCCarararreeeeeeee rr rr rr lolow w rorororouunuunddd ofofofofoff 66668888 atatt OOOOOrereeregogggogogonnnn DuDDuDuDuuuccckccckk IInvnvnvn ittitatataaacacacacaaccaaarererererererreeerereererererereereerer lllllllllowowwowowoowwowoww tttttttoououoouuouo rnrnrnnnamammaamamenenenentt tt (fi(fifi(fififivvvvveeee

DuDuDuDuneneneeenes s ss whwhwhwhwhererereeeee e ee hheheheheh wwwwwwwwasasa fffoosisissisisicccccc ....... tititititittit edededededeeddde fffffffororororooo 3333333331s1s1s1s1ss1s1s1s1sstttt

202022002202202020202202 08008080808080080008808-0-0-0-0-0-009:9:9:9:99999:9:::9: PlPlPlPPPPPPPPlPlllPPP aaaaaaaaaaaaassisisisssss ccccccccccc hihihihhhis s s s bebebebebeeestststststscscccsccssccccss ororooororooooooro e e eee wawawawawwww sss ss s ttttttttt

HiHiHiiHHHHHHiHiHHH ghghghghghghghghhhhhhgh SSSSSSSSSchchchhchchchScScScSScSScSSSccScSS hohohohoohohohohooooololololollololoo ............ gggggggggggg

fofofoofooofouruururuu -y-y-yyeaeaaeaeaaarr r papapapapaaapartrtrtrtrttttpipippippipip onnonononnonoo .... aaaaaaaaaalslslslsslslslslsoooooo ooo plplplplppplplpplplpp aaaaaaaanananananaa ddddddd NaNaNaaaNaNaNaNaNatitititttt ononoonooooonnononalalalalalla HHHHHHH

PePePePPP rsrsrsononononnnalalalala ::: SSSSShhh.... mamamammamammam jojjjjojojoj rirririingngngngggngngngngg

Page 9: 2010-11 Men's Golf Yearbook

7

SUMMARYTournaments 27Best fi nish T2 Rounds played 79Low round 67Strokes 5946Average 75.27Top 10 4Top 25 7

FIN. 1ST 2ND 3RD TOTAL TO PAR Giustina Memorial 41 78 72 74 224 +8 Wyoming Desert T92 83 82 78 243 +27Herb Wimberly T68 80 75 73 228 +12Rees Jones 53 84 82 84 250 +34BYU Cougar Classic T25 74 73 72 219 +3

2008-09 RESULTS

SUMMARYTournaments 5Best fi nish T25 Rounds played 15Low round 72, twiceStrokes 1164Average 77.60Top 10 -Top 25 1

SUMMARYTournaments 12Best fi nish T2 Rounds played 35Low round 68Strokes 2642Average 75.49Top 10 2Top 25 3

2009-10 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR Palouse Collegiate T31 71 83 72 226 +10Kansas Invitational T70 85 76 79 240 +24Del Walker Collegiate T69 77 73 71 221 +11Herb Wimberly Intercollegiate T59 74 70 77 221 +8Jacksonville Invitational T58 83 82 79 244 +28Snowman Getaway T33 74 78 78 230 +14Bandon Dunes Championship 4 81 72 153 +9Oregon Duck Invitational T2 68 72 71 211 -5Wyoming Cowboy Classic T72 73 77 74 224 +14Western Intercollegiate T54 74 76 76 226 +16BYU Cougar Classic T24 72 74 71 217 +1WAC Championship T31 76 74 79 229 +13

2010-11 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR Palouse Collegiate T30 74 70 73 217 +1Kikkor Golf Husky Invitational T30 75 78 69 222 +6Wolf Pack Classic T60 73 79 152 +8WSU Snowman Getaway T12 72 73 71 216 EJackrabbit Invitational T5 67 70 70 207 -9The Duck Invitational T72 75 81 77 233 +17Wyoming Cowboy Classic T38 73 70 74 217 +7Ping Golf Cougar Classic T32 73 75 71 219 +3Boilermaker Invitational T8 74 75 72 221 +5WAC Championship 35 81 76 79 236 +20

SUMMARYTournaments 10Best fi nish T5Rounds played 29Low round 67Strokes 2140Average 73.79Top 10 2Top 25 3

RICHARDSON’S

CAREER

CAREER

~ 2010-11 Team Captain ~

~ Finished in the top 25 in 27 percent of career tournaments played ~

~ Has four top-10 fi nishes ~

Page 10: 2010-11 Men's Golf Yearbook

8

Damian TELLESSophomore •2L • Whatonka High School • The Dalles, Ore.

... ON A PERSONAL NOTE ...What is your favorite meal?

“rice eggs and portugese sausage! Or rice Mac salad and chicken Katsu! ”

Who, throughout all time, would you most like to meet?

“Michael Jordan”

Who would you put in your dream foursome?

“Tiger woods, jack Nicklaus, me and my dad”

What is your favorite movie?

“P.S. I love you”

What is your favorite golf memory?

“tying the course record in the final round of my first collegiate victory.”

What is the best advice you’ve been given?

“treat others the way you would like to be treated.”

2010-11: Tied for fi rst at the Western Athletic Conference Championship but wound up second after playoff that lasted three holes ... earned fi rst-team all-WAC honors ... Had six top-10 fi nishes, which includes winning the season-opening Palouse Collegiate and last two regular-season events ... low round was 65 (twice) – once at the Palouse Collegiate and the other at the Jackrabbit Invitational ... low tournament was a 15-under 201 at the Palouse Collegiate.

2010 summer: Qualifi ed for U.S. Amateur after fi nishing second at Oregon qualifi er.

2009-10: Played in eight tournaments as a true freshman ... top fi nish was tie for 24th at Herb Wimberly Incollegiate ... had a low round of 68 at the Del Walker Collegiate ... low tournament was even-par 213 at Herb Wimberly.

Personal: Telles was ranked 30th in the class of 2009 and 45th overall by the National Junior Golf Scoreboard. He tied for sixth as a junior at the 5A Oregon State High School Tournament and as a junior tied for third. He qualifi ed for the U.S. Junior Amateur in 2004, 2005 and 2008. His qualifi cation in 2004 made him the youngest to qualify - he was 13,

and he missed the cut that would have allowed him to advance to match play by just one stroke. He has been a consistently high fi n-isher in the Big I Junior Classic events, where he tied for seventh

in 2008 in North Carolina and tied for 11th in 2007 at Boise. He also was in the 2008 Junior Americas Cup (tie 7th), 2008 Oregon Junior Stroke Play Championship (tie 7th), 2008 Ho-gan Cup Matches (tie 7th) and was the 2008 Central Oregon Junior Championship winner.

88888888

ototototootothehhhhehheheher rrr attatat tttthehheeheehehehe JJJJaaacaacacca krkrkrkrkrkrkrkrkkrrkrabababababbbbabbbibibibiibbibbitttt t ttttt t InInInInnnnnnI vivivvitatatatatitititiiononononno alalalala ...... llllowowowowowowwowo tttttttttouououououououuo rnrrnrnrnrnrrnamaamamammammmeneeenenee t t tt wawawaaaas ss s aaa 111

20202002 101010010 sssumumummuuuuu mememmemeemm r:r:rr:r QQQQuauauaualililiilifififi fieeee

20202020009090909909 1-11-1000:0 PlPlPlPPP ayayayaytitititititititieeeeee fofofofofofoooof r rrr rrr 24242424242424242444thththththththhhththththththeeeee DeDeDeDeDel ll WaWWaWaWaWaWWiWiWiW mbmbmbmbmm ererererrrrlylylylyly..

PePePePePePeersrsrsrsrsrsssrsoonononoonnalalallaala :::: TTTTbbybybybybybybyy tttttttheheheheheheheee NNNNNNNNNatatatatatatatioioioioiooiooonnn5A5A5AA5A5A5A5A OOOOOOOrerererereereregogogogogogggogonnnnnnnHeHHeHeHeHeeeHeHeHeHeeeeeee qqqqqqqqqqquauauauauauauuaualliliillliiiiil fififififi fififi eeeeeeeequququuquuququalalalaalalla ifiifiifiifiifiifiifificcccccatatataaatatata

ananananndddddd hehehehehmamamamatctctctchhhhisisisisheheheherrr

ininninn 222HeHeHeOOggg

Page 11: 2010-11 Men's Golf Yearbook

9

SUMMARYTournaments 19Best fi nish 1Rounds played 56Low round 65, twice Strokes 4091Average 73.05Top 10 6Top 25 7

SUMMARYTournaments 8 Best fi nish T24 Rounds played 24Low round 68 Strokes 1782Average 74.25Top 10 - Top 25 1

2009-10 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR Palouse Collegiate T55 78 78 76 232 +16Wolf Pack Classic T28 78 71 70 219 +3Del Walker Collegiate T38 77 69 68 214 +4Herb Wimberly Intercollegiate T24 70 73 70 213 ESnowman Getaway T33 80 75 75 230 +14Oregon Duck Invitational T63 78 74 76 228 +12Wyoming Cowboy Classic T36 71 74 73 218 +8Western Intercollegiate T60 78 76 74 228 +18

2010-11 RESULTS

FIN. 1ST 2ND 3RD TOTAL TO PAR Palouse Collegiate 1 66 70 65 201 -15Kikkor Golf Husky Invitational T33 70 75 78 223 +7Wolf Pack Classic T5 72 69 141 -3Herb Wimberly Intercollegiate T52 72 78 77 227 +14WSU Snowman Getaway T54 83 71 76 230 +14Jackrabbit Invitational T7 65 73 70 208 -8The Duck Invitational T29 73 75 72 220 +4Wyoming Cowboy Classic T51 76 74 69 219 +9Ping Golf Cougar Classic T4 72 68 68 208 -8Boilermaker Invitational T6 74 72 74 220 +4WAC Championship T1* 66 73 7 212 -4* fi nished second after three-hole playoff

SUMMARYTournaments 11Best fi nish 1Rounds played 32Low round 65, twiceStrokes 2309Average 72.16Top 10 6Top 25 6

TELLES’

CAREER

CAREER

~ 2010-11 tied for fi rst at Western Athletic Conference Tournament; awarded second after a three-hole playoff ~

~ 2010-11 fi rst-team all-Western Athletic Conference ~~ 2010-11 low round of 65 ties for third-best of the year in

the Western Athletic Conference ~~ Finished in the top 10 in 50 percent of 2010-11

tournaments ~~ Had top 10 fi nishes in the last two regular-season meets

of 2010-11 ~

~ToToToToToToTT uuu

~~~~~~ 222022220202020220

~ HHHHHHH

Page 12: 2010-11 Men's Golf Yearbook

10

FIN. 1ST 2ND 3RD TOTAL TO PAR WSU Snowman Getaway T20 71 73 74 218 +2Jackrabbit Invitational T46 73 73 76 222 +6Boilermaker Invitational T44 76 80 81 237 +21WAC Championship T22 75 81 74 230 +14

SUMMARY

Justin KADINJunior • 1L •SW Oregon CC • Crescent Valley HS • Corvallis, Ore.

KADIN’S

CAREER

Tournaments 4Best fi nish T20Rounds played 12Low round 71

Strokes 907Average 75.58Top 10 0Top 25 2

SUMMARYTournaments 4Best fi nish T20Rounds played 12Low round 71Strokes 907Average 75.58Top 10 0Top 25 2

2010-11 RESULTS

2010-11: Played in four spring tour-naments .... best outing was a tie for 20th at the Snowman Getaway ... low round was 71 and low tournament was 218 – both at the Snowman Get-away.

2009-10: Kadin joined the Vandals for the 2009-10 season but did not play.

2008-09: He sat out the 2008-09 season after playing one year at Southwestern Oregon Community College. At Southwestern, he had a scoring average of 73.5.

High school/junior: He is a gradu-ate of Crescent Valley High School at Corvallis, Ore. He was the 2007 state high school champion after rounds of 70-66–136 to win by seven strokes.

Personal: He is the son of Kathy Springer and Larry Kadin and was born Sept. 15, 1989. He is majoring in Marketing.

... ON A PERSONAL NOTE ...What is your favorite meal?

“Panda Express, Fried Rice, Orange Chicken and Sweet Fire Chicken”

Who, throughout all time, would you most like to meet?

“Sir Nick Faldo!”Who would you put in your dream foursome?

“Tupac Shakur, Tiger Woods, Ben Hogan”

What is your favorite movie?

“Happy Gilmore”

Who is your favorite University of Idaho professor?

“Steven Peterson”

What is your favorite golf memory?

“Winning the 2007 Nike Junior shootout with Champions Tour player Lo-ren Roberts and then watching it on the golf channel!”

What is the best advice you’ve been given?

“Be Patient!”

Page 13: 2010-11 Men's Golf Yearbook

11

WANDERSCHEID’S

CAREER

FIN. 1ST 2ND 3RD TOTAL TO PAR UNLV Spring Rebel Invitational 71 77 86 77 240 +24Dr. Donnis Thompson Invitational T82 79 85 84 248 +32Anteater Invitational 28 78 82 73 233 +20Gonzaga Spring Individual 9 76 76 152 +12WAC Championship T36 81 78 78 237 +21

Zach WANDERSCHEIDFreshman •1L • Goldendale High School • Goldendale, Wash.

Tournaments 5Best fi nish 9Rounds played 14Low round 73

Strokes 1110Average 79.29Top 10 1Top 25 1

SUMMARYTournaments 5Best fi nish 9Rounds played 14Low round 73Strokes 1110Average 79.29Top 10 1Top 25 1

2010-11 RESULTS

2010-11: Played in fi ve tour-naments ... best fi nish was ninth at Gonzaga Spring In-vitational ... low round was 73 in fi nal round of Anteater Invitational.

High school/junior: Fin-ished second at 2008 Washington Junior Golf As-sociation state champion-ship with rounds of 76, 76, and 77 ... Washington Junior Player of the Year in 2009 ... represented Washington at Junior Worlds ... also won two WJGA sub-district tour-naments and played in the Washington Junior Ameri-ca’s Cup.

... ON A PERSONAL NOTE ...What is your favorite meal?

“Pepperoni Pizza from Papa Murphy’s”

Who, throughout all time, would you most like to meet?

“Tiger Woods”

Who would you put in your dream foursome?

“Tiger Woods, Chris Farley and Will Smith”

What is your favorite movie?

“Tommy Boy”

Who is your favorite University of Idaho professor?

“Scott Barnicle”

What is your favorite golf memory?

“ Teeing off on hole number one at the U.S Junior Am. With Donald Trump watching from behind the tee.”

What is the best advice you’ve been given?

“It’s not the club, it’s you!”

Page 14: 2010-11 Men's Golf Yearbook

12

Gordon WEBBJunior• Western New Mexico • Malta High School •Malta, Mont.

WEBB’S

CAREER

REDSHIRTED IN 2010-11

Webb joined the Vandals in the fall of 2010 and redshirted after playing for two seasons at Western New Mexico University where he was a fi rst-team all-conference choice as a sopho-more and a third-team selection as a freshman. He averaged 73.52 strokes per round as a sophomore after a freshman average of 75.66.

He is a 2008 graduate of Malta (Mont.) High School where he was a four-time all-state choice and four-time all-conference choice. He also played football and basketball.

Webb was born May 4, 1989 and is the son of Kristine and James Webb. He is in Idaho’s Professional Golf Management curriculum.

... ON A PERSONAL NOTE ...What is your favorite meal?

“Chicken Alfredo pizza”

Who, throughout all time, would you most like to meet?

“Will Farrell”

Who would you put in your dream foursome?

“Tiger Woods, Rory Mcilroy, and Jack Nicklaus”

What is your favorite movie?

“She’s Out Of Your League”

Who is your favorite University of Idaho professor?

“Cole Mize”

What is your favorite golf memory?

“Winning the Montana state amateur.”

What is the best advice you’ve been given?

“No comment”

Page 15: 2010-11 Men's Golf Yearbook

13

PALOUSE COLLEGIATEPalouse Ridge Golf Club, Pullman, Wash.

Sept. 13-14, 2010 • Par 72 • 7,308 yards

1 Washington State U. 271 272 284 827 -37 2 Idaho, Univ. of 281 278 280 839 -25 3 Portland, U. of 272 281 294 847 -17 4 Santa Clara Univ. 282 282 286 850 -14 5 San Jose State 283 286 286 855 -9 6 Cal Poly 285 287 287 859 -5 7 Loyola Marymount U. 280 285 295 860 -4 8 Boise State Univ. 293 279 293 865 +1 9 Weber State Univ. 283 290 293 866 +2 10 CSU-Northridge 297 288 285 870 +6 11 Sacramento State 286 295 293 874 +10 12 CSU-Fullerton 288 291 299 878 +14 13 Gonzaga University 298 288 297 883 +19 14 Utah Valley Univ. 298 298 292 888 +24 15 Seattle University 295 297 297 889 +25

IDAHO PLAYERS1 Damian Telles 66 70 65 201 -15 2 Jarred Bossio 68 65 70 203 -13 T30 Stefan Richardson 74 70 73 217 +1 T36 Zach Wanderscheld 74 73 72 219 +3 T72 Matt Rawitzer 73 75 78 226 +10 86 Chris Cho 81 77 75 233 +17

KIKKOR GOLF HUSKY INVITATIONAL Washington National Golf Club, Auburn, Wash.

Sept. 20-22, 2010 • Par 72 • 7,304 yards1 Pepperdine Univ. 290 276 281 847 -172 Washington, U. of 292 282 280 854 -10 3 San Diego State U. 284 292 283 859 -5 4 Texas A&M 305 283 281 869 +5 5 Idaho, Univ. of 294 295 282 871 +7 6 Oregon State U. 299 290 285 874 +10 7 Missouri 293 286 296 875 +11 8 Oregon, U. of 297 289 294 880 +16 T9 Pacifi c, U. of the 289 298 297 884 +20 T9 UC Davis 288 302 294 884 +20 T9 Washington State U. 299 296 289 884 +20 12 Fresno State 312 285 291 888 +24 13 Brigham Young Univ. 299 295 296 890 +26 14 Gonzaga University 307 292 307 906 +42

IDAHO PLAYERS3 Jarred Bossio 75 73 63 211 -5 T30 Stefan Richardson 75 78 69 222 +6 T30 Zach Wanderscheid 74 72 76 222 +6 T33 Damian Telles 70 75 78 223 +7 T59 Justin Kadin 80 75 74 229 +13

SEASON RESULTSSEASON RESULTSWOLF PACK CLASSIC

Edgewood Golf Club, Stateline, Nev.Oct. 4-5, 2010 • Par 72 • 7,445 yards

1 San Diego, U. of 280 284 564 -12 2 Nevada, Univ. of 292 284 576 E 3 Fresno State 294 283 577 +1 T4 San Francisco, U. of 289 289 578 +2 T4 Washington State U. 289 289 578 +2 6 Wyoming, U. of 290 293 583 +7 7 Idaho, Univ. of 297 290 587 +11 8 UC Santa Barbara 293 296 589 +13 T9 Portland, U. of 297 294 591 +15 T9 Stephen F. Austin St 295 296 591 +15 11 UAB 284 309 593 +17 12 Sacramento State 291 303 594 +18 T13 Loyola Marymount U. 298 298 596 +20 T13 Utah State Univ. 295 301 596 +20 15 Hawaii, Univ. of 311 301 612 +36

IDAHO PLAYERST5 Damian Telles 72 69 141 -3 T24 Justin Kadin 76 70 146 +2 T55 Zach Wanderscheid 78 73 151 +7 T60 Stefan Richardson 73 79 152 +8 T66 Matt Rawitzer 76 78 154 +10

HERB WIMBERLY INTERCOLLEGIATE New Mexico State Golf Course, Las Cruces, N.M.

Oct. 25-26, 2010 • Par 71 • 6,999 yards1 Kansas 295 290 273 858 +6 2 UNLV 289 288 282 859 +7 3 New Mexico State U. 276 298 290 864 +12 4 Washington State U. 287 288 290 865 +13 5 Idaho, Univ. of 285 297 285 867 +15 6 Boise State Univ. 289 296 283 868 +16 T7 Air Force Academy 295 296 292 883 +31 T7 Weber State Univ. 293 297 293 883 +31 9 Illinois State U. 290 304 291 885 +33 10 Texas State Univer. 285 308 294 887 +35 11 Nebraska 287 309 292 888 +36 12 Texas El Paso, U. of 290 306 299 895 +43 13 Wichita State Univ. 297 306 293 896 +44 14 Utah, Univ. of 299 313 289 901 +49 15 Western New Mexico U 296 315 307 918 +66

IDAHO PLAYERST 1 Matt Rawitzer 68 70 70 208 -5 T 5 Jarred Bossio 73 74 64 211 -2 T 33 Justin Kadin 72 76 75 223 +10 T 52 Damian Telles 72 78 77 227 +14 T 59 Zach Wanderscheid 75 77 76 228 +15

Page 16: 2010-11 Men's Golf Yearbook

14

WSU SNOWMAN GETAWAY Cat Tail @ Whirlwind, Chandler, Ariz.

Feb. 21-22, 2011 • Par 72 • 7,163 yards1 Missouri 280 280 281 841 -23 2 Idaho, Univ. of 288 291 287 866 +2 3 UMKC 289 291 288 868 +4 4 Washington State U. 288 292 289 869 +5 5 British Columbia, U. 291 288 292 871 +7 T6 Northern Illinois U. 298 289 295 882 +18 T6 Portland, U. of 307 287 288 882 +18 8 St. John’s Univ. 293 291 299 883 +19 9 Utah State Univ. 283 310 301 894 +30 10 Northern Colorado 301 306 295 902 +38 11 Gonzaga University 310 299 294 903 +39 12 SIU Edwardsville 300 307 301 908 +44 13 Bradley University 306 312 306 924 +60 14 Seattle University 310 312 304 926 +62

IDAHO PLAYERST5 Zach Wanderscheid 72 72 70 214 -2 T12 Stefan Richardson 72 73 71 216 E T20 Justin Kadin 71 73 74 218 +2 T22 Jarred Bossio 74 77 68 219 +3 T22 Matt Rawitzer 71 74 74 219 +3 T54 Damian Telles 83 71 76 230 +14

JACKRABBIT INVITATIONAL Primm Valley Golf Course (Desert), Primm, Nev.

March 14-15, 2011 • Par 72 • 7,090 yards1 Missouri 263 282 282 827 -37 2 Idaho, Univ. of 269 279 280 828 -36 3 UMKC 284 279 283 846 -18 4 Nebraska 290 283 276 849 -15 5 Oral Roberts Univ. 291 279 288 858 -6 6 Drake University 287 290 287 864 E 7 Northern Iowa, U. of 289 293 291 873 +9 8 South Dakota State U 291 292 291 874 +10 9 Southern Utah Univ. 290 303 286 879 +15 10 Oakland University 298 297 295 890 +26 11 North Dakota, U. of 297 299 295 891 +27 12 Youngstown State U. 299 290 303 892 +28 13 North Dakota State 307 299 288 894 +30 14 South Dakota, U. of 304 299 295 898 +34

IDAHO PLAYERST3 Matt Rawitzer 67 67 70 204 -12 T5 Stefan Richardson 67 70 70 207 -9 T7 Damian Telles 65 73 70 208 -8 T14 Jarred Bossio 71 72 70 213 -3 T23 Zach Wanderscheid 70 70 76 216 E T46 Justin Kadin 73 73 76 222 +6

SEASON RESULTSSEASON RESULTS

THE DUCK INVITATIONAL Eugene Country Club, Eugene, Ore.

March 21-22, 2011 • Par 72 • 7,020 yards1 Oklahoma State 291 279 278 848 -16 2 Oregon, U. of 289 284 283 856 -8 3 Washington, U. of 282 294 294 870 +6 4 Oregon State U. 298 283 297 878 +14 5 New Mexico State U. 291 299 289 879 +15 6 San Jose State 290 298 292 880 +16 7 Pepperdine Univ. 295 298 290 883 +19 8 Idaho, Univ. of 296 303 289 888 +24 9 UC Davis 296 298 297 891 +27 10 San Francisco, U. of 296 303 293 892 +28 11 Colorado 298 297 300 895 +31 12 Santa Clara Univ. 304 299 297 900 +36 13 Rice 312 297 292 901 +37 14 Portland, U. of 305 304 294 903 +39 15 UAB 306 302 303 911 +47

IDAHO PLAYERST29 Damian Telles 73 75 72 220 +4 T29 Matt Rawitzer 74 73 73 220 +4 T46 Jarred Bossio 74 77 74 225 +9 T46 Zach Wanderscheid 77 78 70 225 +9 T72 Stefan Richardson 75 81 77 233 +17

WYOMING COWBOY CLASSIC Talking Stick North, Scottsdale, Ariz.

April 4-5, 2011 • Par 70 • 7,133 yards1 Baylor 282 273 281 836 -4 2 Arizona, U. of 281 282 276 839 -1 3 Colorado State Univ. 284 277 280 841 +1 4 UC Davis 286 285 272 843 +3 T5 Colorado 290 278 286 854 +14 T5 Nevada, Univ. of 288 277 289 854 +14 T7 Idaho, Univ. of 290 288 277 855 +15 T7 San Diego, U. of 285 283 287 855 +15 9 Oregon State U. 294 281 286 861 +21 10 San Francisco, U. of 288 287 287 862 +22 11 Wichita State Univ. 296 285 282 863 +23 12 UC Santa Barbara 289 287 288 864 +24 13 Wyoming, U. of 285 303 277 865 +25 14 Kansas State 294 292 280 866 +26 T15 Kansas 296 287 287 870 +30 T15 Utah, Univ. of 292 294 284 870 +30 17 Utah State Univ. 296 294 283 873 +33 18 Air Force Academy 302 295 287 884 +44 19 Santa Clara Univ. 303 297 288 888 +48 20 Gonzaga University 303 295 291 889 +49

IDAHO PLAYERST9 Jarred Bossio 68 73 68 209 -1 T38 Matt Rawitzer 75 71 71 217 +7 T38 Stefan Richardson 73 70 74 217 +7 T45 Zach Wanderscheid 74 75 69 218 +8 T51 Damian Telles 76 74 69 219 +9

Page 17: 2010-11 Men's Golf Yearbook

15

SEASON RESULTSSEASON RESULTS

PING GOLF COUGAR CLASSIC Riverside Country Club, Provo, Utah

April 15-16, 2011 • Par 72 • 7,142 yards1 Colorado State Univ. 284 288 275 847 -17 2 UNLV 280 285 286 851 -13 3 Pacifi c, U. of the 292 280 285 857 -7 4 UC Davis 289 286 283 858 -6 5 Idaho, Univ. of 287 291 282 860 -4 6 Brigham Young Univ. 292 290 279 861 -3 7 Utah, Univ. of 291 291 287 869 +5 T8 Nevada, Univ. of 287 292 291 870 +6 T8 Washington State U. 284 291 295 870 +6 10 Fresno State 299 290 292 881 +17 T11 Northern Colorado 292 296 294 882 +18 T11 Wyoming, U. of 296 292 294 882 +18 T13 Air Force Academy 299 295 291 885 +21 T13 Weber State Univ. 295 292 298 885 +21 T15 Texas El Paso, U. of 303 296 289 888 +24 T15 Utah State Univ. 295 302 291 888 +24 17 Southern Utah Univ. 293 303 294 890 +26 18 Boise State Univ. 291 311 291 893 +29

IDAHO PLAYERST4 Damian Telles 72 68 68 208 -8 T19 Matt Rawitzer 70 75 72 217 +1 T32 Stefan Richardson 73 75 71 219 +3 T55 Zach Wanderscheid 78 74 71 223 +7 T68 Jarred Bossio 72 74 79 225 +9

BOILERMAKER INVITATIONAL Kampen Course, West Lafayette, Ind.

April 23-24, 2011 • Par 72 • 7,456 yards1 Purdue University 296 297 284 877 +13 2 Idaho, Univ. of 296 300 293 889 +25 3 Bowling Green State 296 306 289 891 +27 T4 IUPUI 310 289 295 894 +30 T4 Northern Illinois U. 298 302 294 894 +30 6 Hartford, Univ. of 304 310 307 921 +57 7 Western Illinois U. 310 311 303 924 +60 8 IPFW 307 309 309 925 +61 9 Ohio University 315 319 301 935 +71 10 Chicago State U. 355 354 349 1058 +194

IDAHO PLAYERST6 Damian Telles 74 72 74 220 +4 T6 Jarred Bossio 72 74 74 220 +4 T8 Stefan Richardson 74 75 72 221 +5 T20 Zach Wanderscheid 76 79 73 228 +12 T44 Justin Kadin 76 80 81 237 +21

WESTERN ATHLETIC CONFERENCE CHAMPIONSHIP Rio Secco Golf Club, Henderson, Nev.May 2-4, 2011 • Par 72 • 7313 yards

1 New Mexico State U. 289 295 291 875 +11 2 San Jose State 293 304 291 888 +24 3 Fresno State 288 305 296 889 +25 T4 Idaho, Univ. of 298 307 296 901 +37 T4 Louisiana Tech Univ. 295 310 296 901 +37 6 Nevada, Univ. of 299 306 308 913 +49 T7 Boise State Univ. 309 309 303 921 +57 T7 Hawaii, Univ. of 308 313 300 921 +57 9 Utah State Univ. 301 318 331 950 +86

IDAHO PLAYERS T1 Damian Telles * 66 73 73 212 -4 17 Jarred Bossio 76 80 71 227 +11 T22 Justin Kadin 75 81 74 230 +14 35 Stefan Richardson 81 76 79 236 +20 T36 Zach Wanderscheid 81 78 78 237 +21 * awarded second after three-hole playoff

Page 18: 2010-11 Men's Golf Yearbook

16

M. Duane Nellis is the University of Idaho’s 17th president.

He provides robust and engaging leadership for the University of Idaho by supporting its statewide land-grant mission of teaching, research and outreach. He also is guiding the institution to re-envision that mission for the 21st century by focusing on entrepreneurialism, engagement, global connections, sustainability, diversity and interdisciplinary synergies.

Prior to and since his inauguration in October 2009, Nellis has engaged the state of Idaho to deepen the land-grant University’s presence and impact. His presidency is defi ned by that outreach, a characteristic that began when he became president and immediately embarked on a statewide listening tour – meeting more than 1,500 people along a 1,500-mile travel route. He is committed to maintaining and growing connections and relationships with stakeholders and decision-makers.

Nellis has served with distinction in various regional and national lead-ership positions. He is a commissioner for the Northwest Commission on Colleges and Universities and was appointed by Idaho Gov. C.L.

‘Butch’ Otter to serve on the Western Interstate Commission for Higher Education. He served as president of the Association of American Geographers, one of the largest professional geography organizations in the world. He is also past president of the National Council for Geographic Education; past president of Gamma Theta Upsilon, the International Geographic Honor Society, and he served as one of 10 members of the National Council of Colleges of Arts and Sciences Research Universities Committee.

Nellis is recognized nationally and internationally for his research utilizing satellite data and geographic information systems to analyze various dimensions of the earth’s land surface.

He is recognized for his research and teaching through numerous awards, such as receiving national honors from the Association of American Geographers in 2001, the AAG’s John Fraser Hart Award for Excellence in Research, and the Outstanding Contributions Award by the AAG’s Remote Sensing Specialty Group.

Prior to his appointment at Idaho, Nellis served as provost and senior vice president of Kansas State University and at West Virginia Univer-sity as dean of the Eberly College of Arts and Sciences, WVU’s largest academic college.

A native of the Northwest, he met and married his wife, Ruthie, while pursuing his bachelor’s degree in earth sciences at Montana State University. He earned his master’s and doctoral degrees in geography at Oregon State University.

PRESIDENT DR. M. DUANE NELLIS

“Athletics is the front porch and highly visible dimension of

the University.”

MMM.MMMM

HHHHeHeHeHeeeeebybybyby ssououuouooutttttthhththeeeecococococococcoc nnnnnnnnn

PrPrPrPrPP ioioioiooththththththtthththhtht eeeeeeeimimmmimiimpppptthththththhhhthataattataataaaaaa a aa ststststststtss1,1,1,1,1111,11 555555cococoocoocconnnn

NeNNeNeNeNellllllerererersssssononnn

awawara dsds,, susususss chh aaassss rereececceivivining g g nanaattitiononnala hhhonorors s fromommmm tthehe AAssssssociaaaatit onon oof forororr bybybyby

orororororooro rrr-r-r-r-r--rrststtsttt

eee eeeeee e e eeyyyyyy

Page 19: 2010-11 Men's Golf Yearbook

17

Rob Spear assumed the lead of the University of Idaho athletic department during a crucial juncture in its storied history.

The Vandals were seeking solidifi cation of their conference status and their facilities were in need of modernization. They needed a leader with vision and passion. Spear fi t the bill.

First was securing a home in the Western Athletic Conference, a league that preserves historic rivalries and offers the benefi ts of a Division I association. Next was rebuilding the Vandals’ home. He was on hand to oversee the fi nal stages of the construction of the Iverson Speed and Strength Center. Next were the playing surfaces – inside and out. The Vandals now have a SprinTurf practice facility outdoors and RealGrass Pro inside the Kibbie Dome. The football, men’s and women’s basketball, and swimming locker rooms were renovated into modern, stylish facilities for the student-athletes.

Last fall, the athletic training and equipment rooms were renovated and state-of-the-art classrooms and meeting rooms came on line as part of a multi-million dollar facelift for the Kibbie Dome. Last fall, the fi rst phase of a new-look Kibbie Dome debuted when the plywood on the west end wall was replaced with translucent panels. When the Vandals kickoff in 2011, not only will the east wall match the west but there will be a new club area with suites, loge boxes and a clubroom as well as premium seating and a new press box.

Facilities are but one area where Spear has moved the department forward. He added to the support services staff to enhance the student-athlete experience. Computer labs and academic support staff are cornerstones of a successful department and the additions and upgrades in those areas are paying dividends. In the fall of 2007, the Idaho Athletics Hall of Fame was established with 100 individuals and fi ve teams being inducted over a two-year period as part of the inaugural class.

His involvement isn’t limited to the Idaho campus. He began a second term with the NCAA’s ‘Legislative Council – one of two top-tier governing bodies in the organization.

“I am honored and excited to represent the Western Athletic Conference on this governing board,” Spear said at the time of his appointment. “It is a tremendous opportunity to make an impact on future NCAA legislation to ensure we con-tinue to provide the best possible service to the student-athlete.”

Spear’s ties with athletics are life-long. He was a standout high school athlete in his native Butte, Mont., before moving on to letter four times at the University of Great Falls. Next was a two-year professional basketball career with the Montana

Golden Nuggets, at the time coached by George Karl.He earned his bachelor’s degree in business administration from

Great Falls in 1980 and his MBA from the University of Montana in 1983. He accepted a position as an internal auditor with the University of Idaho in 1989. While working at Idaho, he also pursued his doctorate in educa-tion, which he completed in 1993.

Prior to his appointment as director of athletics in 2003, Spear was the interim assistant fi nancial vice president. He also spent time at Idaho as the Assistant Vice President for Outreach in the College of Agricultural and Life Sciences and in grants contracts.

He and his wife, Sandy, have one daughter, Morgan – a junior at Idaho.

University of Great Falls (BS)University of Montanan (MBA)

University of Idaho (PhD)

DIRECTOR OF ATHLETICS DR. ROB SPEAR

cccc

sss a a aa

aaa a aaaa aaaa a aaaaaaee eee eeeeeeeeeeeeeee ssss s s syyyyyyyyyyyyy lllllll,,eeeeeeee

onononononon tttttttoooooo leleleeeetttttttttererrer ffouur rr tittitimmmmemmmees s atatata ttheheheh UUUUnininnn veveveersrsrssitittitty yy yy ofofoffo GGGGGGrerereereatatatata FFFFFalala lslssGoGoGooGGG lll

GGrGrGGGGrGreeeeeHeHeHeeininninnini 111tititiitiiiitititit onononoooonoo

ththththththththt eeeeeeeasasasaasss tttttttananannnaanannna ddddd

Page 20: 2010-11 Men's Golf Yearbook

18

THE

A LEGACY OF LEADING

The University of Idaho opened its doors on Oct. 3, 1892, when it welcomed about 40 students and one professor, John Edwin Ostrander.

On June 11, 1896, the university graduated its fi rst class when four students marched across a stage to receive their diplomas. Two years later, the university awarded its fi rst graduate degree. By 1899, a growing body of University of Idaho alumni formed the Idaho Alumni Association.

Alumni numbers weren’t all that grew in those early days. Over the next few years, the University of Idaho established its College of Agriculture, dedicated Ridenbaugh Hall and established the Pacifi c Northwest’s fi rst Department of Domestic Science (later to be called Home Economics).

The Administration Building fi re in 1906 was a turning point in the university’s history. John Tourtellotte, a Boise architect who had designed the state’s capitol, designed

a new Tudor Gothic structure to symbolize the university’s growth and maturity as a major institution of higher education.

The Administration Building remains the centerpiece of campus.

The hiring in 1908 of the nation’s premier landscape architects,Olmsted Brothers of Massachusetts whose fi rm’s founding father designed New York’s Central Park, led to the

A BRIEF HISTORY

11111111ppppp

ccccrrrrrrraaaaabbbbbbbAAAAAAAAAA

eeeeeIIIIIIddddRRRRRRRRRfifififififififi HHHHHHHH

ppppppppppppaaaaaaa

gggggggg

sss wwwwwwwww

Page 21: 2010-11 Men's Golf Yearbook

19

small-town New England look of the campus.

President Theodore Roosevelt was the fi rst U.S. president to visit the campus in 1911. He planted the fi rst tree in Presidential Grove.

Through the next 50 years, the campus continued to grow in size

and academic offerings. Among the additions were Forney Hall, the School of Education, Science Hall, Hays Hall, the Music Building, the Library, the Student Union and outreach campus locations.

In 1976 the new ASUI-Kibbie Dome won a national engineering structural achievement award. Its sound structure has withstood roaring cheers of Vandal fans (as well as the groans and wailings of rival teams) ever since.

Today, the university is home to nearly 12,000 students and nearly 1,300 faculty and staff. It continues to be a leading place of learning in Idaho and the West, because although it is ever-responsive to the changing needs of its students and society, it never forgets its roots and traditions.

Perhaps no better example of this distinct combination of

rich history and innovative service is the Associated Students of the University of Idaho (ASUI). Today as vibrant as ever, ASUI has been a force on campus for more than 100 years.

rrrriiiiiccccciiiissss tttUUUUUnnnnnnnvvvvvviiiiiibbbboooonnnn

11111

ffffff

ssssssssmmmmmmmmmmcccccaaaaaaaa

ttthhhhhheecccccaaaaatttttttttttrrrrrrrrreeeeeee

cccccaaaaaaaaaaaaaannnnnndddddd aaacccaaadddddddeeeemmmmiiiiiccccc ooooooofffffffffffffeeeeeeerrrrrrriiiiiinnnnnggggggsssss AAAAAAAmmmoonngggg tthhhee aaaaaaaaddddddddddddddiiiiiiiitttttttiiiiiiiooooonnnnnnss wwwwweeerrree FFooorrneeeyyyy

Page 22: 2010-11 Men's Golf Yearbook

20

• The College of Law celebrates its centennial in 2009. A featured event was the March Bellwood Lecture presented by Chief Justice of the United States John G. Rob-erts, Jr. • Students from the College of Engineering consistently score well above the nation-

al average for passage of the Fundamentals of Engineering exam; in 2008 the College of Engineering’s overall pass rate was 94 percent compared to a national average of 79 percent.• The University of Idaho’s PGA Golf Management (PGM) students took fi rst place in

the PGA Jones Cup against the 19 other PGM-certifi ed schools in the U.S. The Idaho team rallied from a two-stroke, fi rst-round defi cit to grab the title with a two-day winning total of 615 in the 36-hole event. • The University of Idaho Foundation distributed a record $8.1 million to the Univer-

sity to support scholarships and programs in fi scal year 2008. The funds came from investment earnings on 1,290 endowments cre-ated by donors to support the University. • Gold medal - Alumna Kristin Armstrong ‘95

won the gold medal for the women’s cycling time trial at the 2008 Summer Olympic in Beijing, China.• The University of Idaho is included in the 2009

edition of Princeton Review’s “Best 368 Colleges.” Only about 15 percent of the nation’s colleges are included the in the ranking of the nation’s best institutions for undergraduate education. • NASA interns - 12 University of Idaho students

were selected as NASA interns for summer 2008 and will work and study at three NASA locations around the country.• The Corporation for National and Community

Service has named the University of Idaho to the 2008 President’s Higher Edu-cation Community Service Honor Roll for exemplary service efforts. The Com-munity Service Honor Roll is the highest federal recognition a school can achieve for its commitment to service-learning and civic engagement. This year 2,250 students at Idaho engaged in some 70,500 hours of service.

• John Clayton, artistic director of the Lionel Hampton International Jazz Festival at the University of Idaho, is a 2008 Grammy Award winner. Clayton was given the award for Best Instrumental Arrangement Accompanying Vocalist(s) for his work as arranger on the song “I’m Gonna Live Till I Die” from Queen Latifah’s “Trav’lin’ Light” recording.

2222222200000000

SeSeSerccacaacacacacacattttttttmmumumumumuuumufofofofofoffofofoorrrrrststststtststttuuuuu

•••••FeFeFeFeFeFeFeFesssssgigiigigigigigg vevevevevevvevehihhihihihissssss“T“T“TT“T“ rarararrararararara

ThThThThThThhThT eeee CoCoCoCoCoCooC lllllllllegegegegeggeeee ofofof LLLawwawaww ccccelelebebbbrararararrarrateteteteeeessssss ititititttsssssss cececentntntntteee

THE

A LEGACY OF LEADING

yy ppppppppp pppppp pppp ggggggginininnvvvvatatatattatteeeee

•••wowowowottrtriaiaiaChChC ii•••

ededdeddee iiiiOnOnOnOOOOininnnccinininnnsssss

•••weweweeananananana dddararararoooooo•

rvrvviciciccccici eeeee hahahahassss nananaanan mememeeddddddd thththththtththheeeee UnUnUnnU ivivvivivererersissisitytytytySSeSeeSeSeSS rr

MaMaMMMMaMaMMaMMMMaMaerereertstststs

•••alallaal aaofofofoff EEEEEEE7979797••••••

thththttht eeeteteteaaatotootatataata••••

sisisiisisssityttytttyy

••••

yyyyy

Page 23: 2010-11 Men's Golf Yearbook

21

• The University of Idaho’s Lionel Hampton International Jazz Festival was awarded the National Medal of Arts by President George W. Bush. It is the highest national honor an individual or arts organization can receive. The University of Idaho is the fi rst public university to be named a recipient of the award since it was cre-ated by Congress in 1984.

• Sarah Heath Palin ’87 is the fi rst woman to serve as Alaska’s governor. Palin was a candidate for vice president of the United States in the 2008 election. She earned a journalism degree from Idaho, and worked in media and the utilities industry before beginning her public service.

• Idaho Extension reaches out to more than 12,000 Idaho youth through the Junior Master Gardener program. The science-based gardening curriculum aims to ignite a passion for learning.

• The Operation Education Scholarship program is the fi rst of its kind in the nation. The scholarship is available to veterans severely and permanently wounded as a result of service since Sept. 11, 2001. The spouses of wounded veterans also are eligible for the scholarship.

• The three mule clones born at Idaho are now fi ve years old. Two of the mules, Idaho Gem and Idaho Star, are competing on the mule-racing circuit.

• Idaho ranks second in the Northwest for enrolling new National Merit Schol-ars. Fall 2008 enrollment included 26 new National Merit Finalist Scholars in the freshman class. There are now 67 National Merit Schol-ars enrolled at Idaho.

• Outside magazine listed UI 29th on its list of Top 40 colleges offering the best in outdoor adventure. The magazine rated UI’s Outdoor Program and the Student Recreation Center’s climbing wall as outstanding.

ooooooo

s sssss dddddddd

--

ppp p ppp p

e e

Page 24: 2010-11 Men's Golf Yearbook

22

Moscow is the perfect ex-ample of the old adage: Don’t judge a book by its cover.

Small though it may be, Moscow has plenty to offer.

More than 130 years after it was settled, Moscow is a small yet vibrant community with a penchant for the arts and the University of Idaho.

Every year people come from around the world to take part in events such as the Lionel Hampton International Jazz Festival or the Re-naissance Fair. So much so, the city was named one of the top 100 small art towns in America.

The city’s 22,000 residents are a bright and diverse group of people. The city offers many of the advantages of a big city while retaining its small town friendliness. Crime in Moscow is almost non-existent.

For entertainment, choices abound whether they be indoor or out.

MOSCOW IS:• One of the top 100 Small Arts Towns• Host of the Lionel Hampton International Jazz Festival• Largest of the 27 Moscows in the United States• A U.S. Small Arts Center• A “Gem Community”

MOSCOW MISCELLANEOUSLocated in Latah CountySettled in 1871Elevation: 2,583Land area: 6.2 square milesNearest city with population of 100,000 or more: Spokane, Wash. (84 miles)Nearest city with population of 1 million or more: Seattle, Wash. (298 miles)

Outdoor lovers might believe they’ve landed in paradise. Since Moscow is nestled be-tween the rolling hills of the Palouse on one side and Mos-cow Mountain on the other, op-portunities abound for outdoor

entertainment. Camping, skiing, snowmobiling, hunt-ing and fi shing locales can all be found within a few short miles from town.

If you’re the sort who prefers more urban forms of entertainment Mos-cow offers a broad assort-ment of activities typical of a small town infl uenced largely by its resident uni-versity. Add to those, a

variety of theatrical presentations and concerts on the Idaho campus, and just about every choice of entertainment can be found.

At 2,500 feet above sea level, Moscow has a mild climate despite it being located in the northern United States. Tem-peratures rarely drop below 24 degrees during the winter and the summer months won’t get much hotter than 87 degrees for a pleasant year-round climate. atatate.e. oooor rr aaaa plplplplppp eaeeaeaaae sasasasaas ntntntnt yyyyyyeaeaaeeear-r-rrr rorororoounununnununfofofofo nnndddd clcllclclclimimimimaaa

222222

inininininininnii dodoododddodooororoorororoorrr oooooooorrrr r ououououououtt.t.tt.t.tt.

Page 25: 2010-11 Men's Golf Yearbook

23

Idaho was settled during the gold rush of the 1800s. Veins of silver and gold were found in the mountains of central Idaho and it wasn’t long before thousands of pioneers had settled all over the territory in an attempt to get rich. As the pioneers mined for gold, they happened upon a pleasant sur-prise. In addition to the silver and gold, Idaho was abundant in gems such as topaz and jade. Hence Idaho’s nickname: the Gem State. Idaho is one of the most scenic states in the nation. It holds claim to numerous world famous sites. Here are just a few of the many wonders Idaho offers.

• Hells Canyon, the deepest river gorge in the U.S. – 8,000 feet deep at some points. • Shoshone Falls (36 feet taller than Niagara falls)

• Soda Springs (largest man-made geyser)• The Sawtooth Mountains in central Idaho

• The world famous Lava Hot Springs• The “Craters of the Moon” in south-central Idaho

• Sun Valley Resort, where the movie stars play• Coeur d’Alene, playground of the Pacifi c Northwest• Bruneau Dunes, the largest sand dunes in North America

Geographically, Idaho is one of the most diverse in the country. From the rolling deserts of southern Idaho and the forested mountains of central Idaho to the roll-ing plains of the Palouse, this state has it all. If you’re into river rafting, Idaho has

the Salmon River, nicknamed “The River of No Return.” If you like water sports, Idaho has more than 2,000 lakes with names, and many more without. One of the most famous is Pend Oreille, which is more than 1,100 feet deep in some parts. The Navy has tested some of its submarines at Lake Pend Oreille.

Idaho is an outdoorsman’s dream come true. The state offers thou-sands of miles of trails for backpackers. Hunting and fi shing

locales are abundant all over the state. Idaho is home to part of the famous Lewis and Clark Trail. You can learn fi rst-hand how the expedi-tion was saved from certain starva-tion by the Nez Perce Indian tribe. Idaho is the 13th largest state in the nation, but is sparsely populated with 1.3 million residents. The benefi t of this is low crime rates and a healthy lifestyle. Last but certainly not least, Idaho indeed does have great potatoes. In 1937, the Idaho Potato Commission was formed. The state-run agency’s responsibilities include research-ing and expanding the Idaho potato market.

IIIIIIIIdadadadadadadaddadaahohohohohohohohoho wwwwwwwwwwasasasasaassa sssetettetetetttttltltltltlttllleededededededed dddddddururururuuuruuu ininnniniinningggg g ggg ththtthththhheeeee ee ee gogogoggogogoldldldldd rrrrrusuusususuusushhhhh ofofofoffoff ttttheheehe 111111808008008 0s0s0s000s0ss.. .. VVVeieieiieeee nsnsnsn oooooooooffffffmomomomomomoooununuuunuunttatatatat inininininsssss ofofofof ccccccccenenenenene trtrttrtrt aalallal IIIIdadadadaaad hohohohoo aaaandndndndnddn iiitt tt tt wawaww snsnsnn’tt’tt lllononno g gg ggg gg beeebebeefofofofofof rererreereree ttttttthohohohohousususususususussususananannananannaaa dsdddsdssdss ooooooofffff ff ppppppppteteeeteeerrrrrrrrrrrritititititororororory y yy yy inininn aaaaannnnnn atatatatatatttatteteteteeetteteeett mpmpmpmmpmpmmmmpmpm t t t t ttt totototott gggggeteteteetet rrrrriciicicicch.h.hhh.h.hhh AsAsAsAsAs ttthehhehehheh pppppiooioioioiooi neneneneeerererererrre ssssssss mimimimim nenenenenenenenedddddd fofofofofofoor rr gogogogogogogoggogoogoldldldldddd,,,,, thththththththhhpprprisissse.e.ee InInInInInn aaddddddittitioionnnn totoo tttthehehehe ssssssilililvevevverr rrr aananannnanaaa ddddddd ggogogogoogog ldldldddddldldd,, , , IdIdIdIdddIdI ahahahhaahoooooo wwawwaawassss abababaabaaba unununundadadadaaaadaantntnntntntntn iiiiiiiinnnnnn gegegegeggeemmmmmmIIddIdIdahahahho’o’o’o’o sssss s ss ninnininninnnickckckckckkckcknanananaanaamemmmemmemmmmem ::: thththhhheeeee ee GeGeGeeGeGemmm m StSStS atatatatatteee.ee.e

IIIIIIIIdadaaaadadadahhohooo iiiss sss onononnonoo e e ofofofoo ttttttttthehheheeehehe mmmmmosososo t ttt sscs enenicccicc ssssssstatatatattatatateteteteteteteeesss ss sss ininninininnii tttthehehehe nnnnnatatatatata iiioioion.nn..n.n. ItItItItItItItI hhhhhhhholoololoolooooolddsdsdsdsdsdsdsisisisiss tetteteteet s.s.s.s HeHeHeHeeeH rrerererererereee aaaaaaarerererrere jjjjjjjjjjususususussu t t t aaaaa fefeffefeef ww wwww ofofoff tttthheehehee mmmmmmmmmmananananananana yyyy yyyy y wowowwowwowowowwondndnddndndndnnn erererererererrs s ssss IddIddIdddahahahhahoooo offofoofoffffeefefeeefeferrsrsrsrsrsrs.

•• HeHeHeHeHeHeH llllllllllllllssssss CCaCaCaCCaCaCaCC nynynynyynyonooonono ,, ththththeeeeee dededeeededeepepepepepepppeppepesesesseseseseestttttt tt riiriririririr veeveveveveveveverrr r gogogogogogogogogg rrgrggrgrgrgeee e e ininnininii ttttheheheheehe UUUUUUUUU SS.SS.SS.SS.... –– 88888,8,8,8,8 00000000000000000000000000 fefefefefefefefeef eeteteteteteet ddddddddddd•••• ShShhSSS ososhohoonenee FFFalalallsls ((36363636 ffffffffeeeeeee t t tataaatallllllll ererrerererr tttttttthahahahahahahahahh n nnn n nnn NiNNiNiiNiNNNiNiNiagagagagagagagagaggarararaaraaaraaraaaaaaaa fafafafafafafafallllllllllllllls)s)ss)s)s))s)ss)s

••• SoSSoSoSoddaadadadadaa SSSSSSSSprprpriinnningsgsgsgsgsgg (((lallalaargrgrggrggesesesesstt tt t mamamamammammman-n-nn-n-n mmamamamamamamaadedededededdeddddedd ggggggggeyeyeyeyeyeyeyeyeysesesesesesesesser)r))r))r)r))r)r)•• ThThhhThThhThThee eeeeee SaSSSaSSaSaS wtwtwwtwtwtw ooooooooooooooooo thththt MMMMMMMououououououououo ntnttttnttnnttaiaiaiaaa nsnsnsssnss iiiiiiiin nnnnn cececececececcc ntnttnttntn rararaaralllll IdIdIdIdIdIdI ahahahhahahhaaaaa ooooo

•••• ThThThTTThThhThe ee e e wowowoowoworllrrlrlrlr ddd dd fafafafafamomomomoom ususususuus LLLLLLavavavavavavaaaaaa HoHHoHoHoHoooHH t tttt t t SpSpSSpSppSpSpSpSpSpSppriririiirirrirringnngngngngnnnngn sssssss••••• ThThThhhTThhee eee eee “C“C“CC“C“ rararaaar tetetetteersssrsr oooooof f ff ththththhhthhheee eee ee ee MoMoMoMooMoMooooMM onononononononnnn””””” iinininininnn ssssssououououououououououuoououththththththhhhhth-c-c-c-c-c-c-c--ceneneneneneenntrtrtrtrtralalalaalalalallall IIIIIdadadaadadaaaadahohhooohoh

••••••• SuSuSSSuSSuSSuS nn nnnnnn VaVaVaVaVVaVaVaVaallllllllllleyeyeyeyeyyeyeyeyyeeyeeeeyyyyy RRRRRRRRResesesesesesesesesssorororororooooo t,t,t,t,tt, wwwwwwwwwhehehhheheeererererererrreerrereeeeere ttttttttttttttthheheeehehehhhehehehehe mmmmmmmmovovovvovovooovoovieieieieieiiiee ssssssstataaatattaarsrssssrsrsrss pppppppppppppplalalalaallaalaaaaayyyyyyyyyyyyyyyyyy•••••• CCoCoCCCoCCoCoCCoCCoCC eeeeuuuuuuuueueuueuuueuuuuuuuuuurrrrrrrrrrrrrrrrrrrrr rrrrrrrrrrr dddd’d’’ddd’ddddddd AAlAlAlAlAAAAlAlAlAA enneneneeenneennenenennene,e,e,eeee,eeee,ee,ee,,, pppppppppppppppppplallalalalalaaalaaaaallaaygygygygggygygyggygyyygygygygygggrororrorooorororrroooooouunununnnunnuunnuuu ddddddddddd ofofofoofofofofoofoooofofofofofofoooof tttttthehehehehehehheheee PPPPPPPPPacacaccaccacaccacaacaaacaccififiifiifiififiififiifiifiifiififiifiiifiifiificcccccccccccccccccccccc NNNNNNNNNNNNNNNNNNNNNooooooooooooooooo••••• BrBrBBBBrBBrBrBBBrBrBrunnnununununeaeaeeeaeaeauuuu DuDuDuDDDuDuDunenennenees,ss,ss,,,, ttttttttheheehehheheheheheheh llllararararara ggegegegestststts ssananddddddd ddduddudududdudd neneneneneneeen s s ss sss ininininininnnn

GeGGeeGeGeGeGGeeeGG ogogogoogogogogogggrarararaaar phhphpphphhphphhphpphhiciciccicicalalalalalaalalallylylylyly,,, IdIdIdIdIdIddahahaho oo isisisi ooooooneneenenennne ooooooooff f f ththheeee momomomomm ststst ddddivivivvii erersssdedededededed seseseseserttrtrtrtrr s sss s s ffofofofofofofofofofo sssssssouuouououououoouuththththtththt erererernnnn IdddIdddddd hahhhahahahaa oooo anaananaanannanddddddddddd thhthhthhththhthhtt ee eee e fffofooofoooorererrrerre tttstsstststst dddddededdeddededed mmmmmmmooooooinininininnnnggg gg g g plplplplplplpp aiaiaiaaaia nnsnsnsnnn oooooff f thhthththe e eee PaPaPaPaaalololololoolousuusususe,ee,eeee,e, tttttttthiihihhihiss s ss stststststtsstatatatatata eeeee e e hahahaahahh s s s ititititt aaaallllllllll. IIIIffff

ththhthtt e ee SaSaS lmlmononon RRRivivvi ererere ,,, ninininickckckcknanananan memememem dddd “T“T““Thehehhehh RRRRRRivivivivverererer ooooff ff NNNNIdIdIddddddahahhahahhaho oo oo hahahahahaahh s s ss mommoorerererere tttthahahahh nnnnn 2,2,2,22,000000000000 lalalalaaakekekekes s sss wiwiwiwiww tthttOnOnOnOOO eeeee ofofofofff ttheheee mmmmosososost t t t fffffamamamamououousss isisi PPPPPenenenennne ddddd OrOrOrOrOrreeeedededddd epep iiinnn sosooososomememeemee pppppararara ttststs.. TTTTThehehehe NNNNavavavavy yy yy hhahahahassss teteteLaLaLaLaL kekekekeek PPenenenddd OrOrOrOrOreieieieieie llllllllllle.ee.e.

IdIdIdIddahahahahho oo o isisisisss aaaaannnnnn ououoouooouo tdtdtdddtdoooooooorsrsssrsrssrsmamamman’n’n’nn sssss drdrdrdrd eaeaeaaaammmsasasasasasasasandndndndnddnnds ssss ooofofoo mmililli esesee oooooof ff f trtrtrtttrtrtraiaaiaaailslslsssls ffffforororor bbbbbbaaaaaa

sssffff

ttttttt

wwww

ww

Page 26: 2010-11 Men's Golf Yearbook

24

Director Ana Tuiaea-Ruud

MAIN NUMBER ........................ 208-885-0200DEPARTMENTAL FAX .............. 208-885-2862WEBSITE.................... WWW.GOVANDALS.COMACADEMIC SUPPORT SERVICESAmy, Nikita ................................ 208-885-0288Sanford,Tom ............................. 208-885-0297Tuiaea-Ruud, Ana ..................... 208-885-0297ADMINISTRATIONBuchanan, Debbie ................... 208-885-0238Kleffner, Matt ........................... 208-885-0214Spear, Rob ................................ 208-885-0243ADMINISTRATIVE ASSISTANTSHenderson, Margaret ............... 208-885-0224Howard, Donna ......................... 208-885-0243McLam, Shelley ........................ 208-885-0275Sayler, Margaret ....................... 208-885-2692Schultz, Jana ............................ 208-885-0235

MISSION STATEMENTThe Vandal Academic Support Services offi ce is dedicated to guiding student-athletes toward graduation with the collaboration of cross-campus resources to monitor and support student-athlete academic progress and NCAA eligibility. To fulfi ll this mission, we focus on nurturing study and social skills, and encouraging initiative, self-motivation and accountability. We strive to develop positive, meaningful relationships within the Vandal community and beyond to develop well-rounded, employable graduates.

ACADEMIC SUPPORT SERVICES

ATHLETIC TRAININGBertman, Max ........................... 208-885-0225Borchert, Megan ...................... 208-885-0256Steele, Barrie ............................ 208-885-0212COMPLIANCEWallace, John ........................... 208-885-0219DEVELOPMENTKees, Emily ............................... 208-885-0259Mooney, Tim ............................. 208-885-0258Robson, Shelly .......................... 208-651-7992Reynolds, Nat ........................... 208-334-2087Wang, Jeremy ........................... 208-885-0259EQUIPMENT SERVICESFreshour, Megan ...................... 208-885-0222Garnett, Damien ....................... 208-885-9260

FOOTBALLAkey, Robb ................................ 208-885-0275Axman, Steve ............................ 208-885-0275Carr, Luther ............................... 208-885-0275Christoff, Rob ............................ 208-885-0275Criner, Mark .............................. 208-885-0275Ena, Eti ...................................... 208-885-0275Libey, Patrick ............................ 208-885-0275McDonell, John ......................... 208-885-0275Pupunu, Al ................................ 208-885-0275Thielbahr, Jeremy ..................... 208-885-0275Vaught, Mark ............................ 208-885-0275GOLFJohnson, Lisa ............................ 208-885-5244Means, John ............................. 208-885-5244

Vandal CHAMPS Life Skills Program(Challenging Athletes’ Minds

for Personal Success)

Commitment to these fi ve developmental areas for student-athletes:

• Academic Excellence• Athletic Excellence• Personal Development• Career Development• Community Service

MMAMAAMAMM ININNNI NNNNNNUMMUMMUMMMBEBEBEBEBERRRRRRRR......... ................. .................... ............ 202020202020888-8-8-8-8 8888888888 5-5-5-5-02022020220000000000DDEDDDEDEDEPAPAPAPAPAPARTRTRTTMMMEMEMEMENTNNTNTALAALAL FFFFAAAXAXAX 2020202088 8888888 5555 2822882862626262

ATATATAATATA HLHLHLHLETETETTETICICICICIC TTTTRARAAININININGGB t MMM 220208888 888 55 02020222525252

FOFOFOFFOFOOTOTOTOTO BABABAAALLLLLLLAAkAk RRRR bb 20088 88885555 02022757

UNIVERSITY OF IDAHO ATH

Page 27: 2010-11 Men's Golf Yearbook

25

ATHLETIC TRAINING

HLETICS STAFF DIRECTORYKIBBIE DOMEDrew, Tyson ............................... 208-885-7353LEARFIELDMorris, Tom ............................... 208-882-8382Ostermann, Josh ...................... 208-885-8382MARKETINGPopplewell, Nick ........................208-885-0276MEDIA RELATIONSFarrin, Spencer ......................... 208-885-7065Heidelberger,Nick ..................... 208-885-0211Paull, Becky .............................. 208-885-0245MEN’S BASKETBALLFreeman, Mike ......................... 208-885-0209Helbling, Chris .......................... 208-885-0208Lopes, Ray ................................ 208-885-0242Murphy, Tim .............................. 208-885-4381Verlin, Don ................................ 208-885-0201

NCAA FACULTY REPRESENTATIVEHunt, Carl .................................... 208-885-692SOCCERSchoene, Katie ......................... 208-885-9438Showler, Pete ............................ 208-885-5047SPEED AND STRENGTHBarry, Nate ................................ 208-885-4988Herold, Joe ................................ 208-885-4988Scharnhorst, Jake .................... 208-885-4988SWIMMING AND DIVINGTBA ............................................ 208-885-0265TENNISBeaman, Jeff .............................208-885-0247Neill, Tyler ..................................208-885-0247TICKET OFFICEWallace, Scott ........................... 208-885-0733

TRACK AND FIELDGraham, Jason ......................... 208-885-0210Phipps, Wayne .......................... 208-885-0210Taylor, Julie................................ 208-885-5105Whyte, Angela ........................... 208-885-0210VIDEOTBA ............................................ 208-885-4404VOLLEYBALLBuchanan, Debbie ................... 208-885-0238Whitaker, Steve ........................ 208-885-0246WOMEN’S BASKETBALLNewlee, Jon .............................. 208-885-0227Sanford, Christa ....................... 208-885-4696Green, Jordan ........................... 208-885-4696

Head Athletic Trainer Barrie Steele

MISSION STATEMENTThe University of Idaho’s commitment to its student-athletes can be seen in the continu-

ing enhancement and growth of its athletic training, and strength and conditioning services. With the number one goal being prevention, Idaho athlete services provides not only strength and conditioning, and preventative athletic training measures, but coordinates with sports nutritionists and sports psychologists for the overall well-being of Vandal student-athletes.

“We approach our jobs fi rst from a prevention standpoint,” head athletic trainer Bar-rie Steele said. “But, injuries do occur in athletics and when they do we make sure our student-athletes receive the fi nest in immediate and follow-up care. When they return to competition, our goal is to have them in better condition than before the injury and with a reduced chance of re-injury.”

Page 28: 2010-11 Men's Golf Yearbook

26

In its 49th year, the Western Athletic Conference contin-ues to evolve and features some of the nation’s best inter-collegiate competition. One thing that remains unchanged is the persistent nature of the schools in the WAC to ad-vance their programs to compete at the top levels of the NCAA.

The WAC provides its student-athletes the chance to travel to scenic destinations and gain exposure in some of the nation’s most diverse markets. In addition, the WAC’s student-athletes work to achieve the highest levels of suc-cess with the academic support of their respective institu-tions.

The WAC is the sixth oldest among the nation’s 11 Di-vision I-A conferences. Its history traces back to July 27, 1962, when the original six-team league of Arizona, Arizona State, Brigham Young, New Mexico, Utah and Wyoming be-gan competition.

The fi rst championship was in November 1962, when Arizona won the men’s cross country title and New Mexico followed with the fi rst WAC football title. Arizona fi nished second in the NCAA College World Series and, less than three years later, Arizona State claimed the league’s fi rst NCAA title when the Sun Devils won the

College World Series trophy. Fresno State was the last WAC school to earn an NCAA team title when it won the Col-lege World Series in 2008.

The WAC has had just fi ve commissioners in its history. Paul Brechler was named the fi rst leader of the conference and held the position from 1962-1968. He was followed by Wiles Hallock (1968-71), Stan Bates (1971-80), Dr. Joe Kearney (1980-94) and Karl Benson (1994-present).

Presently, the WAC crowns team and individual cham-pions in 19 sports – eight men’s and 11 women’s. For the men, there are championships in baseball, basketball, cross country, football, golf, tennis, indoor track and fi eld, and outdoor track and fi eld. Championships for women are held in basketball, cross country, golf, gymnastics, soccer, softball, swimming and diving, tennis, indoor track and fi eld, outdoor track and fi eld and volleyball.

The WAC offi ce has been located in the Denver area since the conference’s inception with the exception of a two-year stay in Phoenix from 1964-66.

THE WESTERN ATHLETIC CONFERENCE

WAC SCHOOLSIDAHO • BOISE STATE • FRESNO STATE • HAWAI`I

• LOUISIANA TECH • NEVADA • NEW MEXICO STATE • SAN JOSE STATE •

UTAH STATE

2010-11 WAC SUPERLATIVESTop 10 Player Low Rounds

1. 63 Jarred Bossio, Idaho-Kikkor Husky Invitational, 9/21 (3)63 Timothy Madigan, New Mexico State-Wimberly Intercollegiate, 10/25 (1)

3. 64 Jay Myers, San Jose State-Palouse Collegiate, 9/13 (1) 64 Jarred Bossio, Idaho-Wimberly Intercollegiate, 10/26 (3)5. 65 Jarred Bossio, Idaho-Palouse Collegiate, 9/14 (2) 65 Damian Telles, Idaho-Palouse Collegiate, 9/14 (3) 65 Brian Sunker, Fresno State-Pacifi c Invitational, 11/2 (2) 65 Nate Jessup, Fresno State-John Burns Intercollegiate, 2/18 (3) 65 Damian Telles, Idaho-Jack Rabbit Invitational, 3/14 (1) 65 Timothy Madigan, New Mexico State-Border Olympics, 3/26 (3) 65 Chanse Godderidge, Utah State-Wyoming Cowboy Classic, 4/5 (3)

Top 10 Team Low Rounds1. 269 Idaho-Jack Rabbit Invitational, 3/14 (1)2. 276 Fresno State-MacKenzie Invitational, 10/18 (1) 276 San Jose State-MacKenzie Invitational, 10/18 (1) 276 New Mexico State-Wimberly Intercollegiate, 10/25 (1)5. 277 Fresno State-MacKenzie Invitational, 10/19 (3) 277 Nevada-John Burns Intercollegiate, 2/18 (3) 277 Nevada-Wyoming Cowboy Classic, 4/4 (2) 277 Idaho-Wyoming Cowboy Classic, 4/5 (3)9. 278 Idaho-Palouse Collegiate, 9/14 (2)10. 279 Louisiana Tech-Sam Hall Intercollegiate, 9/13 (1) 279 Boise State-Palouse Collegiate, 9/14 (2) 279 Fresno State-Pacifi c Invitational, 11/2 (2) 279 Fresno State-John Burns Intercollegiate, 2/18 (3) 279 New Mexico State-Rice Intercollegiate, 2/22 (2) 279 Idaho-Jack Rabbit Invitational, 3/15 (2) 279 New Mexico State-Border Olympics, 3/26 (3)

Individual Scoring Average Rounds Strokes Average1. Timothy Madigan, New Mexico State 33 2365 71.672. Jarred Bossio, Idaho 27 1936 71.703. Bhavik Patel, Fresno State 35 2514 71.834. Scott Smith, Nevada 29 2087 71.975. Damian Telles, Idaho 29 2097 72.316. Mark Hubbard, San Jose State 33 2392 72.487. Jay Myers, San Jose State 33 2398 72.678. Kevin Lucas, Nevada 29 2120 73.109. Clinton Shepard, Louisiana Tech 29 2121 73.1410. Stefan Richardson, Idaho 26 1904 73.23

Team Scoring Average Rounds Strokes Average1. Idaho 29 8350 287.92. Fresno State 35 10216 291.93. New Mexico State 33 9637 292.04. San Jose State 33 9655 292.65. Nevada 29 8511 293.56. Louisiana Tech 26 7634 293.67. Utah State 24 7154 298.18. Boise State 26 7798 299.99. Hawai‘i 26 7837 301.4

Page 29: 2010-11 Men's Golf Yearbook

27

QUICK FACTSGOLF INFORMATION

Head coach...........................Lisa JohnsonHome .................................. UI Golf Course

UNIVERSITY INFORMATION

WHY THE “VANDALS”?One of the most unique handles in sports, “Vandals” has been the nickname for

University of Idaho athletic teams for 90 years. Area sportswriters coined the name as they tried to describe the tenacity with which coach Hec Edmundson’s basketball teams played defense. It fi rst was used in 1918 strictly for the men’s basketball team and offi cially adopted for all teams in 1921.

The sports editor of the school newspaper, Lloyd “Jazz” McCarty, along with the dean of the College of Liberal Arts, Edward Maslin Hulme, made the fi nal push for the nickname to be adopted, both as a tribute to the intensity of the athletic teams and to the Norsemen of old.

222222222777777777777222222

nnnnn tttttheheheheh nnnnicicicicicknknknknnnamamamamme e ee eee fofofofor r r r ccocococooiniinininededdede tttthhehehee nnnnamamamamee ee asasasassasss’s’s’s’ss bbbbbbbasasasassassskekekekekkeeetbtbtbbtbtbbbt alalalalaaa llllll teteteteamamamamaaa sssss

alalalallllllllll teteteteeteteteamaamaam aaaaandndndddndndd ooooffiffiffifificccciaiiaiaalllllllly yy y yyy

alolongngngnnnnnngn wwitititi hhh thtthtt eeee deded anananannnshshsh fffffororooror tttheheheh nnnicicccknknknknknamaamamamaame e eennnnddddddddd tototot ttthehehehe NNNNNororrsesesesememememen n

Location ............................ Moscow, IdahoFounded ............................................ 1889 Enrollment .....................................11,636Nickname...................................... VandalsColors ....................Silver and Vandal GoldConference...............................Western AthleticAffi liation .....................................NCAA Division IPresident ................... Dr. M. Duane Nellis

Director of Athletics ............ Dr. Rob SpearAssociate AD ........................Matt KleffnerAssociate AD .......................... Tim MooneyAssociate AD ........................ John WallaceSenior Woman Administrator ................... Debbie BuchananNCAA Faculty Representative ................... Dr. Carl HuntHead athletic trainer ............Barrie SteeleEquipment ......................Damien GarnettAcademic coodinator .... Ana Tuiaea-RuudHead strength coach.... Jake Scharnhorst

Media relations ......................................... Becky Paull (golf contact) O, 208-885-0244; C, 208-669-0411 email: [email protected] Spencer Farrin Nick HeidelbergerAthletics Phone ................208-885-0200Athletics FAX .....................208-885-2862

gg

Page 30: 2010-11 Men's Golf Yearbook